Description, molecular identification and pathological lesions of Huffmanela persica sp. nov. (Nematoda: Trichosomoididae: Huffmanelinae) from the daggertooth pike conger Muraenesox cinereus Author Ghanei-Motlagh, Reza Author Fast, Mark D. 1,2 & 1,2 & * Author Groman, David 1,2 & * Author Kumar, Gokhlesh Author Soliman, Hatem 1,2 Author El-Matbouli, Mansour Author Saleh, Mona 1,2 text Parasites & Vectors 2023 182 2023-06-05 16 1 1 20 http://dx.doi.org/10.1186/s13071-023-05772-7 journal article 10.1186/s13071-023-05772-7 ba9ceb1a-d033-4fb1-a682-ab2ded48f85b 1756-3305 11552130 Huffmanela persica sp. nov. Taxonomic summary Type definitive host : Daggertooth pike conger, Muraenesox cinereus (Forsskål) , Anguilliformes , Muraenesocidae , date of collection, February 2021 . Type locality : Persian Gulf off the coast of Zir Ahak , Bushehr , Iran ( 28°17’ N , 51°13’ E ) . Site of infection : Ovary, tunica serosa of stomach ( Fig. 2A ). Conspicuous masses of eggs of H. persica sp. nov. were observed in the ovaries of all 13 fish infected. Te egg aggregations were simultaneously found in the serosae of stomach of 3 out of 13 fish infected by the nematode. All fish examined were also infected by larval (viscera) and adult (stomach and intestine) forms of anisakids and raphidascaridids. Adult forms (male and female) of H. persica sp. nov. were not observed. Table 1 List of primers used in this study

Molecular marker	Primer set	Sequence (5 ′ -3 ′ )	References
18S rDNA	Nem_18S_F	CGCGAATRGCTCATTACAACAGC	[27]
Nem_18S_R	GGGCGGTATCTGATCGCC
28S rDNA	D2A	ACAAGTACCGTGAGGGAAAGT	[ 28 , 29 ]
D3B	TGCGAAGGAACCAGCTACTA
28SF	AGCGGAGGAAAAGAAACTAA
28SR	ATCCGTGTTTCAAGACGGG
ITS region	NC5	GTAGGTGAACCTGCGGAAGGATCATT	[30]
NC2	TTAGTTTCTTTTCCTCCGCT

Table 2 List of GenBank accession numbers for sequence data used in phylogenetic analyses in this study

Species	Accession number (18S rDNA)	References
Capillaria anatis	LC052335	[77]
Capillaria bursata	LC425006	[ 78 ]
Capillaria madseni	LC052348	[77]
Capillaria pudendotecta	LC052343	[77]
Capillaria spinulosa	LC424999	[ 78 ]
Capillaria suis	LC052376	[77]
Capillaria tenuissima	EU004822	[ 79 ]
Huffmanela cf. huffmani	ON838247	[5]
Huffmanela cf. huffmani	ON838248	[5]
Huffmanela huffmani	ON838249	[5]
Huffmanela huffmani	ON838251	[5]
Huffmanela markgracei	ON838250	[5]
Huffmanela persica	OQ418445	This study
Huffmanela sp.	ON838246	[5]
Pseudocapillaria tomentosa	KU987805	[ 80 ]
Trichinella britovi	AY851257	[ 81 ]
Trichinella murrelli	AY851259	[ 81 ]
Trichinella nativa	AY851256	[ 81 ]
Trichinella nelsoni	AY851261	[ 81 ]
Trichinella papuae	AY851263	[ 81 ]
Trichinella patagoniensis	MF628272	[ 82 ]
Trichinella spiralis	U60231	[83]
Trichinella zimbabwensis	AY851264	[ 81 ]
Trichosomoides crassicauda	LC425007	Unpublished
Trichuris arvicolae	HF586908	[84]
Trichuris discolor	HF586910	[84]
Trichuris muris	AF036637	[85]
Trichuris ovis	HF586911	[84]
Trichuris skrjabini	HF586912	[84]
Trichuris suis	HF586905	[84]
Trichuris trichiura	LC596914	Unpublished
Trichuris vulpis	HF586909	[84]

Fig. 2 Macroscopic and microscopic appearance of fully developed eggs of Huffmanela persica sp. nov. A Grossly visible lesions of eggs previously deposited by adult forms of H.persica sp. nov. in the form of dark spots of various size within the infected tissues (ovary and serosa of stomach) of Muraenesox cinereus . B Wet mount prepared from infected ovary illustrating variously oriented advanced eggs of H.persica sp.nov. within the egg clusters Prevalence : 65% (13 infected out of 20). Etymology : Te specific name persica (Persian) refers to the country of its occurrence ( Iran ). Molecular characterization : Nucleotide sequences of the 18S rDNA (OQ418445), 28S rDNA (OQ428648) and ITS rDNA (OQ428649) of the new species have been deposited in GenBank. Deposited specimens : Syntype eggs collected from the host ( M. cinereus ) were deposited in the Helminthological Collection , Institute of Parasitology , Biology Centre of the Czech Academy of Sciences , České Budějovice , Czech Republic (catalog no. N-1277) . ZooBank registration : To comply with the regulations set out in article 8.5 of the amended 2012 version of the International Code of Zoological Nomenclature [ 37 ], details of the new species have been submitted to ZooBank. Te Life Science Identifier (LSID) of the article is urn:lsid:zoobank. org:pub: 