Steinernema guangdongense sp. n. (Nematoda: Steinernematidae), a new entomopathogenic nematode from southern China with a note on S. serratum (nomen nudum) Author Qiu, Lihong Author Fang, Yuanyuan Author Zhou, Yong Author B, Yi Pang And Khuong text Zootaxa 2004 704 1 20 journal article 10.5281/zenodo.158636 4f74a567-982e-47f3-832a-35329cac1ec6 1175­5326 158636 B24DDD03-9B31-4A47-83F2-0998E0B66B98 Steinernema guangdongense n. sp. ( Figs 1–8 ) Description First­generation male: Measurements are in Table 1 . Body curved ventrally posteriorly, C­shaped when heat­killed. Head rounded, usually slightly swollen. Anterior end with six labial papillae, two amphids and four prominent cephalic papillae ( Fig. 2 D). Stoma shallow, cheilorhabdions as small and sclerotized structures at anterior end, sometimes indistinct. Excretory pore located mostly anterior to basal bulb. Esophagus with cylindrical procorpus, metacorpus slightly swollen, isthmus present, nerve ring around isthmus, basal bulb distinct. Esophago­intestinal valve present. Gonad monorchic, reflexed. Distance from base of esophagus to anterior end of testis variable. Spicules paired, brown in color. Head (manubrium) of spicules with rounded anterior end, almost continuous with shaft ( Fig. 2 E). Shaft (calomus) very short or absent, blade (lamina) thick anteriorly, tapering gradually posteriorly, blade terminus blunt, velum present, sometimes very thin ( Fig. 1 B,C). Each spicule with two internal sclerotized ribs. Gubernaculum boat­shaped in lateral view, tapering gradually anteriorly. There are eleven pairs and one single precloacal genital papillae. Tail conoid, tail terminus rounded without a mucron. FIGURE 1. Steinernema guangdongense n. sp, first generation male and infective juvenile. Scale bars: A, B,C = 50 μm, D, E. = 20 μm. Second­generation male similar to that of the first generation except body, spicule and gubernaculum shorter and thinner. First­generation female: Measurements are in Table 1 . Body cuticle smooth or with faint annules. Lateral fields and phasmids not observed. Head rounded, continuous with body; six labial and four cephalic papillae ( Fig. 2 A). Lips indistinct. Amphids usually inconspicuous even under SEM. Stoma shallow, subtriangular anteriorly; triradiate internally. Cheilorhabdions, well sclerotized but small ( Fig. 4 A). A smaller sclerotized structure posterior to cheilorhabdions (presumably the prorhabdions), observed in other species, indistinct in this species. Esophagus with procorpus cylindrical, muscular; metacorpus swollen; isthmus distinct; basal bulb valvate as in other steinernematids. Nerve ring surrounding isthmus, just anterior to basal bulb. Esophago­intestinal valve present. Excretory pore located near mid­esophagus, anterior to nerve ring. Gonads amphidelphic, reflexed, often containing many eggs. Vulva a transverse slit situated on a protruding area, small double­flapped epiptygma present ( Fig. 4 D). Anterior lip larger than posterior one. Body diameter right anterior to vulva larger than that posterior to vulva. Vagina sclerotized, short. Tail shape variable, with blunt terminus, occationally, a mucron­like structure present on dorsal side ( Fig. 4 B,C). Ventral postanal swelling present, tail shorter than anal body width. Second­generation female: Similar to first generation female but smaller. Vulva less protruding, epiptygma presesent but less prominent ( Fig. 4 E). Tail, tapering to a pointed end, longer than anal body width; ventral postanal swelling present. FIGURE 2. SEM photographs of the first­generation Steinernema guangdongense n. sp. A, head of a young female showing labial (l) and cephalic (c) papillae. B, tail of a young female. C, posterior end of a male showing genital papillae (p). E, F, spicule and gubernaculum. Scale bars: A, D = 10 μm, B = 42.9 μm, C = 42.5 μm. E, F = 20 μm. FIGURE 3. Comparative photographs of spicule shape and spicule tips of the first­generation male of Steinernema guangdongense n. sp. (A, B) and S . longicaudum (C, D). Note: Spicule tip of S . longicaudum suddenly narrow to form the tip but not for S. guangdongense n. sp. Scale bars: A, B = 20 μm, C, D = 25 μm. FIGURE 4. Steinernema guangdongense n. sp. first and second generations females. A, anterior region. B, C, variation in tail shape and mucron­like structure. D, vulva and double flapped epiptygma. E, vulva and epiptygma of the second generation female. Scale bar: A­E = 50 μm. TABLE 1. Morphometrics (in µm) of different stages of Steinernema guangdongense n. sp.

