Redescriptions of three Milnesium Doyère, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus Author Michalczyk, Łukasz Author Wełnicz, Weronika Author Frohme, Marcus Author Kaczmarek, Łukasz text Zootaxa 2012 3154 1 20 journal article 45702 10.5281/zenodo.214356 2ccb32a4-9476-4a35-9231-e9849f5ed473 1175-5326 214356 Milnesium tardigradum sensu stricto Doyère, 1840 ( Figs 12–15 , Table 3 ) Material examined. Neotype , 46 neoparatypes (all females), 2 exuvia with eggs mounted in Hoyer’s medium and eight additional specimens used for molecular analysis ( COI and ITS2 region sequencing): Zeesen, Wildau, Germany , 52°16'52''N and 13°38'23''E , 37 m asl, moss and lichen sample from a roof, 11.02.2011 , coll. Marcus Frohme. Description (measurements in Table 3 ). Body white/transparent in small individuals and yellowish to brownish in large ones. Eyes were present in 70% of examined individuals (fixed in Hoyer’s medium). Cuticle smooth, without granulation or pores ( Fig. 12 ). Two lateral and six peribuccal papillae present (ventral papilla smaller than other papillae). Buccal apparatus of the Milnesium type ( Fig. 13 ). Six peribuccal lamellae around the mouth opening present. Buccal tube cylindrical (anterior and posterior diameters similar). Pharyngeal bulb elongated, pear-shaped and without placoids or septulum. Claws of the Milnesium type , slender ( Figs 14–15 ). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature. Secondary branches with rounded basal thickenings. Secondary branches of external claws I–III and posterior claws IV with two points, and secondary branches of internal claws I–III and anterior claws IV with three points (i.e. claw configuration: [2-3]-[3-2]). Single, long transversal, cuticular bars under claws I–III present ( Fig. 14 ). TABLE 3. Measurements and pt values of selected morphological structures of fifteen randomly chosen specimens from the neotype population of Milnesium tardigradum s.s. (N = number of specimens or structures measured; RANGE = the smallest and the largest structure found among all specimens measured; SD = standard deviation). CHARACTER N RANGE MEAN SD Neotype µm pt µm pt µm pt µm pt Posterior base + secondary branch 14 16.0 – 10.6 44.9 – 36.2 13.7 40.3 1.5 2.1 10.6 36.2 Eggs are oval, smooth and deposited in exuvium (in the two exuvia we found there were 6 and 8 eggs respectively).
Body length 15 605 – 330 1609 – 1078 454 1314 81 153 334 1140
Peribuccal papillae length 12 9.0 – 6.0 24.4 – 20.4 7.8 22.5 1.0 1.5 6.3 21.5
Lateral papillae length 9 5.7 – 4.5 17.2 – 13.8 5.0 15.0 0.4 1.1 4.5 15.4
Buccal tube
Length 15 39.4 – 29.3 – 34.3 – 3.0 – 29.3 –
Stylet support insertion point 15 26.5 – 19.1 67.3 – 63.5 22.5 65.4 2.0 1.3 19.7 67.2
Anterior width 15 16.6 – 10.7 48.2 – 36.5 14.0 40.7 1.8 3.5 10.7 36.5
Standard width 15 16.8 – 10.2 44.7 – 34.8 13.2 38.4 1.8 2.9 10.2 34.8
Posterior width 15 18.0 – 10.2 47.9 – 34.8 14.0 40.7 2.1 3.7 10.2 34.8
Standard width/length ratio 15 45% – 35% – 38% – 3% – 35% –
Posterior/anterior width ratio 15 108% – 93% – 100% – 5% – 95% –
