From f93ed5ffbc7399933378480fe739daf3842d2b06 Mon Sep 17 00:00:00 2001 From: ggserver Date: Tue, 6 Aug 2024 04:14:16 +0000 Subject: [PATCH] Add updates up until 2024-08-06 04:11:59 --- .../DC/0385DC3DFFA5B44C8096E776FEEDF866.xml | 101 ++ .../DC/0385DC3DFFA6B44F8096E098FC5EFBE0.xml | 203 ++++ .../DC/0385DC3DFFA6B44F8096E774FCB2F82D.xml | 80 ++ .../DC/0385DC3DFFA7B44E8096E098FEA8FBAD.xml | 193 ++++ .../87/038787808E13FF911AD5DDFAB0A9FC5D.xml | 124 +++ .../87/038787808E13FF931AD5D90CB098FDEA.xml | 738 +++++++++++++ .../87/038787808E19FF9D1AD5D9E4B295FAAE.xml | 748 +++++++++++++ .../87/038787808E1FFF9E1AD5D85FB6ECFD0C.xml | 568 ++++++++++ .../2E/03922E4FED5AFFA3FF49F975004AF8FD.xml | 284 +++++ .../87/039387C71E43EE5E2AAF44994908FDCB.xml | 186 ++++ .../87/039387C71E46EE542AAF46FB4966F8AB.xml | 64 ++ .../87/039387C71E47EE512AAF41C1484FFBD1.xml | 870 ++++++++++++++++ .../87/039387C71E55EE442AAF42394836FA7A.xml | 687 ++++++++++++ .../5C/039C5C52FFD5944CFF456F36FE86FD25.xml | 368 +++++++ .../87/03A187C0FFE5634096D5FCECFD15ADCA.xml | 288 +++++ .../87/03A187C0FFE6634096D5F8F2FEECA889.xml | 194 ++++ .../87/03A187C0FFE6634396D5FD34FAC1AD63.xml | 284 +++++ .../87/03A187C0FFEB634F96D5F8BCFCB7AE59.xml | 254 +++++ .../87/03A187C0FFEF634A96D5FC65FE7BAD63.xml | 246 +++++ .../87/03A187C0FFEF634E96D5F8F2FE14A8C4.xml | 209 ++++ .../87/03AA87AFFF80FFB95CE6F8A5FE04FE73.xml | 981 ++++++++++++++++++ .../87/03AA87AFFF80FFBD5CE6FE68FD02F935.xml | 179 ++++ .../F8/03B7F81454605244FF68F872FAA1FF6E.xml | 118 +++ .../F8/03B7F81454605247FF68F91BFB59F8C5.xml | 98 ++ .../F8/03B7F81454605247FF68F9C1FAA2F939.xml | 85 ++ .../F8/03B7F81454605247FF68FAF3FC4BFA0F.xml | 101 ++ .../F8/03B7F81454605247FF68FB7AFBE9FB44.xml | 85 ++ .../F8/03B7F81454605247FF68FC21FB52FBDD.xml | 124 +++ .../F8/03B7F81454605247FF68FCA8FBE9FC13.xml | 91 ++ .../F8/03B7F81454605247FF68FD53FC2DFCAC.xml | 85 ++ .../F8/03B7F81454605247FF68FDDAFC2DFD25.xml | 90 ++ .../F8/03B7F81454605247FF68FE5CFC2DFDBE.xml | 90 ++ .../F8/03B7F81454605247FF68FEE5FAFDFE37.xml | 106 ++ .../F8/03B7F81454615246FF68F890FC49F86A.xml | 85 ++ .../F8/03B7F81454615246FF68F97CFC62F8A0.xml | 98 ++ .../F8/03B7F81454615246FF68FA48FC82F994.xml | 96 ++ .../F8/03B7F81454615246FF68FAF3FB79FACB.xml | 93 ++ .../F8/03B7F81454615246FF68FB7AFA95FB44.xml | 87 ++ .../F8/03B7F81454615246FF68FC21FCE8FBDD.xml | 102 ++ .../F8/03B7F81454615246FF68FCA8FAD1FC13.xml | 85 ++ .../F8/03B7F81454615246FF68FD70FBCEFCAC.xml | 98 ++ .../F8/03B7F81454615246FF68FDFBFA2CFDC3.xml | 91 ++ .../F8/03B7F81454615246FF68FE62FB13FE5C.xml | 95 ++ .../F8/03B7F81454615246FF68FF29FBA2FED5.xml | 130 +++ .../F8/03B7F81454625245FF68F93AFAC0F8C8.xml | 102 ++ .../F8/03B7F81454625245FF68FF29FD63FEF4.xml | 91 ++ .../F8/03B7F8145462524AFF68F84FFB6FFF6E.xml | 100 ++ .../F8/03B7F81454635244FF68F84AFBC4F7B5.xml | 91 ++ .../F8/03B7F81454635244FF68F974FB92F88A.xml | 104 ++ .../F8/03B7F81454635244FF68FA22FBDDF99C.xml | 94 ++ .../F8/03B7F81454635244FF68FE3FFBCFFD80.xml | 89 ++ .../F8/03B7F81454635244FF68FEE5FC3EFE19.xml | 122 +++ .../F8/03B7F81454665241FF68F8B6FE35F84C.xml | 116 +++ .../F8/03B7F81454665241FF68F982FEC4F882.xml | 132 +++ .../F8/03B7F81454665241FF68FA6EFD64F9F6.xml | 110 ++ .../F8/03B7F81454665241FF68FB37FE66FAEA.xml | 107 ++ .../F8/03B7F81454665241FF68FBDFFCFAFB01.xml | 96 ++ .../F8/03B7F81454665241FF68FC64FE5DFBB8.xml | 89 ++ .../F8/03B7F81454665241FF68FD0DFDECFCEF.xml | 91 ++ .../F8/03B7F81454665241FF68FDFBFA8BFD07.xml | 130 +++ .../F8/03B7F81454665241FF68FE62FCC3FE5C.xml | 85 ++ .../F8/03B7F81454665241FF68FF29FD2AFED5.xml | 112 ++ .../F8/03B7F81454675240FF68F86FFE8BF7B1.xml | 91 ++ .../F8/03B7F81454675240FF68F97BFB13F8A5.xml | 93 ++ .../F8/03B7F81454675240FF68F9E2FBCEF9DC.xml | 89 ++ .../F8/03B7F814546D524AFF68FE5CFB44FC8E.xml | 183 ++++ .../F8/03B7F814546D524AFF68FEE5FB99FE37.xml | 100 ++ .../4F/03B94F0AFF950348D4FE699D6A178D21.xml | 102 ++ .../4F/03B94F0AFF950348D4FE6D556CFA8C70.xml | 147 +++ .../4F/03B94F0AFF95034AD4FE68716C4A8B72.xml | 153 +++ .../4F/03B94F0AFF97034AD4FE6D1A6FDF88E7.xml | 78 ++ .../4F/03B94F0AFF97034AD4FE6DB26C2D89F3.xml | 85 ++ .../4F/03B94F0AFF97034AD4FE6E266C778B9E.xml | 102 ++ .../87/03BB87F38427614BD5CFF91FFD3FFB75.xml | 184 ++++ .../F1/03BBF11A4311FFF0FF1E5A79FC84FEA6.xml | 175 ++++ .../CC/03BDCC27FFA0EE2FC29FEDEEFAC7FD4E.xml | 772 ++++++++++++++ .../CC/03BDCC27FFA3EE2EC29FEB60FE60FDA8.xml | 187 ++++ .../CC/03BDCC27FFA3EE2FC29FEE0EFDF8FA06.xml | 154 +++ .../CC/03BDCC27FFA6EE2DC29FE88EFDC0FE7E.xml | 159 +++ .../CC/03BDCC27FFA7EE2BC29FE9BDFD81F800.xml | 147 +++ .../CC/03BDCC27FFA7EE2BC29FEDCCFBC8FBB5.xml | 148 +++ .../CC/03BDCC27FFA8EE24C29FEDEEFDA5FBFC.xml | 242 +++++ .../CC/03BDCC27FFA8EE27C29FE97AFCB4FBD3.xml | 652 ++++++++++++ .../CC/03BDCC27FFA9EE25C29FE927FADAF82D.xml | 236 +++++ .../CC/03BDCC27FFA9EE25C29FEDEEFA82FC3B.xml | 157 +++ .../CC/03BDCC27FFAAEE26C29FEFCAFE09F86E.xml | 257 +++++ .../CC/03BDCC27FFABEE26C29FEA6CFE41FD6C.xml | 156 +++ .../CC/03BDCC27FFABEE27C29FE949FE52F902.xml | 163 +++ .../CC/03BDCC27FFACEE20C29FEDEEFD45FC87.xml | 154 +++ .../CC/03BDCC27FFACEE20C29FEEE3FE09F84F.xml | 345 ++++++ .../CC/03BDCC27FFB1EE3DC29FE918FE4FF8A8.xml | 193 ++++ .../CC/03BDCC27FFB1EE3DC29FEDEEFDC0FC1F.xml | 193 ++++ .../CC/03BDCC27FFB2EE31C29FE99FFCCAFEDB.xml | 209 ++++ .../CC/03BDCC27FFB2EE3EC29FEC9BFAA3FB93.xml | 161 +++ .../CC/03BDCC27FFB3EE3EC29FE958FE70FE9C.xml | 297 ++++++ .../CC/03BDCC27FFB3EE3FC29FEDEEFB54FBDE.xml | 225 ++++ .../CC/03BDCC27FFB9EE35C29FE927FAFCF82D.xml | 213 ++++ .../CC/03BDCC27FFB9EE35C29FEDEEFAFEFC38.xml | 183 ++++ .../CC/03BDCC27FFBAEE36C29FEDEEFAC3FCA5.xml | 149 +++ .../CC/03BDCC27FFBDEE31C29FE86DFDCAF7F8.xml | 163 +++ .../87/03C987E0FF897221FF73F91C8C2D9EB4.xml | 344 ++++++ .../F9/03CBF90BFF844B66C7B09C3717705DA8.xml | 239 +++++ .../F9/03CBF90BFF8B4B67C7B09B2A122F5E52.xml | 294 ++++++ .../F9/03CBF90BFF8C4B68C7B098CD14265CBC.xml | 306 ++++++ .../D7/03CDD70DC360FFEBFF4FF99995D4FE49.xml | 238 +++++ .../D7/03CDD70DC363FFEBFF4FFDB493F8FC21.xml | 186 ++++ .../87/03D187FECC02FFAA548EFBE2FF63FB56.xml | 132 +++ .../87/03D187FECC02FFAA548EFCD3FE2CFBAA.xml | 119 +++ .../87/03D187FECC02FFAA548EFE62FE14FD7A.xml | 130 +++ .../87/03D187FECC02FFAA548EFEFBFC09FE68.xml | 115 ++ .../87/03D187FECC02FFAA548EFF52FB9DFEE1.xml | 134 +++ .../87/03D187FECC04FFAC548EF942FCBEF8D7.xml | 156 +++ .../87/03D187FECC04FFAC548EFB4CFDE1F9C5.xml | 167 +++ .../87/03D187FECC04FFAC548EFB86FC25FBCF.xml | 112 ++ .../87/03D187FECC04FFAC548EFCF0FEB0FC44.xml | 128 +++ .../87/03D187FECC04FFAC548EFDEDFD62FD58.xml | 132 +++ .../87/03D187FECC04FFAC548EFE26FE76FDF3.xml | 135 +++ .../87/03D187FECC05FFAD548EF942FC5FF8D7.xml | 148 +++ .../87/03D187FECC05FFAD548EF99FFBF8F9C5.xml | 108 ++ .../87/03D187FECC05FFAD548EFAA9FCB9FA3F.xml | 107 ++ .../87/03D187FECC05FFAD548EFBE2FB3AFB71.xml | 108 ++ .../87/03D187FECC05FFAD548EFC5AFB80FBEE.xml | 122 +++ .../87/03D187FECC05FFAD548EFD76FF5CFCFD.xml | 122 +++ .../87/03D187FECC05FFAD548EFDCFFC16FD15.xml | 106 ++ .../87/03D187FECC05FFAD548EFE18FB91FE4E.xml | 108 ++ .../87/03D187FECC05FFAD548EFF52FB80FE80.xml | 110 ++ .../87/03D9878D4010B852E1D5FDB98A191D3D.xml | 378 +++++++ .../BE/03DDBE2194645130FF69FBC90D99F91B.xml | 170 +++ .../BE/03DDBE2194645130FF69FD5C0ED0FBF8.xml | 153 +++ .../BE/03DDBE2194645133FF69F8A90DCBFE1C.xml | 202 ++++ .../BE/03DDBE2194675133FF69F9F20BE0F80C.xml | 192 ++++ .../BE/03DDBE2194675133FF69FB8E0A5CF9D4.xml | 216 ++++ .../BE/03DDBE2194675133FF69FDAA0EFEFBF8.xml | 187 ++++ .../87/03EB87B6E118FFA2FF6FFEC61FA0FDC9.xml | 355 +++++++ .../01/03EC016B1170FFF70CB9FD954E17F9C9.xml | 134 +++ .../01/03EC016B1172FFF70CB9FEE64CF0FD9E.xml | 264 +++++ .../87/03EC87DDFFCAFFA8449DFC47093458C6.xml | 81 +- .../87/03EC87DDFFCBFFA8449DFC0209405C0D.xml | 79 +- .../87/087687C68311FF84FF0E00B24AB3FE41.xml | 170 +++ .../87/087687C68311FF87FF0E05014C6CF953.xml | 106 ++ .../87/087687C68314FF82FF0E05774D30F851.xml | 171 +++ .../87/087687C68315FF83FF0E020E4C7BF823.xml | 145 +++ .../87/087687C68316FF80FF0E02C44D47F81C.xml | 142 +++ .../87/087687C68316FF80FF0E06974B82FB8A.xml | 147 +++ .../87/087687C68317FF81FF0E020E4D46F805.xml | 130 +++ .../87/087687C68318FF8EFF0E02004B03FB77.xml | 82 ++ .../87/087687C68318FF8EFF0E02894D6CFA5B.xml | 85 ++ .../87/087687C68318FF8EFF0E059F4BD2FBEC.xml | 84 ++ .../87/087687C68318FF8EFF0E07E24CA6FDC8.xml | 80 ++ .../87/087687C68318FF8FFF0E03944C54FE2A.xml | 146 +++ .../87/087687C6831BFF82FF0E007F4B42FD1E.xml | 199 ++++ .../87/1B4D879A0759D02700F8FF7E277D4660.xml | 224 ++++ .../87/1B4D879A075BD02500F8FA68262444BD.xml | 114 ++ .../87/1B4D879A075BD02600F8F89920C645B7.xml | 276 +++++ .../87/1F6F87F72660FFC9FF19F8BD6279E4CB.xml | 84 ++ .../87/1F6F87F72664FFCDFF19F8A66279E4D7.xml | 84 ++ .../87/1F6F87F72666FFCDFF19FF1D670FE45E.xml | 442 ++++++++ .../5A/26185A62FFCEFFCC5DF384A97229FA2F.xml | 516 +++++++++ .../22/2A5A221EFFD15177FF2AED3AFBD4D583.xml | 485 +++++++++ .../22/2A5A221EFFD35172FF2AEFFEFC38D54F.xml | 272 +++++ .../31/2F1D3109FFEC6E77FF79FEB0FB4244F6.xml | 237 +++++ .../31/2F1D3109FFEF6E77FF79F902FDE24610.xml | 242 +++++ .../87/30348788E239FFAAFF39FED7B02DFB51.xml | 141 +++ .../57/36725714382CFF8A01BCF88BFD68FD1B.xml | 138 +++ .../57/36725714382CFF8B01BCFA62FBC9FB15.xml | 183 ++++ .../57/36725714382CFF8B01BCFBF6FD62F92D.xml | 165 +++ .../57/36725714382CFF8B01BCFE57FD67FDBE.xml | 115 ++ .../57/36725714382DFF8501BCF8E4FD86FEEF.xml | 277 +++++ .../57/36725714382DFF8A01BCFAC3FE44FAB6.xml | 183 ++++ .../57/367257143836FF9201BCF9C9FE00FBA2.xml | 724 +++++++++++++ .../EB/395FEB71FFE5FFB254AAFBB0FB64FAC5.xml | 222 ++++ .../EB/395FEB71FFE7FFB254AAFA39FBCEF9F5.xml | 113 ++ .../87/3A2D87A5181A227887B4982EFE75F808.xml | 250 +++++ .../87/404887BE8E129E15E688F9DE26A0F9D8.xml | 824 +++++++++++++++ .../87/404887BE8E169E16E688F9DE26A0FB2E.xml | 661 ++++++++++++ .../6B/601D6B40F250E36DFF3EF98BFEAAFE60.xml | 259 +++++ .../AD/877AAD7B7F7FFF8F1481FDDFFBD4F832.xml | 212 ++++ .../87/8B0C87FA5859FFB765B8FA1BFD47CE8B.xml | 836 +++++++++++++++ .../87/8B0C87FA585AFFB665B8F8A1FDFDCF85.xml | 659 ++++++++++++ .../87/8B0C87FA585AFFB765B8FB20FB4DCD08.xml | 290 ++++++ .../87/8B0C87FA585BFFB16732F992FD85CAE4.xml | 241 +++++ .../87/8B0C87FA585CFFB065B8FA34FAF9CAE4.xml | 292 ++++++ .../87/8B0C87FA585CFFB165B8FEF6FE0BCF85.xml | 531 ++++++++++ .../87/8B0C87FA585DFFB065B8F8BEFCF9CDD8.xml | 139 +++ .../87/8B0C87FA585DFFB065B8FE6BFD34CCCF.xml | 582 +++++++++++ .../87/8B0C87FA585DFFB06732FEECFDFACBB4.xml | 125 +++ .../87/8B0C87FA585EFFB26732FEF6FC15CB93.xml | 691 ++++++++++++ .../87/8B0C87FA585FFF8D65B8FB8FFD79CB18.xml | 555 ++++++++++ .../87/8B0C87FA585FFFB26732FE0EFB31CE10.xml | 303 ++++++ .../87/8B0C87FA5860FF8C65B8F83EFD4AC80A.xml | 161 +++ .../87/8B0C87FA5860FF8D65B8F94DFB8FCDAD.xml | 219 ++++ .../87/8B0C87FA5860FF8D65B8FEB1FA89CC5D.xml | 552 ++++++++++ .../92/993D9254FFF68C1BD9E5FB30EB3F29ED.xml | 256 +++++ .../87/C21187BFCD562A3BFF79FBC84A21F85C.xml | 785 ++++++++++++++ .../C5/C675C50EFFEEFF8169B00C699D1BFDDB.xml | 279 +++++ .../55/C7235500FFD8F50DFF07FEE366DCEA80.xml | 142 +++ .../55/C7235500FFD8F50EFF07FB54641BEFB6.xml | 130 +++ .../B1/C97AB10B4B33FFF662D27399FDC9683E.xml | 311 ++++++ .../B1/C97AB10B4B34FFF462D276F8FABF6C29.xml | 193 ++++ .../B1/C97AB10B4B35FFF662D2710EFDC96F96.xml | 270 +++++ .../B1/C97AB10B4B35FFF762D276B7FE9A687A.xml | 128 +++ .../B1/C97AB10B4B37FFF562D27527FE956DDC.xml | 227 ++++ .../00/DF750049FFC6F352FF10F91EFF47F84B.xml | 95 ++ .../00/DF750049FFC6F352FF10F9E1FE1FF911.xml | 117 +++ .../00/DF750049FFC6F352FF10FA89FDEAFA3D.xml | 84 ++ .../00/DF750049FFC6F352FF10FC42FE84FB90.xml | 95 ++ .../00/DF750049FFC6F352FF10FCEAFD58FC5D.xml | 79 ++ .../00/DF750049FFC6F352FF10FE1CFDCEFD04.xml | 107 ++ .../00/DF750049FFC6F352FF10FF2CFCC8FE16.xml | 93 ++ .../00/DF750049FFC8F35CFF10F9C3FC37F977.xml | 83 ++ .../00/DF750049FFC8F35CFF10FA89FE32F9DE.xml | 97 ++ .../00/DF750049FFC8F35CFF10FB7FFD69FAE4.xml | 112 ++ .../00/DF750049FFC8F35CFF10FC42FDCEFBB1.xml | 94 ++ .../00/DF750049FFC8F35CFF10FD56FB4AFC5D.xml | 137 +++ .../00/DF750049FFC8F35CFF10FE3AFEC0FD49.xml | 90 ++ .../00/DF750049FFC8F35CFF10FEEFFC70FE75.xml | 103 ++ .../00/DF750049FFC9F35DFF10F95AFC97F8A9.xml | 130 +++ .../00/DF750049FFC9F35DFF10F9E1FD1AF955.xml | 79 ++ .../00/DF750049FFC9F35DFF10FA89FD23FA3D.xml | 79 ++ .../00/DF750049FFC9F35DFF10FB7FFF21FAE4.xml | 95 ++ .../00/DF750049FFC9F35DFF10FC42FBC2FBB1.xml | 119 +++ .../00/DF750049FFC9F35DFF10FD56FE73FC5D.xml | 116 +++ .../00/DF750049FFC9F35DFF10FE3AFA93FD49.xml | 119 +++ .../00/DF750049FFC9F35DFF10FF2CFEBFFE75.xml | 107 ++ .../00/DF750049FFCBF35FFF10F987FC86F932.xml | 89 ++ .../00/DF750049FFCBF35FFF10FA2EFB04F99A.xml | 90 ++ .../00/DF750049FFCBF35FFF10FB13FACCFA41.xml | 115 ++ .../00/DF750049FFCBF35FFF10FBF8FBFAFB0F.xml | 120 +++ .../00/DF750049FFCBF35FFF10FD93FEAFFCE2.xml | 115 ++ .../00/DF750049FFD2F346FF10F93CFB2FF84B.xml | 122 +++ .../00/DF750049FFD2F346FF10FA2EFEB3F977.xml | 128 +++ .../00/DF750049FFD2F346FF10FB32FAFEFA41.xml | 127 +++ .../00/DF750049FFD2F346FF10FC05FDCEFB6D.xml | 86 ++ .../00/DF750049FFD2F346FF10FCCBFEAFFC19.xml | 98 ++ .../00/DF750049FFD2F346FF10FDDFFCA6FD26.xml | 115 ++ .../00/DF750049FFD2F346FF10FE85FBF4FDD2.xml | 111 ++ .../00/DF750049FFD2F346FF10FF2CFB6CFE9F.xml | 87 ++ .../00/DF750049FFD5F341FF10F91EFDCEF806.xml | 99 ++ .../00/DF750049FFD5F341FF10F9A5FBCEF911.xml | 85 ++ .../00/DF750049FFD5F341FF10FA6AFC15F9F8.xml | 106 ++ .../00/DF750049FFD5F341FF10FB32FDC1FA86.xml | 81 ++ .../00/DF750049FFD5F341FF10FBF8FB38FB6D.xml | 105 ++ .../00/DF750049FFD5F341FF10FCEAFDCEFC3A.xml | 108 ++ .../00/DF750049FFD5F341FF10FDDFFBA4FD04.xml | 108 ++ .../00/DF750049FFD5F341FF10FEC1FDCEFDD2.xml | 102 ++ .../00/DF750049FFD6F342FF10F9C3FDCEF933.xml | 84 ++ .../00/DF750049FFD6F342FF10FA89FAD0F9DE.xml | 118 +++ .../00/DF750049FFD6F342FF10FB9CFDCEFAE4.xml | 93 ++ .../00/DF750049FFD6F342FF10FD56FDCEFC5D.xml | 86 ++ .../00/DF750049FFD6F342FF10FE1CFAB1FD49.xml | 112 ++ .../00/DF750049FFD6F342FF10FF2CFF7DFE16.xml | 144 +++ .../00/DF750049FFD8F34CFF10F8FFFCBCF84B.xml | 89 ++ .../00/DF750049FFD8F34CFF10F987FAD1F932.xml | 90 ++ .../00/DF750049FFD8F34CFF10FA6AFD1CF99A.xml | 116 +++ .../00/DF750049FFD8F34CFF10FB32FDF5FA86.xml | 79 ++ .../00/DF750049FFD8F34CFF10FBF8FA1AFB6D.xml | 105 ++ .../00/DF750049FFD8F34CFF10FCCBFD7DFC3A.xml | 119 +++ .../00/DF750049FFD8F34CFF10FDB1FD48FD26.xml | 99 ++ .../00/DF750049FFD8F34CFF10FE66FD12FDEC.xml | 99 ++ .../00/DF750049FFD8F34CFF10FF2CFE06FEB9.xml | 100 ++ .../00/DF750049FFDAF34EFF10F91EFDCEF806.xml | 100 ++ .../00/DF750049FFDAF34EFF10FA00FD6EF911.xml | 138 +++ .../00/DF750049FFDAF34EFF10FB13FEB4FA63.xml | 109 ++ .../00/DF750049FFDAF34EFF10FBF8FDCEFB0F.xml | 94 ++ .../00/DF750049FFDAF34EFF10FD08FB95FC3A.xml | 173 +++ .../00/DF750049FFDAF34EFF10FDFDFF5EFD6B.xml | 93 ++ .../00/DF750049FFDAF34EFF10FE85FDFAFE30.xml | 79 ++ .../00/DF750049FFDAF34EFF10FF2CFDEAFE9F.xml | 84 ++ .../00/DF750049FFDEF34AFF10F88BFE32F7D9.xml | 97 ++ .../72/E021721EFF85D446BB8BF8E83BF2A961.xml | 303 ++++++ .../72/E021721EFF8BD441BB8BF8A43B1EA926.xml | 332 ++++++ .../72/E021721EFF8BD44DBB8BFB823B59AB86.xml | 186 ++++ .../72/E021721EFF99D45EBB8BFAAE3EFDAC80.xml | 212 ++++ .../72/E021721EFF99D45FBB8BFF773D79A998.xml | 262 +++++ .../72/E021721EFF9ED458BB8BFD843C32AA79.xml | 253 +++++ .../87/E60B87CDFFE0E434B5C3FE2BFCF6FE55.xml | 76 ++ .../87/E60B87CDFFE4E430B5C3FD92FB7BFAAA.xml | 276 +++++ .../87/EA3887ECFF98451AFF2A15166C7AB21E.xml | 391 +++++++ .../87/EA3887ECFF9A451AFF2A11666EC4B7F2.xml | 75 ++ .../FA/F016FA47FFBBFF875FAAFED8F0ECF874.xml | 425 ++++++++ 280 files changed, 53523 insertions(+), 79 deletions(-) create mode 100644 data/03/85/DC/0385DC3DFFA5B44C8096E776FEEDF866.xml create mode 100644 data/03/85/DC/0385DC3DFFA6B44F8096E098FC5EFBE0.xml create mode 100644 data/03/85/DC/0385DC3DFFA6B44F8096E774FCB2F82D.xml create mode 100644 data/03/85/DC/0385DC3DFFA7B44E8096E098FEA8FBAD.xml create mode 100644 data/03/87/87/038787808E13FF911AD5DDFAB0A9FC5D.xml create mode 100644 data/03/87/87/038787808E13FF931AD5D90CB098FDEA.xml create mode 100644 data/03/87/87/038787808E19FF9D1AD5D9E4B295FAAE.xml create mode 100644 data/03/87/87/038787808E1FFF9E1AD5D85FB6ECFD0C.xml create mode 100644 data/03/92/2E/03922E4FED5AFFA3FF49F975004AF8FD.xml create mode 100644 data/03/93/87/039387C71E43EE5E2AAF44994908FDCB.xml create mode 100644 data/03/93/87/039387C71E46EE542AAF46FB4966F8AB.xml create mode 100644 data/03/93/87/039387C71E47EE512AAF41C1484FFBD1.xml create mode 100644 data/03/93/87/039387C71E55EE442AAF42394836FA7A.xml create mode 100644 data/03/9C/5C/039C5C52FFD5944CFF456F36FE86FD25.xml create mode 100644 data/03/A1/87/03A187C0FFE5634096D5FCECFD15ADCA.xml create mode 100644 data/03/A1/87/03A187C0FFE6634096D5F8F2FEECA889.xml create mode 100644 data/03/A1/87/03A187C0FFE6634396D5FD34FAC1AD63.xml create mode 100644 data/03/A1/87/03A187C0FFEB634F96D5F8BCFCB7AE59.xml create mode 100644 data/03/A1/87/03A187C0FFEF634A96D5FC65FE7BAD63.xml create mode 100644 data/03/A1/87/03A187C0FFEF634E96D5F8F2FE14A8C4.xml create mode 100644 data/03/AA/87/03AA87AFFF80FFB95CE6F8A5FE04FE73.xml create mode 100644 data/03/AA/87/03AA87AFFF80FFBD5CE6FE68FD02F935.xml create mode 100644 data/03/B7/F8/03B7F81454605244FF68F872FAA1FF6E.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68F91BFB59F8C5.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68F9C1FAA2F939.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FAF3FC4BFA0F.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FB7AFBE9FB44.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FC21FB52FBDD.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FCA8FBE9FC13.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FD53FC2DFCAC.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FDDAFC2DFD25.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FE5CFC2DFDBE.xml create mode 100644 data/03/B7/F8/03B7F81454605247FF68FEE5FAFDFE37.