Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Cantha zoirodicta Grishin , new species https://zoobank.org/ 7874E2A2-2FE3-45BD-BA94-F363C90CB2CE ( Fig. 6 part, 161–162, 388–390) Definition and diagnosis. Phylogenetic trees reveal that two specimens identified as Cantha zara (E. Bell, 1941) (type locality in Bolivia , holotype sequenced as NVG-18022E02) show prominent genetic differentiation from it ( Fig. 6 ): e.g., their COI barcodes differ by 6.5% (43 bp), and therefore represent a new species. This new species keys to “ Cantha celeus zara ” (I.9.1(b)) in Evans (1955) but differs from it by rounder wings, browner (not reddish) ground color, and yellow framing at outer margins of both wings beneath, in addition to yellow veins. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly 2178.10.1 :C102T, aly363.37.1:A909G, aly363.37.1:T3771G, aly1139.50.8:T279G, aly1139.50.8:T372G, and COI barcode: 67G, T74C, A88T, T508C, A535G, A565G. Barcode sequence of the holotype . Sample NVG-8016, GenBank OR837695, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCATTAAGTTTATTAATTCGGACAGAACTAGGAAATCCTGGTTCTCTTATT GGAGATGATCAAATTTATAATACCATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATT GATTAGTACCCCTAATATTAGGGGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATATTATTAAT TTCAAGAAGAATCGTAGAAAATGGTGCAGGAACTGGATGAACTGTTTATCCTCCTCTTTCATCTAATATTGCCCATCAAGGAGCATCTGTTGATTTA GCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCAT TTGATCAAATACCTTTATTTGTCTGATCAGTTGGTATTACCGCATTATTGTTACTTTTATCTTTACCGGTATTAGCTGGGGCTATTACTATACTTTT AACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTATACCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 161–162 , bears the following seven rectangular labels, six white: [ PERU 300m | 30 Km S. W. | Pto. Maldonado | 8 May ’84 | S. S. Nicolay ], [ ♂ genitalia | slide/vial # | H864 | Prep. S.S. Nicolay ], [ Cantha ♂ | celeus | Det. zara Bell | S.S. Nicolay ], [DNA sample ID: | NVG-8016 | c/o Nick V . Grishin ], [genitalia | NVG170208-01 | Nick V . Grishin ], [USNMENT | { QR Code } | 01321856], and one red [ HOLOTYPE ♂ | Cantha zoirodicta | Grishin ] . Paratype : 1♂ NVG-21046E03 Brazil : Rondonia , 62 km S of Ariquemes, linha C-10, 5 km S of Cacaulandia, 25-Apr-1995 , G. T . Austin leg., genitalia GTA-8707 [ MGCL ]. Type locality. Peru : Madre de Dios Region , 30 km SW of Puerto Maldonado, elevation 300 m . Etymology. The name is a compound word of Greek ζωηρός (zoirós) meaning lively, vivid, or vibrant, and διΚτυωτός (diktyotós) meaning reticulated. The name reflects the bright reticulated pattern of this species and is a noun in apposition. Distribution. Amazonian Peru and Brazil .