84ABB846-5AF2-4008-97F6-573A68DFD1BB . Te LSID for the new species name Huffmanela persica is urn:lsid:zoobank.org:act: urn:lsid:zoobank. org:act: E12D7B01-E298-4BEE-AD69-8C075F84B33E . Description of eggs Grossly visible eggs of H. persica sp. nov. were mostly observed in the form of black aggregates with different dimensions which were randomly distributed in the infected tissues ( Fig. 2B ). Scalpel scrapings obtained from fresh and fixed egg clusters showed thousands of variously oriented eggs with untinted, brown or black eggshells depending on the stage of development of each egg. Four stages of egg development (from less developed to fully developed eggs) are reported herein based upon morphology and morphometry of eggs as well as embryonic stages of development observed in eggs. Tese include stage I (meiotic stage), stage II (early mitotic embryonated stage), stage III (late embryonated stage) and stage IV (vermiform larvated stage). Stage I eggs Stage I eggs ( Figs. 3A, a ; 4A–D ; 5H ) were evidently recently laid eggs in probably meiosis I with a distinctly spherical nucleus mainly located centrally in the granular cytoplasm and no developed or two poorly developed plugs at poles. Eggs in stage I spherical shaped (occasionally shrunken and wrinkled), with light amber rigid eggshell walls and no discernable layering. Egg morphometrics ( n = 15) recorded in stage I was as follows: total length (with uterine layer, UL) 34.14–44.32 (38.12 ± 2.97); total length (without UL) 30.51–39.51 (34.06 ± 2.76); total width (with UL) 32.65–41.25 (35.50 ± 2.06); total width (without UL) 30.45–37.20 (32.60 ± 1.72); shell thickness (with UL) 3.27–6.07 (4.74 ± 0.81); shell thickness (without UL) 1.54–2.99 (2.47 ± 0.44); nucleus length 8.2–10.71 (9.24 ± 0.87); nucleus width 7.57–10.08 (8.53 ± 0.74). Stage II eggs Stage II represents various stages of early embryonic development within the eggshell from single-cell (probably meiosis II) stage to multiple cell mitotic stages ( Fig. 3B, b; C, c; D, d ). Eggs in the single-cell stage ( Fig. 3B, b ) were distinguished by having a spherical nucleus present in the granular cytoplasm and two newly developed polar plugs. Eggs in the two-cell stage ( Fig. 3C, c ) had a symmetric pattern as the result of the first cell division. Eggs containing multi-cell stages ( Fig. 3D, d ) showed further development of embryo, where the inner space of the rigid eggshell wall was partly or completely occupied by a multicellular mass. Eggs in stage II were elliptical or oblong, light yellow to light brown, with polar plugs (apparently two-layered) slightly or markedly protruding and no distinct shell layers. Egg morphometrics ( n = 40) obtained in stage II: total length (inclusive of protruding polar plugs and UL) 46.79–65.84 (58.26 ± 4.83); total length (exclusive of protruding part of polar plugs and UL) 43.24–61.85 (54.08 ± 4.85); total width (with UL) 31.51–40.80 (35.43 ± 2.23); total width (without UL) 30.35–39.52 (33.57 ± 2.35); shell thickness (with UL) 3.43–8.44 (5.20 ± 1.11); shell thickness (without UL) 2.70–7.57 (4.28 ± 1.14); polar plug width 7.52–15.76 (9.78 ± 1.65). Stage III eggs Eggs in stage III ( Fig. 3E, e; F, f ) demonstrating higher development of embryo were characterized by possessing spatially differentiated forms (bean-like or tadpole-like embryos; Fig. 3E, e; F, f ), two easily distinguishable apparent shell layers and mild to moderate degrees of embryonic bending within the eggshell. Eggs in stage III elliptical or oblong in shape, brown in color, containing two protruding polar plugs, with bilayer shell inclusive of a thin and light (hyaline) inner layer alongside with a thick and dark outer layer (this layering is an optical illusion under light microscopy caused by the birefringent properties of chitin; see Bond and Huffman, 2023) [ 25 ]. Morphometric measurements of eggs ( n = 27) in stage III are summarized as follows: total length (with protruding polar plugs and UL) 59.39–70.98 (62.44 ± 2.60); total length (without protruding part of polar plugs and UL) 54.75–61.67 (57.39 ± 1.94); total width (with UL) 32.46– 44.75 (34.95 ± 3.03); total width (without UL) 30.62– 43.30 (32.88 ± 3.05); shell thickness (with UL) 3.81–5.73 (4.90 ± 0.52); shell thickness (without UL) 2.92–5.02 (3.77 ± 0.46); polar plug width 8.18–11.09 (9.39 ± 0.68). (See figure on next page.) Fig. 3 General morphology and surface ornamentation pattern of eggs of Huffmanela persica sp. nov. in various stages of development. A–H Photomicrographs and a–h corresponding line drawings of individual eggs at different stages of development (scale bars: 20 µm). A , a Eggs in stage I at very early stage,probably meiosis I, with a spherical nucleus in granular cytoplasm and incompletely developed chitinous layer and polar plugs (note early appearance of superficial projections of UL already apparent). B , b Eggs in stage II at later stage of development (probably meiosis II); chitin deposition appears to be complete. C , c Two-celled mitotic stage of early embryonic development (embryonated). D , d Later multicellular stage of embryonic development; chitinous layer still uniformly translucent with no apparent division into outer and inner chitinous layers. E , e Eggs in stage III with bean-like embryo and chitinous layer appearing two-layered under bright-field (light) microscopy with darker inner layer. F , f Tadpole-like embryos with UL appearing to have been partially dislodged from chitinous layer. G , g Eggs in stage IV with darker-brown shell; embryo now vermiform (larvated) and in-folded three times (pretzel stage). H , h Later stage IV egg with chitinous layer very dark brown; larva nearing final development and folded 5–6 times. I–T Photomicrographs of less developed ( I–L ), moderately developed ( M–P ) and fully developed ( Q–T ) eggs, where the first set of images ( I , M , Q ) represents overview of these variously advanced eggs, and the second ( J , N , R ), third ( K , O , S ) and fourth ( L , P , T ) series of images focus on the pattern of their surface ornamentation by adjusting the focal plane. Black and yellow arrows represent illusions of superficial ridges (well demonstrated in less developed eggs; occasionally appearing as interconnecting ridges, blue arrowhead) and sculptures on the egg surface, respectively. Green arrowheads exhibit irregular protuberances on the eggshell surface.Red arrowheads indicate an illusory spinous appearance in fully developed eggs Fig. 3 (See legend on previous page.) Stage IV eggs Stage IV eggs ( Figs. 3G, g; H, h ; 4E–I ; 5G, I ) were differentiated by having brown to dark-brown color, oblong or elliptical shape, varying degrees of larval formation within egg from threefold stage (pretzel, Fig. 3G, g ) to five–sixfold stage (fully developed larva, Fig. 3H, h ), dark outer layer much thicker in width and two distinctly protruding polar plugs. Morphometric data obtained from stage IV eggs ( n = 71) were as follows: total length (with protruding polar plugs and UL) 60.37–75.13 (66.62 ± 3.04); total length (without protruding part of polar plugs and UL) 54.37–67.86 (62.03 ± 2.94); total width (with UL) 32.54–44.63 (36.46 ± 2.65); total width (without UL) 30.96–43.39 (34.41 ± 2.78); shell thickness (with UL) 4.48–7.17 (5.63± 0.53); shell thickness (without UL) 3.51–6.11 (4.63 ± 0.55); polar plug width 8.43–12.00 (10.29 ± 0.79); larval width in fully developed eggs 6.09–9.16 (7.91 ± 0.61); larval length ( n = 17) in fully developed eggs 196.27–231.49 (209.51 ± 10.64). Fig. 4 Scanning electron micrographs of poorly developed ( A–D ) and fully developed ( E–I ) eggs of Huffmanela persica sp. nov. (separated from infected ovary).Less developed eggs spherical shaped (white arrow shows a shrunken and wrinkled egg) and with no evidently developed polar plugs. Fully developed eggs oblong and containing two plugs at poles. Eggs completely surrounded by a UL bearing uniformly based mammiform mounds adorned with tendril-like vermiform appendage emerging from the apex,occasionally adjoined to that of a neighboring mound (green arrowheads). Note the illusory appearance of serrated-like ridges (occasionally in the form of illusory interconnecting ridges,black arrows) in side views which is caused by overlapping of the mound bases (well observed in less developed eggs, red arrowheads). Outer surface of eggshell with irregular protuberances (yellow arrowheads) Egg surface ornamentations Te rigid eggshell wall (or its integral outermost layer, Pellicula Ovi ) at all stages adorned with irregular protuberances on the surface ( Fig. 4B–D, H, I ). Eggs thoroughly surrounded by a thin transparent