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68F890FC49F86A.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68F97CFC62F8A0.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FA48FC82F994.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FAF3FB79FACB.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FB7AFA95FB44.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FC21FCE8FBDD.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FCA8FAD1FC13.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FD70FBCEFCAC.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FDFBFA2CFDC3.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FE62FB13FE5C.xml create mode 100644 data/03/B7/F8/03B7F81454615246FF68FF29FBA2FED5.xml create mode 100644 data/03/B7/F8/03B7F81454625245FF68F93AFAC0F8C8.xml create mode 100644 data/03/B7/F8/03B7F81454625245FF68FF29FD63FEF4.xml create mode 100644 data/03/B7/F8/03B7F8145462524AFF68F84FFB6FFF6E.xml create mode 100644 data/03/B7/F8/03B7F81454635244FF68F84AFBC4F7B5.xml create mode 100644 data/03/B7/F8/03B7F81454635244FF68F974FB92F88A.xml create mode 100644 data/03/B7/F8/03B7F81454635244FF68FA22FBDDF99C.xml create mode 100644 data/03/B7/F8/03B7F81454635244FF68FE3FFBCFFD80.xml create mode 100644 data/03/B7/F8/03B7F81454635244FF68FEE5FC3EFE19.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68F8B6FE35F84C.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68F982FEC4F882.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FA6EFD64F9F6.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FB37FE66FAEA.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FBDFFCFAFB01.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FC64FE5DFBB8.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FD0DFDECFCEF.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FDFBFA8BFD07.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FE62FCC3FE5C.xml create mode 100644 data/03/B7/F8/03B7F81454665241FF68FF29FD2AFED5.xml create mode 100644 data/03/B7/F8/03B7F81454675240FF68F86FFE8BF7B1.xml create mode 100644 data/03/B7/F8/03B7F81454675240FF68F97BFB13F8A5.xml create mode 100644 data/03/B7/F8/03B7F81454675240FF68F9E2FBCEF9DC.xml create mode 100644 data/03/B7/F8/03B7F814546D524AFF68FE5CFB44FC8E.xml create mode 100644 data/03/B7/F8/03B7F814546D524AFF68FEE5FB99FE37.xml create mode 100644 data/03/B9/4F/03B94F0AFF950348D4FE699D6A178D21.xml create mode 100644 data/03/B9/4F/03B94F0AFF950348D4FE6D556CFA8C70.xml create mode 100644 data/03/B9/4F/03B94F0AFF95034AD4FE68716C4A8B72.xml create mode 100644 data/03/B9/4F/03B94F0AFF97034AD4FE6D1A6FDF88E7.xml create mode 100644 data/03/B9/4F/03B94F0AFF97034AD4FE6DB26C2D89F3.xml create mode 100644 data/03/B9/4F/03B94F0AFF97034AD4FE6E266C778B9E.xml create mode 100644 data/03/BB/87/03BB87F38427614BD5CFF91FFD3FFB75.xml create mode 100644 data/03/BB/F1/03BBF11A4311FFF0FF1E5A79FC84FEA6.xml create mode 100644 data/03/BD/CC/03BDCC27FFA0EE2FC29FEDEEFAC7FD4E.xml create mode 100644 data/03/BD/CC/03BDCC27FFA3EE2EC29FEB60FE60FDA8.xml create mode 100644 data/03/BD/CC/03BDCC27FFA3EE2FC29FEE0EFDF8FA06.xml create mode 100644 data/03/BD/CC/03BDCC27FFA6EE2DC29FE88EFDC0FE7E.xml create mode 100644 data/03/BD/CC/03BDCC27FFA7EE2BC29FE9BDFD81F800.xml create mode 100644 data/03/BD/CC/03BDCC27FFA7EE2BC29FEDCCFBC8FBB5.xml create mode 100644 data/03/BD/CC/03BDCC27FFA8EE24C29FEDEEFDA5FBFC.xml create mode 100644 data/03/BD/CC/03BDCC27FFA8EE27C29FE97AFCB4FBD3.xml create mode 100644 data/03/BD/CC/03BDCC27FFA9EE25C29FE927FADAF82D.xml create mode 100644 data/03/BD/CC/03BDCC27FFA9EE25C29FEDEEFA82FC3B.xml create mode 100644 data/03/BD/CC/03BDCC27FFAAEE26C29FEFCAFE09F86E.xml create mode 100644 data/03/BD/CC/03BDCC27FFABEE26C29FEA6CFE41FD6C.xml create mode 100644 data/03/BD/CC/03BDCC27FFABEE27C29FE949FE52F902.xml create mode 100644 data/03/BD/CC/03BDCC27FFACEE20C29FEDEEFD45FC87.xml create mode 100644 data/03/BD/CC/03BDCC27FFACEE20C29FEEE3FE09F84F.xml create mode 100644 data/03/BD/CC/03BDCC27FFB1EE3DC29FE918FE4FF8A8.xml create mode 100644 data/03/BD/CC/03BDCC27FFB1EE3DC29FEDEEFDC0FC1F.xml create mode 100644 data/03/BD/CC/03BDCC27FFB2EE31C29FE99FFCCAFEDB.xml create mode 100644 data/03/BD/CC/03BDCC27FFB2EE3EC29FEC9BFAA3FB93.xml create mode 100644 data/03/BD/CC/03BDCC27FFB3EE3EC29FE958FE70FE9C.xml create mode 100644 data/03/BD/CC/03BDCC27FFB3EE3FC29FEDEEFB54FBDE.xml create mode 100644 data/03/BD/CC/03BDCC27FFB9EE35C29FE927FAFCF82D.xml create mode 100644 data/03/BD/CC/03BDCC27FFB9EE35C29FEDEEFAFEFC38.xml create mode 100644 data/03/BD/CC/03BDCC27FFBAEE36C29FEDEEFAC3FCA5.xml create mode 100644 data/03/BD/CC/03BDCC27FFBDEE31C29FE86DFDCAF7F8.xml create mode 100644 data/03/C9/87/03C987E0FF897221FF73F91C8C2D9EB4.xml create mode 100644 data/03/CB/F9/03CBF90BFF844B66C7B09C3717705DA8.xml create mode 100644 data/03/CB/F9/03CBF90BFF8B4B67C7B09B2A122F5E52.xml create mode 100644 data/03/CB/F9/03CBF90BFF8C4B68C7B098CD14265CBC.xml create mode 100644 data/03/CD/D7/03CDD70DC360FFEBFF4FF99995D4FE49.xml create mode 100644 data/03/CD/D7/03CDD70DC363FFEBFF4FFDB493F8FC21.xml create mode 100644 data/03/D1/87/03D187FECC02FFAA548EFBE2FF63FB56.xml create mode 100644 data/03/D1/87/03D187FECC02FFAA548EFCD3FE2CFBAA.xml create mode 100644 data/03/D1/87/03D187FECC02FFAA548EFE62FE14FD7A.xml create mode 100644 data/03/D1/87/03D187FECC02FFAA548EFEFBFC09FE68.xml create mode 100644 data/03/D1/87/03D187FECC02FFAA548EFF52FB9DFEE1.xml create mode 100644 data/03/D1/87/03D187FECC04FFAC548EF942FCBEF8D7.xml create mode 100644 data/03/D1/87/03D187FECC04FFAC548EFB4CFDE1F9C5.xml create mode 100644 data/03/D1/87/03D187FECC04FFAC548EFB86FC25FBCF.xml create mode 100644 data/03/D1/87/03D187FECC04FFAC548EFCF0FEB0FC44.xml create mode 100644 data/03/D1/87/03D187FECC04FFAC548EFDEDFD62FD58.xml create mode 100644 data/03/D1/87/03D187FECC04FFAC548EFE26FE76FDF3.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EF942FC5FF8D7.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EF99FFBF8F9C5.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFAA9FCB9FA3F.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFBE2FB3AFB71.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFC5AFB80FBEE.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFD76FF5CFCFD.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFDCFFC16FD15.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFE18FB91FE4E.xml create mode 100644 data/03/D1/87/03D187FECC05FFAD548EFF52FB80FE80.xml create mode 100644 data/03/D9/87/03D9878D4010B852E1D5FDB98A191D3D.xml create mode 100644 data/03/DD/BE/03DDBE2194645130FF69FBC90D99F91B.xml create mode 100644 data/03/DD/BE/03DDBE2194645130FF69FD5C0ED0FBF8.xml create mode 100644 data/03/DD/BE/03DDBE2194645133FF69F8A90DCBFE1C.xml create mode 100644 data/03/DD/BE/03DDBE2194675133FF69F9F20BE0F80C.xml create mode 100644 data/03/DD/BE/03DDBE2194675133FF69FB8E0A5CF9D4.xml create mode 100644 data/03/DD/BE/03DDBE2194675133FF69FDAA0EFEFBF8.xml create mode 100644 data/03/EB/87/03EB87B6E118FFA2FF6FFEC61FA0FDC9.xml create mode 100644 data/03/EC/01/03EC016B1170FFF70CB9FD954E17F9C9.xml create mode 100644 data/03/EC/01/03EC016B1172FFF70CB9FEE64CF0FD9E.xml create mode 100644 data/08/76/87/087687C68311FF84FF0E00B24AB3FE41.xml create mode 100644 data/08/76/87/087687C68311FF87FF0E05014C6CF953.xml create mode 100644 data/08/76/87/087687C68314FF82FF0E05774D30F851.xml create mode 100644 data/08/76/87/087687C68315FF83FF0E020E4C7BF823.xml create mode 100644 data/08/76/87/087687C68316FF80FF0E02C44D47F81C.xml create mode 100644 data/08/76/87/087687C68316FF80FF0E06974B82FB8A.xml create mode 100644 data/08/76/87/087687C68317FF81FF0E020E4D46F805.xml create mode 100644 data/08/76/87/087687C68318FF8EFF0E02004B03FB77.xml create mode 100644 data/08/76/87/087687C68318FF8EFF0E02894D6CFA5B.xml create mode 100644 data/08/76/87/087687C68318FF8EFF0E059F4BD2FBEC.xml create mode 100644 data/08/76/87/087687C68318FF8EFF0E07E24CA6FDC8.xml create mode 100644 data/08/76/87/087687C68318FF8FFF0E03944C54FE2A.xml create mode 100644 data/08/76/87/087687C6831BFF82FF0E007F4B42FD1E.xml create mode 100644 data/1B/4D/87/1B4D879A0759D02700F8FF7E277D4660.xml create mode 100644 data/1B/4D/87/1B4D879A075BD02500F8FA68262444BD.xml create mode 100644 data/1B/4D/87/1B4D879A075BD02600F8F89920C645B7.xml create mode 100644 data/1F/6F/87/1F6F87F72660FFC9FF19F8BD6279E4CB.xml create mode 100644 data/1F/6F/87/1F6F87F72664FFCDFF19F8A66279E4D7.xml create mode 100644 data/1F/6F/87/1F6F87F72666FFCDFF19FF1D670FE45E.xml create mode 100644 data/26/18/5A/26185A62FFCEFFCC5DF384A97229FA2F.xml create mode 100644 data/2A/5A/22/2A5A221EFFD15177FF2AED3AFBD4D583.xml create mode 100644 data/2A/5A/22/2A5A221EFFD35172FF2AEFFEFC38D54F.xml create mode 100644 data/2F/1D/31/2F1D3109FFEC6E77FF79FEB0FB4244F6.xml create mode 100644 data/2F/1D/31/2F1D3109FFEF6E77FF79F902FDE24610.xml create mode 