<document ID-DOI="http://dx.doi.org/10.3897/zookeys.375.6222" ID-GBIF-Dataset="89f16d40-bb9c-4b0f-b2e6-f08e88f0fb9a" ID-PMC="PMC3921562" ID-Pensoft-Pub="1313-2970-375-15" ID-PubMed="24526844" ID-ZBK="8BCC6418E8CD470A8A1A57CC67822F53" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1313-2970-375-15" ModsDocOrigin="ZooKeys 375" ModsDocTitle="Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)" checkinTime="1451246388436" checkinUser="pensoft" docAuthor="Leger, Theo, Landry, Bernard, Nuss, Matthias & Mally, Richard" docDate="2014" docId="B2474C9B6617ED1E9BF1ACA677F29A5C" docLanguage="en" docName="ZooKeys 375: 15-73" docOrigin="ZooKeys 375" docSource="http://dx.doi.org/10.3897/zookeys.375.6222" docTitle="Catharylla serrabonita T. Leger & B. Landry, sp. n." docType="treatment" docUuid="8B0F3E46-1CA6-47C3-A5AC-D9A9A01AAA29" docUuidSource="ZooBank" docVersion="4" lastPageNumber="43" masterDocId="9036FFB11B3EFFAFA138FFCA1A5BFFCE" masterDocTitle="Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)" masterLastPageNumber="73" masterPageNumber="15" pageNumber="41" updateTime="1668157587888" updateUser="ExternalLinkService"> <mods:mods xmlns:mods="http://www.loc.gov/mods/v3"> <mods:titleInfo> <mods:title>Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)</mods:title> </mods:titleInfo> <mods:name type="personal"> <mods:role> <mods:roleTerm>Author</mods:roleTerm> </mods:role> <mods:namePart>Leger, Theo</mods:namePart> </mods:name> <mods:name type="personal"> <mods:role> <mods:roleTerm>Author</mods:roleTerm> </mods:role> <mods:namePart>Landry, Bernard</mods:namePart> </mods:name> <mods:name type="personal"> <mods:role> <mods:roleTerm>Author</mods:roleTerm> </mods:role> <mods:namePart>Nuss, Matthias</mods:namePart> </mods:name> <mods:name type="personal"> <mods:role> <mods:roleTerm>Author</mods:roleTerm> </mods:role> <mods:namePart>Mally, Richard</mods:namePart> </mods:name> <mods:typeOfResource>text</mods:typeOfResource> <mods:relatedItem type="host"> <mods:titleInfo> <mods:title>ZooKeys</mods:title> </mods:titleInfo> <mods:part> <mods:date>2014</mods:date> <mods:detail type="volume"> <mods:number>375</mods:number> </mods:detail> <mods:extent unit="page"> <mods:start>15</mods:start> <mods:end>73</mods:end> </mods:extent> </mods:part> </mods:relatedItem> <mods:location> <mods:url>http://dx.doi.org/10.3897/zookeys.375.6222</mods:url> </mods:location> <mods:classification>journal article</mods:classification> <mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.375.6222</mods:identifier> <mods:identifier type="Pensoft-Pub">1313-2970-375-15</mods:identifier> <mods:identifier type="ZBK">8BCC6418E8CD470A8A1A57CC67822F53</mods:identifier> <mods:identifier type="ZooBank">8BCC6418E8CD470A8A1A57CC67822F53</mods:identifier> </mods:mods> <treatment ID-GBIF-Taxon="152050784" LSID="urn:lsid:zoobank.org:act:8B0F3E46-1CA6-47C3-A5AC-D9A9A01AAA29" httpUri="http://treatment.plazi.org/id/B2474C9B6617ED1E9BF1ACA677F29A5C" lastPageId="28" lastPageNumber="43" pageId="26" pageNumber="41"> <subSubSection pageId="26" pageNumber="41" type="nomenclature"> <paragraph pageId="26" pageNumber="41"> <taxonomicName LSID="http://zoobank.org/8B0F3E46-1CA6-47C3-A5AC-D9A9A01AAA29" authority="T. Leger & B. Landry" class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="26" pageNumber="41" phylum="Arthropoda" rank="species" species="serrabonita"> Catharylla serrabonita T. <normalizedToken originalValue="Léger">Leger</normalizedToken> & B. Landry </taxonomicName> <taxonomicNameLabel pageId="26" pageNumber="41">sp. n.</taxonomicNameLabel> Figs 6, 21-26, 39, 45, 46 </paragraph> </subSubSection> <subSubSection pageId="26" pageNumber="41" type="type material"> <paragraph pageId="26" pageNumber="41">Type material.</paragraph> <paragraph pageId="26" pageNumber="41"> Holotype. ♂, with labels as follows: "BRASIL: BA, Camacan | Res[erva]. Serra Bonita | 15°23'S, - 39°33'W, | 800m, 06.iv.2011 | B. Landry, V. Becker"; "HOLOTYPE | Catharylla serrabonita | T. <normalizedToken originalValue="Léger">Leger</normalizedToken> & B. Landry" [red label]. Deposited in Becker Collection. </paragraph> <paragraph pageId="26" pageNumber="41"> Paratypes. 