diff --git a/data/13/77/87/137787C07C7613701ABFFF6FB08BFEE3.xml b/data/13/77/87/137787C07C7613701ABFFF6FB08BFEE3.xml new file mode 100644 index 00000000000..dc8dd2e6cef --- /dev/null +++ b/data/13/77/87/137787C07C7613701ABFFF6FB08BFEE3.xml @@ -0,0 +1,120 @@ + + + +The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence + + + +Author + +Wang, Maozhi +0000-0002-4215-939X +Department of Entomology, China Agricultural University, Beijing 100193 China. +chuw5304@gmail.com + + + +Author + +Lai, Yan +0000-0003-3822-8759 +Department of Entomology, China Agricultural University, Beijing 100193 China. + + + +Author + +Liu, Xingyue +Department of Entomology, China Agricultural University, Beijing 100193 China. + +text + + +Zootaxa + + +2025 + +2025-01-16 + + +5570 + + +1 + + +138 +150 + + + + +https://doi.org/10.11646/zootaxa.5570.1.6 + +journal article +10.11646/zootaxa.5570.1.6 +1175-5326 +14734691 +1BB0F512-0B12-476C-9450-2288562E1D2B + + + + + + +Key to species of + +Kuwayamachrysa + + + + + + + + +1. Hind wing costal crossveins brown....................................................................... 2 + + + +- Hind wing costal crossveins mostly pale green ( +Fig. 5A +)....................................... + +K. neptuna + + +sp. nov. + + + + + + + +2. Terga without red stripes; flat pieces of gonapsis with serrated edge ( +Fig. 2F +)............................. … + +K. kichijoi + + + + + +- Red stripes present on terga; flat pieces of gonapsis with smooth edge ( +Fig. 4F +)................. + +K. wujiaoensis + + +sp. nov. + + + + + + + \ No newline at end of file diff --git a/data/13/77/87/137787C07C79137C1ABFF991B4E8FD03.xml b/data/13/77/87/137787C07C79137C1ABFF991B4E8FD03.xml new file mode 100644 index 00000000000..793176226da --- /dev/null +++ b/data/13/77/87/137787C07C79137C1ABFF991B4E8FD03.xml @@ -0,0 +1,252 @@ + + + +The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence + + + +Author + +Wang, Maozhi +0000-0002-4215-939X +Department of Entomology, China Agricultural University, Beijing 100193 China. +chuw5304@gmail.com + + + +Author + +Lai, Yan +0000-0003-3822-8759 +Department of Entomology, China Agricultural University, Beijing 100193 China. + + + +Author + +Liu, Xingyue +Department of Entomology, China Agricultural University, Beijing 100193 China. + +text + + +Zootaxa + + +2025 + +2025-01-16 + + +5570 + + +1 + + +138 +150 + + + + +https://doi.org/10.11646/zootaxa.5570.1.6 + +journal article +10.11646/zootaxa.5570.1.6 +1175-5326 +14734691 +1BB0F512-0B12-476C-9450-2288562E1D2B + + + + + + + +Kuwayamachrysa wujiaoensis + +sp. nov. + + + + + + +( +Figs 3 +, +4 +) + + + + +Diagnosis. +Forewing veins mostly brown but longitudinal veins pale; hind wings with costal crossveins and outer gradate crossveins brown. Abdomen red ventrally, red stripes present dorsally. + + + + +Description. +Body mostly green, 12.00– +13.80 mm +long ( +Fig. 3A, B +). + + +Head. +1.30-1.40 mm +wide (including compound eyes). Mostly green, with genal markings and lateral markings. Mandibles asymmetrical, broad; labial palpomeres marked black, maxillary palpus black apically, brownish and tapered apically. Antenna shorter than forewing, brownish, pale at base; scape and pedicel greenish, unmarked, flagellar setae arranged in four rings, flagellum yellowish, setae brownish ( +Fig. 3B, C +). + + + +FIGURE 3. + +Kuwayamachrysa wujiaoensis + + +sp. nov. + +, holotype male. A. habitus, dorsal view; B. head and prothorax, lateral view; C. head, frontal view. Abbreviations: A, anal veins; C, costa; CuA, cubitus anterior; CuP, cubitus posterior; MA, media anterior; MP, media