100644 data/30/34/87/30348788E239FFAAFF39FED7B02DFB51.xml create mode 100644 data/36/72/57/36725714382CFF8A01BCF88BFD68FD1B.xml create mode 100644 data/36/72/57/36725714382CFF8B01BCFA62FBC9FB15.xml create mode 100644 data/36/72/57/36725714382CFF8B01BCFBF6FD62F92D.xml create mode 100644 data/36/72/57/36725714382CFF8B01BCFE57FD67FDBE.xml create mode 100644 data/36/72/57/36725714382DFF8501BCF8E4FD86FEEF.xml create mode 100644 data/36/72/57/36725714382DFF8A01BCFAC3FE44FAB6.xml create mode 100644 data/36/72/57/367257143836FF9201BCF9C9FE00FBA2.xml create mode 100644 data/39/5F/EB/395FEB71FFE5FFB254AAFBB0FB64FAC5.xml create mode 100644 data/39/5F/EB/395FEB71FFE7FFB254AAFA39FBCEF9F5.xml create mode 100644 data/3A/2D/87/3A2D87A5181A227887B4982EFE75F808.xml create mode 100644 data/40/48/87/404887BE8E129E15E688F9DE26A0F9D8.xml create mode 100644 data/40/48/87/404887BE8E169E16E688F9DE26A0FB2E.xml create mode 100644 data/60/1D/6B/601D6B40F250E36DFF3EF98BFEAAFE60.xml create mode 100644 data/87/7A/AD/877AAD7B7F7FFF8F1481FDDFFBD4F832.xml create mode 100644 data/8B/0C/87/8B0C87FA5859FFB765B8FA1BFD47CE8B.xml create mode 100644 data/8B/0C/87/8B0C87FA585AFFB665B8F8A1FDFDCF85.xml create mode 100644 data/8B/0C/87/8B0C87FA585AFFB765B8FB20FB4DCD08.xml create mode 100644 data/8B/0C/87/8B0C87FA585BFFB16732F992FD85CAE4.xml create mode 100644 data/8B/0C/87/8B0C87FA585CFFB065B8FA34FAF9CAE4.xml create mode 100644 data/8B/0C/87/8B0C87FA585CFFB165B8FEF6FE0BCF85.xml create mode 100644 data/8B/0C/87/8B0C87FA585DFFB065B8F8BEFCF9CDD8.xml create mode 100644 data/8B/0C/87/8B0C87FA585DFFB065B8FE6BFD34CCCF.xml create mode 100644 data/8B/0C/87/8B0C87FA585DFFB06732FEECFDFACBB4.xml create mode 100644 data/8B/0C/87/8B0C87FA585EFFB26732FEF6FC15CB93.xml create mode 100644 data/8B/0C/87/8B0C87FA585FFF8D65B8FB8FFD79CB18.xml create mode 100644 data/8B/0C/87/8B0C87FA585FFFB26732FE0EFB31CE10.xml create mode 100644 data/8B/0C/87/8B0C87FA5860FF8C65B8F83EFD4AC80A.xml create mode 100644 data/8B/0C/87/8B0C87FA5860FF8D65B8F94DFB8FCDAD.xml create mode 100644 data/8B/0C/87/8B0C87FA5860FF8D65B8FEB1FA89CC5D.xml create mode 100644 data/99/3D/92/993D9254FFF68C1BD9E5FB30EB3F29ED.xml create mode 100644 data/C2/11/87/C21187BFCD562A3BFF79FBC84A21F85C.xml create mode 100644 data/C6/75/C5/C675C50EFFEEFF8169B00C699D1BFDDB.xml create mode 100644 data/C7/23/55/C7235500FFD8F50DFF07FEE366DCEA80.xml create mode 100644 data/C7/23/55/C7235500FFD8F50EFF07FB54641BEFB6.xml create mode 100644 data/C9/7A/B1/C97AB10B4B33FFF662D27399FDC9683E.xml create mode 100644 data/C9/7A/B1/C97AB10B4B34FFF462D276F8FABF6C29.xml create mode 100644 data/C9/7A/B1/C97AB10B4B35FFF662D2710EFDC96F96.xml create mode 100644 data/C9/7A/B1/C97AB10B4B35FFF762D276B7FE9A687A.xml create mode 100644 data/C9/7A/B1/C97AB10B4B37FFF562D27527FE956DDC.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10F91EFF47F84B.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10F9E1FE1FF911.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10FA89FDEAFA3D.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10FC42FE84FB90.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10FCEAFD58FC5D.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10FE1CFDCEFD04.xml create mode 100644 data/DF/75/00/DF750049FFC6F352FF10FF2CFCC8FE16.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10F9C3FC37F977.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10FA89FE32F9DE.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10FB7FFD69FAE4.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10FC42FDCEFBB1.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10FD56FB4AFC5D.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10FE3AFEC0FD49.xml create mode 100644 data/DF/75/00/DF750049FFC8F35CFF10FEEFFC70FE75.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10F95AFC97F8A9.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10F9E1FD1AF955.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10FA89FD23FA3D.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10FB7FFF21FAE4.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10FC42FBC2FBB1.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10FD56FE73FC5D.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10FE3AFA93FD49.xml create mode 100644 data/DF/75/00/DF750049FFC9F35DFF10FF2CFEBFFE75.xml create mode 100644 data/DF/75/00/DF750049FFCBF35FFF10F987FC86F932.xml create mode 100644 data/DF/75/00/DF750049FFCBF35FFF10FA2EFB04F99A.xml create mode 100644 data/DF/75/00/DF750049FFCBF35FFF10FB13FACCFA41.xml create mode 100644 data/DF/75/00/DF750049FFCBF35FFF10FBF8FBFAFB0F.xml create mode 100644 data/DF/75/00/DF750049FFCBF35FFF10FD93FEAFFCE2.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10F93CFB2FF84B.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FA2EFEB3F977.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FB32FAFEFA41.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FC05FDCEFB6D.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FCCBFEAFFC19.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FDDFFCA6FD26.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FE85FBF4FDD2.xml create mode 100644 data/DF/75/00/DF750049FFD2F346FF10FF2CFB6CFE9F.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10F91EFDCEF806.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10F9A5FBCEF911.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10FA6AFC15F9F8.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10FB32FDC1FA86.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10FBF8FB38FB6D.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10FCEAFDCEFC3A.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10FDDFFBA4FD04.xml create mode 100644 data/DF/75/00/DF750049FFD5F341FF10FEC1FDCEFDD2.xml create mode 100644 data/DF/75/00/DF750049FFD6F342FF10F9C3FDCEF933.xml create mode 100644 data/DF/75/00/DF750049FFD6F342FF10FA89FAD0F9DE.xml create mode 100644 data/DF/75/00/DF750049FFD6F342FF10FB9CFDCEFAE4.xml create mode 100644 data/DF/75/00/DF750049FFD6F342FF10FD56FDCEFC5D.xml create mode 100644 data/DF/75/00/DF750049FFD6F342FF10FE1CFAB1FD49.xml create mode 100644 data/DF/75/00/DF750049FFD6F342FF10FF2CFF7DFE16.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10F8FFFCBCF84B.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10F987FAD1F932.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FA6AFD1CF99A.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FB32FDF5FA86.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FBF8FA1AFB6D.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FCCBFD7DFC3A.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FDB1FD48FD26.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FE66FD12FDEC.xml create mode 100644 data/DF/75/00/DF750049FFD8F34CFF10FF2CFE06FEB9.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10F91EFDCEF806.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FA00FD6EF911.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FB13FEB4FA63.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FBF8FDCEFB0F.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FD08FB95FC3A.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FDFDFF5EFD6B.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FE85FDFAFE30.xml create mode 100644 data/DF/75/00/DF750049FFDAF34EFF10FF2CFDEAFE9F.xml create mode 100644 data/DF/75/00/DF750049FFDEF34AFF10F88BFE32F7D9.xml create mode 100644 data/E0/21/72/E021721EFF85D446BB8BF8E83BF2A961.xml create mode 100644 data/E0/21/72/E021721EFF8BD441BB8BF8A43B1EA926.xml create mode 100644 data/E0/21/72/E021721EFF8BD44DBB8BFB823B59AB86.xml create mode 100644 data/E0/21/72/E021721EFF99D45EBB8BFAAE3EFDAC80.xml create mode 100644 data/E0/21/72/E021721EFF99D45FBB8BFF773D79A998.xml create mode 100644 data/E0/21/72/E021721EFF9ED458BB8BFD843C32AA79.xml create mode 100644 data/E6/0B/87/E60B87CDFFE0E434B5C3FE2BFCF6FE55.xml create mode 100644 data/E6/0B/87/E60B87CDFFE4E430B5C3FD92FB7BFAAA.xml create mode 100644 data/EA/38/87/EA3887ECFF98451AFF2A15166C7AB21E.xml create mode 100644 data/EA/38/87/EA3887ECFF9A451AFF2A11666EC4B7F2.xml create mode 100644 data/F0/16/FA/F016FA47FFBBFF875FAAFED8F0ECF874.xml diff --git a/data/03/85/DC/0385DC3DFFA5B44C8096E776FEEDF866.xml b/data/03/85/DC/0385DC3DFFA5B44C8096E776FEEDF866.xml new file mode 100644 index 00000000000..381a52dd7d5 --- /dev/null +++ b/data/03/85/DC/0385DC3DFFA5B44C8096E776FEEDF866.xml @@ -0,0 +1,101 @@ + + + +Two new species of the genera Islamia and Mercuria (Gastropoda, Hydrobiidae) from Morocco + + + +Author + +Mabrouki, Youness +Université Sidi Mohamed Ben Abdellah, Faculté des Sciences de Dhar El Mehraz, Laboratoire de Biotechnologie, Conservation et Valorisation des Ressources Naturelles, Fes, Morocco. E-mail: younes _ mab @ hotmail. fr + + + +Author + +Glöer, Peter +Schulstr. 