Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Spioniades artemidoides Grishin , new species https://zoobank.org/ 85986CDE-04A2-42E3-BD64-178DD5DB5583 ( Fig. 2 part, 59–60, 271–273) Definition and diagnosis. Phylogenetic analysis reveals that a specimen from Southern Brazil identified as Spioniades artemides (Stoll, 1782) ( type locality in Suriname ) is genetically differentiated from it ( Fig. 2 ): e.g., their COI barcodes differ by 5.0% (33 bp), and therefore represent a new species. This new species keys to S. artemides (E.14.2) in Evans (1953) and differs from it and S. artemis new species by the following combination of characters: the irregular, wavy, and sharp border between discal brown and postdiscal white area on the hindwing, frequent expression of pale diffuse spot(s) towards inner margin and tornus of the ventral forewing ( Fig. 59–60 ), less robust uncus in lateral view, broader in dorsal view, shallowly divided harpe with slightly concave distal margin in lateral view and protruding deeper inward in dorsal view, nearly straight with a broader knob-like process that protrudes less inward ( Fig. 271–273 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly251.4.1:G89A, aly6370.13.3:C61T, aly15220.10.2:C66T, aly2012.51.1:T768G, aly336.2.3:A52T, aly4333.9.1:C60C (not T), aly 1113.5.5 :T45T (not A), aly 1456.5.1 :T1015T (not A), aly 1456.5.1 :T1044T (not C), aly1139.42.1:C66C (not T), and COI barcode: T70C, T91A, T178C, T202C, T226C, A379G. Barcode sequence of the holotype . Sample NVG-19088B05, GenBank OR837648, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGTTTACTAATTCGAACCGAATTAGGAAATCCTGGAGCACTTATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAATT GATTAATCCCATTAATGCTAGGGGCCCCTGACATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATACTTTTGAT TTCTAGTAGTATTGTTGAAAATGGGGCAGGTACTGGTTGAACAGTTTATCCCCCTCTTTCAGCTAATATTGCACATCAAGGATCTTCGGTTGATTTA GCAATTTTTTCTTTACATCTTGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTTCTACAATTATTAATATACGAATTAGAAATCTTTCAT TTGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACTGCTTTACTTTTATTATTATCTTTACCAGTATTAGCTGGTGCTATTACTATACTTTT AACTGACCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington , DC , USA ( USNM ), illustrated in Fig. 59–60 , bears the following four rectangular labels, three white: [ Brasil : Santa Catarina | Joinville: 10–200 m | 16 Feb. 1991 | Leg. H. Miers], [DNA sample ID: | NVG-19088B05 | c/o Nick V . Grishin], [USNMENT | {QR Code} | 01588918], and one red [ HOLOTYPE ♂ | Spioniades | artemidoides Grishin ]. Type locality. Brazil : Santa Catarina, Joinville. Etymology. The name is formed from its sister species name and is a noun in apposition. From north to south, short to long, we get artemis , artemides , and artemidoides . Distribution. Currently known only from Southern Brazil .