Pseudouroctonus peccatum, a new scorpion from the Spring Mountains near " Sin City, " Nevada (Scorpiones, Vaejovidae) Author Tate, Amanda E. Author Riddle, Rebecca R. Author Soleglad, Michael E. Author Graham, Matthew R. text ZooKeys 2013 364 29 45 http://dx.doi.org/10.3897/zookeys.364.6288 journal article http://dx.doi.org/10.3897/zookeys.364.6288 1313-2970-364-29 295E11F9A48E4CA98C8EDA10904BFBAC 295E11F9A48E4CA98C8EDA10904BFBAC Pseudouroctonus peccatum sp. n. Figs 1-17; Table 1-2 Type material. United States: Nevada : female holotype, Kyle Canyon Road, Spring Mountains, 36.2666°N , 115.5988°W , 10 May 2013, A.E. Tate, R.R. Riddle, and M.R. Graham leg. (AMNH, MRG1251); paratype, mature male, same location as holotype, A.E. Tate and R.R. Riddle leg. (AMNH, MRG1252); paratype, juvenile female, collected with holotype (AMNH, MRG1222); paratype, juvenile female, same location as holotype, 23 April 2013, A.E. Tate, R.R. Riddle, and D.R. Tate leg. (AMNH, MRG1221); juvenile female, same location as holotype, 2 July 2013, R.R. Riddle leg. (AMNH, MRG1253). Etymology. The specific epithet is Latin for "sin" in reference to the proximity of the type locality to Las Vegas, which is known informally as "Sin City." Diagnosis. Medium to large sized species for the genus, females reaching 50 mm; pectinal tooth counts 13-14 for females and 15 for males. Hemispermatophore lacking secondary lamellar hook; lamellar hook protrudes somewhat from the lamina base creating a modest basal constriction; lamina terminus with a distinct distal crest. Cheliceral movable finger ventral edge with low-profiled pigmented crenulated teeth; fixed finger ventral edge with several small flat pigmented protuberances; movable finger dorsal edge with two subdistal (sd) denticles. Chelal movable finger with seven inner denticles (ID). Metasomal segment V somewhat stout in adults, length compared to width 1.908 in females and 1.953 in males. Description of holotype. Color: Carapace, trochanter, femur, patella, tergites, and metasoma have a yellow-orange base color with dark brown to black markings along the carinae of the pedipalp and metasoma. Legs are light yellow. Pedipalp chelae are dark brown in color with darker reddish-brown coloration at the anterior portion of the palm where the fixed finger and movable finger meet. Chelicerae are light yellow on proximal half with dark reddish-brown fingers. Vesicle portion of the telson is yellow-orange with a dark reddish-brown to black aculeus. Pectines and genital operculum are light yellow. Morphology : Carapace: trapezoidal with noticeably emarginated anterior margin; surface finely granular with scattered small granules, with larger granules symmetrically flanking the lateral and median eyes; median furrow is slight and traverses length of carapace; ratio of location of median eyes location (from anterior edge)/carapace length = 0.338. Tergites: surface with small granules on distal 1/3-1/2 of tergites I-VI ; tergite VII with two pairs of granular lateral carinae, and a slight median hump. Sternites: III-VI smooth to very finely granular and without carinae; VII with granular ventral lateral carinae on posterior 4/5, median carinal pair essentially obsolete. Spiracles: ellipsoid and with median side rotated 40° away from posterior sternite margin. Genital Operculum: sclerites separated on posterior 1/5. Pectines: tooth count 13/13; middle lamellae 8/8; sensorial areas present on all pectine teeth. Metasoma: ratio of segment I length/width 0.91; segment II length/width 1.00; segment III length/width 1.06; segment IV length/width 1.36; segment V length/width 1.91. Segments I-IV : dorsal carinae are moderately denticulate on segments I-IV and have slightly enlarged distal denticles; dorsolateral carinae are moderately crenulate on segment I and moderately denticulate on segments II-IV with enlarged posterior denticles; posterior denticles are largest and most pronounced on dorsolateral carinae IV; ventrolateral carinae are moderately crenulate on segments I-IV ; segments II and III have sparse and moderately crenulate intermediary carinae forming an approximately 30° angle with the dorsolateral carinae on the posterior 2/3 on segment II and posterior 1/3 segment III; ventromedian carinae are smooth to obsolete on segment I, and crenulate on segments II-IV ; ventrolateral setae 2/2:2/2:2/2:2/2; ventral submedian setae 3/3:3/3:3/3:3/3. Segment V: dorsolateral carinae subtly denticulate; lateral carinae crenulate and obsolete on posterior 1/3; ventrolateral carinae crenulate; ventromedian carinae crenulate; intercarinal spaces finely granular; dorsolateral setation 3/3; lateral setation 3/3; ventrolateral setation 4/4; ventromedian setation 4/4. Telson: smooth to slightly granular with no subaculear tubercule and lacking LAS denticles (Fet et al. 2006). Chelicerae: dorsal edge of fixed finger with four teeth, one distal, one subdistal, one median, and one basal, the latter two denticles formed as a bicuspid; ventral edge with seven low-profile pigmented protuberances, the distal two smaller in size; dorsal edge of movable finger has five teeth total comprised of one distal, two subdistal, one median tooth, and one basal tooth; ventral edge of movable finger has seven small pigmented crenulated teeth; serrula with approximately 23 tines. Pedipalps:trichobothrial pattern type