posterior; PsC, pesudocubitus; PsM, pesudomedia; RA, radius anterior; RP, radius posterior; Sc, subcosta; ig, inner gradate; im, intramedian cell. + + + +Thorax. Greenish, pronotum about as long as wide; setae dark, with brown, broad stripes on lateral pronotum; transverse sulci present. A yellowish longitudinal median stripe present on pro-, meso-, and metanotum ( +Fig. 3B, C +). + +Legs. Greenish, unmarked, covered with short black setae; claws curved, brown. + +Forewing. +13.60-15.10 mm +long. Wing membrane transparent, rounded apically, tegula unmarked; longitudinal veins mostly greenish, base of anal veins greenish, other veins marked brown. Costa area narrow basally, costal crossveins simple, straight, slightly sinuous on third and fourth crossveins, 16 costal crossveins present; basal subcostal crossvein present, crossveins posteriad pterostigma absent; 12 radial crossveins present; intramedian cell ( +im +) triangular, subdistally connected by 1rp-m crossvein; series of gradate corssveins varied in number, three gradate series of crossveins present in most individuals but two present occasionally, number of gradates (inner/ middle/outer: 6/2/7, or inner/outer: 7/8); basal crossveins of first gradate series not meeting PsM; +dcc +open, CuP not forked ( +Fig. 3A +). + + +Hind wing. Pterostigma greenish, veins greenish, but costal crossveins, anterior half of radial crossveins and outer gradate veins marked brown, inner gradate greenish basally and brownish distally; 12 costal crossveins present; seven crossveins between PsC and PsM; two gradate series of crossveins present, number of gradates (inner/outer): 5/7 ( +Fig. 3A +). + + +Abdomen. Greenish; red stripe present on sterna 2-7, brownish markings on terga present; sterna covered with short black setae; spiracles small, round, not enlarged, atria not enlarged ( +Fig. 3A +). + + +Male genitalia. Terminalia broad; tergum 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick setae on ectoproct absent; sterna 8 and 9 fused, regular, without strong apical setae; gonarcus medially fused, lateral arm expanded; entoprocessus slender, slightly curved, bifurcated and slightly expend; mediuncus closely associated with gonarcus, elongate, laterally expended, mediuncus process absent; gonosaccus robust, with gonosetae and spinellae; parameres absent; numerous gonostae present; gonapsis constituted by a pair of asymmetrical lobes, with lateral lobe expanded and right lobe tapering distad, curved; tignum absent ( +Fig. 4A, C, D, E, F +). + + +Female genitalia. Tergum 9 and ectoprocts fused; sternum 7 simple, apically rounded; subgenitale broader than long, attached on a broad membranous structure; spermatheca small, more flat than other; vela thick and elongate; spermathecal twisted ( +Fig. 4B, G, H +). + + + + +Type material. + +Holotype + +, + +CHINA +, +Sichuan +: + +Muli +, +Wujiao +( +屋¶ +), +27.9624°N +, +100.7473°E +, + +2823 m + +, + +24.VII.2020 + +(L), Yuezheng Tu ( +CAU +) + +. + +Paratypes +: +2♂ +2♀ +, same data as holotype ( +CAU +) + +. + + + + +Etymology. +The new species is named after its +type +locality, i.e., Wujiao Village in southwestern +Sichuan +. + + + + +Distribution. +China +( +Sichuan +). + + + + +Remarks. +This new species can be differentiated by the red stripes present on terga, and the smaller size of the gonapsis in the male genitalia. + + + + +FIGURE 4. + +Kuwayamachrysa wujiaoensis + + +sp. nov. + +, scale bar = 5 μm. A. male terminalia, holotype, lateral view; B. female terminalia, lateral view, paratype; C. male genitalia, holotype, frontal ventral view; D. male