Character	First generation Holotype Male Female Allotype	Second generation Male Female	Infective Juvenile
n	20 20	20 20	20
Body length	2000 1809 ± 415 5050 ± 913 6250 (1627–2126) (3800–6800)	1441 ± 43.7 276 ± 201 (1350–1500) (3130–2500)	1055 ± 49 (987–1145)
Greatest body width	135 112 ± 14 218 ± 29 265	80 ± 3.5 143 ± 8	42 ± 4
EP	(90–135) (175–275) 123 120 ± 8 158 ± 7 163	(75–88) (130–155) 119 ± 2.8 119 ± 5.6	(30–48) 80 ± 3.6

(103–132) (150–175) (113–123) (113–130) (71­ 85) NR 130 127 ± 8 163 ± 15 162 136 ± 4.9 165 ± 2.5 102 ± 6 (109–139) (143–200) (125–143) (?–168) (88–111) ES 165 162 ± 7 199 ± 16 230 166 ± 5.9 204 ± 4.9 134 ± 5 (150–176) (183­238) (160–175) (195–215) (123–144) Tail length (T) 35 31 ± 3 55 ± 8 40 30 ± 1.8 80 ± 3 91 ± 8 (24–38) (43–65) (28–33) (75–85) (82–103) Anal body diam (ABW) 55 50 ± 5 77 ± 15 75 42 ± 3.2 54 ± 2.4 27 ± 2 (42–58) (63­118) (38–48) (50–58) (24–32) Spicule length (SP) 85 86 ± 3 71±3.9 (80–94) (65–80) Gubernaculum length (GU) 70 64 ± 6 46 ± 2.9 (47–73) (25­42) a 25 ± 3 (22–35) b 7.9 ± 0.3 (7.3–8.5) c 11.6 ± 0.7 (10.2–12.9) H% 57 ± 3 (53­62) D% =EP/ES x 100 75 70 ± 17 71 ± 3 59 ± 3 (67–78) (67­75) (54–65) E% = EP/T x 100 88 ± 7 (74–100) SW=SP/ABW 1.55 1.75 ± 0.20 1.83 ± 0.16 (1.52–2.16) (1.58­2.00) GS=GU/SP 0.82 0.75 ± 0.06 0.65 ± 0.06 (0.59–0.82) (0.59­0.74) V% 49.5 ± 0.75 50 53 ± 1.5 (48­50) (51­56) EP = distance from anterior end to excretory pore. NR = distance from anterior end to nerve ring. ES = distance from anterior end to end of esophagus. H% = hyaline portion on tail/tail length x 100 Infective juveniles: Measurements are in Table 1 . Body elongate. Sheath (secondstage cuticle) present immediately after harvesting, but many IJ will lose their sheath in storage. Labial region smooth, rounded anteriorly, continuous with body. Labial papillae not seen; four cephalic papillae prominent. Amphids slit­shaped but not prominent, sometimes covered with exudates. Cuticle marked with prominent transverse striations. Lateral field begins anteriorly with one line at annule five or six ( Fig. 6 A,B). Two additional lines appear at annules 10­11 to form two ridges ( Fig. 6 C). Near excretory pore level, the number of ridges in lateral fields increases from two to seven ( Fig. 6 C). Near the end of esophagus, the central ridge divides into two, making a total of eight ridges, the maximum number in the lateral field. The portion with eight ridges is the longest part (compared to portions with 2, 7, 4 ridges) of the lateral field. Near anus, the number of ridges reduced to seven. Some annules posterior to phasmid, the seven ridges in lateral field become four ridges. Three or four annules after that, the four ridges change to two ridges. With the above description, the formula of the lateral field is 2, 7, 8, 7, 4, 2. Esophagus with thin corpus, basal bulb more or less elongate with visible valve. Tail attenuate, tapering gradually with constriction on dorsal side ( Fig. 5 C­F). Hyaline portion occupies about 57.5% (52­63) of tail