Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) Author Tedersoo, Leho Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Magurno, Franco 0000-0002-3117-8149 Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland Author Alkahtani, Saad 0000-0001-7381-5110 Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Mikryukov, Vladimir 0000-0003-2786-2690 Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia text MycoKeys 2024 2024-08-09 107 249 271 journal article 10.3897/mycokeys.107.125549 Riederberga sylviae Tedersoo sp. nov. Diagnosis. Separation from other species of Riederberga based on the ITS region (ITS 2 positions 186–215 gctttggacggcatgcgaatctgcatcaca; one mismatch allowed) and LSU (positions 656–685 tcaccaatcgacgtcaatcggcatgcgtct; one mismatch allowed) as indicated in Fig. 14 . Figure 14. Diagnostic barcodes for Riederberga sylviae relative to closely-related taxa in ITS 2 and LSU. Type. Soil eDNA sample TUE 128372 ( holotype ); eDNA sequence: EUK 1602903 ( lectotype ); GSMc plot G 5783, wet grassland (soil sample TUE 028372 ) in Altnurga , Estonia , 58.55682 ° N , 26.29259 ° E . Description. Other sequences: EUK 1604046 and EUK 1604047 (both type locality); and GU 055683 ( ITS part considered; managed grassland soil in Riederberg, Austria , 48.25 ° N , 16.07 ° E ), collected by Sylvia Klaubauf ( Klaubauf et al. 2010 ). Etymology. Riederberg (German) refers to type locality; and Sylvia (German) refers to the first name of Sylvia Klaubauf, who first collected the materials of type species and the entire order from the type habitat. Notes. Found in Austria and Estonia , with ITS and LSU sequences displaying up to 1 % differences.