Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Eutus amazonicus Grishin , new species https://zoobank.org/ FE50E403-652D-4E02-8EB3-6EAA7C30B600 ( Fig. 5 part, 119–120, 350–352) Definition and diagnosis. Phylogenetic trees reveal that specimens from the Amazonian region that were challenging to place belong to the genus Eutus Grishin, 2022 ( type species Cobalus rastaca Schaus, 1902 ) and are the closest to Eutus yesta ( Evans, 1955 ) ( type locality in Peru : Inambari) or its relative ( Fig. 5 ) but are phenotypically distinct and therefore represent a new species. Identified by the following combination of characters: wings are narrower than in E. yesta , forewing is with a contrasting black wedge-shaped brand at the base of forewing cell CuA 1 -CuA 2 , hyaline spot shaped as an angle bracket distad of the brand, three round spots of decreasing size in cells M 3 -CuA 1 , R 5 -M 1 , and R 4 -R 5 , and a small spot at the upper side of forewing discal cell; ventral forewing is with a large (about half of wing length) cream area near tornus, ventral hindwing with more or less apparent yellowish spots and a trace of a pale ray in the cell CuA 2 -1A+2A. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1656.16.2:A48C, aly1656.16.2:A63G, aly4456.8.2:C72T, aly517.17.2:C372G, aly517.17.2:G516A, and COI barcode: A22G, T25C, T103C, T157C, T304C, A586C. Barcode sequence of the holotype . Sample NVG-19121G08, GenBank OR837678, 658 base pairs: AACTTTATATTTTATTTTTGGGATCTGAGCAGGAATATTAGGAACTTCCTTAAGTTTATTAATTCGTACTGAATTAGGAAATCCGGGTTCTTTAATT GGAGACGATCAAATTTATAACACTATCGTTACAGCACATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGTGGATTTGGAAATT GACTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTATTTTTATTAAT TTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCTCCTTTATCTTCTAACATTGCCCACCAAGGATCTTCTGTTGATTTA GCAATTTTTTCTCTACATTTAGCAGGAATTTCATCCATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATATCAT TTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACCGCTTTATTACTACTCTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTT AACCGATCGAAATTTAAATACCTCATTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 119–120 , bears the following six rectangular labels, five white: [ PERU Madre De Dios | Rio La Torre 300m | Tambopata Res. | 5 Oct. ‘86 | S.S. Nicolay ], [ ♂ genitalia | slide/vial # | H956 | Prep. S.S. Nicolay ], [ Thoon ♂ | Det. ponka | S.S. Nicolay ], [DNA sample ID: | NVG-19121G08 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01602763], and one red [ HOLOTYPE ♂ | Eutus amazonicus | Grishin ] . Paratypes : 1♂ NVG-22023D03, H20815 French Guiana , Montagne Favard, GPS 4.500 , −52.050 , 18-Sep-2003 , B. Hermier leg. [BHermier] and 1♀ : NVG-21048D10 62 km S of Ariquemes, linha C-10, 5 km S of Cacaulandia, 8-Oct-1994 O. Gomes leg. [ MGCL ]. Type locality. Peru : Madre de Dios , Tambopata National Reserve, Rio La Torre, elevation 300 m . Etymology. The name is for the Amazonian distribution of this species and is a noun in apposition. Distribution. The Amazonian region: recorded from Peru , French Guiana , and Brazil .