UL decorated with closely and regularly spaced mammiform mounds (superficial projections, Figs. 3 I–T , 4B–D, F, G ) appearing to form pointed serrated-like ridges ( Fig. 3J, N, R ) (occasionally appearing as interconnecting ridges; Figs. 3J , 4D ) on the egg surface (the appearance of ridges is most likely a geometric illusion; see Figs. 1–3 , 7, 8 of Žďárská et al. 2001, Fig. 30 of Bond, 2020 and Fig. 24 of Bond and Huffman, 2023) [ 25 ], resulting in manifestation of a fine superficial sculpture on the surface of eggs examined with light microscope ( Fig. 3K, O, S ). UL mammiform mounds predominantly with a tendril-like vermiform appendage extending from the tip, sometimes adjoined to that of a neighboring mound ( Fig. 4A–F ). Fig. 5 Photomicrographs from histological sections of infected tissues of a daggertooth pike conger eel. A , B Histological sections of the stomach infected by eggs of Huffmanela persica sp. nov. at various stages of development as well as degenerated encysted metazoans (⁎). C , D Sections of the tunica serosa of the stomach parasitized with completely developed eggs. E Sections of the ovarian lamellae infected by both clusters of immature (➔) and developing (➤) eggs, representing immature and previtellogenic oocytes embedded within a loose fibro-granulomatous infiltration containing histiocytes and eosinophilic granular leukocytes (⁎). F Magnified view of histological section of infected ovary showing a fibro-granulomatous infiltrate surrounding clusters of eggs at different stages of development (mainly highly developed eggs, ➤). G High magnification (100×) view of a fully developed egg of H. persica (cross-sectional view) showing larva in-folded within the eggshell and a protruding polar plug at either end. H Less developed eggs with a nearly central nucleus (⁎) and thin eggshell layer and I fully developed eggs containing twisted larvae of H. persica cut on varying planes of section Pathological lesions Te serosal surface of the stomach in infected fish contained eggs of H. persica sp. nov. at various stages of development ( Fig. 5A–D ) and degenerated encapsulated metazoans ( Fig. 5A, B ; more likely larval forms of Anisakis and less likely adult forms of Huffmanela as the females are usually extremely long, are rarely found encapsulated and are not much thicker than the eggs), all of which were enclosed in a fibro-granulomatous infiltrate. Ovigerous lamellae of the ovary were infected with nests of developing eggs from the nematode H. persica . Te eggs were located within both clusters of immature and previtellogenic oocytes and the connective tissue of the lamellae and encased by a fibro-granulomatous infiltrate containing both histiocytes and eosinophilic granular leukocytes ( Fig. 5E, F ). Gene characterization and phylogenetic analysis Sequencing of purified PCR products of 18S, 28S and ITS regions from H. persica sp. nov. resulted in DNA fragments with different lengths (855 bp, 1264 bp and 1127 bp, respectively). Te BLAST analysis revealed that 18S rDNA gene sequence of H. persica sp. nov. shared 93–96% identity (ID) and 83–96% query coverage (QC) with Huffmanela species collected from freshwater bony fish including H. cf. huffmani of Bullard et al., 2022 (ON838248, 93.12% ID and 96% QC), H. huffmani (ON838249, 94.62% ID and 88% QC), H. huffmani (ON838251, 96.08% ID and 83% QC) and H. cf. huffmani (ON838247, 95.80% ID and 83% QC) and 86–89% ID and 81–95% QC with those isolated from marine cartilaginous fish including Huffmanela sp. (ON838247, 86.28% ID and 95% QC) and Huffmanela markgracei Ruiz and Bullard, 2013 (ON838250, 89.38% ID and 81% QC). According to the ML tree generated from 18S rDNA sequences ( Fig. 6 ), H. persica was not grouped with previously reported species of Huffmanela . However, a sister relationship was recovered between the new species of marine origin with freshwater species of Huffmanela ( H. huffmani and H. cf. huffmani ), all of which are known to infect teleost fish. A sister group relationship was also found between Huffmanela species infecting teleost fish ( H. huffmani , H. cf. huffmani and H. persica ) with those parasitizing elasmobranch fish ( H. markgracei and Huffmanela sp. ). Phylogenetic analysis based on 18S rDNA dataset strongly corroborated monophyly of the subfamily Huffmanelinae ( Fig. 6 ).