Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Calpodes salianus Grishin , new species https://zoobank.org/ 9916050C-DBCE-4EDA-A05C-6BB74C2BD7B3 ( Fig. 8 part, 195–196, 432–434) Definition and diagnosis. Phylogenetic trees reveal that a specimen from Peru identified as Calpodes salius (Cramer, 1775) ( type locality in Suriname ) is not monophyletic with and shows prominent genetic differentiation from it ( Fig. 8 ): e.g., their COI barcodes differ by 5.2% (34 bp), and therefore represents a new species. This new species keys to “ Saliana salius ” (O.14.17) in Evans (1955) but differs from it by longer costal shoulder of the discal cell spot that has an appearance of a separate spot shifted distad (at the base too) but joined with the lower spot (instead of a single spot with a flatter base and irregular outer margin), and the lack of ash-gray overscaling at the base of ventral hindwing (this area is maroon-colored instead with violet sheen) ( Fig. 195–196 ), ampulla more protruding dorsad, and more convex costa near ampulla ( Fig. 434 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly276558.9.2:A84G, aly276558.9.2:A150G, aly 2258.12.5 :G486C, aly272.25.11:T84C, aly 1660.4.4 :C157T, aly638.8.1:G327G (not A), aly638.8.1:A369A (not G), aly827.13.1:C42C (not G), aly827.13.1:C75C (not T), aly525.2.6:G186G (not A), and COI barcode: T19C, A44T, T121C, A175G, T596C. Barcode sequence of the holotype . Sample NVG-18112H11, GenBank OR837712, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCAGGAATATTAGGTTCTTCATTAAGTTTATTAATTCGTACAGAATTAGGTAATCCTGGTTCATTAATT GGAGATGACCAAATTTATAATACCATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATGATTGGAGGATTTGGAAATT GATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCAGCTAATATCGCCCATCAAGGATCTTCAGTTGATCTA GCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTAATAT TTGACCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTATTATCATTACCAGTTTTAGCAGGAGCTATTACAATACTTCT TACTGACCGAAATCTAAATACATCTTTCTTTGACCCTGCAGGAGGAGGTGACCCTATTTTATACCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 195–196 , bears the following four rectangular labels, three white: [ PERU 300m | 30 Km S.W. | Pto. Maldonado | 26 Oct. ’83 | S. S. Nicolay ], [DNA sample ID: | NVG-18112H11 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01531430], and one red [ HOLOTYPE ♂ | Calpodes | salianus Grishin ]. Type locality. Peru : Madre de Dios Region , 30 km SW of Puerto Maldonado, elevation 300 m . Etymology. The name reflects its somewhat similar appearance to C. salius . Made longer, the name signifies it is a more southern relative. The name is treated as a noun in apposition. Distribution. Currently known only from the holotype collected in the Amazonian region of Peru .