Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica Author Chacon, Isidro A. Author Janzen, Daniel H. Author Hallwachs, Winnie text ZooKeys 2014 421 39 63 http://dx.doi.org/10.3897/zookeys.421.6342 journal article http://dx.doi.org/10.3897/zookeys.421.6342 1313-2970-421-39 748B04579F8443E5A165C2CE1A36CE58 748B04579F8443E5A165C2CE1A36CE58 Taxon classification Animalia Lepidoptera Notodontidae Symmerista aura Chacon sp. n. Figs 26-35 Material examined. 4 specimens (2 males, 2 females) Type material. Holotype male: INB0003116415 (dissected, COI barcoded), Costa Rica, Prov. Cartago, Paraiso, P.N. Tapanti, Macizo de La Muerte, Estacion Quebrada Segunda, 9.762583-83.788328, 1300 m, November 2000, R. Delgado (INBio). Paratypes: 1 males, 2 females. Male: INBIOCRI002442681 (COI barcoded), Costa Rica, Prov. Puntarenas, Buenos Aires, Potrero Grande, Estacion Altamira, 1 Km. S del Cerro Biolley, 9.032987-83.010887, 1450 m, 13-26 May 1996, R. Villalobos (INBio). Female: INBIOCRI002549508 (COI barcoded), Costa Rica, Prov. Puntarenas, Coto Brus, Sabalito, Send. El ripario a 3 Km NE. de Progreso, 8.917676-82.78469, 1300 m, 6-9 April 1997, A. Picado (INBio). Female: INBIOCRI002754030 Costa Rica, Prov. Cartago, Turrialba, Tayutic, Moravia de Chirripo Shipiri, 9.837781-83.453639, 1000 m, 10 May 1983, D. H. Janzen & W. Hallwachs (INBio). Etymology. This species is dedicated to Isidro Chacon's daughter, Aura Chacon , for 25 years of understanding an absent father obsessed with his work. Diagnosis. Dorsal FW ground color light gray; a white cream mark from the discal cell to the apex. Male genitalia: St8 anterior margin with a sclerotized triangular projection in the middle, posterior margin sclerotized, irregular, with a rectangular projection at the center bearing two highly sclerotic and sharply serrated structures; proximal part of phallus tube wide and short at the base, with a blade-like lateral projection, sharp at the distal apex; a small rounded projection and curve off the previous, distal part of phallus tube robust, sclerotized, with a small bulge on the ventral side; proximal part of the vesica with a ventral scobinate patch, distal part of the vesica bulbous. Female genitalia: papillae anales ovoid-triangular, setose; posterior apophyses longer and more slender than anterior apophyses; DB sclerotized; CB elongated, membranous and pleated, lacking a signum; margin distal of antevaginalis plate very sclerotized and lightly depressed at the center, concave to the sides, proximal margin convex. The female of Symmerista aura differs from female of Symmerista meridionalis Thiaucourt, 2007 in the shape of the antivaginalis plate; the CB elongated, membranous and pleated, lacking a signum; margin distal of antevaginalis plate very sclerotized and lightly depressed at the center, concave to the sides, proximal margin convex. This is the description of the female genitalia of Symmerista meridionalis published by Thiaucourt in 2007 which mentiones the differences, "Female terminalia: distal edge of lamella postvaginalis slightly incurved; lamella antevaginalis rectangular, almost square; its distal margin strongly sclerotized; mouth of the ostium bursae oval, densely sclerotized under the margin; ductus bursae beyond the constriction under the ostium, forming a short funnel; bursa membranous inserted on the dorsal surface of the extremity of the duct; signum distinct." The male of Symmerista meridionalis is unknown. Description. Male (Figs 26, 27, 30-34) Head - antenna bipectinate, ventral shaft dark brown, dorsal light brown, scape bearing a tuff of beige scales; haustellum vestigial; eye smooth, round, black; front dark brown; labial palpus porrect, dark brown laterally, beige ventrally; patagiun dark brown. Thorax and abdomen - tegula light gray; mesoscutum dark brown anteriorly, light brown and cream posteriorly; mesoscutellum black and gray; thoracic pleuron beige; legs dark brown on outer surfaces, beige on