Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) Author Tedersoo, Leho Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Magurno, Franco 0000-0002-3117-8149 Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland Author Alkahtani, Saad 0000-0001-7381-5110 Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Mikryukov, Vladimir 0000-0003-2786-2690 Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia text MycoKeys 2024 2024-08-09 107 249 271 journal article 10.3897/mycokeys.107.125549 Langduoa dianae Tedersoo sp. nov. Diagnosis. Separation from other species of Langduoa based on the ITS region (positions 87–106 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 617–636 ccctctcggggggctgggga; no mismatch allowed) as indicated in Fig. 8 . Diagnostic barcodes for Langduoa dianae relative to closely-related taxa in ITS 2 and LSU. Type. Soil eDNA sample TUE 128827 ( holotype ); eDNA sequence: EUK 1107335 ( lectotype ); montane grassland in Langduo , Tibet , 29.4 ° N , 94.4 ° E . Description. Other sequences: EUK 1602727 and EUK 1602728 (both from GSMc plot G 5906, stadium grassland soil in Karksi-Nuia, Estonia , 58.10088 ° N , 25.55959 ° E ); EUK 1604031 ( GSMc plot G 4185, Picea - Pinus forest soil in Ristipalo, Estonia , 58.10241 ° N , 27.47874 ° E ); and EUK 1604032 ( GSMc plot G 4766, soil of coppiced garden dominated by Fraxinus and Ulmus in Ruudiküla, Estonia , 58.33630 ° N , 25.78084 ° E ). Etymology. Langduo (Tibetan) refers to type locality; and Diana (Lithuanian) refers to the first name of Diana Marčiulynienė who was the first to record this genus. Notes. Found from grassland soils in Estonia and Tibet, with ITS and LSU sequences differing up to 0.2 %. So far, not found from the roots.