genitalia, ventral trontal view, holotype, lateral view; E. male genitalia, lateral view, holotype; F. gonapsis, dorsal view, holotype; G. spermatheca, lateral view, paratype; H. subgenitale, ventral view, paratype. Abbreviations: cc, callus cerci; ent, entoprocessus; gl, gonapophysis lateralis; g.ap., gonarcal apodeme; gst, gonosetae; mu, mediuncus; sg, subgenitale; S7, sternum 7; S8+9, sterna 8+9; T7 and T8, terga 7 and 8; T9+e, tergum 9+ectoprocts. + + + + + +DNA barcode sequence + + + +T C G C G A C A G T G AT TAT T T T C A A C TA A C C ATA A G G ATAT T G G TA C AT TATAT T T TAT T T T T G G TAT T T G AT C T G G AT TA G TA G G TA C C A G T T TA A G T T TAT TA AT T C G A G C T G A AT TA G G T C A A C C A G G T T C AT TA AT T G G T G AT G AT C A A AT T TATA AT G TA AT T G T TA C A G C T C AT G C T T T TAT TATA AT T T T C T T TATA G T TATA C C TAT T G TA AT T G G A G G AT T T G G A A A C T G AT TA G T T C C T T TA ATAT TA G C A G C C C C T G ATATA G C T T T C C C T C G A ATA A ATA ATATA A G T T T T T G A AT AT TA C C C C C T T C T T TA A C AT TA C T C C T T G C T T C T T C TATA G T T G A A A G A G G A G C T G G TA C A G G T T G A A C T G T T TAT C C A C C C C T T T C T T C TA G A AT T G C C C AT G C A G G A G C T T C T G T T G AT T TA G C TAT T T T TA G T T TA C AT T TA G C T G G A AT C T C AT C A AT T T TA G G A G C T G TA A AT T T TAT TA C TA C T G TA AT TA ATATA C G T T TA A G T TATATA A C T T TA G AT C G A ATA C C T T TAT T T G T T T G AT C A G T T G T TAT TA C A G C AT TA C T T C T T C +TAT TAT C +T T TA C C T G TAT TA G C T G G A G C TAT TA C TATAT TAT TA A C A G AT C G TA AT T TA A ATA C T T C T T T T T T T G AT C C T G C A G G A G G A G G A G AT C C A AT T T TATAT C A A C AT T TAT T T T G AT T T T T T G G A C AT C C T G A A G T T TATAT T C T AATTTTACCTGGATTTGTTC + + + + \ No newline at end of file diff --git a/data/13/77/87/137787C07C7A13711ABFFD08B639FA78.xml b/data/13/77/87/137787C07C7A13711ABFFD08B639FA78.xml new file mode 100644 index 00000000000..6513ffb9d9c --- /dev/null +++ b/data/13/77/87/137787C07C7A13711ABFFD08B639FA78.xml @@ -0,0 +1,433 @@ + + + +The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence + + + +Author + +Wang, Maozhi +0000-0002-4215-939X +Department of Entomology, China Agricultural University, Beijing 100193 China. +chuw5304@gmail.com + + + +Author + +Lai, Yan +0000-0003-3822-8759 +Department of Entomology, China Agricultural University, Beijing 100193 China. + + + +Author + +Liu, Xingyue +Department of Entomology, China Agricultural University, Beijing 100193 China. + +text + + +Zootaxa + + +2025 + +2025-01-16 + + +5570 + + +1 + + +138 +150 + + + + +https://doi.org/10.11646/zootaxa.5570.1.6 + +journal article +10.11646/zootaxa.5570.1.6 +1175-5326 +14734691 +1BB0F512-0B12-476C-9450-2288562E1D2B + + + + + + + +Kuwayamachrysa neptuna + +sp. nov. + + + + + + +( +Figs 5 +, +6 +) + + + + +Diagnosis. +Forewing veins mostly brown, but longitudinal veins pale; hind wing pale. Abdomen scarlet ventrally, scarlet markings present on terga. + + + + +Description. Body. Mostly green, +12.70-15.10 mm +long ( +Fig. 5A, B, E +). + + +Head. +1.50-1.70 mm +wide (including compound eyes). Green, with genal markings and lateral markings, and with irregular markings on frons between scape (sometimes absent). Mandibles asymmetrical, broad; labial and maxillary palpi yellow, brownish on palpomeres 1-2, slightly tapered apically. Antenna shorter than forewing, brownish; scape and pedicel greenish, unmarked, flagellar setae arranged in four rings, flagellum yellowish, setae brownish ( +Fig. 5B, C, D +). + + +Thorax. Greenish, pronotum