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Taybi, Abdelkhaleq Fouzi +Université Mohammed Premier, Faculté Pluridisciplinaire de Nador, Équipe de Recherche en Biologie et Biotechnologie Appliquées. Morocco. E-mail: taybiaf @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-08 + + +39 + + +76 +80 + + + + +http://dx.doi.org/10.37828/em.2021.39.8 + +journal article +10.37828/em.2021.39.8 +2336-9744 +urn:lsid:zoobank.org:pub:DF930EB1-6B0F-4F11-BFFE-D00C22C0E769 + + + + + + +Genus + +Islamia +Radoman, 1973 + + + + + + + +Type +species: + +Hydrobia valvataeformis +Möllendorf, 1873 + +. + + +The shell is valvatiform with a roundish-ovoid aperture and a sharp outer lip. Species of the genus occur in the Balkan Peninsula, +Turkey +(Radoman 1983), +Italy +(Cossigniani & Cossigniani 1995), +France +( +Falkner et al. 2002 +) and +Spain +( +Bank & Neubert 2017 +). The species of + +Islamia + +are usually endemic to their +type +locality. + + + + \ No newline at end of file diff --git a/data/03/85/DC/0385DC3DFFA6B44F8096E098FC5EFBE0.xml b/data/03/85/DC/0385DC3DFFA6B44F8096E098FC5EFBE0.xml new file mode 100644 index 00000000000..b69a8aa100a --- /dev/null +++ b/data/03/85/DC/0385DC3DFFA6B44F8096E098FC5EFBE0.xml @@ -0,0 +1,203 @@ + + + +Two new species of the genera Islamia and Mercuria (Gastropoda, Hydrobiidae) from Morocco + + + +Author + +Mabrouki, Youness +Université Sidi Mohamed Ben Abdellah, Faculté des Sciences de Dhar El Mehraz, Laboratoire de Biotechnologie, Conservation et Valorisation des Ressources Naturelles, Fes, Morocco. E-mail: younes _ mab @ hotmail. fr + + + +Author + +Glöer, Peter +Schulstr. 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Taybi, Abdelkhaleq Fouzi +Université Mohammed Premier, Faculté Pluridisciplinaire de Nador, Équipe de Recherche en Biologie et Biotechnologie Appliquées. Morocco. E-mail: taybiaf @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-08 + + +39 + + +76 +80 + + + + +http://dx.doi.org/10.37828/em.2021.39.8 + +journal article +10.37828/em.2021.39.8 +2336-9744 +urn:lsid:zoobank.org:pub:DF930EB1-6B0F-4F11-BFFE-D00C22C0E769 + + + + + + +Islamia karawiyiensis + +n. sp. + + + + + +Fig. 2 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +4B73B5AC-BA3D-41A6-BAFC-370E572C7806 + + + + + +Material examined +: + + +Holotype +: + +0.8 mm +high, +1.25 mm +broad ( +ZMH 140821 +) + +. + + +Paratypes + +: 33 from type locality ( +ZMH 140822 +) + +5 in +coll. +Glöer. + + + +Locus typicus +: + +Morocco +, +Aouinat El Hajjaj +, Fez prefecture, (28-09-20), +34°01'36.7"N +4°58'06.9"W + +. + + + + +Description +: The valvatoid light-brownish shell has 3.25 slightly convex whorls ( +Figure 2 +). The spire is short, the body whorl is prominent. The aperture is circular with a sharp peristome. The umbilicus is deep and wide. The shell is +0.8 mm +high and +1.2-1.3 mm +broad. + + + + +Discussion: +Because we did not find a male after several attempts, the new valvatoid species described herein is included in the genus + +Islamia + +. The genus inhabiting the Iberian Peninsula and Balearic Islands ( +Ruiz Cobo et al. 2018 +) is already represented in +Morocco +by + +I. tifertiensis +Glöer, Mabrouki & Taybi 2020 + +. The latter species is endemic to Lower Moulouya (Northeastern +Morocco +), characterized by a light corneous glossy shell, conical with a very short spire and a very prominent inflated body whorl. In addition, + +I. tifertiensis + +differs from the new species in the more vertically compressed shell. Otherwise, the study area “Aouinat El Hajjaj” located in central +Morocco +, has revealed recently the new valvatoid genus and species + +Fessia aouintii +Glöer, Mabrouki & Taybi, 2020 + +. While + +I. karaouyiensis + +n. sp. +has a light-brownish bigger shell, + +F. aouintii + +has a tiny translucent shell with a silky surface. The two species might co-occur together. + + + + +Etymology +: The specific name refers to the University of al-Qarawiyyin, also written Al-Karaouine, is a university located in Fez, +Morocco +. Some sources such as the UNESCO and the Guinness World Records cite the Qarawiyyin as the oldest university or oldest continually operating higher learning institution in the world. + + +Habitat +: One of the springs in a village named Aouinat el Hajjaj or Laaouina located in eastern Fez, characterized by different springs that arise on the surface and sink on the ground. The grain size of the bottom consists of stones, pebbles and sand, the banks are covered with dense vegetation of + +Mentha +spp + +( +Figure 1 +). The entire area is under anthropogenic impacts + + + + +Distribution +: +Morocco +; only known from +type +locality. + + + + \ No newline at end of file diff --git a/data/03/85/DC/0385DC3DFFA6B44F8096E774FCB2F82D.xml b/data/03/85/DC/0385DC3DFFA6B44F8096E774FCB2F82D.xml new file mode 100644 index 00000000000..a57bc174932 --- /dev/null +++ b/data/03/85/DC/0385DC3DFFA6B44F8096E774FCB2F82D.xml @@ -0,0 +1,80 @@ + + + +Two new species of the genera Islamia and Mercuria (Gastropoda, Hydrobiidae) from Morocco + + + +Author + +Mabrouki, Youness +Université Sidi Mohamed Ben Abdellah, Faculté des Sciences de Dhar El Mehraz, Laboratoire de Biotechnologie, Conservation et Valorisation des Ressources Naturelles, Fes, Morocco. E-mail: younes _ mab @ hotmail. fr + + + +Author + +Glöer, Peter +Schulstr. 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Taybi, Abdelkhaleq Fouzi +Université Mohammed Premier, Faculté Pluridisciplinaire de Nador, Équipe de Recherche en Biologie et Biotechnologie Appliquées. Morocco. E-mail: taybiaf @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-08 + + +39 + + +76 +80 + + + + +http://dx.doi.org/10.37828/em.2021.39.8 + +journal article +10.37828/em.2021.39.8 +2336-9744 +urn:lsid:zoobank.org:pub:DF930EB1-6B0F-4F11-BFFE-D00C22C0E769 + + + + + + +Genus + +Mercuria +Boeters, 1971 + + + + + + + +Type +species: + +Cyclostoma simile +Draparnaud, 1805 + + +The shell is milky whitish, especially in the region of the umbilicus. The penis possess a large and flat triangular or rounded lobe. The operculum is light orange. + + + \ No newline at end of file diff --git a/data/03/85/DC/0385DC3DFFA7B44E8096E098FEA8FBAD.xml b/data/03/85/DC/0385DC3DFFA7B44E8096E098FEA8FBAD.xml new file mode 100644 index 00000000000..fb82f0a49ab --- /dev/null +++ b/data/03/85/DC/0385DC3DFFA7B44E8096E098FEA8FBAD.xml @@ -0,0 +1,193 @@ + + + +Two new species of the genera Islamia and Mercuria (Gastropoda, Hydrobiidae) from Morocco + + + +Author + +Mabrouki, Youness +Université Sidi Mohamed Ben Abdellah, Faculté des Sciences de Dhar El Mehraz, Laboratoire de Biotechnologie, Conservation et Valorisation des Ressources Naturelles, Fes, Morocco. E-mail: younes _ mab @ hotmail. fr + + + +Author + +Glöer, Peter +Schulstr. 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Taybi, Abdelkhaleq Fouzi +Université Mohammed Premier, Faculté Pluridisciplinaire de Nador, Équipe de Recherche en Biologie et Biotechnologie Appliquées. Morocco. E-mail: taybiaf @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-08 + + +39 + + +76 +80 + + + + +http://dx.doi.org/10.37828/em.2021.39.8 + +journal article +10.37828/em.2021.39.8 +2336-9744 +urn:lsid:zoobank.org:pub:DF930EB1-6B0F-4F11-BFFE-D00C22C0E769 + + + + + + +Mercuria atlasica + +n. sp. + + + + + +Fig. 3-4 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +9A47A682-2827-41FC-83D4-4D6194ECBAFB + + + + + +Material examined +: + + +Holotype + +: shell height +2.95 mm +, width 2.0 mm ( +ZMH 140823 +) + +. + + +Paratypes + +: (1) Fes 27/10/20, +10 paratypes +( +ZMH 140824 +), (2) +Aouinat El Hajjaj +27/10/20, +10 paratypes +coll +Glöer +, +31 paratypes +ZMH 140825 + +. + + +Locus typicus +: + +Morocco +, +Aouinat El Hajjaj +, Fez prefecture, 27/10/20, +34°01'36.7"N +4°58'06.9"W + +. + + + + +Description +: The dark yellowish conical shell has 5.5 fast growing, slightly convex whorls with a deep suture ( +Figure 3 +). The body whorl is prominent. The ovate aperture is somewhat oblique, narrowed at the top with a rounded angle. The peristome is sharp, the umbilicus is closed. The shell is 2.8-3.0 mm high and 1.9-2.0 mm broad. + + +Male copulatory organ +: The greyish penis is long, broad and tapered at the tip ( +Figure 4 +). The penial lobe is long and broad, whitish and rounded at the distal end. + + + + +Discussion +: The new species can be distinguished from its congeners in +Morocco +by its penis almost equal in length with the unpigmented penial appendix. + +M. tingitana +Glöer, Boeters & Walther, 2015 + +has black short and triangular penis, + +M. targouasensis +Glöer, Boeters & Walther, 2015 + +has gradually tapering penis and slightly pigmented penial appendix, shorter than penis and + +M. tensiftensis +Boulaassafer, Ghamizi & Delicado, 2018 + +has a gradually tapering dark pigmented penis with dark pigmented penial appendix. While + +M. bakeri +Glöer, Boeters & Walther, 2015 + +has a long strap- like penis