C, orthobothriotaxic: trichobothria ib-it positioned on extreme base of fixed finger, Dt located considerably basal of palm midpoint, Db ventral of digital carina, patellar trichobothria v3 adjacent to et3; ratio of chela length/width 3.57; femur length/width 2.60; patella length/width 2.79; fixed finger length/carapace length 0.78. Chela: median denticles (MD) of fixed finger aligned and divided into six subrows by five outer denticles (OD); flanked by six inner denticles (ID); movable finger with six subrows of MD, five OD and seven ID. Chela carinae: Digital carina rounded, rough, and somewhat flattened; subdigital essentially obsolete, formed by two granules; dorsosecondary flat, rounded, and roughly textured; dorsomarginal very rounded, with large scattered granules; dorsointernal rounded, with scattered granules; ventroexternal rounded, roughly textured, terminating at external condyle of movable finger; ventromedian flat, essentially obsolete; ventrointernal rounded, with small granules scattered distally; external carina very rounded, roughly textured. Femur: dorsointernal, and ventrointernal carinae denticulate and black in color, ventroexternal and dorsoexternal carinae denticulate with small granules throughout, internal surface has 6 prominent dentate granules. Patella:dorsointernal carinae are denticulate, dorsoexternal carinae are mildly crenate, ventral internal carinae are dentate, ventroexternal carinae are moderately denticulate, internal surface has 11 prominent granules. Legs: Ventral surface of tarsus with single median row of 7-17 spinules terminating distally with one to two pairs of spinules. The terminal spinules are slightly stouter than the those comprising the median row. Flanking setal pairs are essentially absent in legs I-II , with 2-3 irregularly positioned and sized pairs on legs III-IV . Basitarsus spinule rows are limited, 2 rows on leg I, 1 row on leg II, 1 weak row on III, and absent on IV. Basitarsus populated with large irregularly placed darkly pigmented setae. Hemispermatophore: Left hemispermatophore is 5.7 mm in length; lamina length 3.71, lamellar hook length 1.03, and trough different (vertical distance between ventral and dorsal troughs) 0.55. Lamellar edges sub-parallel, except for slight expansion on mid-area of the internal edge; terminus blunted with a distinct distal crest on the dorsal side. Lamellar hook extends somewhat from lamina base, is distinctly bifurcated, and is formed entirely from the dorsal trough. A modest basal constriction and a deep truncal flexure are present. Sclerotized mating plugs with smooth barbs were extracted from the ventrointernal aspect of both hemispermatophore median areas. Figure 1. Map depicting the distribution of Pseudouroctonus peccatum sp. n. (black star) and type localities of geographically proximate species in genus Pseudouroctonus (blue diamonds) and Uroctonites (red circles): 1 Pseudouroctonus glimmei (Hjelle, 1972) 2 Uroctonites montereus (Gertsch & Soleglad, 1972) 3 Uroctonites giulianii William & Savary, 1991 4 Uroctonites sequoia (Gertsch & Soleglad, 1972) 5 Pseudouroctonus minimus thompsoni (Kraepelin, 1911) 6 Pseudouroctonus angelenus (Gertsch & Soleglad, 1972) 7 Pseudouroctonus minimus minimus (Kraepelin, 1911) 8 Pseudouroctonus bogerti (Gertsch & Soleglad, 1972) 9 Pseudouroctonus andreas (Gertsch & Soleglad, 1972) 10 Pseudouroctonus williamsi (Gertsch & Soleglad, 1972) 11 Pseudouroctonus minimus castaneus (Gertsch & Soleglad, 1972) 12 Pseudouroctonus rufulus (Gertsch & Soleglad, 1972) 13 Uroctonites huachuca (Gertsch & Soleglad, 1972) 14 Pseudouroctonus apacheanus (Gertsch & Soleglad, 1972). Figure 2-3. Dorsal view of male (2) and female (3) Pseudouroctonus peccatum sp. n. in vivo. Figures 4-15. Pseudouroctonus peccatum sp. n., Spring Mountains, Clark Co., Nevada, USA. Female holotype. 4 Carapace and close-up of lateral eyes. 5-8 Right pedipalp 5 Chela, external view 6 Chelal finger dentition, fixed and movable fingers 7 Patella, dorsal view 8 Femur, dorsal view 9 Right leg II, tarsus close-up, partial ventral view. Right leg III, tarsus and basitarsus, ventral view 10 Cheliceral movable and fixed fingers, ventral view. Chelicera, dorsal view 11 Sternite VII 12 Left stigma I 13 Metasoma and telson, ventral and lateral views 14 Sternopectinal area 15 Male paratype, sternopectinal area. Figure 16. Pseudouroctonus peccatum sp. n. female holotype, Spring Mountains, Clark Co., Nevada, USA. Trichobothrial pattern. Figure 17. Pseudouroctonus peccatum sp. n., male paratype, Spring Mountains, Clark Co., Nevada, USA. Left hemispermatophore and mating plug (both reversed, photographed submerged in alcohol). Outside hemispermatophore, dorsal and ventral views. Top closeup of median area, dorsal and ventral views. Note, due to the translucency of the hemispermatophore,the sclerotized ventral trough is partially visible from the dorsal side. Bottom mating plug. dorsal and ventral views. Note, the sclerotized edge of the mating plug barb is located on the dorsal surface and is partially visible from the ventral side due to the translucency of the plug. Figure 18. Type locality of Pseudouroctonus peccatum sp. n. on the eastern slope of the Spring Mountains, Nevada. Red arrow indicates where the holotype was discovered. Table 1. Measurements (in millimeters) of all known specimens of Pseudouroctonus peccatum .

