Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Rectava chiriquensis Grishin , new species https://zoobank.org/ B38D4A96-FE18-495F-9423-AB1EC92348CD ( Fig. 6 part, 151–152, 377–379) Definition and diagnosis. Phylogenetic trees reveal that a specimen from Panama identified as Rectava sobrinus Schaus, 1902 ( type locality Brazil : Rio de Janeiro ) shows prominent genetic differentiation from it ( Fig. 6 ): e.g., their COI barcodes differ by 3.8% (25 bp), and therefore represents a new species. This new species keys to “ Papias sobrinus ” (J.36.2) in Evans (1955) but differs from similar-looking species by more expressed pale overscaling on somewhat darker ventral wing distal areas, smaller but visible pale spots between veins in most cells on ventral hindwing ( Fig. 152 ), harpe shorter, its ventral margin rounder and less extended in lateral view, dorsal margin with a tooth projecting dorsad and separated from ampulla, costa only slightly concave ( Fig. 377–379 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly499.36.11:A168G, aly 2680.6.3 :A79T, aly 2680.6.3 :C80A, aly113.6.1:G3177C, aly357.1.11:A96G, aly7186.4.1:A787A (not T), aly173.79.3:C261C (not T), aly88.15.4:C31C (not T), aly423.11.2:G129G (not A), aly529.34.2:A18A (not G), and COI barcode: T38C, T49C, A286G, T499A, T574C. Barcode sequence of the holotype . Sample NVG-19019H03, GenBank OR837690, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCCGGAATACTAGGTACATCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATCATTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTCTGAATACTTCCCCCTTCCTTAATATTGTTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGCACTGGTTGAACTGTTTATCCCCCCCTTTCTTCTAATATTGCACATCAAGGAGCTTCAGTCGATCTA GCAATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAACTTTATCACCACAATTATTAATATACGAATTATAAATTTATCAT TTGATCAAATACCATTATTTGTTTGATCAGTTGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCTGGTGCTATTACCATACTCTT AACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 151–152 , bears the following six rectangular labels, five white: [Volcan | Chiriqui , Panama | 18 April ’73 | S. S. Nicolay ], [ ♂ genitalia | slide/vial # | H569 | Prep. S.S. Nicolay ], [ Papias ♂ | sobrinus | Schs | DET. BY S.S. NICOLAY], [DNA sample ID: | NVG-19019H03 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01532625], and one red [ HOLOTYPE ♂ | Rectava chiriquensis | Grishin ]. Type locality. Panama : Chiriquí Province , Volcán. Etymology. The name is given for the type locality and is a feminine adjective. Distribution. Currently known only from the holotype collected in Chiriquí Province , Panama . This is the only Rectava species known from Central America.