length. CROSS­BREEDING No offspring were observed from any of the slides with two females indicating that none of GDc339, CB2B and CWL05 could self­fertilize and produced second­generation nematodes. Offspring were found from most of the slides in which two inoculated IJs developed into opposite sex adults for all treatments and control. Nematodes in the control developed further into adults of the second generation and many IJ were produced after that. For treatments, nematodes developed slowly, a number of them died; some of them developed to adults, but none of the females had eggs in the body. All of them died in about 10 day after becoming adults. No IJ were produced. The repeated test showed similar results. The above evidence showed that S. guangdongense n. sp. and S. longicaudum are very similar to each other; they could hybridize but would produce non­fertile second generation. TYPE HOST , LOCALITY AND SPECIMENS Type host and locality : The type host of this nematode in nature is unknown as it was recovered from soil using Galleria larvae as bait. The soil sample was collected in an artificial eucalypt forest in Jijia town (latitude N20.49 , longitude E109.58 ), Lei Zhou, Guangdong province, China . Type specimens : Holotype male, allotype female, 10 paratype first generation males, 5 paratype females, 15 paratype infective juveniles and other population slides deposited in the State Key Lab for Biocontrol, College of Life Sciences, Zhongshan University, Guangzhou 510275, China . Living infective juveniles are also preserved in liquid nitrogen in the nematode collection of SKLB , Zhongshan University. Slides of several males and infective juveniles were deposited in the United States Department of Agriculture Nematology, Beltsville, Maryland, USA . FIGURE 5. Steinernema guangdongense n. sp. Light­microscope photographs. A­B, epiptygma of the first generation females. C­D, tails of infective juveniles showing dorsal constriction (arrows), compared to no dorsal constriction in S. longicaudum in E­F. G, mature female of the first generation with prominent post­anal swelling. H, second generation female with longer tail. Scales: A, B = 18 μm, C = 24 μm, D = 22 μm, E, F = 22 μm. DIAGNOSIS AND RELATIONSHIP Steinernema guangdongense n. sp. can be recognized by large IJ body diam. 42 (30­ 48) μm, distance from anterior end to nerve ring 102 (88­111) μm; pharynx length 134 (123­144) μm and a = 25 (22­35). Lateral field pattern variable, the formula for the arrangement of ridges from head to tail is 2, 7, 8, 7, 4, 2 ( Fig. 6 ). The new species can be recognized further by males with spicules length averaging 86 (80­94) μm, spicule shape, spicule tip ( Fig. 3 ) and the ratios SW and GS ( Table 2 ). The female of the new species is characterized by the presence of an epiptygma ( Fig. 4 , 5 ) and prominent post­anal swelling. FIGURE 6. SEM photographs of Steinernema guangdongense n. sp. infective juvenile. A­B, anterior region showing one lateral line, closed mouth (m), amphids (a) and cephalic (c) papillae. C, lateral field with 2 ridges (3 incisures). D, lateral field showing the change of lateral field pattern from 2 to 7 ridges. E, lateral field showing 7 ridges and the middle one (number 4) is divided into 2 making 8 ridges in lateral field. F, lateral field showing phasmid (p) and 7 ridges changing to 4 then 2. Scales: A = 6.67 μm, B = 5 μm, C = 8.60 μm, D ­ F = 6.67 μm. S teinernema guangdongense n. sp. can be distinguished from the closest species S. longicaudum by characteristics of infective juveniles (IJ), males and females. For IJ, although the body length, EP, E% is almost similar (1055 μm compared to 1063 μm, 80 μm to 82 μm and 88% to 87% respectively), body diameter is larger; value of NR and the ratio body length/body width are smaller ( Table 2 ) and tail with dorsal constriction ( Fig. 5 C,D). For male, the new species has longer spicule, not well curved, spicule head shorter, shaft not prominent or absent and spicule tip not suddenly tapered as shown in S. longicaudum ( Fig. 3 ). Also, the ratios SW and GS are smaller. For female, the presence of a small double flapped epiptygma ( Fig. 5 A,B), a small projection on dorsal side of the tail tip and prominent post­anal swelling ( Fig. 5 G) differentiate this nematode from S. longicaudum . Steinernema guangdongense n. sp. can be distinguished from other related species by morphometrical characteristics listed in the Table 2 . Alignment of ITS regions 1.... 50 S. guangdongense GTACACAC T GCCCGTCGCTGCCCGGGACTGAGTTGTTTCGAGAAAAGCGG S. longicaudum CB2B GTACACACCGCCCGTCGCTGCCCGGGACTGAGTTGTTTCGAGAAAAGCGG S. diaprepesi GTACACACCGCCCGTCGCTGCCCGGGACTGAGTTGTTTCGAGAAAAGCGG S. glaseri GTACACACCGCCCGTCGCTGCCCGGGACTGAGTTGTTTCGAGAAAAGCGG S. longicaudum CWLO5 GTACACACCGCCCGTCGCTGCCCGGGACTGAGTTGTTTCGAGAAAAGCGG ******** ***************************************** 51.... 100 S. guangdongense AGACTGCTTCTCTGAGCG T TTTCGG A CGTGAATTGAGGCGAGAACCGCGT S. longicaudum CB2B AGACTGCTTCTCTGAGCGCTTTCGGGCGTGAATTGAGGCGAGAACCGCGT S. diaprepesi AGACTGCTTCTCTGAGCGCTTTCGGGCGTGAATTGAGGCGAGAACCGCGT S. glaseri AGACTGCTTCTCTGAGCGCTTTCGGGCGCGAATTGAGGCGAGAACCGCGT S. longicaudum CWLO5 AGACTGCTTCTCTGAGCGCTTTCGGGCGTGAATTGAGGCGAGAACCGCGT ****************** ****** ** ********************* 201.... 250 S. guangdongense GATGAT G ATTGTTCGGAACG­­GCACTG C ­T T CGTTTCTAGGTGTCGATT S. longicaudum CB2B GATTAGAA­­GTTCGGAACG­­GGACTG­­TGCGCATCTAAGTGTCGATT S. diaprepesi GTTACGTATCGTTCGGAACG­­ACACTGTCCACGTTTCTAAGTGTCGATT S. glaseri TATGATCACTGTTCGGAACGCGGCACTGT­­­CGTTTCTAGGTGTCGCGA S. longicaudum CWLO5 GATTAGAA­­GTTCGGAACG­­GCACTGT­­GCGCATCTAGGTGTCGATT * * ********** **** ** **** ****** 301.... 350 S. guangdongense ATGAGCGTGGCTGTGGTGAAGGACATTTGACATCCTATGCCAGACGTCT T S. longicaudum CB2B ATG­GCGTGGCTGTGGTGAAGGACATTTTACATCC­­­­­­­­­­­­­­­ S. diaprepesi ATGAGCGTGGCTGTGATGAAGGACATTTAACATCCTATGCCAGACGTCTA S. glaseri ATGAGCGTGGCTGTGGTGAAGGACATTTGACATCGCGT­­­­­­­­­­­­ S. longicaudum CWLO5 ATGAGCGTGGCTGTGGTGAAGGACATTTTACATCGC­­­­­­­­­­­­­­ *** *********** ************ ***** 351.... 