Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Pythonides lera Grishin , new species https://zoobank.org/ CE3F7AF8-AAA1-4496-8044-F42391762519 ( Fig. 2 part, 35–36, 248–249) Definition and diagnosis. A specimen from Peru identified as Pythonides lerina ( Hewitson, 1868 ) ( type locality in French Guiana and Brazil : Para) is genetically differentiated from it (COI barcodes differ by 5% (33 bp)) ( Fig. 2 ) and therefore is a new species. This new species keys to P. lerina (E.41.4) in Evans (1953) and differs from it by a more elongated lower hyaline spot in the forewing discal cell, less developed network of brown “webbing” on the ventral hindwing ( Fig. 35–36 ), and more robust harpe that protrudes dorsad of costa (249). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly393.15.7:G381C, aly393.15.7:A395T, aly531.17.6:C195T, aly82.4.5:A198T, aly173.28.2:A84G, aly345.5.1:C36C (not T), aly 2116.6.1 :C247C (not T), aly221.16.10:A57A (not T), aly3512.5.3:T141T (not C), aly2012.21.2:C863C (not G), and COI barcode: T79C, T133T, A190T, T280C, T536C. Barcode sequence of the holotype . Sample NVG-18018B09, GenBank OR837637, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTTGGAACATCTTTAAGTTTATTAATTCGAACTGAACTAGGCAACCCTGGTTCTTTAATT GGAGATGATCAAATTTATAATACCATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATT GACTAGTACCCCTTATACTAGGAGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGACTATTACCTCCTTCTCTCACATTATTAAT TTCAAGAAGTATTGTAGAAAATGGAACTGGAACTGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCTCATCAAGGTTCTTCCGTAGATTTA GCTATTTTTTCCCTGCATTTAGCTGGAATTTCATCAATTTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAACCTTTCTT TTGATCAAATACCTTTATTCGTTTGAGCAGTAGGAATTACAGCATTACTTCTACTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATACTATT AACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 35–36 , bears the following four rectangular labels, three white: [ PERU : Cuzco 1050m | Quitacalzone | Cosnipata Road 1530 | 5.ii.2011 Kinyon ], [DNA sample ID: | NVG-18018B09 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01450938], and one red [ HOLOTYPE ♂ | Pythonides | lera Grishin ]. Type locality. Peru : Cuzco , Cosñipata Road, Quitacalzone, elevation 1050 m . Etymology. The name is formed from its sister species name ler [in] a and is a feminine noun in apposition. Distribution. Currently known only from the holotype collected in southern Peru .