Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Cynea ( Cynea ) aureofimbra Grishin , new species https://zoobank.org/ E2C5918D-5713-48C4-B171-FACD197E03B7 ( Fig. 5 part, 113–114, 342–344) Definition and diagnosis. Phylogenetic analysis reveals that an unspotted brown specimen of Cynea Evans, 1955 ( type species Hesperia cynea Hewitson, 1876 ) with unique orange fringes is sister to a group of species closely related to Cynea cynea ( type locality in Venezuela ) but is not genetically close to any of these species ( Fig. 5 ): e.g., its COI barcode differs from that of C. cynea by 3.8% (25 bp), and therefore is a new species. This new species is recognizable by its uniformly dark brown wings on both sides, the forewing tornal area ventrally only very slightly paler than the rest of the wing due to sparse overscaling and without spots, and orange fringes on both wings (except apical areas). This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly5294.26.2:A30G, aly5294.26.2:T183A, aly638.8.1:A318G, aly18826.6.2:A171G, aly18826.6.2:T180G, aly12063.12.6:A81A (not G), aly8211.10.1:A693A (not G), aly3277.16.1:C533C (not T), aly3277.16.1:C1022C (not T), aly37338.4.2:A48A (not C), and COI barcode: A81C, G200A, A211G, T358C, 484C, A514T. Barcode sequence of the holotype . Sample NVG-18119D08, GenBank OR837675, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTACCCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAATTCCTTTAATGTTAGGAGCCCCTGATATAGCCTTCCCTCGAATAAATAACATAAGATTTTGAATACTTCCCCCCTCATTAATATTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCTCCTTTATCTTCTAACATTGCTCACCAAGGATCCTCAGTTGATTTA GCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTAACCT TTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACTGCTCTTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTTT AACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC , USA ( USNM ), illustrated in Fig. 113–114 , bears the following six rectangular labels, five white: [Old Sto. Domingo | Rd. 1800 m ECUADOR | 7 Oct. ’73 | S.S. Nicolay ], [ ♂ genitalia | slide/vial # | H600 | Prep. S.S. Nicolay ], [ Cynea sps . | nr. megalops | Det. | S.S. Nicolay ], [DNA sample ID: | NVG-18119D08 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01531869], and one red [ HOLOTYPE ♂ | Cynea aureofimbra | Grishin]. Type locality. Ecuador: Pichincha / Santo Domingo de los Tsáchilas Province , Old Santo Domingo road, elevation 1800 m . Etymology. In Latin, aurea fimbria means golden fringe. The name reflects the golden-orange fringe on the wings of this species and is a noun in apposition. Distribution. Currently known only from the holotype collected in Ecuador .