as long as wide; setae dark, with brown, broad stripes present on pronotum laterally, two brown markings present on prescutum of metanotum; transverse sulci present. A yellowish longitudinal median stripe, present on pro-, meso-, and metanotum ( +Fig. 5A, B, E +). + +Legs. Greenish, unmarked, covered with short black setae; claws curved, brown. + +Forewing. +14.60 mm +long. Wing membrane transparent, rounded apically, tegula unmarked; longitudinal veins mostly greenish, costal crossveins marked brown or brownish basally, greenish distally, psm-psc crossveins brownish or 1-5 psc-psm crossveins greenish, base of anal veins greenish or marked brown, other veins marked brown. Costal crossveins simple, straight, slightly sinuous on third and fourth crossveins, 22 costal crossveins present; basal subcostal crossvein present, crossveins posteriad pterostigma absent; 13 radial crossveins present; intramedian cell ( +im +) triangular, subdistally connected by 1rp-m crossvein; three gradate series of crossveins present in most individuals but two present occasionally, number of gradates (inner/middle/outer: 7/2/7); basal crossveins of first gradate series not meeting PsM; +dcc +open, CuP not forked ( +Fig. 5A, E +). + + +Hind wing. Pterostigma greenish, veins greenish; 17 costal crossveins present; two gradate series of crossveins, number of gradates (inner/outer): 6/5 ( +Fig. 5A, E +). + + +Abdomen. Greenish; red longitudinal stripe present on sterna 2-7, and sterna covered with short black setae; red stripes and markings present on terga; spiracles small, round, not enlarged, atria not enlarged ( +Fig. 5A, E +). + + +Male genitalia. Tergum 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick setae on ectoproct absent; sterna 8 and 9 fused, regular, without strong apical setae; gonarcus medially fused, lateral arm expanded; entoprocessus robust, slightly curved, bifurcated and slightly expanded; mediuncus closely associated with gonarcus, slender, laterally expanded, mediuncus process absent; gonosaccus robust, with gonosetae and spinellae; parameres absent; numerous gonostae present; gonapsis constituted by a pair of asymmetrical pieces: flat on one side, tapered on the other, slightly curved; tignum absent ( +Fig. 6A, C, D, E, F +). + + +Female genitalia. Tergum 9 and ectoprocts fused; sternum 7 simple, apically rounded; subgenitale broader than long, attached to a broad membranous structure; spermatheca round; vela thick and elongate; spermatheca twisted ( +Fig. 6B, G, H +). + + + + +FIGURE 5. + +Kuwayamachrysa neptuna + + +sp. nov. + +A. habitus, holotype male, dorsal view; B. head and prothorax, holotype male, lateral view; C. head, holotype male, frontal view; D. head, frontal view, without marking on frons, paratype male; E. habitus, paratype female, dorsal view, paratype female. Abbreviations: A, anal veins; C, costa; CuA, cubitus anterior; CuP, cubitus posterior; MA, media anterior; MP, media posterior; PsC, pesudocubitus; PsM, pesudomedia; RA, radius anterior; RP, radius posterior; Sc, subcosta; ig, inner gradate; im, intramedian cell; mg, middle gradate; og, outer gradate. + + + + +Type material. + +Holotype + +, + +CHINA +, +Henan +: + +Luoyang +, +Mt. Baiyunshan +( +白云山 +), +Xiaohuangshan +( +小#山 +), +33.6840°N +, +111.8391°E +, + +1600 m + +, + +11.VII.2020 + +, Weihai Li, Yanhua Yan ( +CAU +) + +. + +Paratypes +: + +CHINA +, +Henan +: + +3♀ +, +Luoyang +, +Mt. Baiyunshan +( +白云山 +), +33.6822°N +, +111.8436°E +, + +1500 m + +, + +10.VII.2020 + +, Wenliang Li ( +CAU +); + + + +Shaanxi + +: +2♂ +, +Zhouzhi +, +Houzhenzi +( +ñḃŦ +), +Laoxiancheng +( +Ɩ县µ +), +107.7596°E +. +33.7933°N +, + +1777 m + +, + +14.VII.2018 + +(L), +Yingnan He +( +CAU +) + +; + +2♂ +, +Foping +, +Daguping +( +k古坪 +), +33.5945°N +, +107.7677°E +, + +1329.2 m + +, + +24.VII.2014 + +(L), +Xiumei Lu +( +CAU +) + +; + +3♀ +, +Nanzheng +, +Liping +( +NJ坪 +), +106.6509°E +, +32.8024°N +, + +1554 m + +, + +3.VII.2018 + +(L), +Yingnan He +( +CAU +) + +; + + +Sichuan +: + +1♀ +, +Muli +, +Wujiao +( +屋¶ +), +27.9624°N +, +100.7473°E +, + +2823 m + +, + +24.VII.2020 + +(L), +Yuezheng Tu +( +CAU +) + +. + + + + +Etymology. +The specific name + +neptuna + +is derived from the Latin name Neptunus, the god of sea, using trident as weapon, referring to the trifurcated frontal marking of the new species. + + + + +Distribution. +China +( +Sichuan +, +Henan +, +Shaanxi +). + + + + +Remarks. +Although the specimens of + +K. neptuna + +we examined show significant variation, such as the markings on the frons and the coloration of the forewing veins, the new species can be distinguished by its greenish hind wing veins, a smaller gonapsis, and mediuncus noticeably more slender than that of other species of + +Kuwayamachrysa + +. Therefore, combining morphological characteristics and molecular evidence ( +Fig. 7 +), we propose + +K. neptuna + +as a new species with variable characteristics, and we suggest that it is the species that + +Lai +et al. +(2024) + +referred to as + +Kuwayamachrysa +sp. 1 + +YLBOLD. + + + + +FIGURE 6. + +Kuwayamachrysa neptuna + + +sp. nov. + +A. male terminalia, holotype, lateral view; B. female terminalia, paratype, lateral view, paratype; C. male genitalia, holotype, frontal ventral view; D. male genitalia, holotype, ventral frontal view, lateral view; E. male genitalia, holotype, lateral view, paratype; F. gonapsis, holotype, dorsal view; G. spermatheca, paratype, lateral view, paratype; H. subgenitale, paratype, ventral view, paratype. Abbreviations: cc, callus cerci; ent, entoprocessus; gl, gonapophysis lateralis; g.ap., gonarcal apodeme; gst, gonosetae; gp, gonapsis; sp, spermatheca; mu, mediuncus; sg, subgenitale; S7, sternum 7; S8+9, sterna 8+9; T7 and T8, terga 7 and 8; T9+e, tergum 9 +ectoprocts. Scale bar = 5 μm. + + + + +FIGURE 7. +Neighbour-joining tree of + +Kuwayamachrysa +species + +based on the COI barcodes. Bootstrap support values higher than 95 are shown on the tree. + + + + + +DNA barcode sequence + + +TCGCGACAGTGATTATTTTCAACTAACCATAAAGATATTGGTACATTATATTTTATTTTTGGAATTTGATC TCTGGATTAGTAGGTACTAGTTTAAGATTATTAATTCGAGCTGAATTAGGTCTCTGGATTAGTAGGTAAA CCAGGTTCATTAATTGGTGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTT TTTATAGTTATACCTATTGTAATTGGAGGATTTGGTAATTGATTAGTTCGGAACAGGTTGAACTGTCTAT CACCCCTTTCTTCTAGAATTGCCCATGCAGGAGCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAGC TGGAATTTCATCAATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGTTTAAGATACATAA CTTTAGATCGAATACCCTTATTTGTTTGATCAGTTGTTATTACAGCATTACTTCTTCTATTATCTTTACCTG TATTAGCAGGAGCTATCACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTTGATCCCGCAGGA GG AGGAGATCCAATTTTATACCAACATTTATTTTGA + + + \ No newline at end of file diff --git a/data/13/77/87/137787C07C7F13781ABFFD55B626F8E4.xml b/data/13/77/87/137787C07C7F13781ABFFD55B626F8E4.xml new file mode 100644 index 00000000000..d773b1325eb --- /dev/null +++ b/data/13/77/87/137787C07C7F13781ABFFD55B626F8E4.xml @@ -0,0 +1,546 @@ + + + +The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence + + + +Author + +Wang, Maozhi +0000-0002-4215-939X +Department of Entomology, China Agricultural University, Beijing 100193 China. +chuw5304@gmail.com + + + +Author + +Lai, Yan +0000-0003-3822-8759 +Department of Entomology, China Agricultural University, Beijing 100193 China. + + + +Author + +Liu, Xingyue +Department of Entomology, China Agricultural University, Beijing 100193 China. + +text + + +Zootaxa + + +2025 + +2025-01-16 + + +5570 + + +1 + + +138 +150 + + + + +https://doi.org/10.11646/zootaxa.5570.1.6 + +journal article +10.11646/zootaxa.5570.1.6 +1175-5326 +14734691 +1BB0F512-0B12-476C-9450-2288562E1D2B + + + + + + + +Kuwayamachrysa kichijoi +(Kuwayama, 1936) + + + + + + + +( +Figs 1 +, +2 +) + + + + + +Chrysopa kichijoi +Kuwayama, 1936: 811 + +. +Type +locality: +Japan +( +Hokkaido +). + + + + + +Mallada qinlingensis +Yang, 1989: 23 + + +. +Type +locality: +China +( +Shaanxi +: Qinling). +syn. nov. + + + + + +Diagnosis. +Forewing veins mostly brown, but longitudinal veins pale; hind wings with costal crossveins, radial crossveins and gradate crossveins brown. Abdomen with greenish terga and red stripe on sterna. + + + + +Material examined. + + +CHINA +, +Shanxi +: + +1♀ +, +Yuncheng +, +Huangguman Reserve +( + +Dzd +幔保护区 + +), +111.9480°N +, +35.3900°E +, + +1299 m + +, + +23.VII.2020 + +, +Rongrong Shen +, +Jingyu Wu +( +CAU +) + +; + +5♂ +8♀ +, +Yuncheng +, +Lishan Reverse +( +历山保 护区 +), +35.4600°N +, +111.9750°E +, + +1316 m + +, + +22-23.VII.2020 + +(L), +Xingyue Liu +, +Rongrong Shen +, +Jingyu Wu +( +CAU +) + +; + + +Shaanxi +: + +2♂ +6♀ +, +Ankang +, +Ningshan +, +Huoditang +( +火地Oi +), +33.4343°N +, +108.4453°E +, + +1528 m + +, + +19.VII.2018 + +(L), +Yingnan He +( +CAU +) + +; + +5♂ +11♀ +, +Zhouzhi +, +Houzhenzi +( +ñḃŦ +), +Laoxiancheng +( +Ɩ县µ +), +33.7933°N +, +107.7596°E +, + +1777 m + +, + +14.VII.2018 + +(L), +Yingnan He +( +CAU +) + +; + +1♂ +2♀ +, +Huyi +( +IJẽ +), +Changping +( +K坪 +), +33.7833°N +, +108.5742°E +, + +456 m + +, + +9-13.VII.2020 + +(L), +Bing Zhang +( +CAU +) + +; + +2♂ +4♀ +, +Weibin +( +DZ滨 +), +Dasanguan +( +kü关 +), +34.2659°N +, +107.0163°E +, + +805 m + +, + +6-8.VII.2020 + +(L), +Bing Zhang +( +CAU +) + +; + +1♂ +1♀ +, +Foping +, +Daguping +( +k古坪 +), +33.5945°N +, +107.7677°E +, + +1329.2 m + +, + +24.VII.2014 + +(L), +Xiumei Lu +( +CAU +) + +; + + +Taiwan +: + +1♂ +, +Huali +, +Xiulin +, +Guanyuan +( +关® +), +24.190°N +, +121.3407°E +, + +2376 m + +, + +19.VI.2019 + +, +Yuchen Zheng +( +CAU +) + +; + +2♂ +, +Hualian +, +Xiulin +, +Guanyuan +( +关® +), + +2376 m + +, + +16.VI.2020 + +, +Yuchen Zheng +( +CAU +) + +. + + + + +Distribution. +China +( +Shanxi +, +Shaanxi +, +Taiwan) +, +Japan +( +Aomori +, +Iwate +, +Fukushima +, +Saitama +, +Yamanashi +, +Nagano +), +South Korea +( +Gangwon +), +Russia +( +Primorskiy +). + + + + +Remarks. +The species + +Apertochrysa qinlingensis + +was originally described by +Yang (1989) +as having the following characters: the presence of markings on gena, the presence of two or three series of gradate crossveins, the red stripes on the sterna 2-7, the absence of the tignum, and the asymmetric gonapsis in the male genitalia, which are largely consistent to the diagnostic characters of + +K. kichijoi + +. Although the +holotype +of + +A. qinlingensis + +is lost, based on the specimens we collected from the type locality of this species and the illustrations given by +Yang (1989) +, we confirm that they are + +A. qinlingensis + +and this species should be treated as a junior synonym of + +K. kichijoi + +. + + + +Apertochrysa joannisi +( +Navás, 1910 +) + +is another potential synonym of + +K. kichijoi + +. This species was originally described by +Navás (1910) +from +Shanghai +(originally spelled as Chang-Hay), +China +. Makarkin (1985) recorded this species