and + +M. midarensis +Boulaassafer, Ghamizi & Delicado, 2018 + +has gradually tapering to strap-like penis and similarly pigmented penial appendix. All other + +Mercuria +spp. + +known from +Morocco +occur in coastal regions. + + + + +Etymology +: Named after the Atlas Mountains. + + +Habitat +: This species seems rheophilous, preferring moderate to fast-flowing, well-oxygenized springs and streams ( +Figure 1 +), usually on solid substrate and stony bottoms but it can be found among aquatic vegetation. + + + + \ No newline at end of file diff --git a/data/03/87/87/038787808E13FF911AD5DDFAB0A9FC5D.xml b/data/03/87/87/038787808E13FF911AD5DDFAB0A9FC5D.xml new file mode 100644 index 00000000000..e240d4ce58b --- /dev/null +++ b/data/03/87/87/038787808E13FF911AD5DDFAB0A9FC5D.xml @@ -0,0 +1,124 @@ + + + +On the taxonomy of Zeuzera boisduvalii Herrich-Schäffer, 1854 (Cossidae, Zeuzerinae) species complex with description of a new genus and three new species + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-23 + + +38 + + +215 +226 + + + + +http://dx.doi.org/10.37828/em.2020.38.31 + +journal article +10.37828/em.2020.38.31 +2336-9744 +13232777 +urn:lsid:zoobank.org:pub:B0D7676D-1A36-4BBF-B8D8-531B0519D96B + + + + + + + +Davidlivingstonia prozorovi +Yakovlev + +spec. nov. + + + + + + +Figs 11 +, +20 +, +25 + + + + +Type material +: + +Holotype +(male). [ + +Democratic Republic of the Congo + +] “ +Congo +Belge +, +Congo +River +, + +16 Sept. 1922 + +”, gen. slide No.: NHMUK 010315467, unique number: NHMUK 012832434 ( +NHMUK +). + + + + + +Description +. Forewing length +16 mm +. Forewing light-yellow with longitudinal brown stripe medially between base and postdiscal area. Thin light-brown transverse dashes throughout the wing, partially fused and forming thin transverse bands; discal area without pattern. Hindwing light-yellow without pattern. + +Male genitalia. Uncus pyramidal, short, apically rounded; valvae narrow, distal margin semicircular, costal and ventral margins smooth almost straight; juxta wide with short leaf-like posterio-lateral processes; saccus 1.5 times shorter than valva, sharply tapering from base to apex, apically pointed. Phallus typical of the genus. +Female unknown. + + + +Diagnosis +. The new species differs from the other species of the genus in the following characters: + +- the forewing discal area is without pattern, +- the presence of a brown longitudinal medial stripe between the base and the postdiscal area of the forewing, - the pointed apex of the saccus. + + + +Etymology +. The species is named after Mr. Alexey Prozorov – Russian lepidopterist. He was one of the largest specialists in African +Lasiocampidae +. + + + + +Distribution +. +Democratic Republic of the Congo +. + + + + \ No newline at end of file diff --git a/data/03/87/87/038787808E13FF931AD5D90CB098FDEA.xml b/data/03/87/87/038787808E13FF931AD5D90CB098FDEA.xml new file mode 100644 index 00000000000..e1dff97af28 --- /dev/null +++ b/data/03/87/87/038787808E13FF931AD5D90CB098FDEA.xml @@ -0,0 +1,738 @@ + + + +On the taxonomy of Zeuzera boisduvalii Herrich-Schäffer, 1854 (Cossidae, Zeuzerinae) species complex with description of a new genus and three new species + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-23 + + +38 + + +215 +226 + + + + +http://dx.doi.org/10.37828/em.2020.38.31 + +journal article +10.37828/em.2020.38.31 +2336-9744 +13232777 +urn:lsid:zoobank.org:pub:B0D7676D-1A36-4BBF-B8D8-531B0519D96B + + + + + + + +Davidlivingstonia lenzi +Yakovlev + +spec. nov. + + + + + + +Figs 12−15 +, +21−22, 24−25 + + + + +Type material +: + +Holotype +(male). “ + +Zambia + +, + +777 m + +, +Ndole Bay +, on the shores of +Lake Tanganyika +, +S08°28′42′′ +, +E30°26′59′′ +, 30.iv.−5.v.13, leg. +Smith +, Takano & Oram”, ANHRT:2017.19, unique number: ANHRTUK 00051030, gen. slide +No. +: ANHRT 00040 ( +ANHRT +). + + + + + +Paratypes + +. + +Zambia + +: +8 males +, +1 female +, with the same data as in the +holotype +, unique numbers: ANHRTUK 00047120, 00082981-00082987, gen. slide +No. +: LG 5184 (male) + +; + +2 females +, same locality, + +23−25.xi.2012 + +, leg. +Smith +& +Takano +, ANHRT:2017.7, unique numbers: ANHRTUK 00052291, 00082988, gen. slide +No. +: ANHRT 00041 ( +ANHRT +) + +; + + +Zimbabwe + +: +1 male +, +S. Rhodesia +, +Umtali district +, + +8.xii.1931 + +, +P.A. Sheppard + +; + +1 male +, +S. Rhodesia +, +Umtali district +, + +27.xi.1932 + +, +P.A. Sheppard + +; + +1 male +, +S. Rhodesia +, +Vumba +, + +13.xii.1962 + +, +B.D. Barnes + +; + +1 male +, +S. Rhodesia +, +Vumba +, + +28.xi.1958 + +, +A.T. Duke + +; + +1 male +, +S. Rhodesia +, +Salisbury +, + +21.xi.1959 + +, +A.T. Duke + +; + +3 males +, +S. Rhodesia +, +Salisbury +, + +13−25.xii.1966 + +, +A.T. Duke + +; + +1 male +, +S. Rhodesia +, +Salisbury +, + +21.xi.1959 + +, +A.T. Duke + +; + +1 male +, +S. Rhodesia +, +Salisbury +, + +i.1961 + +, +A.T. Duke +( +NHMZ +) + +; + + +Kenya + +: +1 male +, +Seengai +, + +18.xi.1973 + +, leg. +Dr. Politzar + +; + +1 male +, +Sigor +, + +24.viii.1973 + +, leg. +Dr. Politzar +, gen. slide +Heterocera No. +: 32.933) ( +MWM +) + +. + + +Tanzania + +: +1 male +, +Mpanda +, +Sibwesa +, + +xii.1969 + +, leg. +J. Kielland +( +ZSM +) + +. + + +Burundi + +: +19 males +, +Urundi +, +Usumbura +, + +900m + +, 21.10.- + +13.11.1961 + +, +Dr. M. Fontaine + +; + +1 male +, +Urundi +, +Kitega +, + +5.02.1935 + +, +P. Lefevre +( +MRAC +) + +. + + +Malawi + +: +1 male +, +Chintheche +, + +2.05.1978 + +, R. +Jocque +( +MRAC +) + +; + +2 females +, +Nkhata Bay +, +Kolwe Forest Reserve +, 11°36'39" +S 34°14'60" +E, + +540m + +, + +19.04.2011 + +, leg. +R. Yakovlev +( +RYB +) + +. + + +South Sudan + +: +1 female +, UNMISS, +Bentiu +, +N09°19’43” +, +E29°47’18” +, + +13.vii.2017 + +, leg. T.C. Nicholson- +Roberts +, ANHRT: 2017.34 ( +ANHRT +) + +; + +1 male +, +White Nile +, +Lat. +6º6′ N, +Malek +, + +Feb. 11 1912 + +, +G.B. Longstaff +( +NHMUK +) + +. + + +Uganda + +: +1 male +, +Masindi Distr. +, +Budongo Forest +, + +50 km +W +Masindi + +, +N01º42.931 +, +E 31º28.183 +, + +1090m + +, + +14−16.xi.2007 + +, leg. +Fibiger +& +Aarvik + +; + +1 male +, +Kabarole Distr. +, +Matiri Forest +, + +50 km +E Fort Portal + +, +N00º36.300 +, +E 30º42.089 +, + +1250m + +, + +12.xi.2007 + +, leg. +Fibiger +& +Aarvik +( +NHMO +) + +; + +4 males +, +Western distr. +, +Kibale +NP, +N00º24.177′ +, +E30º23.001′ +, + +1500m + +, + +17−21.x.2012 + +, leg. +Elk Ott +& +H. Sulak + +; + +1 male +, +Western Region +, Prov. +Fort Portal +, +Kibale +N.P., +N00º32.086′ +, +E30º17.623′ +, + +10−16.v.2011 + +, + +1520m + +, leg. +H. Sulak + +; + +1 male +, +Western Region +, +Kibale +N.P., +Chimps Nest +, + +1200m + +, + +18−22.i.2011 + +, leg. +H. Sulak +& +Tom Kolb + +; + +1 male +, +Western Region +, +Kabarol district +, +Planet Ringwo +, +N00º26.006′ +, +E30º17.508′ +, + +17−19.vi.2011 + +, + +1240m + +, leg. +H. Sulak +( +MWM +) + +; + +1 male +, +Distr. +Kabarole +, near +Fort Portal +, +Kibale +NP, + +1200m + +, +March +/ + +April 2011 + + +; + +1 male +, +Itwara forest +, +Kyenjojo +, + +xii.2002 + +( +MSW +) + +; + +1 male +, +Bwaba Forest +, +Fort Portal +, 2400′, + +iv.1961 + +( +NHMZ +) + +; + + +Mozambique + +: +1 male +, +Salone River +, +25 km +S. Morrameu +, + +8.xi.1967 + +, E. +Pinhey +( +NHMZ +) + +. + + + + +Description +. Male. Forewing length +12−16 mm +. Forewing light- yellow with pattern consisted of fine dashes throughout the wing, brown dashes larger and denser discally. Hindwing white with poorly expressed grey pattern of dashes medially. + +Male genitalia. Uncus pyramidal, short, apically pointed; valvae narrow, distal margin semicircular, costal and ventral margins smooth, almost straight; juxta wide with short leaf-like posterio-lateral processes; saccus 1.25 times shorter than valva, wide between base and medium third, distal section sharply tapering to apex, apex pointed. Phallus typical of the genus. + +Female. Forewing +18−23 mm +. Wing pattern analogous to that of male. + +Female genitalia. Ovipositor relatively short, thick; papillae anales tapering, with ribbed notches laterally; apophyses anteriores and posteriores equal equal in length; antrum cup-like, poorly immersed; ductus bursae relatively short, thick; corpus bursae small, sack-like, with small star-shaped signum bursae on lateral surface; thin short ductus with small bag-like bulla seminalis. + + + +Figure 25. +Distribution map of + +Davidlivingstonia +species. + + + + + +Diagnosis +. The new species clearly differs from all species of Genus in a series of characters: + +- the thickening of brown dashes in the forewing discal area; +- the poorly expressed pattern of dashes on the hindwing medially; +- the specific shape of the saccus; + +- from + +D. +boisduvalii + +the new species differs in the female genital structure: the shorter and thicker