400 S. guangdongense G­TGT T TCT A GCGTTTGGTGATGT­AGAATTAAAGAGGTCAG G TCGGAG G S. longicaudum CB2B ­­­­­­­­­­­­ATTTGCTGATGT­AGAATTAAAGAAGTCAG­TCGGAGA S. diaprepesi GCTGTCTCTTGCGTTTGGTGATG­­AGAATTAAAGAGGTCAG­TCGGAGA S. glaseri ­­­­­­­­­­­­­CTCGACGCGGTGAGAATTGAAGAGGTCAG­TCGGAGA S. longicaudum CWLO5 ­­­­­­­­­­­­­TTTGCTGATGT­AGAATTAAAGAGGTCAGTCCGGAGA * * * * ****** **** ***** ***** 401.... 450 S. guangdongense CCCG­­CCGTTCACAAACCCTACT­ATTAACATTT­­­­ACTTGATG C TG S. longicaudum CB2B CCCCGCCCGTTCACAAACCCTACT­ATTAACATTTT­­­ACTTGATGATG S. diaprepesi CCCG­­CCGTTCAAAAACC­TACC­ATTAACATTTT­­­CCATACTAA­G S. glaseri CCCG­­CCGTTCACAAACCCTACC­ATTAACAATTTTACACACGATGACA S. longicaudum CWLO5 CCCG­­CCGTTCCCAAACCCTACTTATTACCATTTT­­­ACTTGATGATG *** ****** ***** *** **** ** ** * * 651.... 700 FIGURE 7. Selective blocks of sequence alignments of ITS regions and partial 28S showing diagnostic characters (red letters) of Steinernema guangdongense n. sp. (continued on the next page). S. guangdongense TCGTGACTTGCAGTCAGCTGAGACTGTTTTTTCGAT T AGCTACT C TT C TT S. longicaudum CB2B TCGTGACTTGCAGTCAGCTGAGACTGTTTTTTCGATGAGCTACTTTTTT­ S. diaprepesi TCGTTACTTGCAGTCAGCTTCGACTGTTTATTCGATAAGCTACTTTCGAG S. glaseri ACGTTACTTGCAGTCAGC­­­GACTGTTTTTTCGACGAGCTATGTACGTT S. longicaudum CWLO5 TCGTGACTTGCAGTCAGCTGAGACTGTTTTTTCGATGAGCTACTTTTTT­ *** ************* ******** ***** ***** 701.... 750 S. guangdongense T T­CGGA G G G ACCTT­TTCGGTATGGTCGC­­­AAT T GAAAAA T GCGAT­ S. longicaudum CB2B ­­­­­GAAGTACCTT­TTCGGTATGGTCGC­­­AAT­GAAAAGCGCGAT­ S. diaprepesi CTGCGAAAGTACCTT­TTCGGTGTGAACGCTTCAATGCGATAGGCTAATG S. glaseri ­­­CGTATGTACCTCGTTCGGTGTGAACGTTCCCCCGGCACTGGGGGCGA S. longicaudum CWLO5 ­­­­­GAAGTACCTT­TTCGGTATGGTCGC­­­AAT­GAAAAACGCGAT­ * * **** ****** ** ** * 851.... 900 S. guangdongense G­­GACAGC­­­GT­TCGTGCGTA­GTTTCTAGAAGTCGGTAGCCAC G TG S. longicaudum CB2B G­­GACAGCTTCGT­TCGTGCGTAAGTTTCTAGAAGTCGGTAGCCATTTT S. diaprepesi GCAGACGTAACTGTCTCGTATGTAAGCTTCTTGAAGTCGGCTGCCACAT­ S. glaseri G­­­­TAATTTTTT­GCGTATGTAAGCTTCTTGAAGTCAGT­GTTGCCAG S. longicaudum CWLO5 G­­GACAGCTTCGT­TCGTGCGTAAGTTTCTAGAAGTCGGTAGCCATTTT * * *** *** * **** ****** * * 901.... 950 S. guangdongense G ­­­TGACTCAGCTTGTTTCCGTTGGTCAACGGACGCAC T TGGAACT A ­­ S. longicaudum CB2B AGTTTGACTCAACTTGTTTCCGTTGGTCAACGGACGTACGTG­AACTT­­ S. diaprepesi ­­­­­­GTTCGACC­­­­TTTGCGGGTTGACGAACGCAACTGGAACTTGC S. glaseri CAAGCGTTTGAGCCTGT­ACGGTTCGGCGCGCGACGTAGCTGGGACTT­­ S. longicaudum CWLO5 AGTTTGACTCAACTTGTTTCCGTTGGTCAACGGACGTACGTG­AACTT­­ * * * * *** * ** *** Alignment of partial 28S sequences 201.... 250 S. guangdongense GDC339 TCGGCGTGCGATGCGTGGTATGGCTAAGGTT T ­­­CGCCGGTCTTGAA­G S. longicaudum CB2B TCGGCGTGCGATGCGTGGTATGGCTAGGGTG­­­­CGCCGGTCTTGAA­G S. longicaudum CWL05 TCGGCGTGCGATGCGTGGTATGGCTAGGGTGC­­­­GCCGGTCTTGAA­G S. cubanum TCGGCGTACGATGCGTGGTATGGCTAAGGTTCTGTCGCCGGTCTTGAAAG S. longicaudum USA TCGGCGTGCGATGCGTGGTATGGCTAGGGTGC­­­­GCCGGTCTTGAA­G S. glaseri TCGGCGTACGATGCGTGGTATGGCTAAGGTTCTGTCGCCGGTCTTGAA­G S. longicaudum CH TCGGCGTACGATGCGTGGTATGGCTAAGGTTCTGTCGCCGGTCTTGAA­G ******* ****************** *** ************ * 351.... 