Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Tromba xantha Grishin , new species https://zoobank.org/ 8A465187-542D-43AA-B5DA-BF3B8DB19614 ( Fig. 8 part, 213–214, 454–455) Definition and diagnosis. Phylogenetic trees reveal that a number of specimens identified as Tromba xanthura (Godman, 1901) (type locality in Panama ) show prominent genetic differentiation from it ( Fig. 8 ): e.g., their COI barcodes differ by 3.6% (24 bp), and therefore represent a new species. This new species keys to T. xanthura (K.14.2) in Evans (1955) but differs from it by male genitalia with deeper separation of harpe from ampulla, which is only slightly notched in T. xanthura , but in some specimens of the new species (including the holotype , Fig. 454–455 ) is separated by a groove, more prominent serrations towards distal end of the dorsal margin of harpe, and less bulky ventral margin on harpe near its fusion with the body of valva. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2672.7.10 :C117T, aly 1295.7.1 :A156T, aly133.6.8:G260A, aly4592.2.4:G73A, aly4592.2.4:A74T, and COI barcode: 49G, 238C, T340C, T367C, T640C. Barcode sequence of the holotype . Sample NVG-5054, GenBank OR837720, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCAGGAATATTAGGAACATCGTTAAGATTATTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACCATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAATT GATTAGTACCATTAATATTAGGAGCACCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACTTTATTAAT CTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGCTCACCAAGGATCTTCAGTAGATTTA GCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTATAAACTTATCTT TTGACCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACAATATTACT TACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATCTTATATCAACATTTATTT Type material. Holotype : deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 213–214 , bears the following five rectangular labels, four white: [Paso San Juan, | V . Cruz.], [ Thracides | xanthura | Godm. | comp. type.], [DNA sample ID: | NVG-5054 | c/o Nick V . Grishin], [genitalia | NVG151102-09 | Nick V . Grishin], and one red [ HOLOTYPE | Tromba xantha | Grishin] . Paratypes : 3♂♂ : 1♂ NVG-17111B07 Mexico : Guerrero , Ixtapa , 5-Mar-1985 , Benjamin Landing leg. [ LACM ] ; 1♂ NVG-5055 Honduras : 18 km W of La Ceiba , 17-Apr-1980 Robert D. Lehman leg., genitalia NVG151102-10 [ USNM ] ; and 1♂ NVG-5056 Nicaragua : San Marcos , old specimen ca. 1900, Coll. Baker , genitalia NVG151102-11 [ USNM ] . Type locality. Mexico : Veracruz , Paso de San Juan. Etymology. The name is derived from T.xanthura , the southern counterpart of this species. It has been shortened to indicate this is a more northern species. The name is a feminine adjective. Distribution. From Mexico to Nicaragua .