inner ones; abdominal dorsum dark brown, venter beige. Figures 26-29. Symmerista aura 26, 27 Paratype male dorsal and ventral INBIOCRI002442681 28, 29 Paratype female dorsal and ventral INBIOCRI002549508. Figures 30-35. Symmerista aura INB0003116415 30, 31 Holotype male genitalia 32 Phallus 33 Uncus 34 Male St8 35 Paratype female genitalia INBIOCRI002549508. Figure 36. The Symmerista species from Costa Rica in a NJ barcoding tree. ICG01, Symmerista inbioi ; ICG02, Symmerista luisdiegogomezi ; ICG03, Symmerista minaei ; ICG04, Symmerista aura . Wings - Dorsal FW ground color light gray; mark white cream from the discal cell to apex; costal margin beige until R1; subterminal line black; fringe light gray; dorsal HW light gray, fringe cream (Figs 26, 27) (WL 16.26-17.32 mm). Male genitalia (Figs 30-34) - T8 wider than long, posterior margin sclerotized and highly irregular; St8 anterior margin with a sclerotized triangular projection in middle, posterior margin sclerotized, irregular, with a rectangular projection at center bearing two highly sclerotic and sharply serrated structures (Fig. 34). Valvae membranous with saccular margin esclerotized, slightly irregular and setose; costal margin smooth, apex rounded, sclerotized and setose; tegumen with margins very sclerotized, narrowed where both arms intersect; uncus slightly concave plate, with papillae and setae in dorsal and ventral edge, with socii elongate, wide at base, narrowed and flattened at apex with papillae and setae in dorsal part (Figs 30, 31, 33); juxta heart shaped; vinculum membranous slightly sclerotized (Fig. 31); proximal part of phallus tube wide and short in base, with a blade-like lateral projection, sharp at distal apex and a small rounded curved projection, distal part of phallus tube robust, sclerotized, with a small bulge on ventral side; proximal part of vesica with a ventral scobinate patch, distal part of vesica bulbous (Fig. 32). Female (Figs 28, 29, 35) Similar to male: Head - Antenna filiform, antennal shaft light brown with cream scales, scape bearing a long tuft of cream scales; frons and vertex cream; haustellum vestigial; labial palpus mostly cream with black lateral scales. Thorax and abdomen - tegula light gray; mesoscutum dark brown anteriorly, light brown and cream posteriorly; mesoscutellum black and gray; thoracic pleuron beige; legs dark brown on outer surfaces, beige on inner ones; abdominal dorsum dark brown, venter beige. Wings - Dorsal FW ground color light gray; mark white cream from the discal cell to apex; costal margin beige until R1; subterminal line black; fringe light gray; dorsal HW light gray, fringe cream (Figs 28, 29) (WL 20.22-21.51 mm). Female genitalia (Fig. 35) - papillae anales ovoid triangular, setose; posterior apophyses longer and more slender than anterior apophyses; DB sclerotized; CB elongated, membranous and pleated, lacking signum; margin distal of antevaginalis plate very sclerotized and lightly depressed at center, concave to sides, proximal margin convex. Distribution and habitat. In Costa Rica, Symmerista aura has been collected between 1000 to 1400 m on both slopes of the Cordillera de Talamanca (Talamanca Mountain Range) (Fig. 49). Remarks. DNA barcode paratype male INB0003116415. MHMXP017-08 | INB0003116415 | Symmerista aura | COI-5P: ACATTATATTTTATTTTTGGGGTTTGAGCTGGGATAGTTGGAACTTCCCTAAGTTTACTAATTCGAGCTGAATTGGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCACCATAATCGGGGGATTTGGTAATTGACTAGTTCCTCTTATATTAGGGGCACCGGATATAGCATTTCCACGTATAAATAACATAAGTTTTTGACTTCTACCCCCTTCTTTAACCCTTTTAATTTCAAGAAGAATTGTCGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCATTGTCATCTAATATTGCTCATGGTGGTAGTTCCGTAGATTTAGCTATTTTTTCACTTCATTTAGTGGAATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACAATCATTAATATACGTCTTAATAATATATCTTTTGACCAAATACCTTTATTTGTGTGAGCTGTAGGGATTACAGCATTTTTACTTTTACTTTCTTTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGTAATCTAAACACATCTTTTTTTGATCCCGCTGGAGGAGGAGATCCTATTTTATAC