400 S. guangdongense GDC339 TGTAGC­TCGATCTACTGA A TTGGGATGCGTTGTCTC T T­GTGGACGGCG S. longicaudum CB2B TGTAGC­TCGATCTACTGACTTGGGATGCGTTGTCTCCT­GTGGACAGCG S. longicaudum CWL05 TGTAGC­TCGATCTACTGACTTGGGATGCGTTGTCTCCT­GTGGACAGCG S. cubanum GGTGAC­GTAAGTTGCTGACTTGGGATGCGCTGTCTTCTTGTGGACGGCG S. longicaudum USA TGTAGC­TCGATCTACTGACTTGGGATGCGTTGTCTCCT­GTGGACAGCG S. glaseri GGTGACGTCAAGTTGCTGACTTGGGATGCGCTGTCTCCT­GTGGACGGCG S. longicaudum CH GGTGACGTAAGTTTGCTGACTTGGGATGCGCTGTCTTCT­GTGGACGGCG ** * * **** ********** ***** * ****** *** __________________________ * No differences found among nematode species. ­ Gaps. TABLE 2. Comparative morphometrics (in µm) of males and infective juveniles of Steinernema guangdongense sp. n and related Steinernema spp. Male Infective juvenile Character S. guangdon­ S. longico­ S. arenarium S. glaseri S. guang­ S. longico­ S. arenar­ S. glaseri gense dum dongense dum ium Present Stock et a l. Kozodoi Poinar Psesent Stock et al. Poinar Poinar (103–132) (79–162) (153–187) (121–178) (71–85) (74–92) (76–86) (87–110)

study	2001	1984	1978	study	2001	1990	1990
n 20	23	­	25	20	28	25	25
Body length 1809	1788	2282	1700	1055	1043	1034	1130

(1627–2126) (1412–2733) (2091–2550) (1500–1900)	(987–1145)	(929–1170)	(724–1408)	(864–1448)
Greatest body width	112 136 188 72 (90–135) (86–194) (184–219) (54–92)	42 (30–48)	37 (34–40)	46 (28–77)	43 (31–50)
EP	120 127 164 145	80	82	83	102

NR 127 151 ­ 132 102 111 109 120 (109–139) (120–176) (99–183) (88–111) (98–129) (100–120) (112–126) ES 162 165 176 160 134 142 138 162 (150–176) (79–192) (173–184) (155–187) (123–144) (134–150) (123–160) (158–168) Tail length 31 30 49 30 91 94 75 78 (T) (24–38) (20–43) (41–57) (28–44) (82–103) (79–105) (64–84) (62–87) Spicule 86 91 84 77 length (SP) (80–94) (72–108) (81–91 (62–90) Gubernacu­ 64 60 55 46 lum length (47–73) (54–65) (49–60) (40–50) (GU) a 25 28. 2 26 29 (22–35) (25.9–30.7) (17–34) (26–35) D% =EP/ES 70 75.4 93 90 59 57.4 55 65 x 100 (67–78) (56–92) (88–102) (54–65) (52.4–62.5) (52–59) (58–71) E% = EP/T x 88 86.9 119 131 100 (74–100) (75.5–104.1) (106–130) (122–138) SW=SP/ 1.75 1.61 2.1 2.56 ABW (1.52–2.16) (1.16–2.25) GS=GU/SP 0.75 0.66 0.65 0.59 (0.59–0.82) (0.56–0.88) (0.60–0.66) ­ not available EP = distance from anterior end to excretory pore. NR = distance from anterior end to nerve ring. ES = distance from anterior end to end of esophagus. ABW = anal body width. MOLECULAR CHARACTERIZATION The lengths of ITS and partial 28S rDNA (flanked by the above­mentioned primers) of S. guangdongense n. sp. GDc339 and S. longicaudum CB2B and CWL05 were 989, 463; 902, 462; 903, 462bp, respectively. The phylogenetic tree of ITS regions ( Fig. 8 ) shows that the 5 nematodes ( S. guangdongense n. sp. S. longicaudum CB2B and CWL05, S. diaprepesi and S. glaseri ) form a monophyletic group. Additionally, the sequence alignment ( Fig. 7 ) of this group shows that S. guangdongense n. sp. has 24 diagnostic character states and differs from its sister taxon, S. longicaudum at 35 (CB2B) and 38 (CWL05) total characters of the ITS sequence ( Tables 3 , 4 ). TABLE 3 : Sequence length of ITS regions, composition, and diagnostic characters of 5 isolates of Steinernema spp.

