Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Alychna ayonis Grishin , new species https://zoobank.org/ 050EC67D-FC69-4005-B871-A861C7D74835 ( Fig. 5 part, 107–108, 334–335) Definition and diagnosis. Phylogenetic trees reveal that specimens from Ecuador and Peru identified as Alychna exclamationis (Mabille, 1898) (type locality in Bolivia , lectotype sequenced as NVG-18042G08) show prominent genetic differentiation from it while being its sister ( Fig. 5 ): e.g., their COI barcodes differ by 1.5% (10 bp) and, therefore, represent a new species, more distantly related to Alychna zenus (E. Bell, 1942) (type locality in Ecuador ) (COI barcodes differ by 3.5%, 23 bp). This new species keys to “ Psoralis exclamationis ” (J.43.3) in Evans (1955) but differs from it by narrower stigma, narrower white spots and streaks on forewing, a semi-circle of discal pale dots on ventral hindwing ( Fig. 107–108 ), undivided uncus, harpe strongly upcurved and protruding beyond ampulla dorsad, terminally rounded in lateral view and plate-like in dorsal view, costa-ampulla with a bump closer to ampulla, concave on both sides of the bump ( Fig. 334–335 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly420.62.5:G73T, aly420.62.5:G84A, aly 2041.8.2 :A195C, aly2012.47.1:G1269C, aly25.10.1:G48C, and COI barcode: A85T, T163A, T169A, T205A, A553C, A631G. Barcode sequence of the holotype . Sample NVG-22035H07, GenBank OR837672, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATACTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTAGGAAATCCTGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCCTTAATATTATTAAT TTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTATCCCCCCCTTTCTTCTAATATCGCACACCAAGGATCATCTGTTGATTTA GCAATTTTTTCTTTACATTTAGCTGGGATCTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATATCCT TTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCCGTATTAGCTGGAGCTATTACAATACTTTT AACTGATCGAAACTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGGGACCCTATCTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 107–108 , bears the following three rectangular labels, two white: [ ECUADOR Napo | Papallacta 2800m | 23 Sept. ’87 | S. S. Nicolay ], [DNA sample ID: | NVG-22035H07 | c/o Nick V . Grishin ], and one red [ HOLOTYPE ♂ | Alychna | ayonis Grishin ] . Paratype : 1♂ NVG-19021H01 the same data as the holotype but collected on 17-Sep-1987 , genitalia H962 by S. S. Nicolay [ USNM ]. Type locality. Ecuador : Napo Province , Papallacta, elevation 2800 m . Etymology. The name is given for the “i” on the forewing. A close relative of this species is named exclamati- onis , probably for the exclamation mark pattern on the forewing. In the new species, the exclamation mark is thinner and resembles the letter “i” [ ay ]. The name is treated as a noun in apposition. Distribution. Currently known only from the type locality in Napo , Ecuador .