Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Thespieus mandal Grishin , new species https://zoobank.org/ BA7D773F-A815-4251-B153-DC7B3CAC5B13 ( Fig. 4 part, 103–104, 328–329) Definition and diagnosis. Phylogenetic analysis of a specimen from Rio de Janeiro , Brazil , identified as Thespieus dalman (Latreille, [1824]) (type locality in Brazil , lectotype sequenced as NVG-18078F01) reveals its strong genetic differentiation ( Fig. 4 ): e.g., COI barcode difference of 3.8% (25 bp) from T. dalman , and therefore it represents a new species. This new species keys to T. dalman (O.7.4) in Evans (1955) but differs from it by a generally narrower hyaline spot in the forewing discal cell but wider spot in the hindwing cell CuA 1 -CuA 2 , which is framed by a smaller and paler brown spot at the base of this cell on the ventral side, which has no brown discal dash in cell Sc+R 1 -RS, and exhibits paler basal area in cell 1A+2A-3A ( Fig. 103–104 ), harpe wider, protrudes dorsad farther than ampulla, more concave along the distal margin, saccus stronger bowed ventrad ( Fig. 328–329 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly168.8.1:G313A, aly 2517.1.2 :T285C, aly3905.3.3:A99C, aly971.11.1:A75G, aly3268.8.1:T840C, aly10226.17.4:A204A (not C), aly320.37.1:G189G (not A), aly1656.14.1:C411C (not T), aly594.20.16:C67C (not A), aly 1651.3.5 :A72A (not T), and COI barcode: T50C, T133C, T340C, T352C, A379C, T640C. Barcode sequence of the holotype . Sample NVG-18012A11, GenBank OR837670, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCACTAAGATTACTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCTCCCTCTTTAACATTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCCTTATCCTCTAATATTGCTCATCAAGGATCTTCCGTAGATTTA GCAATTTTCTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCAT TTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCTGGTGCTATTACCATATTATT AACAGATCGAAATTTAAATACTTCATTCTTTGACCCTGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTT Type material. Holotype : ♂ currently currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington , DC , USA ( USNM ), illustrated in Fig. 103–104 , bears the following six rectangular labels, five white: [ BRAZIL , RJ, P. N. de | Itatiaia, 800m | 22°27′S , 44°37′W | 7Apr 1995 | Diversity Project UERJ ], [ Thespieus | dalman], [no transect], [DNA sample ID: | NVG-18012A11 | c/o Nick V . Grishin], [USNMENT | {QR Code} | 01450264], and one red [ HOLOTYPE ♂ | Thespieus | mandal Grishin ]. Type locality. Brazil : Rio de Janeiro , Itatiaia National Park, elevation 800 m , GPS −22.450 , −44.617 . Etymology. The name reverses syllables in its sister species, T. dalman . The name is a noun in apposition. Distribution. Southeast Brazil .