Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Cantha meiodicta Grishin , new species https://zoobank.org/ 7756C17B-E4A5-42D2-B809-ECD97BC3EA77 ( Fig. 6 part, 163–164, 391–393) Definition and diagnosis. Phylogenetic trees reveal that several specimens identified as Phlebodes eteocla ( Plötz, 1882 ) or Phlebodes virgo Evans, 1955 are not closely related to these species and instead are conspecific, belong to Cantha Evans, 1955 (type species Cantha celeus calva Evans, 1955 ), and are a distant sister to Cantha zoirodicta new species ( Fig. 6 ): e.g., their COI barcodes differ by 5.9% (39 bp), and therefore represent a new species. This new species is similar to C. zoirodicta new species but the hindwings are more pointed at the tornus, the amount of yellow framing of margins and veins beneath is reduced, and yellow spots are smaller, especially on the dorsal hindwing, which is completely unspotted in the holotype . This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly 1935.7.3 :G30C, aly 1935.7.3 :G87A, aly 1497.7.1 :A1020T, aly103.32.1:T650A, aly103.32.1:A681G, and COI barcode: A34T, A67T, T124C, A184G, A256T, T517C. Barcode sequence of the holotype . Sample NVG-19024C02, GenBank OR837696, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGAACATCATTAAGTTTATTAATTCGTACTGAATTAGGAAATCCTGGATCTCTTATT GGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGGAATT GATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAACATAAGTTTTTGAATATTACCTCCTTCTTTAATATTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTTTATCCTCCTCTTTCTTCTAATATTGCTCACCAAGGTTCATCTGTTGATCTA GCAATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCAT TCGACCAAATACCTTTATTTGTTTGATCAGTCGGAATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTT AACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Type material. Holotype : currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 163–164 , bears the following seven rectangular labels, six white: [ PERU 300m | 30 Km S. W. | Pto. Maldonado | 8 May ’84 | S. S. Nicolay ], [ genitalia | slide/vial # | H880 | Prep. S.S. Nicolay ], [ Phlebodes | eteocla | Det. | S.S. Nicolay ], [ Parphorus sp. n. ], [DNA sample ID: | NVG-19024C02 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01532910], and one red [ HOLOTYPE | Cantha meiodicta | Grishin ] . Paratypes : 2♂♂ NVG-19019B09, USNMENT_01532561 the same data as the holotype but 17-Oct-1983 and not dissected and NVG-21048C09 Brazil : Rondônia , 62 km S of Ariquemes, linha C-10, 5 km S of Cacaulandia, 10-Jul-1993 , O. Gomes leg., genitalia GTA-3649 [ MGCL ]. Type locality. Peru : Madre de Dios Region , 30 km SW of Puerto Maldonado, elevation 300 m . Etymology. The name is a compound word of Greek μειώ (meió) meaning reduce, decrease, or lessen, and διΚτυωτός (diktyotós) meaning reticulated. The name points to less contrasting lattice patterns compared to the previous species and is a noun in apposition. Distribution. Amazonian Peru and Brazil .