Claw 1 lengths
External primary branch 11 18.4 – 13.3 49.4 – 43.0 15.7 46.2 1.7 1.9 13.4 45.7
External base + secondary branch 10 12.5 – 9.3 35.1 – 29.9 11.1 32.9 1.0 1.7 9.3 31.7
Internal primary branch 10 17.4 – 12.4 48.3 – 41.0 15.0 43.6 1.5 2.3 12.4 42.3
Internal base + secondary branch 10 12.8 – 9.8 34.2 – 32.0 11.3 33.1 1.1 0.9 9.8 33.4
Internal spur 10 4.3 – 2.7 12.4 – 7.7 3.5 10.2 0.5 1.7 3.4 11.6
Claw 2 lengths
External primary branch 15 19.8 – 13.4 52.7 – 44.9 16.8 48.8 2.0 2.6 13.7 46.8
External base + secondary branch 12 14.0 – 9.7 37.2 – 33.1 12.0 35.1 1.3 1.4 9.7 33.1
Internal primary branch 15 18.6 – 13.1 49.7 – 43.4 16.0 46.7 1.7 1.9 13.5 46.1
Internal base + secondary branch 11 13.3 – 10.2 36.0 – 32.3 11.7 34.6 1.1 1.2 10.2 34.8
Internal spur 10 4.6 – 2.7 13.9 – 9.2 4.0 11.8 0.5 1.5 3.9 13.3
Claw 3 lengths
External primary branch 13 19.7 – 14.2 52.4 – 45.9 17.0 49.5 1.8 1.7 14.3 48.8
External base + secondary branch 10 13.5 – 9.9 37.4 – 33.8 12.1 35.6 1.2 1.0 9.9 33.8
Internal primary branch 12 17.7 – 12.8 48.3 – 43.1 15.9 46.3 1.6 1.8 12.8 43.7
Internal base + secondary branch 12 13.7 – 9.5 37.1 – 32.4 11.7 34.5 1.1 1.6 9.5 32.4
Internal spur 12 5.6 – 3.1 16.1 – 10.5 4.3 12.7 0.7 1.7 4.1 14.0
Claw 4 lengths
Anterior primary branch 13 22.3 – 16.4 62.9 – 52.6 19.5 57.6 2.1 2.9 16.8 57.3
Anterior base + secondary branch 13 15.0 – 10.3 40.7 – 32.7 12.8 37.7 1.4 2.3 10.3 35.2
Anterior spur 12 4.9 – 3.2 14.8 – 10.9 4.1 12.2 0.6 1.2 3.6 12.3
Posterior primary branch 14 25.0 – 16.8 67.9 – 55.6 20.7 60.9 2.5 3.6 17.3 59.0
FIGURE 12. Milnesium tardigradum s.s. Doyère, 1840, habitus (dorso-ventral view, neotype). [PCM]
COI sequence. There were no differences between the sequences obtained from the single animal and the
pooled material. The complete COI sequence (GenBank Accession No. JN664950 ) is 639 bp long. The sequence
(5’–3’) was as follows:
AGATATTGGGATATTATATTTTATTTTTGGTATTTGATGTGCTTTTGGTGGATCAGCCTTAAGTATGTTAATTCGT CTTGAGTTGTCTCAACCTAATACAATACTAATAAGTGAAGATATTTATAATGCGTTTATTACAAGTCATGCATTAG TAATAATTTTTTTTTTTGTTATACCTGTTTTAATTGGGGGCTTTGGAAATTGATTAGTTCCTTTAATAATTAGTTC ACCAGATATAGCTTTTCCACGAGTTAATAATGTCAGATTTTGAATATTGGTTGCTTCATTTATGTTATTAGTGTAT AGAATATTTTGTGGAGAGGGTGTTGGTGCTGGTTGGACTCTTTACCCTCCATTAACTAATATTTATGGCCATAGAA GAACAGCAGTTGATTATGCAATTTTATCATTACACATTGCTGGTGCTTCTTCTATTTTTAGAGCTATGAATTTTTT AACTACAATTTTTAATATACATTATTTTGGAGTTCGTATAGATAAGTTGCCTTTATTTGTTTGGTCAATTTTTATT ACAGCCTTGTTATTAGTGTTAGCTCTTCCGGTATTGGCTGGGGCTATTACTATATTGATTGCAGATCGTAATTTTG ATACTTCCTTTTTTGATCCTGCAGGGGGAGG
ITS2 sequence. There were no differences between the sequences obtained from the single animal and the
pooled material. The complete ITS2 sequence (GenBank Accession No. JF951049 ) is 446 bp long. The sequence
(5’–3’) was as follows:
AACGAAAATAAACCTGATAGCTACGTGTTTGCTATCGATTGTTTGTCATTCTCTACTGGCCTGCTTCTGTCTTCTC AGAGCAGAGCCAGGTTAAGGCTGACAGATGAAGTTTCGACCCTATGACGAGCGTGCTTCTTGATCTGTAGCAGATC GGAAGCCGACGCGTATCCATACATTTTGTGTACAAAGGACTGTATGATGAAAGTAGGTTGGCGGTCGCTGATGGGC GCTCTATTATCGCTTAGCTAGCAGTGCATGCGGCAGTTTTGCACAGATTGCTAGCGGTGTTTAGAGACGCTTGGCT AACCGAACGACAGTCCATTTTCCTTGTACGCAATCGGTATTGGAGCCATACGCGCTTCGGCTTTGAGTACAGATAT CAGTACGCTGAATTGTCATAGGTTGTAGACTGTATGCGTGCTTAACGCGTTACACACTCATTACGT Neotype locality. Zeesen, Wildau, Germany , 52°16'53''N and 13°38'23''E , 37 m asl, moss and lichen from a roof. Distribution. All previous records of M. tardigradum will now need to be re-examined; therefore not much can be stated regarding the species geographic distribution. Nevertheless, we can hypothesise that M. tardigradum s.s. is likely to be found throughout Europe, but it may also have a wider, Palearctic or Holoarctic range. Etymology. Louis Doyère named the genus after a French zoologist, Henri Milne-Edwards. The specific name comes from Spallanzani (1777) , who first described specimens of Milnesium as ‘Tardigrado’. FIGURES 13–15. Milnesium tardigradum s.s. Doyère, 1840. 13 —buccal tube (dorso-ventral section, neotype); 14 —claws III (neotype); 15 —claws IV (neotype). [All PCM] Type depositories. Neotype and 46 neoparatypes mounted in Hoyer’s medium are preserved at the Department of Animal Taxonomy and Ecology, A. Mickiewicz University, Umultowska 89, 61-614 Poznań, Poland . Comparison with the original description. Specimens we designated as a new type series correspond well with the description and drawings in Doyère (1840) . The cuticle appears to be smooth, buccal tube cylindrical and the claw configuration is [2-3]-[3-2]. Although in Doyère (1840) the claws were drawn without accessory points, we have assumed they were present M. tardigradum s.s. , and have based our assumption on two reasons: (1) Doyère (1840) did not draw accessory points in any of his figures (e.g. all known Ramazzottius and Macrobiotus species have accessory points, whereas in Doyère’s drawings of these genera such structures were not shown); (2) only five, of seventeen known Milnesium species, do not have accessory points and none of these were for European records. Differential diagnosis. Apart from M. tardigradum s.s. , there are four other described Milnesium species with the claw configuration [2-3]-[3-2]. M. tardigradum s.s. differs specifically from: M. krzysztofi by having smooth dorso-lateral cuticle (reticulated in M. krzysztofi ). M. reductum Tumanov, 2006 by the presence of accessory points on the primary branches of claws (accessory points absent in M. reductum ). M. reticulatum by having smooth dorso-lateral cuticle (reticulated and with gibbosities in M. reticulatum ) and six peribuccal lamellae (four in M. reticulatum ). M. tetralamellatum by having six peribuccal lamellae (four in M. tetralamellatum ). In other words, smooth cuticle, the presence of accessory points on the primary branches of all claws, six peribuccal lamellae and cylindrical buccal tube create a unique combination of characters within the group of Milnesium species with the [2-3]-[3-2] claw configuration. Thus, we conclude that it is most unlikely that any synonym species of M. tardigradum s.s. have been described since Doyère (1840) .