from eastern Russian and illustrated the Russian specimens, his illustrations show a specialized gonapsis similar to that of + +K. kichijoi + +. Therefore, the Russian specimens identified as + +A. joannisi + +by Makarkin (1985) probably are + +K. kichijoi + +. However, the genital morphology of the +type +specimen of + +A. joannisi + +(a female) from +China +is unreported. The specimen itself is in the Muséum national d’Histoire naturelle (MNHN) in Paris ( + +Legrand +et al. +2008 + +), and any formal taxonomic treatment related to + +A. joannisi + +must be made after checking the +type +of this species. + + + + +FIGURE 1. + +Kuwayamachrysa kichijoi +(Kuwayama, 1936) + +, male. A. habitus, dorsal view; B. head and prothorax, lateral view; C. head, frontal view. Abbreviations: A, anal veins; C, costa; CuA, cubitus anterior; CuP, cubitus posterior; MA, media anterior; MP, media posterior; PsC, pesudocubitus; PsM, pesudomedia; RA, radius anterior; RP, radius posterior; Sc, subcosta; ig, inner gradate; im, intramedian cell; mg, middle gradate; og, outer gradate. + + + + + +DNA barcode sequence + + +TCGCGACAATGATTGTTTTCAACTAACCATAAGGATATTGGTACATTATATTTTATTTTTG G TAT T T G AT C T G G AT TA G TA G G TA C TA G T T TA A G T T TAT TA AT T C G A G C T G A AT TA G G T C A A C C A G G T T C AT TA AT T G G T G AT G AT C A A AT T TATA AT G TA AT T G T TA C A G C T C AT G C C T TTATTATAATTTTTTTTATAGTTATACCAATTGTAATTGGGGGTTTTGGTAATTGATTAGTT CCTTTAATATTAGCGGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGAA TATTACCCCCTTCTTTAACATTACTTCTTGCTTCTTCTATAGTAGAAAGAGGAGCTGGAA C A G G T T G A A C T G T T TAT C C A C C T C T T T C C T C TA G A AT T G C T C AT G C A G G A G C T T C T G T T GATTTAGCTATTTTTAGTTTACATCTAGCTGGTATTTCTTCAATTTTAGGAGCTGTAAATT TTATTACTACTGTAATTAATATACGACTAAGTTATATAACTTTAGATCGAATACCTCTATTT GTTTGATCTGTTGTTATTACAGCATTATTATTACTTTTATCATTACCTGTATTAGCAGGAGCTATTACTAT TATTAACTGATCGTAATTTAAACACTTCTTTTTTTGA + + + \ No newline at end of file diff --git a/data/13/77/87/137787C07C7F13791ABFFEDFB7DEFDF6.xml b/data/13/77/87/137787C07C7F13791ABFFEDFB7DEFDF6.xml new file mode 100644 index 00000000000..2aaf5ab8a47 --- /dev/null +++ b/data/13/77/87/137787C07C7F13791ABFFEDFB7DEFDF6.xml @@ -0,0 +1,112 @@ + + + +The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence + + + +Author + +Wang, Maozhi +0000-0002-4215-939X +Department of Entomology, China Agricultural University, Beijing 100193 China. +chuw5304@gmail.com + + + +Author + +Lai, Yan +0000-0003-3822-8759 +Department of Entomology, China Agricultural University, Beijing 100193 China. + + + +Author + +Liu, Xingyue +Department of Entomology, China Agricultural University, Beijing 100193 China. + +text + + +Zootaxa + + +2025 + +2025-01-16 + + +5570 + + +1 + + +138 +150 + + + + +https://doi.org/10.11646/zootaxa.5570.1.6 + +journal article +10.11646/zootaxa.5570.1.6 +1175-5326 +14734691 +1BB0F512-0B12-476C-9450-2288562E1D2B + + + + + + +Genus + +Kuwayamachrysa +Tsukaguchi & Tago, 2018 + + + + + + + + + + +Kuwayamachrysa +Tsukaguchi & Tago, 2018: 71 + + +. + + + + + +Type +species: + +Chrysopa kichijoi +Kuwayama, 1936 + +, by original designation. + + + + +Diagnosis. +Medium-sized green lacewings; body color mostly greenish. Head with black markings on lateral clypeus and gena, frons marked or not; palpus tapered apically, mandibles broad, asymmetrical. Pronotum with brown stripes laterally, meso- and metanotum unmarked. Sterna with red stripe, tergum marked or not. Male genitalia with asymmetrical gonapsis; tignum absent. + + + + +Distribution. +Palearctic and Oriental regions. + + + + \ No newline at end of file