Species	ITS1	ITS2	A	C	G	T	Diagnostic
(Seq length)	(bp)	(bp)	(%)	(%)	(%)	(%)	character*
S. guangdongense	285	293	24.1	19.6	26.7	29.6	24
(986)
S. longicaudum CB2B	257	292	25.1	19.6	25.8	29.5	5
(955)
S. diaprepesi	301	313	24.9	21.2	24.9	29	91
(1022)
S. glaseri	279	302	23.6	21.8	27.1	27.5	117
(988)
S. longicaudum CWLO05	257	292	24.7	19.9	25.9	29.5	7
(956)

* Diagnostic characters = numbers of characters (in the same column of the alignment) present in one sequence but not in others. TABLE 4. Pairwise distances of ITS regions betwwen taxa. Below the diagonal:Total character differences; above diagonal: Mean character differences (adjusted for missing data).

Species	GUA	CB2B	DIA	GLA	CWL05
S. guangdongense	­	0.03704	0.11191	0.14752	0.04013
S. longicaudum CB2B	35	­	0.10650	0.14952	0.01368
S. diaprepesi	109	100	­	0.16046	0.10957
S. glaseri	140	141	155	­	0.14799
S. longicaudum CWLO05	38	13	103	140	­

FIGURE 8 . Phylogenetic relationships between 17 species of Steinernema with bootstrap analysis of ITS regions. The five species S. diaprepesi , S, glaseri , S. guangdongense , S . longicaudum (strains CB2B and CWL05) form a monophyletic group. Numbers at the nodes represent bootstrap proportion. The new species also can be differentiated from other closely related nematodes by characteristics of its 28S sequence. Phylogenetic tree of 28S partial sequence ( Fig. 9 ) shows that S. guangdongense n. sp. and S. longicaudum comprise a monophyletic group. Pairwise distances from Table 5 can be used to separate the new species from other closely related nematodes. The sequence alignment ( Fig. 7 ) of this group shows that S. guangdongense n. sp. has three diagnostic character states and differs from its sister taxon, S. longicaudum at nine base­pair characters. It is interesting that the pairwise distances show that there is no difference between a strain from USA and two Chinese strains (CB2B and CWL05) of S. longicaudum ( Table 5 ). Also, the distances between S . longicaudum strain CH , and CB2B, CWL0, and USA are 33 base pairs. It is possible that the strain CH was misidentified as a strain of S. longicaudum . The identification of this isolate needs to be reevaluated. FIGURE 9. Phylogenetic relationships between 25 species of Steinernema with bootstrap analysis of partial 28S sequences. The eight species S. guangdongense n. sp. , S. longicaudum (strains CWL05, USA and CB2B) S. glaseri , S. cubanum , S. longicaudum CH, S. arenarium , S. puertoricense and S. karii form a monophyletic group. Numbers at the nodes represent bootstrap proportion. TABLE 5. Pairwise distances of the partial 28S between taxa. Below diagonal: Total character differences. Above diagonal: Mean character differences (adjusted for missing data).

