Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Amblyscirtes ( Mastor ) chrysoplea Grishin , new species https://zoobank.org/ 81EE321D-0271-4A7C-A136-ED06491AB494 ( Fig. 6 part, 145–146, 370–371) Definition and diagnosis. Phylogenetic trees reveal that specimens from Oaxaca , Mexico , identified as Amblyscirtes anubis Godman, 1900 ( type locality in Mexico : Guerrero ), show prominent genetic differentiation from it ( Fig. 6 ): e.g., their COI barcodes differ by 5.8% (38 bp), and therefore represent a new species. This new species keys to A. anubis (N.2.21) in Evans (1955) but differs from it in having bright-orange forewing fringes, hindwing fringes typically with some orange scales, and ventral hindwing essentially unspotted (better defined, rounder ventral hindwing spots are typical for A. anubis ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly216.64.14:G57A, aly216.64.14:A87G, aly103.15.43:C102T, aly3125.2.3:G201A, aly6398.11.1:G1269A, and COI barcode: 88T, A199G, T277C, T358C, T487C, A643G. Barcode sequence of the holotype . Sample NVG-18012F09, GenBank OR837687, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGAAACCCTGGTTCATTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTGGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGGATAAATAATATAAGATTTTGAATACTTCCCCCATCCCTAATACTTTTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTATACCCCCCTTTATCATCTAACATTGCCCATCAAGGTTCATCTGTTGATTTA GCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGAGTTAGAAATATATCAT TCGATCAAATACCCCTATTTGTTTGATCTGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATCACAATACTCCT CACTGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTCTGTATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 145–146 , bears the following four rectangular labels, three white: [ MEXICO : OAXACA | Putla-Tlaxiaco | 5000-7000 ft | 5-7-VIII-1992 | J. Kemner ], [DNA sample ID: | NVG-18012F09 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01450312], and one red [ HOLOTYPE ♂ | Amblyscirtes (Mastor) | chrysoplea Grishin ] . Paratypes : 2♂♂ Mexico : Oaxaca , Sierra Madre del Sur, J. Kemner leg.: NVG-18063G12, USNMENT_01466218 El Guajolote, 7700′, 14-Jun-1989 , genitalia X-2924 J.M.Burns 1990 [ USNM ] and NVG-21014G07 Sierra Madre del Sur, La Soledad–Buena Vista, 5000′, 14-Apr-1990 [ CMNH ]. Type locality. Mexico : Oaxaca , Putla–Tlaxiaco, elevation 5000-7000 ft. Etymology. The name is formed from the Greek Χρυσός (chrysós), meaning gold and πλέον (pléon), meaning most. The name is given for the orange fringes not only on the forewing but also partly on the hindwing, making this species the most orange-colored member of the A. anubis group. The name is a noun in apposition. Distribution. Mexico : Oaxaca .