Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Canesia ella Grishin , new species https://zoobank.org/ A4979CC1-C793-4277-808B-45D5388EE312 ( Fig. 3 part, 85–86, 304–306) Definition and diagnosis. Phylogenetic analysis reveals that a more brightly colored than typical for the genus specimen of Canesia Grishin, 2019 ( type species Leucochitonea canescens R. Felder, 1869 ) is sister to both Canesia meridensis (Godman and Salvin, 1895) ( type locality in Costa Rica ) and Canesia callipetes (Godman and Salvin, 1895) ( type locality in Mexico , Guatemala , and Colombia ) and therefore is a new species. This new species keys to “ Carrhenes callipetes callipetes ” (E.51.3(a)) in Evans (1953) and differs from its relatives by being more vividly and vibrantly colored, more prominent dark spots, and the lack of whitish scales beneath: ventral side of wings is hay-yellow with well-developed brown spots and brown overscaling in the posterior half. This darker overscaling is not present in either C. meridensis or C. callipetes . This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1651.28.14:C132T, aly1651.28.14:C147T, aly747.2.1:A480C, aly747.2.1:T513C, aly671.50.9:T53C, aly412.9.2:A201A (not G), aly636.8.1:A84A (not G), aly6841.59.1:A39A (not G), aly5719.1.9:A24A (not C), aly 1155.1.7 :G112G (not T), and COI barcode: A40G, T82C, T85C, T439C, A508G. Barcode sequence of the holotype . Sample NVG-19088F11, GenBank OR837661, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTGGGTACTTCCTTAAGTTTATTAATTCGAACTGAATTAGGAAACCCCGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAACATTATTAAT TTCTAGAAGTATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTACCCCCCTCTCTCAGCTAATATCGCTCATCAAGGATCTTCTGTTGATTTA GCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATCAATTTTATTACTACAATTATTAATATGCGAATTAGAAATTTATCTT TTGATCAAATACCATTATTTGTGTGAGCAGTAGGTATTACTGCATTATTATTATTATTATCATTACCAGTATTAGCTGGAGCAATTACTATATTATT AACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGACCCTATTTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 85–86 , bears the following four rectangular labels, three white: [ VENEZUELA : Barinas ; | 27.4kmNW.Barinitas | 17 March 1982 | G.F. & J.F. Hevel ], [DNA sample ID: | NVG-19088F11 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01588972], and one red [ HOLOTYPE ♂ | Canesia | ella Grishin ]. Type locality. Venezuela : Barinas , 27.4 km NW of Barinitas. Etymology. The name is for the type locality in [Venezu] el ( l ) a . Also, אלה (ela) in Hebrew is Goddess. This probably is the most colorful and beautiful species of Canesia . The name is a noun in apposition. Distribution. Currently known only from the holotype collected in Venezuela .