Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Eutus incus Grishin , new species https://zoobank.org/ 9ACA4D61-7A97-46AC-A262-E1DBD30EC6D2 ( Fig. 5 part, 121–122, 353–354) Definition and diagnosis. Phylogenetic trees reveal that a specimen from the Cosñipata Valley in Peru that was superficially similar to Eutus amazonicus new species is genetically differentiated from it ( Fig. 5 ): e.g., their COI barcodes differ by 6.5% (43 bp) and, therefore, represents a new species. This new species is similar to Eutus amazonicus new species and differs from it by having a larger brand at the base of forewing cell CuA 1 -CuA 2 , larger hyaline spots, smaller ventral hindwing tornal pale area, and larger (although still small, dot-like) yellowish spots on ventral hindwing. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly85.15.2:A144C, aly349.15.2:A54G, aly1468.20.2:T507C, aly18826.15.1:T129C, aly1432.18.2:A42G, aly1656.16.2:A48A (not C), aly1656.16.2:A63A (not G), aly4456.8.2:C72C (not T), aly425.14.6:C90C (not T), aly517.17.2:C372C (not G), and COI barcode: T10C, A34G, T112C, T223A, T499C. Barcode sequence of the holotype . Sample NVG-19023C07, GenBank OR837679, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGAGCAGGGATATTAGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAGGAAATCCAGGCTCTTTAATT GGAGATGATCAAATCTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTTCCTTTAATATTAGGGGCCCCAGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTACCTCCTTCTTTATTTTTATTAAT CTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCTCTATCTTCTAATATTGCCCACCAAGGATCCTCTGTTGATTTA GCAATTTTTTCCTTACATTTAGCAGGAATTTCATCCATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATATCAT TTGATCAAATACCCTTATTTGTTTGATCTGTAGGTATTACTGCTTTATTATTACTTTTATCTTTGCCCGTATTAGCTGGAGCTATTACTATACTTTT AACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 121–122 , bears the following four rectangular labels, three white: [ PERU : Cuzco : Cosñipata Valley | Quebrada Quitacalzón 1,050m . | 13° 01′ 13″S , 71° 29′ 50″W | 12 August 2009 Brian Harris ], [DNA sample ID: | NVG-19023C07 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01532830], and one red [ HOLOTYPE ♂ | Eutus incus | Grishin ]. Type locality. Peru : Cuzco Region , Cosñipata Valley, Quebrada Quitacalzón, elevation 1050 m , GPS −13.020278 , −71.497222 . Etymology. The name is for the type locality in Cuzco , the center of the Inca Empire. The name is a noun in apposition. Distribution. Currently known only from the holotype collected in Cosñipata Valley, Peru .