21 ♂, 1 ♀. BRAZIL: 5 ♂ (1 used for DNA barcoding BC MTD 01843, 1 with genitalia on slide BL 1745), <normalizedToken originalValue="Espírito">Espirito</normalizedToken> Santo, Linhares, 40m, 25-30.i.1998 (V. O. Becker n°113929) (Becker Coll., USNM); 2 ♂, 1 ♀ (♀ with genitalia on slide BL 1759) with same except 20-29.ii.1992 (V. O. Becker n°81552) (Becker Coll., USNM); 2 ♂ with same data as holotype except 05-09.iv.1992 (V. O. Becker n°82486) (USNM); 10 ♂ (1 in alcohol, thorax used for DNA sequencing LEP 979, genitalia on slide TL 7, wing on slide TL 8) Bahia, Camacan, Serra Bonita Reserve, <geoCoordinate direction="south" orientation="latitude" precision="925" value="-15.383333">15°23'S</geoCoordinate> , <geoCoordinate direction="west" orientation="longitude" precision="925" value="-39.55">39°33'W</geoCoordinate> , 800 m, B. Landry, V. O. Becker, 1.iv.2011 (1 ♂), 2.iv.2011 (2 ♂), 3.iv.2011 (1 ♂, genitalia on slide BL 1776), 5.iv.2011 (3 ♂), 6.iv.2011 (1 ♂), 7.iv.2011 (1 ♂) (MHNG); 1 ♂ with same data except vii.2010 (V. O. Becker) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 970, BC MTD 01887, genitalia on slide TL 6) Bahia, Porto Seguro, A. <normalizedToken originalValue="d’Ajuda">d'Ajuda</normalizedToken> , <geoCoordinate direction="south" orientation="latitude" precision="925" value="-16.45">16°27'S</geoCoordinate> , <geoCoordinate direction="west" orientation="longitude" precision="925" value="-39.05">39°03'W</geoCoordinate> , 20 m, 12.vii.2009 (V. O. Becker n°144140) (Becker Coll.). </paragraph> <paragraph pageId="26" pageNumber="41">COI barcode sequence of holotype LEP 979 (516 bp): TAGTTGGAACATCATTAAGACTATTAATTCGAGSAGAGTTAGGGAATCCTGGATCTCTTATTGGAGATGATCAAATTTATAATACTATTGKAACAGCTCATGSATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTTCCATTAATATTAGGAGCCCCAGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTCCCCCCCTCTTTAACCCTTTTAATTTCCAGAAGAATTGTAGAGAATGGAGCTGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCTCATAGKGGAAGATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGSAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCGTTATTTGTCTGATCAGTTGGTATTACAGCTTTACTCCTTCTTTTATCTTTAC</paragraph> </subSubSection> <subSubSection lastPageId="27" lastPageNumber="42" pageId="26" pageNumber="41" type="diagnosis"> <paragraph pageId="26" pageNumber="41">Diagnosis.</paragraph> <paragraph lastPageId="27" lastPageNumber="42" pageId="26" pageNumber="41"> From <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="coronata"> <pageBreakToken pageId="27" pageNumber="42" start="start">Catharylla</pageBreakToken> coronata </taxonomicName> and <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName> , <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName> can be separated by the zigzagging median transverse line with the short triangular dent at CuA2 and the pronounced creamy color of the hindwing. The male genitalia provide the best discriminant characters: in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName> , the transtilla forms a pair of sclerotized arms bent inward in distal 1/4 and with a string of long spines of same length medially along it, whereas it forms a pair of short, narrow sclerotized arms with pointed tips projecting posterad, and with a pair of brushes directed medio-ventrally in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName> , and two sclerotized arms slightly bent inward distally, with a row of short spines increasing in size from base to apex in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName> , and the juxta is apically narrow and pointed whereas it is triangular and regularly narrowed in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName> and <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName> . In female genitalia, the anterior angle of sternite VIII is projected anterad into a rounded protrusion covered with short spinules in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName> , whereas it is projected downward in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName> and it is not projected in <taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="27" pageNumber="42" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName> . </paragraph> </subSubSection> <subSubSection lastPageId="28" lastPageNumber="43" pageId="27" pageNumber="42" type="description"> <paragraph pageId="27" pageNumber="42">Description.</paragraph> <paragraph pageId="27" pageNumber="42"> Male (n = 21) (Fig. 6): Head white with ochreous chaetosemata. Antenna brown with whitish-ochreous scales and patch of brown scales at base. Maxillary palpus light ochreous,with patches of dark brown scales at 1/3 and 2/3, white tipped. Labial palpus: 1.7-2.5 mm long; light ochreous, white tipped. Thorax white, with ochreous patch at collar. Foreleg coxa white; femur white, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with brown. Midleg and hindleg white to light ochreous; tarsomeres <normalizedToken originalValue="II–V">II-V</normalizedToken> ochreous, brown on upperside, with white ringed tips. Forewing length: 10-14 mm; costal line ochreous; median transverse line ochreous to brown, zigzagging with short brown