Species	GUA*	GLA*	CWL05	CUB*	ARE*	USA	CB2B	CH
S. guangdongense	­	0.06263	0.01952	0.06061	0.05832	0.01952	0.01952	0.06479
S. glaseri	29	­	0.07143	0.00644	0.03656	0.07143	0.07143	0.01071
S. longicaudum CWL05	9	33	­	0.07359	0.05411	0.00000	0.00000	0.07143
S. cubanum	28	3	34	­	0.04095	0.07359	0.07359	0.01073
S. arenarium	27	17	25	19	­	0.05195	0.05195	0.04516
S. longicaudum USA	9	33	0	34	24	­	0.00000	0.07143
S. longicaudum CB2B	9	33	0	34	24	0	­	0.07143
S. longicaudum CH	30	5	33	5	21	33	33	­

* GUA = guangdongense , GLA = glaseri , CUB = cubanum , ARE = arenarium . Both morphological and molecular studies showed that the new nematode species belongs to S. glaseri group, and is closely related to S. longicaudum (with long body of IJ, morphometrical similarity, small pairwise distances, and monophyletic group). Geographic distribution shows that S. guandongense n. sp. was found in a very humid region (latitude N20.49 , precipitation = 2000mm /year) while S. longicaudum was found in a colder and drier region (latitude N39.50 , precipitation = 700 mm /year). The two nematodes may be derived from the same ancestors; the differences of the two nematodes may be due to their adaptations for their survival in different geographic conditions. A NOTE ON STEINERNEMA SERRATUM While working with S. guangdongense n. sp. we contacted Professor Wang who is one of the authors of S. longicaudum , Shen & Wang, 1992 . In a telephone conversation, we asked him about S. serratum , his answer was, S. serratum is only a strain of S . longicaudum . Our conversation could be summarized in the following letter from Professor Wang: To whom it may concern This is to certify that: 1. The entomopathogenic nematode C8506 strain was isolated from a soil sample collected in an orchard of Laiyang Agricultural University, Shangdong Province, China in 1985 by Dr Shen and myself and it was described as S. longicaudum in 1992; 2. The WL05 strain which was also known as CWL05 in some publications was isolated from the same orchard in 1986 by Dr Liu Jie, this strain was described by Dr Liu as S. serratum in his PhD dissertation; 3. I had successfully crossed C8506 with CWl05. Yours faithfully Prof. Guohang Wang School of Plant Protection Southern Agriculture University of China Professor Wang can be reached at telephone number 86­20­85281910. According to articles No 8, and 9 (11) of the International Code of Zoological Nomenclature, the third edition, a dissertation is not considered as a publication; hence the species name S. serratum in Lius dissertation is not valid. As stated by Prof. Wang in the above letter, he had successfully crossed isolate CWL05 ( S. serratum ) and isolate C8506 ( S. longicaudum ) ; we confirm that the name S. serratum is not valid and the nematode used to described S. serratum was a strain of S. longicaudum .