Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Amblyscirtes ( Amblyscirtes ) aeratus Grishin , new species https://zoobank.org/ 02F9C1E1-2242-4E8B-9276-C8F3614C6FD2 ( Fig. 6 part, 137–140, 368–369) Definition and diagnosis. Phylogenetic trees reveal that a number of specimens identified as Amblyscirtes ( Amblyscirtes ) fluonia Godman, 1900 ( type locality in Mexico : Guerrero ) show prominent genetic differentiation from it ( Fig. 6 ): e.g., their COI barcodes differ by 5.6% (37 bp). These specimens are not even monophyletic with A. fluonia and therefore belong to a new species. This new species keys to A. fluonia (N.2.7) in Evans (1955) but differs from the true A. fluonia ( Fig. 141–144 ) by the lack of pebbly variegated appearance on the ventral side of wings, in particular on the hindwing and the submarginal area of forewing. In wing pattern, it resembles Amblyscirtes aenus W. H. Edwards, 1878 ( type locality in USA : Colorado ) more than A. fluonia , but the spots are more diffuse and less defined, e.g., forewing apical spots are smaller and yellower, and ventral hindwing postdiscal band is composed of diffuse and interconnected blotches rather than smaller and separated spots. In DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly522.2.4:T99A, aly522.2.4:C124T, aly587.21.2:G153A, aly587.21.2:T156C, aly669.9.1:T201A, and COI barcode: T205C, T206C, A295T, T397C, T418C, A565G. Barcode sequence of the holotype . Sample NVG-18063E02, GenBank OR837686, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATT GATTAGTCCCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCTTTATTACTTTTAAT TTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCACATCAAGGATCATCAGTTGATTTA GCAATTTTCTCTCTTCATTTAGCAGGAATCTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTAATAT TTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCAGTTCTAGCTGGGGCTATTACTATACTTCT TACAGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATACCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 137–138 , bears the following four rectangular labels, three white: [ MEXICO : OAXACA | El Vado-San Sebastian | 5500-6500 ft | c 16° 53’ N 96° 53′ W | 27-Jun-1992 J. Kemner ], [DNA sample ID: | NVG-18063E02 | c/o Nick V . Grishin ], [USNMENT | { QR Code } 01466204] and one red [ HOLOTYPE ♂ | Amblyscirtes | aeratus Grishin ] . Paratypes : Mexico : 1♂ NVG-19042F06 Colima , Jun-1918 , C. C. Hoffmann leg., AMNH _IZC 00337883 [ AMNH ] and 1♀ : NVG-19122A02 Oaxaca , La Canada , 2 mi S Dominguillo, ca. 2500 ft , GPS 17.6500 , −96.9167 , 8,10- Aug-1991 , J. Kemner leg. [ USNM ] ( Fig. 139–140 ). Type locality. Mexico : Oaxaca , El Vado–San Sebastián, elevation 5500–6500 ft , GPS 16.8833 , −96.8833 . Etymology. Like aenus , the name aeratus in Latin means made or covered with brass or bronze. Fluonia means a flow, and the pebbly appearance is like a flow on the wings, which is not present in this species. The name is an adjective. Distribution. At least southwestern Mexico , known from Colima and Oaxaca .