Minimalist revision and description of 403 new species in 11 subfamilies of Costa Rican braconid parasitoid wasps, including host records for 219 species Author Sharkey, Michael J. https://orcid.org/0000-0001-6201-7340 The Hymenoptera Institute, 116 Franklin Ave., Redlands, CA, 92373, USA msharkey@uky.edu Author Janzen, Daniel H. Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA Author Hallwachs, Winnie Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA Author Chapman, Eric G. Department of Entomology, University of Kentucky, Lexington, KY 40546 - 0091, USA Author Smith, M. Alex https://orcid.org/0000-0002-8650-2575 Department of Integrative Biology, University of Guelph and Biodiversity Institute of Ontario, Guelph, Canada Author Dapkey, Tanya Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Brown, Allison Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Ratnasingham, Sujeevan Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Naik, Suresh Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Manjunath, Ramya Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Perez, Kate Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Milton, Megan Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Hebert, Paul Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, USA Author Shaw, Scott R. Department of Ecosystem Science, University of Wyoming, 1000 East University Avenue, Laramie, Wyoming 82071, USA Author Kittel, Rebecca N. https://orcid.org/0000-0003-0032-5764 Museum Wiesbaden, Hessisches Landesmuseum fuer Kunst und Natur, Friedrich-Ebert-Allee 2, 65185 Wiesbaden, Germany Author Solis, M. Alma https://orcid.org/0000-0001-6379-1004 Systematic Entomology Laboratory, Beltsville Agriculture Research Center, Agricultural Research Service, U. S. Department of Agriculture, c / o National Museum Natural History, MRC 168, Smithsonian Institution, P. O. Box 37012, Washington, DC, 20013 - 7012, USA Author Metz, Mark A. Systematic Entomology Laboratory, Beltsville Agriculture Research Center, Agricultural Research Service, U. S. Department of Agriculture, c / o National Museum Natural History, MRC 168, Smithsonian Institution, P. O. Box 37012, Washington, DC, 20013 - 7012, USA Author Goldstein, Paul Z. Systematic Entomology Laboratory, Beltsville Agriculture Research Center, Agricultural Research Service, U. S. Department of Agriculture, c / o National Museum Natural History, MRC 168, Smithsonian Institution, P. O. Box 37012, Washington, DC, 20013 - 7012, USA Author Brown, John W. Division of Entomology, PO Box 37012 12. National Museum of Natural History E 515 MRC 127, Washington, DC 20013 - 7012, USA Author Quicke, Donald L. J. Department of Biology, Faculty of Life Sciences, Chulalongkorn University, Bangkok, Thailand Author Achterberg, C. van https://orcid.org/0000-0002-6495-4853 Naturalis Biodiversity Center, Postbus 9517, 2300 RA Leiden, The Netherlands Author Brown, Brian V. https://orcid.org/0000-0001-6367-6057 Department of Entomology, Natural History Museum of Los Angeles County, 900 Exposition Boulevard, Los Angeles, CA, 90007, USA Author Burns, John M. Division of Entomology, PO Box 37012 12. National Museum of Natural History E 515 MRC 127, Washington, DC 20013 - 7012, USA text ZooKeys 2021 2021-02-02 1013 1 665 http://dx.doi.org/10.3897/zookeys.1013.55600 journal article http://dx.doi.org/10.3897/zookeys.1013.55600 1313-2970-1013-1 CFDCEFBB523040339D46E302F66E9886 E4329863A39E5EEBA395938413BDD579 Hymenochaonia kateperezae Sharkey & van Achterberg sp. nov. Figure 286 Diagnostics. BOLD:AAA7061. Consensus barcode. GGTTTTATATTTTATATTTGGGTTATGGGCGGGTATAATTGGKATATCAATAAGATTAGTTATTCGTTTAGAATTAGGTCAATCAGGGGTATTAATTGGTAATGAYCAAATTTATAATAGATTTGTAACTGCCCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGAAGGGTTGATATAGCATTTCCTCGGATAAATAATATGAGATTTTGATTATTAATTCCTTCAATTAATTTATTAGTTTTTAGGGGATTTATAAATATTGGGGTAGGTACTGGGTGAACTGTTTATCCCCCTTTATCATTAAATATTAGACATATAGGTATTTCTGTGGATATAGCAATTTTTTCTTTACATTTAGCAGGGGTTTCTTCTATTATAGGAGCTGTAAATTTTATTGTAACTATTATAAATATACGAAATAATAAAGTATTTATAGATAAAATTAGATTATTATGTTGATCTATTTTAATTACTGYAATTTTATTATTATTGTCTTTACCAGTTTTAGCYGGGGCAATTACAATATTATTAACTGATCGTAATTTAAATACATCTTTTTTTGACCCAGCAGGTGGAGGGGATCCTGTTTTATACCAGCATTTATTT. The long vein 2-SR+M of forewing (ca. as long as vein m-cu), ovipositor sheath ca. 1.2 x as long as body and simple tarsal claws are shared with the H. texana (Muesebeck, 1932) from USA and Mexico. However, the new species has vein 1Cua distinctly wider than vein 2-Cu1 (similar in H. texana ), POL ca. equal to diameter of posterior ocellus (ca. 2 x diameter of posterior ocellus in H. texana ), vertex laterally pale yellowish (dark brown in H. texana ) and vein cu-a of forewing inclivous (vertical in H. texana ). Holotype ♀. Guanacaste, Sector San Cristobal, Tajo Angeles, 10.86472 , -85.41531 , 540 meters, caterpillar collection date: 23/vii/2011, wasp eclosion date: 15/viii/2011. Depository: CNC. Host data . elachBioLep01 BioLep754 ( Depressariidae ) feeding on Tapirira brenesii ( Anacardiaceae ). Caterpillar and holotype voucher codes . 11-SRNP-2902, DHJPAR0045062. Paratypes. Host = Stenoma BioLep86: DHJPAR0035531, DHJPAR0035533. Depository: CNC. Etymology. Hymenochaonia kateperezae is named to honor Ms. Kate Perez for her many years laboring in execution and administration of the field and laboratory actions performed by the Centre for Biodiversity Genomics to rapidly and accurately DNA barcode tens of thousands of Costa Rican insects from Malaise traps installed by ACG and BioAlfa. Figure 286. Hymenochaonia kateperezae , holotype.