Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Perichares fura Grishin , new species https://zoobank.org/ 2FD4A73B-7AC8-4B32-BC27-CB0F8F5FE674 ( Fig. 8 part, 215–216, 456–458) Definition and diagnosis. Phylogenetic trees reveal that specimens from Ecuador identified as Perichares furcata (Mabille, 1891) ( type locality in Brazil : São Paulo ) are not monophyletic with it and show prominent genetic differentiation from it ( Fig. 8 ): e.g., their COI barcodes differ by 6.7% (44 bp), and therefore represent a new species. This new species is a distant sister to Perichares lotus (A. Butler, 1870) ( type locality in Venezuela ), differing from it by 4.9% (32 bp) in COI barcode, but has remarkably different ventral wing pattern, being nearly identical to Perichares furcata instead. This new species keys to “ Alera furcata ” (K.32.3) in Evans (1955) but differs from it by a brown spot in the humeral area of ventral hindwing that is missing in P.furcata and a more diffuse boundary between the darker discal forewing area and paler apex, particularly towards costa that is rather sharp in P. furcata . Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.25.7:G450T, aly15656.2.3:G461A, aly275209.10.4:C66G, aly173.49.2:C33T, aly2012.16.4:T135A, and COI barcode: T55A, T241C, T250C, T394C, T484C. Barcode sequence of the holotype . Sample NVG-18014F08, GenBank OR837721, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACATCTCTAAGATTATTAATTCGTACTGAATTAGGAAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATT GACTTGTCCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGCATAAATAACATAAGATTTTGAATATTACCCCCATCATTAACTCTTTTAAT TTCAAGAAGAATCGTTGAAAACGGTGCTGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATCAAGGATCTTCAGTTGATTTA GCAATCTTTTCCCTTCATTTAGCAGGAATTTCCTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTATAAATTTATCCT TTGACCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCCTTATTATTACTACTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTCT TACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype : ♀ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC , USA ( USNM ), illustrated in Fig. 215–216 , bears the following five rectangular labels, four white: [Alluriquin 700 m | PICHINCHA ECUADOR | 14 Sept. ’76 | S. S. Nicolay ], [ Perichares | lotus ♀ | Det. Btlr. | S.S. Nicolay ], [DNA sample ID: | NVG-18014F08 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01450684], and one red [ HOLOTYPE ♀ | Perichares | fura Grishin ] . Paratype : 1♀ NVG-18014F07, USNMENT_01450683 Ecuador : Pichincha , 10 mi E of Santo Domingo de los Colovados, Tinalandia Grounds/Trails, 16–21-Apr-1984 , Brian Harris leg. [ USNM ]. Type locality. Ecuador : Pichincha , Alluriquin, elevation 700 m . Etymology. The name reflects a strong superficial similarity to Perichares furcata (Mabille, 1891) but does not reflect a close relationship. The name is a non-Latinized noun in apposition. Distribution. Currently known only from Pichincha Province , Ecuador .