Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Polyctor ( Fenops ) lamperus Grishin , new species https://zoobank.org/ CF3D0B2D-8ED2-4D3F-AD93-03621C2AFC9B ( Fig. 3 part, 69–70, 285–287) Definition and diagnosis. This new species is sister to Polyctor enops (Godman and Salvin, 1894) ( type locality in Mexico : Veracruz and Honduras ) and differs from it by 2.3% (15 bp) in COI barcode and is recognizable phenotypically by paler wing ground color, larger forewing hyaline spots and mostly white ventral hindwing (marginally brown towards tornus), in particular by costa and apex, which are brown in P. enops and Polyctor fera (Weeks, 1901) (distal half of hindwing can be white). This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly85.29.3:A228G, aly214.4.1:C375T, aly3268.8.1:T900C, aly72.21.1:G933A, aly 1022.3.1 :G150A, aly315.8.6:G63G (not A), aly570.6.1:G57G (not A), aly 1841.5.20 :T96T (not C), aly1656.40.1:C575C (not A), aly1656.40.1:A1038A (not G), and COI barcode: T50C, A100T, G353A, 445C, T529C. Barcode sequence of the holotype . Sample NVG-19088F12, GenBank OR837653, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCACTAAGTTTAATTATTCGATCTGAATTAGGTATACCTGGTTCATTAATT GGTAATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTCTTCATAGTTATACCCATTATAATTGGAGGATTCGGAAATT GATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTTTAACTTTATTAAT TTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCTCCTTTATCTACTAATATTGCTCATCAAGGTTCTTCTGTAGATTTA GCAATTTTCTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGTGCTATTAACTTCATTACAACTATTATTAATATACGAATTAATAATATATCTT TTGATCAAATACCTCTTTTTATTTGAGCTGTTGGAATTACAGCCTTACTTTTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATATTATT AACTGATCGTAATTTAAATACATCTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTCTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 69–70 , bears the following four rectangular labels, three white: [ PANAMA : Darien | Cana 400m | 9.VII.1981 | Leg. G. B. Small | on mud], [DNA sample ID: | NVG-19088F12 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01588973], and one red [ HOLOTYPE ♂ | Polyctor | lamperus Grishin ]. Type locality. Panama : Darien Province , Cana, elevation 400 m . Etymology. In Greek, λαμπερός (lamperós) means shiny bright. The name reflects the species’ bright colors compared to its relatives and is a noun in apposition. Distribution. Currently known only from the holotype collected in eastern Panama .