Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Astraptes centralis Grishin , new species https://zoobank.org/ 556FE76C-4D98-46DD-802A-D57449CFD0AD ( Fig. 1 part, 25–26, 237–238) Definition and diagnosis. Phylogenetic trees reveal that Central American specimens identified as Astraptes aulus ( Plötz, 1881 ) (type locality in Brazil , a syntype sequenced as NVG-21114H07) show prominent genetic differentiation from it ( Fig. 1 ): e.g., their COI barcodes differ by 5% (33 bp), and therefore represent a new species. This new species keys to “ Astraptes fulviluna ” (C.14.14) in Evans (1952) , which is currently a junior subjective synonym of A. aulus and differs from it by a straighter dorsoposterior margin of harpe ( Fig. 238 ), less extensive green area on the dorsal forewing ( Fig. 25 ) and not pupillated pale spot by inner margin on the ventral hindwing ( Fig. 26 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1341.9.2 :G264C, aly1019.14.10:G1446A, aly 1497.4.1 :T63C, aly887.6.4:C66G, aly594.10.7:G171A, and COI barcode: T35T, T169C, A217G, T292C, T508C. Barcode sequence of the holotype . Sample NVG-14105A07, GenBank OR837632, 658 base pairs: AACTCTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCTTTAAGTCTTCTTATTCGAACTGAATTAGGAACACCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATT GACTAGTACCATTAATATTAGGGGCCCCTGATATAGCTTTCCCTCGAATAAATAACATAAGATTCTGATTATTACCCCCCTCTTTAACTCTCTTAAT CTCAAGAAGTATCGTAGAAAATGGTGCTGGTACTGGTTGAACTGTCTATCCCCCACTTTCATCTAATATTGCCCACCAAGGAACTTCTGTTGATTTA GCAATTTTCTCCCTTCATCTTGCTGGAATTTCCTCCATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATCAATAATTTATCAT TTGATCAAATACCATTATTTATCTGAGCAGTAGGAATTACTGCATTATTATTATTACTTTCTTTACCCGTACTAGCAGGAGCTATTACTATATTACT AACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGTGGTGGGGATCCAATTTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 25–26 , bears the following three rectangular labels, two white: [ PANAMÁ : Canal Zone | Gamboa | X.18.78 | Gordon B. Small ], [DNA sample ID: | NVG-14105A07 | c/o Nick V . Grishin], and one red [ HOLOTYPE ♂ | Astraptes | centralis Grishin ] . Paratypes : 2♂♂ and 1♀ in USNM : 1♂ NVG-14105A06 the type locality, with the same data, additionally “Pipeline Road, NW of Gamboa 9° 07′N , 79° 41′W ” ; and Costa Rica , Area de Conservación Guanacaste , Guanacaste Prov. , Sector Mundo Nuevo , Estacion La Perla , 325 m , GPS 10.76737 , −85.43313 : 1♂ NVG-17106D09 06-SRNP-60359 eclosed on 10-Jan-2007 and 1♀ NVG-17106D08 11-SRNP-56351 eclosed on 29-Aug-2011 . Type locality. Panama : Colón Province , Gamboa. Etymology. The name is for the range of this species in Central America and is a masculine adjective. Distribution. Costa Rica and Panama .