Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae) Author D’Acoz, Cédric D’Udekem Author Havermans, Charlotte text Zootaxa 2015 3971 1 1 80 journal article 10.11646/zootaxa.3971.1.1 28ab0d98-ed65-4875-af05-94c47f4c6d8f 1175-5326 288816 61D379B9-D9BA-41FB-B6A9-57BF87131B42 Eurythenes maldoror sp. nov. ( Figs 33–45 ) Eurythenes gryllus clade Eg3.— Havermans et al ., 2013 : 12–13, fig. 5 (1B)(2B)(3C)(4B)(6B)(8B)(9B)(10B)(11B) (12B)(14B)(15B), table 4. Material examined. HOLOTYPE . RV Meteor, expedition ME 79-1, DIVA 3, Argentine Basin, sta. 531, 35°56.50’S 48°53.90’W , amphipod trap, 4605.2 m , 15.vii.2009 : 1 adult male, 100 mm , HOLOTYPE , partly dissected (dissected parts in alcohol), fixed first 96% denatured ethanol, coll. Ed Hendrycks, DZMB-HH 8048, ZMH K 44280 ; ArgB-7, EG-1810111, JX887151 ( COI ), JX887069 (16S). PARATYPES . Same station as holotype : 1 immature specimen (illustrated in detail), sex unknown, 41 mm , sample 1, ZMH K 44281 ; EG- 21012010 -12 (sequencing failed).—Same station: 1 immature specimen, previously dissected, sample 2, ZMH K 44282 .—Same station: 1 immature specimen, sample 3, ZMH K 44283 .—Same station: 1 immature specimen, sample 4, ZMH K 44284 , ArgB-1, EG-1102101, JX887121 ( COI ), JX887105 (28S), JX887067 (16S).—Same station: 30 immature specimens, sample 5, ZMH K 44285 .—Same station: 5 immature specimens, sample 6, CMNC 2014-0099.—RV Polarstern, expedition PS61, ANT-XIX/4, ANDEEP II, sta. 131-1, East of Antarctic Peninsula, 65°17'S 51°35'W , 3070 m , 08.iii.2002 , baited traps M16, M17, MP10, MP35: 2 immature specimens, sample 7, RBINS , INV . 122791 ; Ant-a3, EG-0112102, JX887123 ( COI ), JX887103 (28S), JX887067 (16S); Ant-a4, EG-P3049, GU109270 ( COI ), JX887104 (28S), JX887067 (16S).—RV Polarstern, expedition PS67, ANT-XXII/3, ANDEEP III, Eastern Weddell Sea, sta. 59-1/59-15, 67°30'00"S 00°00'06"E to 67°30'03"S 00°00'02"E , 4625 m , baited trap, 14–16.ii.2005 : 2 immature specimens, sample 8, RBINS , INV . 122792 ; not sequenced, previously mixed with 7 E. andhakarae .—ANT-XXII/3, sta. 110-1/110-9, 64°56'21"S 43°08'01"W to 64°56'26"S 43°08'07"W , 4693–4696 m , baited trap 09–10.iii.2005 : 1 immature specimen, sample 9, RBINS , INV . 122793 ; not sequenced. Voucher DNA sequences. Holotype , ArgB-7, EG-1810111. COI (GenBANK JX887151 ): GACCTTATACTTCGTCTTAGGTGCCTGAGCTAGGGTCGTCGGCACATCTCTTAGTGTAATTATTCGATCT GAACTCAGTAGACCGGGAAACCTAATTGGAGATGATCAGGTCTATAACGTGATAGTAACTGCCCACGC CTTTGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGCGGTTTTGGAAATTGACTAGTCCCCCTTAT ACTTGGGAGCCCCGACATAGCTTTCCCGCGCATAAACAACATAAGATTCTGACTACTACCCCCCTCAC TAACCTTATTACTAATAAGAGGCCTAGTAGAAAGGGGGGTAGGAACTGGTTGAACCGTTTACCCTCCC TTAGCCGCAGCCGCAGCCCACAGTGGGGGATCTGTTGACCTGGCGATCTTCTCTCTCCACCTAGCAGG TGCTTCTTCCATTTTAGGTGCCATCAATTTTATCTCCACTGTAATTAACATACGAACCCCTGGTATATATA TAGACCGAGTGCCCTTATTTGTCTGGTCCGTCTTCATCACAGCCATTCTGCTCCTCTTATCTCTACCTGT ACTAGCTGGTGCAATTACCATACTCCTAACAGACCGAAATCTAAATACTTCCTTCTTCGATCCTAGGGG TGGAGGTGACCCTATCCTTTACCAACACCTATTC 28S (GenBANK JX887069 ): TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACC GTGCTAAGGTAGCATAGTCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAGGATAGT GTCTTTGTTTTAAATTTGTAATTTATAACAAGAGTAAAAATACTCTGGTGTGATTAAGGGACGACAAGA CCCTAAAAGCTTTATTTTTAAGATAAGTTTGAGTTTAATATAGAATAGAGAGTTTAACTGGGGTAGTTTT TTTGTAAAATCTGAGGTTGTAAAAGGCATGTAAAGTGGGGTTAGGTCCTTTAGATAAGGATAATTTGA GTGAGTTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCT CGATGTTGAATTAAAAGATCAGTGTAGAGCAGGAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATT TTTA Type locality. NW of Argentinian Basin, off Argentina , not far from the maritime border between Argentina and Uruguay , 35°56.50’S 048°53.90’W , 4605 m . Etymology. Maldoror , ghastly character of the tale ‘Les Chants de Maldoror’ by Lautréamont, nom de plume of Isidore Lucien Ducasse (French poet born in Uruguay , 04.04.1846 – 24.11.1870 ). Maldoror is a phonetic transposition of ‘mal d’aurore’, which can be translated as ‘pain of the dawn’ or even 'pain caused by the glow of dawn'. This name has been coined bearing in mind that this species thrives at great depths where sunlight is absent. The name is a noun in apposition. Description. If not specified, the description applies both to the 100 mm male holotype and to the 41 mm immature paratype examined and dissected. Body : pleosomite 3 with anterior concavity; other pleosomites and pereonites without anterior concavity. Head : anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards. Mandible : article 2 of palp strongly expanded posteriorly and strongly tapering distally. Maxilliped : inner plate with 8–9 (adult holotype ) or 3 (immature) nodular spines, which are not protruding. Gnathopod 1 : coxa very weakly concave anteriorly; basis narrow, 3.3 x as long as wide; palm well developed, slightly but distinctly produced. Gnathopod 2 : coxa narrow and strongly curved ventrally; propodus elongate and not expanded distally in holotype , much broader and flaring in immature, 2.8 (immature) to 5.2 (adult) x as long as wide, palm slightly curved and transverse, defined by 2 spines only, both in immature and in adult holotype . Pereopod 3 : coxa narrow, 2.0 (immature) to 2.2 (adult holotype ) x as deep as wide; basis slender, 3.2 (immature) to 3.8 (adult holotype ) x as long as wide; propodus slender, 4.9 (immature) to 6.5 (adult) x as long as wide; dactylus slender. Pereopod 4 : coxa narrow, 1.3 x as deep as wide; junction between anterior and ventral border rounded, indistinct (adult holotype ) or nearly indistinct (immature); ventral border distinctly curved; posteroventral border very weakly concave (adult holotype ) or straight (immature), scarcely oblique; leg almost identical with pereopod 3. FIGURE 33. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m, ZMH K 44280 . A, habitus; B, head. Photograph and copyright, Matthias Schneider, Senckenberg Research Institute. Scale bars: 10 mm. Pereopod 5 : basis with posterior border weakly crenulated (immature) or completely smooth (adult holotype ); merus broad, 1.9 x as long as wide, with posterior border forming a regular curve; propodus slender, 6.1 (immature) to 8.3 (adult holotype ) x as long as wide, with 9 (immature) to 13 (adult holotype ) groups of spines anteriorly; dactylus slender. Pereopod 6 : basis with posterior border scarcely crenulated (crenulation especially faint, scarcely distinct in adult); merus broad, 1.7 (immature) to 1.9 (adult) x as long as wide, with posterior border extremely convex, becoming less convex near its distal end; propodus slender, 6.6 (immature) to 8.5 (adult holotype ) x as long as wide; with 10 (immature) to 11 (adult holotype ) groups of spines anteriorly; dactylus slender. Pereopod 7 : basis elongate, with posterior border weakly expanded, with posterior border scarcely crenulated (crenulation especially faint, scarcely distinct in adult), with ornamentation of anterior border reduced (especially in adult holotype : just a few setae and no spines), 1.6 x as long as wide; with posterodistal corner of lobe scarcely produced and rounded (with very weak trace of angular discontinuity) in adult holotype ), regularly rounded in immatures, ratio length of lobe of basis / total length of basis = 0.21 (immature) to 0.25 (adult holotype ); merus stout, 1.7 (adult holotype ) to 1.8 x as long as wide, with posterior border forming a regular curve (very convex in adult holotype ); propodus slender, 5.7 (immature) to 6.8 (adult) x as long as wide, with 9 (immature) to 11 (adult holotype ) groups of spines anteriorly; dactylus slender. FIGURE 34. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . Habitus (pereopods leveled). FIGURE 35. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . A, head with appendages; B, upper lip; C, lower lip; D, left Md; E, right Md; F, left Mx1 (palp not flattened); G, idem (tip of palp, not flattened); H, Mx2. FIGURE 36. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . A, Mxp; B, tip of inner plates of Mxp. Epimeron 3 : straight ventrally (adult holotype ) or scarcely curved (immatures), without small posteroventral tooth in specimens between 25 and 35 mm . FIGURE 37. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . A, left Gn1; B, chela of left Gn1; C, left Gn2; D, propodus of left Gn2; E, chela of left Gn2 (lateral view); F, idem (medial view). FIGURE 38. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . A, left P3; B, propodus and dactylus of left P3; C, left P4; D, telson. FIGURE 39. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . A, right P5; B, right P6; C, right P7; D, tip of propodus of right P7. FIGURE 40. Eurythenes maldoror n. sp. , adult male, holotype, 100 mm. RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m), ZMH K 44280 . A, pleosome; B, left Ep1; C, left Ep2; D, left Ep3; E, left U1; F, left U2; G, left U3; H, peduncle of left U3, ventral view. FIGURE 41. Eurythenes maldoror n. sp. , immature paratype, sex unknown, 41 mm, RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m, ZMH K 44281 . A, head; B, left Md; C, right Md; D, right Mx1; E, inner plates of Mxp. FIGURE 42. Eurythenes maldoror n. sp. , immature paratype, sex unknown, 41 mm, ZMH K 44281 . RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m. A, left Gn1; B, chela of left Gn1; C, left Gn2; D, propodus and dactylus of left Gn2; E, chela of left Gn2 (lateral view); F, chela of left Gn2 (medial view). FIGURE 43. Eurythenes maldoror n. sp. , immature paratype, sex unknown, 41 mm, ZMH K 44281 . RV Meteor, expedition ME 79-1, DIVA 3, sta. 531, 35°56.50’S 048°53.90’W, 4605 m. A, left P3; B, left P4. Uropod 3 : spines of distolateral angle of peduncle rather long and very slender. Colour pattern. The holotype was entirely pink, with the pigmentation more intense on the posterior margin of body segments, on the margins of coxae, on antennae, mouthparts, the tips of pereopods and uropods. Eye pale yellow. Size. Up to 100 mm ( holotype ). Distribution and depth range. Specimens examined were collected in the Weddell Sea and in the north of the Argentinian basin, between 3076–4693 m . DNA sequences of GenBank suggests that the species is also widely distributed in the North Atlantic and the North Pacific ( Havermans et al. 2013 ) and can descend down to 5117 m depth. A photograph accessible at: http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ Amphipod%20-%20MDSC0728.jpg [accessed on 28.01.2013 ] possibly shows a specimen of E. maldoror sp. nov. The sampling locality of this specimen is the Peru – Chile Trench, 04°27.016’S 81°54.719’W , at 5329 m (Kilgallen, pers. comm.). Biology. E. maldoror sp. nov. is a scavenger, which enters baited traps, albeit not in large numbers. With the exception of one adult male, all specimens examined by us were immature, which suggests some kind of biological segregation of size classes. Remarks. Unlike several other Eurythenes species, E. maldoror sp. nov. exhibits a very clear-cut diagnostic character separating it a first glance from similar species described so far. Indeed whilst other Eurythenes of the gryllus -complex have coxa 2 ventrally broadened and weakly convex, in E. maldoror sp. nov. the same structure is ventrally narrow and strongly convex.