Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Urbanus ( Urbanus ) mericuti Grishin , new species https://zoobank.org/ 5C620BB9-A60D-42F8-B72B-8C832D79A9D4 ( Fig. 1 part, 19–20, 231–232) Definition and diagnosis. Inspection of genomic trees reveals that most South American populations identified as Urbanus tucuti (R. Williams, 1927) (type locality in Panama , holotype sequenced as NVG-15095A10) are strongly differentiated genetically from U. tucuti ( Fig. 1 ): e.g., their COI barcodes differ by 3.5% (23 bp), and therefore represent a new species. It keys to “ Astraptes tucuti ” (C.14.5) in Evans (1952) and differs from it by comparatively shorter harpe with a straighter dorsal margin and less acute terminal angle, the wider separation between harpe and ampulla (wider notch) ( Fig. 232 ), uncus arms being more parallel to each other and closer together, rather than terminally diverging in dorsal view ( Fig. 231 ), and usually absent or reduced hyaline dash in M 3 -CuA 1 cell ( Fig. 19 ). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly53.2.40:C42T, aly 1968.11.7 :A106G, aly58.10.2:C13T, aly58.10.2:G45A, aly7098.1.5:C115A, and COI barcode: A43T, A79G, T178C, T479C, T601C. Barcode sequence of the holotype . Sample NVG-14104A08, GenBank OR837629, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGGACTCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTCTTTATAGTTATACCTATCATAATCGGAGGATTTGGTAATT GACTTGTACCTTTAATAATAGGTGCCCCTGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTACTACCCCCTTCCTTAACTTTATTAAT TTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCCCTTTCATCTAACATTGCTCATCAAGGAGCTTCTGTTGATTTA GCAATTTTCTCTCTTCATCTTGCCGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAATAGACTAACTT TTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATT AACTGATCGAAATCTAAACACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 19–20 , bears the following four rectangular labels, three white: [ ECUADOR : Napo Pr. | 8 km Napo-Ahuano | 1° 2.5′ S 77° 43.5′ W | 9 Nov. 1992 , 480m. | S. S. Nicolay , leg.], [ Astraptes | Det. fulgor | S.S. Nicolay ], [DNA sample ID: | NVG-14104A08 | c/o Nick V . Grishin ], and one red [ HOLOTYPE ♂ | Urbanus mericuti | Grishin ] . Paratypes : 4♂♂ in USNM : 1♂ NVG-14104A09 the same data as the holotype, except 13-Nov-1992 ; Ecuador 1♂ NVG-8078 Napo , Misahualli Jungle Lodge , 450 m , GPS −1.0257 , −77.6570 , 6–8-Jan-2002 , J. P. W. Hall and M. A. Solis leg., genitalia NVG170208-63 ( Fig. 231–232 ) ; Brazil : 1♂ NVG-19071G06 Amazonas , Benjamin Constant , Nov-1960 , Jorge Kesselring leg. ; 1♂ NVG-19071G06 Rondonia , 62 km S Ariquemes , Fazenda Rancho Grande , 165 m , GPS −10.533 , −62.800 , 14-25-Nov-1993 , Brian Harris leg. Type locality. Ecuador : Napo Province , km 8 of Puerto Napo-Ahuano Road, elevation 480 m , GPS −1.0417 , −77.725 . Etymology. The name denotes a more southern range of this species than U. tucuti : meri [dionalis (Latin for southern) + tu] cuti . The name is a noun in apposition. Distribution. Currently known from the upper Amazonian region in Ecuador and Brazil .