Sixteen in One: White-Belted Megaselia Rondani (Diptera: Phoridae) From the New World Challenge Species Concepts Author Brown, Brian V. Entomology Department, Natural History Museum of Los Angeles County, 900 Exposition Boulevard, Los Angeles, CA 90007, USA, bbrown@nhm.org Author Hartop, Emily A. Center for Integrative Biodiversity Discovery, Museum für Naturkunde-Leibniz Institute for Evolution and Biodiversity Science, Author Wong, Maria A. Entomology Department, Natural History Museum of Los Angeles County, 900 Exposition text Insect Systematics and Diversity 2022 2022-05-09 6 3 1 17 http://dx.doi.org/10.1093/isd/ixac008 journal article 10.1093/isd/ixac008 2399-3421 10832806 Megaselia colombizona New Species Fig. 17 . urn:lsid:zoobank.org:act: 983ACBA4-613C-438A-8AAF-57A6A6E78F87 Holotype . Male. COLOMBIA : Bogota : Venado de Oro , 4.5983°N , 74.0614°W , 2,600 m , 9.iii.2016 , M. Gonzalez , forest, Malaise trap [ LACM ENT 366286 ] ( BIOUG40764 -CO2) ( IAVH ). Holotype Barcode TTATATTTTATTTTTGGAGCATGAGCTGG AATAGTAGGAACTTCTTTAAGAATTATAATTCGAGCTGAA TTAGGTCATCCAGGAGCCTTAATTGGTGATGACCAAATTT ATAATGTGATTGTAACTGCTCATGCTTTTATTATAATTTTT TTTATAGTTATACCAATTATAATAGGAGGATTTGGAAATTG ATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCCTTTC CTCGAATAAATAACATAAGATTTTGAATACTTCCACCCTCT TTAACTTTATTGTTAGCAAGAAGTATAGTAGAAAATGGGGC TGGGACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAGA ATTGCTCATAGAGGATCTTCTGTTGATCTTGCAATTTTTTCA CTACATTTAGCAGGTATCTCTTCAATTTTAGGAGCAGTAAAC TTCATTACTACAATTATTAATATACGATCATCTGGAATTACTT TTGATCGAATACCTTTATTTGTATGATCAGTAGGAATTACAG CATTACTACTTCTATTATCTTTACCTGTACTTGCAGGAGCAA TTACAATACTTTTAACAGATCGAAACTTTAATACTTCATTTTT TGATCCCGCTGGAGGAGGTGATCCAATTTTATATCAACACTT ATT---------------------------------------------------------------------------------------- Other Specimens. 2 males ( BIOUG 41393-C04, BIOUG 40354-C04) same data as holotype except for the dates 9.iii.2016 and 14.xii.2016 ( IAVH ). Figs. 10-14. Body parts of Megaselia species. Figs.10-11.Venter of hypandrium.Fig.10. M. albizona new species .Fig.11. M. sulphurizona Borgmeier. Figs. 12-14. Dorsum of abdomen. Fig. 12. M. albizona new species . Fig. 13. M. reductizona new species . Fig. 14. M. sulphurizona Borgmeier. Abbreviation: hp- hypandrial process. Diagnosis. The barcode of this species is most similar to that of M. oklizona , from which it differs by aminimum p-distance of 1.68% ( Fig. 1 , Table 1 ). The wings of M. colombizona and M. oklizona are not separated by landmarking ( Fig. 31 ), but the forecoxa of M. oklizona are yellowish-brown, in contrast to those of M. colombizona , which are dark brown like the mid- and hind coxae. The sympatric species M. paulizona also has the forecoxa dark brown, but it has about 10% mean sequence divergence ( Fig. 1 ) from M. colombizona , and the wings differ as well ( Fig. 17 , Table 3 ). This species is in BOLD as BOLD:ADW0335. Distribution. Colombia . Etymology. This species is named for the county from which specimens were collected.