Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Calpodes stingo Grishin , new species https://zoobank.org/ C1F403E7-718A-427C-9882-2C56D6D2B124 ( Fig. 8 part, 197–198, 435–437) Definition and diagnosis. Phylogenetic trees reveal that a specimen from Ecuador identified as Calpodes placens (A. Butler, 1874) ( type locality Colombia : Bogota ) shows prominent genetic differentiation from it ( Fig. 8 ): e.g., their COI barcodes differ by 3.6% (24 bp), and therefore represents a new species. This new species keys to “ Saliana placens ” (O.14.9) in Evans (1955) but differs from it by much reduced orange overscaling between the pale base and brown tornus of ventral hindwing with that area being more brown than pale or orange (in C. placens , pale basal color intrudes into the brown area and is framed with yellow and orange), as well as darker and more restricted rusty overscaling on forewing above. Due to the lack of additional specimens and unknown phenotypic variation, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1603.82.16:T51C, aly1603.82.16:A54G, aly84.57.9:A48T, aly671.7.4:T54C, aly619.9.1:T48C, aly4305.15.6:T303T (not C), aly1041.22.3:G133G (not A), aly 2103.6.1 :A392A (not G), aly144.20.2:T57T (not A), aly18882.2.3:G48G (not T), and COI barcode: A34C, A58G, A373T, 220C, T653C. Barcode sequence of the holotype . Sample NVG-18112H02, GenBank OR837713, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGCATATTAGGTACTTCATTAAGTTTGTTAATTCGTACTGAATTAGGTAACCCTGGTTCATTAATT GGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTTCCATTAATATTAGGTGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACGGTTTACCCCCCCCTTTCATCCAATATTGCCCACCAAGGTTCATCTGTTGATTTA GCAATTTTTTCTTTACATTTAGCAGGAATCTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATAT TTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTACT TACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATCTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 197–198 , bears the following four rectangular labels, three white: [ ECUADOR : Sucumbíos , | Cerro Lumbaquí Norte, | 0° 01′70″ N, 77° 19′22″ W | 800–950 m , 18–22 Aug 2002 | J.P.W. Hall & M.A. Solis ], [DNA sample ID: | NVG-18112H02 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01531422], and one red [ HOLOTYPE ♂ | Calpodes | stingo Grishin ]. Type locality. Ecuador : Sucumbíos Province , Cerro Lumbaquí Norte, elevation 800–950 m , approx. GPS 0.0283 , −77.3203 Etymology. In Latin, placens means pleasing, and stinguō means to put out or extinguish. The name stingo is given to this species with a “pleasing” orange streak removed from the ventral hindwing. The name is a noun in apposition. Distribution. Currently known only from the holotype collected in north-central Ecuador .