pronounced spot at M1 and short triangular dent at CuA2; subterminal transverse line ochreous to brown, regularly curved up to CuA2, then curved again; R5 faintly marked apically with ochreous; outer margin ochreous with 7 more or less triangular and connected dark brown spots between veins; fringes brass colored; underside ochreous, outer margin with pronounced spots. Hindwing cream-coloured, usually with more or less connected marginal brown spots between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2; fringes white; underside light ochreous, with marginal spots pronounced. </paragraph> <paragraph pageId="27" pageNumber="42">Tympanal organs (n = 4): Transverse ridge more or less rounded, medially slightly flattened. Tympanic pocket extending faintly beyond transverse ridge, rounded. Tympanic drum glomerular, not reaching transverse ridge.</paragraph> <paragraph pageId="27" pageNumber="42">Male genitalia (n = 4) (Figs 21-26): Uncus about as long as tegumen arms, downcurved; uncus arms connecting basally, with ventro-lateral tuft of setae at base; dorsal furrow pronounced medially with row of few hairs on each side; apex rounded, slightly indented medially, slightly convex ventro-apically. Gnathos arms connecting at 1/3; main shaft slightly downcurved with apex pointing upward. Tegumen arms regularly enlarging toward apex, connection at about 4/5 length of arms. Costa with apically rounded arm pointing postero-dorsally; cucullus curved upward in distal 1/3, with apex rounded. Juxta triangular, narrowing in distal 1/4 with bell-shaped ventro-lateral projections, regularly curved with apex horizontally straightened; baso-lateral angles curved upward. Transtilla with two very large sclerotized arms projecting posterad, bent inward in apical 1/4, with longitudinal string of long spines medially. Phallus slightly S-shaped, with apex dorsally sclerotized; vesica covered with microspicules, without cornuti.</paragraph> <paragraph pageId="27" pageNumber="42">Female (n = 1): Labial palpi: 1.9 mm long. Forewing length: 14 mm. Frenulum triple.</paragraph> <paragraph lastPageId="28" lastPageNumber="43" pageId="27" pageNumber="42"> Female genitalia (n = 1) (Fig. 39): Papillae anales straight, thick. Posterior apophyses 0.4 <normalizedToken originalValue="×">x</normalizedToken> length of papillae anales, narrow, wider at base. Intersegmental membrane <pageBreakToken pageId="28" pageNumber="43" start="start">between</pageBreakToken> segment VIII and IX covered with microspines. Sternite VIII laterally about 5/3 length of tergite VIII; posterior margin of tergite VIII with line of setae; sternite VIII forming 2 triangular lobes regularly narrowing downward, not connected, densely covered with short spinules of same length; anterior angle of sternite VIII slightly projected anterad, rounded, covered with short spinules of same length. Anterior apophyses 0.03 <normalizedToken originalValue="×">x</normalizedToken> length of papillae anales. Sterigma membranous, covered with spinules. Ductus bursae about 3 <normalizedToken originalValue="×">x</normalizedToken> length of corpus bursae, narrow, basally directed downward and then bent upward. Corpus bursae elongate, ovoid, with one tiny signum. </paragraph> </subSubSection> <subSubSection pageId="28" pageNumber="43" type="distribution"> <paragraph pageId="28" pageNumber="43">Distribution.</paragraph> <paragraph pageId="28" pageNumber="43">The species occurs in Brazil (Bahia, Espirito Santo) (Figs 45 & 46).</paragraph> </subSubSection> <subSubSection pageId="28" pageNumber="43" type="etymology"> <paragraph pageId="28" pageNumber="43">Etymology.</paragraph> <paragraph pageId="28" pageNumber="43"> The name comes from that of the Serra Bonita Reserve founded by Vitor O. Becker and Clemira de Souza. It is managed by Instituto <normalizedToken originalValue="Uiraçu">Uiracu</normalizedToken> in the State of Bahia, Brazil. </paragraph> </subSubSection> <subSubSection pageId="28" pageNumber="43" type="notes"> <paragraph pageId="28" pageNumber="43">Notes.</paragraph> <paragraph pageId="28" pageNumber="43">Serra Bonita Reserve is located in the Atlantic Forest, in a hilly region of cacao plantations and scattered forest. Adults came late to light, usually after 23:00. Our molecular analysis of the COI barcode sequences highlighted that specimens from Serra Bonita respectively show 3.24 and 2.21 % base differences with those of Porto Seguro and Linhares. This divergence is possibly associated with slight morphological differences in male genitalia as shown in Figs 23-26. No females were found at Serra Bonita.</paragraph> </subSubSection> </treatment> </document>