Scorpion ID	Holotype MRG1251	Female MRG1221	Female MRG1222	Male MRG1252	Female MRG1253
Pectine count

Table 2. Matrix showing character set that distinguishes Pseudouroctonus peccatum sp. n. from the other seventeen species in the genus. If a species differs significantly for a given data character, its state is shaded. Note, except for Pseudouroctonus peccatum sp. n., most of the data contained in this table is based on published information (see reference list). ID = inner denticle.

Hemispermatophore	Cheliceral<br/> Dentition	Chelal Movable Finger ID	Pectinal Tooth Counts	Metasoma Seg V (Length/Width)
Pseudouroctonus peccatum	va	ID
Pseudouroctonus andreas	ID
Pseudouroctonus angelenus	ID
Pseudouroctonus apacheanus	ID
Pseudouroctonus bogerti	ID
Pseudouroctonus cazieri	va	ID
Pseudouroctonus chicano	ID
Pseudouroctonus glimmei	ID
Pseudouroctonus iviei	ID
Pseudouroctonus lindsayi	ID
Pseudouroctonus minimus castaneus	ID
Pseudouroctonus minimus minimus	ID
Pseudouroctonus minimus thompsoni	ID
Pseudouroctonus reddelli	va	ID
Pseudouroctonus rufulus	ID
Pseudouroctonus saavasi	sd	ID
Pseudouroctonus sprousei	va	ID
Pseudouroctonus williamsi	ID

DNA barcodes (COI) - MRG1221 (paratype, GenBank no. KF841448): CTCTAAGTTTAATGATTCGTGCGGAAATTGGTAGACCTGGGTCTTTTATCGGGGATGATCAAATTTATAATGTTGTGGTTACTGCTCATGCTTTTGTCATAATTTTTTTTATGGTTATGCCAATTATGATTGGGGGTTTTGGTAATTGGTTAGTTCCTTTGATGTTAGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTACCACCTGCATTTTTTATGCTTTTAGGTTCGGCATCGTTGGAAAGAGGGGCAGGTACAGGCTGAACTGTGTACCCTCCTCTTTCCTCATA TATGTTTCATTCTGGGGGGTCTGTTGATATGACTATTTTTTCGTTACATTTGGCTGGTGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTTTGAATATGCGAAGATCTGGAATATTGTTGGAGCGTGTGCCTTTATTTGTATGGTCTGTTAAGATTACTGCTATTCTTCTGTTGTTGTCTCTTCCAGTTCTTGCGGGTGCAATTACTATGCTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCAGCGGGTGGAGGGGATCCTATTTTGTACCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTCTTCCGGGATTTGGAATGATTTCTCATATTATTAGTCATCATACTGGGAAGAGGGAACCTTTCGGAGCTTTAGGAATGATTTATGCTATGGTGGCTATTGGGTTTTTGGGTTTTGTGGTTTG . MRG1222 (paratype, GenBank no. KF841449): CTCTAAGTTTAATGATTCGTGCGGAAATTGGTAGACCTGGGTCTTTTATCGGGGATGATCAAATTTATAATGTTGTGGTTACTGCTCATGCTTTTGTCATAATTTTTTTTATGGTTATGCCAATTATGATTGGGGGTTTTGGTAATTGGTTAGTTCCTTTGATGTTAGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTACCACCTGCATTTTTTATGCTTTTAGGTTCGGCATCGTTGGAAAGAGGGGCAGGTACAGGCTGAACTGTGTACCCTCCTCTTTCCTCATATATGTTTCATTCTGGGGGGTCTGTTGATATGACTATTTTTTCGTTACATTTGGCTGGTGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTTTGAATATGCGAAGATCTGGAATATTGTTGGAGCGTGTGCCTTTATTTGTATGGTCTGTTAAGATTACTGCTATTCTTCTGTTGTTGTCTCTTCCAGTTCTTGCGGGTGCAATTACTATACTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCAGCGGGTGGAGGGGATCCTATTTTGTACCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTCTTCCGGGATTTGGAATGATTTCTCATATTATTAGTCATCATACTGGGAAGAGGGAACCTTTCGGAGCTTTAGGAATGATTTATGCTATGGTGGCTATTGGGTTTTTGGGTTTTGTGGTTTG.