Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-01-06 2023 969 1 58 journal article 10.5281/zenodo.7710103 1942-1354 7710103 Arteurotia artistella Grishin , new species https://zoobank.org/ 477809F5-8458-48A4-B38E-FEEABD6B998B ( Fig. 35 part, 36, 37a–c, 38) Definition and diagnosis. Inspection of phylogenetic trees constructed from protein-coding regions in the nuclear genome reveals that specimens identified as Arteurotia tractipennis tractipennis A. Butler and H. Druce, 1872 ( type locality in Costa Rica ) from the northern parts of its range form a separate and strongly supported clade (e.g., Z chromosome tree, Fig. 35a red) sister to a strongly supported clade of all others ( Fig. 35a blue and green). Fst / Gmin statistics for the comparison of the two taxa are 0.40/0.003 suggest that the red clade is a distinct species. Curiously, in mitochondrial genome ( Fig. 35b ), this new species is sister to the nominotypical A. tractipennis from Central America, and the South American subspecies Arteurotia tractipennis contractipennis Mabille and Boullet, 1916 ( type locality in Venezuela ) is sister to them both. This incongruence between nuclear and mitochondrial genomes is likely caused by mitochondrial introgression at some point in the past, because Fst between A. t. tractipennis and A. t. contractipennis computed on the Z chromosome is low (0.13) suggesting that they are conspecific. Therefore,the COI barcodes of the new species are more similar to the barcodes of the nominotypical A. tractipennis (0.8%, 5 bp) than to the barcodes of A. t. contractipennis (1.2%, 8 bp). The new species is similar to A. tractipennis ( Fig. 37d, e ) and differs from it by the apical hyaline forewing spots being closer together, in particular, the spot in the cell R 3 -R 4 is typically closer to the spot in the cell R 4 -R 5 in the new species ( Fig. 36 , 37a–c ) than in A. tractipennis , the apical black patch is usually smaller, and the hindwing androconial patch comes closer to the wing outer margin; long prong (from the ampulla) of the left valva (asymmetric genitalia) is longer and more gracile ( Fig. 38 ). Due to individual variation, this new species is best diagnosed by DNA. A combination of the following base pairs is diagnostic in nuclear genome: aly1313.21.3:A339G, aly1603.80.1:T144A, aly1603.29.3:C411T, aly770.4.1:A1470G, and aly925.19.1:C24T, and COI barcode: A34G, A302G, C421C(not T), C505C(not T), and A628A(not G). Barcode sequence of the holotype . Sample NVG-5485, GenBank OP762110, 658 base pairs: TACTTTATATTTTATTTTTGGTATTTGATCAGGGATAGTAGGAACATCTTTAAGTATACTTATTCGATCAGAATTAGGAATACCTGGATC TTTAATTGGAGATGATCAAATTTATAATACTATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGG AGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCACCTGATATAGCTTTTCCCCGAATAAATAACATAAGATTTTGACTTTTAC CTCCTTCTTTAATATTATTAATTTCAAGAAGTGTTGTAGAAAATGGTGCTGGAACAGGTTGAACTGTTTATCCCCCCCTTTCAGCTAA TATTGCTCATCAAGGATCTTCTGTAGATTTAACTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATTTTAGGGGCAATTAATTTTA TTACAACTATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTCTATTCGTATGAGCTGTAGGTATTACTGCTTTACTTTTA TTATTATCTTTACCCGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGTAATTTAAACACATCTTTTTTTGATCCAGCTGGAGGA GGAGATCCAATTTTATATCAACATTTATTT Figure 35. Trees of Arteurotia constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: A. artistella sp. n. (red), A. tractipennis tractipennis (blue), and A. tractipennis contractipennis (green). Primary type specimens are labeled in magenta. See Fig. 1 legend for other notations. Figure 36. The type series of Arteurotia artistella sp. n . a) holotype ♂ NVG-5485, b) paratype ♂ NVG-18059D02, dorsal (left) and ventral (right) views, data in text. Figure 37. Two species of Arteurotia , iNaturalist observations. a–c) A. artistella sp. n . a) 29447636 Mexico: San Luis Potosí, Aquismón, 16-Jul-2019 © Carlos G Velazco-Macias. b) 65660684 Mexico: Guanajuato, Victoria, Rancho Viejo, 8-Nov-2020 © Ma. Eugenia Mendiola González. c) 9615777 USA: Texas, Hidalgo Co, Mission, 3-Nov-2010 © upupamartin. d–e) A. tractipennis . d) 43115536 Honduras: Francisco Morazán, Santa Ana, 24- Apr-2020 © John van Dort. e) 69372846 Colombia: Sucre, San Benito Abad, 6-Sep-2017 © Jeir Ortega Galvan. Some images are color-corrected, rotated, and/or flipped. CC BY-NC 4.0 https://creativecommons.org/licenses/ by-nc/4.0/. Figure 38. Genitalia of Arteurotia artistella sp. n. holotype (data in text) in different views. a) left lateral, b) left ventrolateral, c) left posterolateral, d) ventral, and e) dorsal. Type material. Holotype : ♂ deposited in the Texas A&M University Insect Collection, College Station, Texas , USA ( TAMU ), illustrated in Fig. 36a , 38 , bears the following eight rectangular labels, seven white: [ FIRST | UNITED STATES | RECORD ], [ TEXAS : | HIDALGO COUNTY | city of Mission | 10 th Street at | irrigation ditch], [coll. | 2-IX-1972 | N. M. McGuire], [Allyn Museum photo | No. 051079-7-8], [ HESPERIIDAE , | Pyrginae: | Arteurotia tractipennis | tractipennis | Butler & H. Druce, 1872 | ♂ det. R .O. Kendall | M. & B. No. 62.5], [DNA sample ID: | NVG-5485 | c/o Nick V . Grishin], [genitalia | NVG160110-26 | Nick V . Grishin], and one red [ HOLOTYPE ♂ | Arteurotia | artistella Grishin ]. Paratype : 1♂ Mexico : Tamaulipas , Ciudad Victoria, Rio San Marcos, ca 1000 ft , GPS 23.9167 , −98.8833 , J. Kemner leg., 4-Jun-1992 , NVG-18059D02, in USNM . Type locality. USA : Texas , Hidalgo Co., Mission. Etymology. The name is for the dense cluster of spots at the forewing apex, from Latin ‘artus’ for narrow, close, fitted, confined, dense and ‘stella’ star. The name is a feminine noun in apposition. English name. Artistarred skipper. Distribution. Presently known from South Texas and Mexico : Tamaulipas . Notably, El Salvador and Costa Rica are inhabited by a different species, A. tractipennis . It is unknown if the two species are sympatric. However, this geographical boundary somewhere in southern Mexico or Guatemala , is not the typical suture zone in Panama or Colombia that separates the faunas of North and South Americas that we see in other cases discussed in this work.