Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Staphylus ( Staphylus ) yucatanus Grishin , new species https://zoobank.org/ E2DA1C62-273A-4640-8B7D-FE16B5FBE315 ( Fig. 3 part, 81–82, 300–301) Definition and diagnosis. Phylogenetic analysis reveals that specimens from the Yucatan peninsula in Mexico identified as Staphylus ascalaphus (Staudinger, 1876) (type locality in Panama : Panama , lectotype sequenced as NVG-15033F12) or Staphylus lenis Steinhauser, 1989 (type locality in Trinidad ) are not monophyletic with either S. ascalaphus or S. lenis and instead form a separate clade that is sister to the clade of three species: S. ascalaphus , Staphylus unicornis Steinhauser and Austin, 1993 (type locality in Costa Rica , holotype sequenced as NVG-15039F08), and Staphylus mazans (Reakirt, [1867]) (type locality in Mexico : Veracruz ) and is genetically differentiated from them ( Fig. 3 ). Therefore, the Yucatecan specimens represent a new species. The four species (the new one, S. ascalaphus , S. unicornis and S. mazans ) are closely related to each other and possess nearly identical DNA barcodes (0–5 bp difference) but are considered distinct due to differences in genitalia ( Steinhauser and Austin 1993 ). This new species keys to “ Staphylus ascaphalus ” [sic!] (E.32.20(d)) in Evans (1953) and differs from it and other relatives by the following combination of characters: valva without prominent expansion directed dorsad between valva and harpe, but with a small (shorter than bristles), plate-like triangular, tooth-shaped lobe armed with three socketed bristles at its base, harpe more elongated than in relatives, terminally rounded, valva near the base of harpe and harpe towards dorsal margin armed on the outer surface with two to three dozen of long (length of harpe), medium-sized (~1/2 of long), and short (~1/4 of long) socketed bristles ( Fig. 300–301 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly419.1.7:G960A, aly 1222.1.15 :G494A, aly276558.8.2:C64T, aly1651.33.11:T222A, aly 2555.6.3 :G64C, and COI barcode: T67C, A160G, C238C. Barcode sequence of the holotype . Sample NVG-18058G01, GenBank OR837659, 658 base pairs: AACTTTATATTTTATCTTTGGTATTTGATCTGGAATAGTAGGAACTTCTTTAAGTATTCTTATTCGCTCTGAATTAGGAACTCCTGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGTTTTGGAAATT GACTTGTTCCTCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATACTTTTAAT TTCAAGTAGAATCGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCCCCCCTTTCAGCTAACATTGCCCATCAAGGTTCTTCTGTAGATTTA GCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCCT TTGATCAAATACCCTTATTTGTTTGAGCAGTTGGAATTACAGCATTATTATTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATACTTTT AACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTC Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 81–82 , bears the following seven rectangular labels, six white: [Near Xcan, Quin- | tana Roo – Yuca- | tan border, | MEXICO | May 19-23, 1959 | T . C. Emmel ], [ ♂ genitalia | slide/vial # | H169 | Prep. S.S. Nicolay ], [ Staphylus ♂ | m.ascalaphus | Det. Stgr. | S. S. Nicolay ], [ Staphylus | lenis ♂ | Steinhauser | det. H.A. Freeman ], [DNA sample ID: | NVG-18058G01 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01466735], and one red [ HOLOTYPE ♂ | Staphylus | yucatanus Grishin ] . Paratypes : 2♂♂ from Mexico : NVG-18058F02, USNMENT_01466724 Campeche , 40 km E of Escarcega , 3–4-May-1959 , T . C. Emmel leg. [ USNM ] ; and NVG-20063A08 Qintana Roo , Nuevo X-Can 25-Nov-1978 ECW leg., genitalia H-1271 H. A. Freeman ( Fig. 300–301 ) [ CSUC ] . Type locality. Mexico : Quintana Roo – Yucatan border, near X-Can. Etymology. The name is for the distribution in the Yucatan peninsula and is a noun in apposition. Distribution. Currently known only from the Yucatan peninsula in Mexico .