ductus bursae and the shorter ductus of the bulla seminalis. + + + + +Etymology. +The species is named after Mr. Jürgen Lenz – German lepidopterist. He was one of the largest specialists in African +Geometridae +. + + + + +Distribution +. Eastern and South-Eastern Africa ( +Burundi +, +Kenya +, +Malawi +, +Mozambique +, Southern +Sudan +, +Tanzania +, Eastern +Zambia +, +Zimbabwe +, +Uganda +). + + + + \ No newline at end of file diff --git a/data/03/87/87/038787808E19FF9D1AD5D9E4B295FAAE.xml b/data/03/87/87/038787808E19FF9D1AD5D9E4B295FAAE.xml new file mode 100644 index 00000000000..b761f81ac26 --- /dev/null +++ b/data/03/87/87/038787808E19FF9D1AD5D9E4B295FAAE.xml @@ -0,0 +1,748 @@ + + + +On the taxonomy of Zeuzera boisduvalii Herrich-Schäffer, 1854 (Cossidae, Zeuzerinae) species complex with description of a new genus and three new species + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-23 + + +38 + + +215 +226 + + + + +http://dx.doi.org/10.37828/em.2020.38.31 + +journal article +10.37828/em.2020.38.31 +2336-9744 +13232777 +urn:lsid:zoobank.org:pub:B0D7676D-1A36-4BBF-B8D8-531B0519D96B + + + + + + + +Davidlivingstonia boisduvalii +(Herrich-Schäffer, 1854) + +, +comb. nov. + + + + + + +Figs 1−6 +, +16−17 +, +23 +, +25 + + + + + +Zeuzera boisduvalii +Herrich-Schäffer, 1854: 58 + +, Taf. 35: 167 + + + + +Type +locality: Gatam (Sierra-Leone). + + +Type material: +holotype +(male) in MNHN, examined. + + +Material examined +. + + +Sierra Leone + +: +Holotype +(male), +Gatam +( +MNHN +); +8 males +, +Sierra Leone +, +Tingi +hills forest reserve, + +800 m + +, +Singi-Singi Mts. +, ca. + +46 km +NE Koido-Sefadu + +, near +Bandaperei +( +KONO +), +N8º 57.083 +, +W10º 44.751 +, + +11-15-IV-2010 + +, leg. +Rudloff +( +MSW +); +1 male +, +Sierra Leone +, +Loma Mountains +, farmland/forest mosaic, + +420 m + +, + +11-15.VI-2016 + +, +N09º07′47′′ +, +W11º 05′24′′ +, leg. +Takano +, +Miles +& +Goff +, ANHRT: 2017.18, gen. slide +No. +: LG 5183 ( +ANHRT +). +Côte d'Ivoire +: +5 males +, +4 females +, +Touba +, +Biemasso +, +N08°04′19.9′′ +, +W07°33′05.6′′ +, + +441 m + +, + +19.xi.2014 + +, +P. Moretto +leg., ANHRT:2018.29, gen. slide +No. +: ANHRT 0 0039 (female); +1 male +, +Man +, +Mt. Tonkoui +, +N07°27′15.0′′ +, +W07°38′12.6′′ +, + +1200 m + +, + +24−27.xi.2014 + +, +P. Moretto +leg., ANHRT:2018.29, gen. slide +No. +: ANHRT 00038; +1 male +, +2 females +, +Telo village +, outside +Sangbe NP +, + +415 m + +, +N08°09′06.5′′ +, +W07°23′53.5′′ +, + +10-13.xi.2015 + +, +Aristophanous, M. +, +Moretto, P. +, +Ruzzier, E. +leg., ANHRT:2017.16; +1 male +, +Mt. Tonkoui Peak +, + +1171 m + +, +N07°27′15.2′′ +, +W07°38′12.5′′ +, + +1-8.xi.2015 + +, +Aristophanous, M. +, +Moretto, P. +, +Ruzzier, E. +leg., ANHRT:2017.16; +1 male +, +Ivory Coast +, +Mt. Nimba +, +Yeale Village +, + +380m + +, +N07°31ʹ35.3” +, +W08°25ʹ20.1ʹʹ +, + +18‒19.iv.2016 + +, +Aristophanous, M. +, +Geiser, M. +, +Moretto, P. +leg., ANHRT 2017.17 ( +ANHRT +); +1 male +, +Bomake +, + +3.12.1974 + +, +J. Hecq +; +2 males +, Abidjan, 1957, +P. Dessart +; +1 male +, +Bingerville +, + +14.06.1969 + +, +J. Decelle +( +MRAC +); +2 males +, +Adiopodome +, 1.1964, +P. Griveaud +(MRAC & MNHN); +1 male +, +Fekessedougon +, + +3.x.1977 + +, leg. +Dr. Politzar +( +MWM +); +1 female +, +Bingerville +, + +Nov. 1913 + +Gaston Melou +; +2 males +, +Korihly +, + +dec. 1938 + +( +MNHN +). + +Ghana + +: +1 male +, +1 female +, +Ashanti Region +, +Bomfobiri Wildlife Sanctuary +, 06°57'N, 01°11'W, + +240 m + +, + +26.11.2011 + +, leg. +Kovtunovich V. +& +Ustjuzhanin P. +( +RYB +). + + + + +Figures 1−6. +Adult specimens of + +Davidlivingstonia boisduvalii +(Herrich-Schäffer, 1854) + +and their labels: 1. Holotype (MNHN); 2. Male, Sierra Leone (ANHRT); 3. Male, Côte d'Ivoire (ANHRT); 4. Male, Guinea Konakri (coll. G. Müller, Freising); 5. Male, Benin (MNHN); 6. Female, Côte d'Ivoire (ANHRT). + + + + + +Cameroon + +: +1 female +, +Adamawa Region +, +Adamawa Plateau +, + +1246m + +, + +7.3 km +West of Bazanga + +, +Chute de Tello +, 07º13ʹ50.6ʹʹN, 13º56ʹ29.2ʹʹE, + +24-30.ix.2018 + +, +Safian +, +Sz. +, +Simonics, G. +leg., ANHRT 2018.36 ( +ANHRT +) + +. + + +Senegal + +: + +1 m + +, +Senegal +, +Richard Toll +, + +25.01.1976 + +, +H. Dumont +( +MRAC +) + +. + + +Burkina Faso + +: +2 males +, +Bobo Douglasso +, + +18.v.1980 +, +5.x.1984 + +, leg. +Dr. Politzar + +; + +4 males +, +Folonzo am Fluss +, +Comoe +, + +28.vii.1985 + +, leg. +Dr. Politzar +( +MWM +) + +. + + +Guinea + +: +7 males +, +2 females +, +Guinea Konakri +, +Macenta Prefecture +, +Ziama Forest +, + +550 m + +, +Mt. Nimba +, + +November 2016 + +, leg. +G. Petranyi +, +V.D. Kravchenko +& +G.C. Müller +(coll. +G. Müller +, +Freising +) + +; + +1 female +, +Seredou +, + +15.xii.1959 + +, +R. Pujol + +; + +1 male +, +Makeuta +, + +26.iv.1953 + +, +R. Pujol + +; + +1 male +, +Mt. Nimba +, +Gouela +, + +5.vi.1991 + +, +Girard +& +Legrand +col. ( +MNHN +) + +. + + +Nigeria + +: +1 male +, +Kaduna +, + +25.v.1970 + +, leg. +Dr. Politzar +, +GenPr. Heterocera +: 32.929 + +; + +5 males +, same locality, + +6.viii.1970 +, +22.v.1970 +, +28.ix.1970 +, +24.x.1970 +, +1.vi.1970 +, +5.x.1970 + + +; + +1 male +, +Ikom +, + +26.v.1974 + +( +MWM +) + +; + +1 female +, +Jkom +, + +27−28.v.1974 + +, leg. +Politzar +( +ZSM +) + +. + + +Togo + +: +1 male +, +Aretcaou +, + +16.xi.1978 + +, leg. +Dr. Politzar +( +MWM +) + +, + +1 male +, +Ogoja County +, +Light +, + +18. Apr. 1963 + +( +ZSM +) + +; + + +Benin + +: +1 male +, +Dahomey +, +Waterlof +, 1912 + +; + +1 male +, +Agouë +, +Abbe Menager +, 1884 ( +MNHN +) + +. + + + + +Description +. Male. Forewing length +12−20 mm +. Forewing light- yellow with bright-brown, relatively wide transverse dashes throughout wing. Hindwing white or pale-yellow without pattern. + +Male genitalia. Uncus pyramidal, relatively wide, apically pointed; valvae narrow, distal margin semicircular, costal and ventral margins slightly arcuate, smooth; juxta wide with short leaf-like posteriorlateral processes; saccus very long (equal to valva in length) with parallel margins, gradually tapering in distal third. Phallus typical of the genus. + +Female. Larger than males, forewing +20−26 mm +. Pattern analogous to that of male. + +Female genitalia. Ovipositor relatively short, thick; papillae anales tapering, with ribbed notches laterally; apophyses anteriores equal in length to apophyses posteriores; antrum cup-like, poorly immersed; ductus relatively short, thin; bursa small, sack-like, with small star-shaped signum on lateral surface; thin duct with small bag-like bulla seminalis projected from lateral surface of bursa. + + + +Diagnosis +. The species clearly differs from all other species of the genus by the bright brown wide transverse strokes on the entire area of the fore wing, the very long saccus (equal to the valva in length) gradually tapering in the distal third. The female genitalia differ from those of + +D. lenzi +Yakovlev + + +spec. nov. + +by the thinner ductus and the thinner and shorter ductus of the bulla seminalis. + + + + +Distribution +. Western Africa ( +Benin +, +Burkina Faso +, +Cameroon +, +Côte d'Ivoire +, +Ghana +, +Guinea +, +Nigeria +, +Senegal +, +Sierra Leone +, +Togo +). The species is recorded here for the first time from +Benin +, +Burkina Faso +, and +Togo +. + + + + \ No newline at end of file diff --git a/data/03/87/87/038787808E1FFF9E1AD5D85FB6ECFD0C.xml b/data/03/87/87/038787808E1FFF9E1AD5D85FB6ECFD0C.xml new file mode 100644 index 00000000000..d4fc2df8b90 --- /dev/null +++ b/data/03/87/87/038787808E1FFF9E1AD5D85FB6ECFD0C.xml @@ -0,0 +1,568 @@ + + + +On the taxonomy of Zeuzera boisduvalii Herrich-Schäffer, 1854 (Cossidae, Zeuzerinae) species complex with description of a new genus and three new species + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-23 + + +38 + + +215 +226 + + + + +http://dx.doi.org/10.37828/em.2020.38.31 + +journal article +10.37828/em.2020.38.31 +2336-9744 +13232777 +urn:lsid:zoobank.org:pub:B0D7676D-1A36-4BBF-B8D8-531B0519D96B + + + + + + + +Davidlivingstonia staudei +Yakovlev + +spec. nov. + + + + + + +Figs 7−10 +, +18−19 +, +25 + + + + +Type material +: +Holotype +(male). “ +Zambi +a, Samfia, Mukushi, reg. Liubwe, +07−16.vii.2009 +” (MWM, GenPr Heterocera: 32.930). + + + + +Paratypes +. +Zambia + +: +2 males +, same locality and data ( +MWM +) + +; + +1 male +, +Samfya +, +Lake Bangweulu +, +S11°22′40′′ +, +E29°33′37′′ +, + +29.x.2014 + +, leg. +Smith +, +Takano +& +Oram +, ANHRT:2017.12, unique numer: ANHRTUK 00082990 ( +ANHRT +) + +; + +1 male +, N. +Rhodesia +, + +xi.1959 + +, +Samfya +( +NHMZ +) + +; + + +Democratic Republic of the Congo + +: +7 males +, +Lokolenge +, +Lulonga +, + +20.05.1927 + +, +J. Ghesquiere + +; + +1 male +, +Lulonga +, +Bifula +, + +15.09.1927 + +, +J. Ghesquiere +( +MRAC +) + +; + +1 male +, +Rep. +Congo +, + +10 km +SE Kisangani + +, +Isl. Mbiye +, +Congo +Riv. +, 00°28′N / 26°17′E, + + +24.ii. +2008 + + +, 374 m, +Gurkovich +& +Zolotuhin +(MWM, +GenPr Heterocera +: 32.932) + +; + +1 male +, +Ubangi +, +Region de Mobeka +, + +10.09.1955 + +, +Dr. M. Fontaine +( +MRAC +) + +; + +1 male +, +Sankuru +, +Lusambo +, + +8.08.1950 + +, +Dr. M. Fontaine +( +MRAC +) + +; + +31 males +, +Uele +, +Paulis +, + +25.02.1957 + +, +Dr. M. Fontaine +( +MRAC +) + +; + +1 male +, +Tshuapa +, +Lukolela +, + +8.09.1955 + +, +Dr. M. Fontaine +( +MRAC +) + +; + +1 male +, +Luebo +, 8.1921, +Lt. Ghesquiere +( +MRAC +) + +; + +3 males +, +Stan +e +Coq +, 11.1921, +L. Verlaine +( +MRAC +) + +; + +1 male +, +Lukonzobwa +, + +14.02.1931 + +, +G.F. de Witte +( +MRAC +) + +; + +1 male +, +Uvira +, 10.1927, +Ch. Seydel +( +MRAC +) + +; + +2 males +, +Itoko +a +Gombe +, 1921, +L. Verlaine +( +MRAC +) + +; + +1 male +, +Rutshuru +, 05.1937, +Ghesquiere +( +MRAC +) + +; + +1 male +, +Elisabethville +, + +3.01.1936 + +, +Ch. Seydel +( +MRAC +) + +; + +6 males +, +Leopoldville +, + +9.11.1955 + +( +MRAC +) + +; + +2 males +, +Kivu +, +Rwankwi +, + +11.10.1948 + +, +J.V. Leroy +( +MRAC +) + +; + +3 males +, +Ituri +, +Nioka +, + +5.11.1952 + +, +J. Hecq +( +MRAC +) + +. + + + + +Figures 7−15. +Adult specimens of + +Davidlivingstonia + +and their labels: 7. + +D. staudei +Yakovlev + + +spec. nov. + +, holotype (MWM). 8. + +D. staudei +Yakovlev + + +spec. nov. + +, paratype, male, Zambia, Samfia (MWM); 9. + +D. staudei +Yakovlev + + +spec. nov. + +, paratype, male, Democratic Republic of the Congo, 10 km SE Kisangani (MWM); 10. + +D. staudei +Yakovlev + + +spec. nov. + +, paratype, male, Democratic Republic of the Congo, Lokolenge (MRAC); 11. + +D. prozorovi +Yakovlev + + +spec. nov. + +, holotype (NHMUK); 12. + +D. lenzi +Yakovl + +ev +spec. nov. +, holotype (ANHRT); 13. + +D. lenzi +Yakovlev + + +spec. nov. + +, paratype, female, Zambia (ANHRT); 14. + +D. lenzi +Yakovlev + + +spec. nov. + +, paratype, male, Kenya, Sigor (MWM); 15. + +D. lenzi +Yakovlev + + +spec. nov. + +, paratype, male, Tansania, Mpanda (ZSM). + + + + +Figures 16−21. +Male genitalia of + +Davidlivingstonia + +: 16. + +D. boisduvalii +(Herrich-Schäffer, 1854) + +, Sierra Leone, Loma Mountains, gen. slide No.: LG 5183 (ANHRT); 17. + +D. boisduvalii +(Herrich-Schäffer, 1854) + +, Côte d'Ivoire, Mt. Tonkoui, gen. slide No.: ANHRT 00038 (ANHRT); 18. + +D. staudei +Yakovlev + + +spec. nov. + +, holotype, Zambia, Samfia, Mukushi, reg. Liubwe, gen. slide Heterocera No.: 32.930 (MWM); 19. + +D. staudei +Yakovlev + + +spec. nov. + +, paratype, Democratic Republic of the Congo, 10 km SE Kisangani, Island Mbiye, Congo River, gen. slide Heterocera No.: 32.932 (MWM); 20. + +D. prozorovi +Yakovlev + + +spec. nov. + +, holotype, male, Congo Belge, Congo River, gen. slide No.: NHMUK 010315467 (NHMUK); 21. + +D. lenzi +Yakovlev + + +spec. nov. + +, holotype, Zambia, Ndole Bay, on the shores of the Lake Tanganyika, gen. slide No.: ANHRT 00040 (ANHRT). Scale bar = 1 mm. + + + + +Description +. Male. Forewing length +14−18 mm +. Forewing color light-grey to light-yellow, with pattern consisting of fine, brown dense transverse dashes (discally often fused into thin transverse bands). Hind wing light-yellow or white, without pattern. + +Male genitalia. Uncus pyramidal, relatively narrow, apically pointed; valvae narrow, distal margin semicircular, costal and ventral margin smooth, slightly arcuate; juxta wide with short leaf-like posterio-lateral processes; saccus half as long as valva, gradually tapering from base to apex. Phallus typical of the genus. +Female. Female unknown. + + + +Diagnosis +. The new species differs from all the known representatives of the genus by the fine pattern of dashes on the forewing and the short saccus. + + + + +Etymology +. The species is named after Mr. Hermann Staude – well known South-African lepidopterist. + + + + +Distribution +. Northern +Zambia +( +Luapula Province +), +Democratic Republic of the Congo +. + + + + \ No newline at end of file diff --git a/data/03/92/2E/03922E4FED5AFFA3FF49F975004AF8FD.xml b/data/03/92/2E/03922E4FED5AFFA3FF49F975004AF8FD.xml new file mode 100644 index 00000000000..0e94e6493e1 --- /dev/null +++ b/data/03/92/2E/03922E4FED5AFFA3FF49F975004AF8FD.xml @@ -0,0 +1,284 @@ + + + +First record of Isochlora balinti from Kazakhstan (Lepidoptera, Noctuidae) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + + + +Author + +Titov, Sergey V. +Department of Biology and Ecology; the Research Centre for Environmental " Monitoring ", Toraighyrov University, Lomova str. 64, KZ- 140008, Pavlodar, Kazakhstan. E-mail: sandipta @ yandex. kz * Corresponding author + + + +Author + +L. + + + +Author + +I.,. + + + +Author + +. + + + +Author + +. + + + +Author + +., I. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-12 + + +38 + + +131 +134 + + + + +http://dx.doi.org/10.37828/em.2020.38.17 + +journal article +10.37828/em.2020.38.17 +2336-9744 +13232767 + + + + + + +Isochlora balinti +Babics, Csővári & L. Ronkay, 2008 + + + + + + +( +Figs 1–9 +) + + + +Isochlora balinti +Babics, Csővári & L. Ronkay, 2008 + +, + +Folia Entomologica Hungarica + +, +69 +: 2, figs 1–4, 9 ( +Type +locality: “ +Kyrgyzstan +, Yssyk- +Köl region +, +Inner Tien Shan mts +, Terskey- +Ala-Too mts +, + +10 km +SW of Barskoon-pass + +, + +3820 m + +, +N41°50’32 +, +E77°43’54” +). + + + + +Type material examined +. + +Photographs +of the + +holotype + +( +Figs 1 +, +5 +): male, “ +Kyrgyzstan +, Yssyk- +Köl region +, +Inner Tien Shan mts +, Terskey-Ala-Too mts, + +10 km +SW of Barskoon-pass + +, + +3820 m + +, +N41°50’32 +, + +E77°43’54, +17 + +.VII.2007, leg. +J. Babics +& +T + +. + +Csővári +” / red label “ +HOLOTYPE + +Isochlora balinti +Babics, Csővári & L. Ronkay, 2008 + +” / “coll. +HNHM +, + +Isochlora +( +Chamyla +) + +sp. n. slide No. RL +9299mm +L. Ronkay +, 2007” ( +HNHM +); photographs of the + +paratype + +( +Figs 2 +, +6 +): male, the same data as the holotype, gen. slide No.: JB + +292m + +(prepared by Babics) ( +HNHM +) + +. + + + +Figures 1–4 +. + +Isochlora balinti + +: adults. Depositories of the specimens: 1 and 2 in HNHM (photo by B. Tóth); 3 and 4 in CAV. + + + +Additional material examined +. + +2 males +, + +02.VII.2015 + +, SE +Kazakhstan +, +Almaty Region +, +Transili Alatau Mts +, 3.5 km +S of Chimbulak +ski resort, +Tuyuksu +gorge, 43°05’51’’ +N 77°04’31.7’’ +E, mountain tundra, P. +V +. +Egorov +leg. + +, gen. slides Nos.: AV2275 and AV2277 (prepared by Volynkin) ( +CAV +). + + + + +Remark +. The freshly collected specimens ( +Figs 3, 4 +) have an intense green suffusion on the forewings while the +type +specimens of + +I. balinti + +( +Figs 1, 2 +) almost lack a green suffusion probably due to degrading of the green pigment caused by using a conserving chemical (paradichlore) during the transporting of the material collected. + + + + +Distribution +and Bionomics. The species is currently known only from two localities in the Tien Shan mountain massif ( +Fig. 9 +). The species inhabits rocky mountain tundra at altitudes above +3500m +( +Fig. 10 +). Preimaginal stages are unknown. + + + + \ No newline at end of file diff --git a/data/03/93/87/039387C71E43EE5E2AAF44994908FDCB.xml b/data/03/93/87/039387C71E43EE5E2AAF44994908FDCB.xml new file mode 100644 index 00000000000..c0f0a2325bb --- /dev/null +++ b/data/03/93/87/039387C71E43EE5E2AAF44994908FDCB.xml @@ -0,0 +1,186 @@ + + + +Notes on the subgenus Albocosta Fibiger & Lafontaine 1997, with descriptions of five new taxa from Asia (Lepidoptera, Noctuidae) + + + +Author + +Gyulai, Péter + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-24 + + +40 + + +26 +45 + + + + +http://dx.doi.org/10.37828/em.2021.40.2 + +journal article +10.37828/em.2021.40.2 +2336-9744 +urn:lsid:zoobank.org:pub:4D3DA677-4B23-4938-A5B8-E9982D4A5D63 + + + + + + + +Dichagyris +( +Albocosta +) +musichuana + +sp. n. + + + + + + +( +Figs 11-12 +, +30-31 +) + + + + + + +Holotype +. + +Male +( +Fig. 11 +), +China +, +Sichuan +, + +W +Bamei Mts. + +, + +3750 m + +, + +10.VIII.2005 + +, leg. +S. Murzin +, slide no. GYP 5276 (coll. +PGYM +, later to be deposited in the +HNHM +). + + + + + +Paratype + +. Male, with the same data, slide no. GYP 5228 (coll. +PGYM +) + +. + + + + +Diagnosis +. + +Dichagyris (A.) musichuana + +sp. n. +( +Figs 11-12 +) is the southern vicariant species of the northern + +D. (A.) musivula + +( +Figs 9-10 +). The new species is significantly larger than + +D. musivula + +; forewing length +16-17 mm +and +12-14 mm +, respectively. Additionally, the black basal dash in forewing is conspicuously stronger, costal stripe broader, whitish – pale ochre; antemedial, postmedial and subterminal transverse lines are more defined in the new species, particularly the latter one, which is brown and more wavy. + + +In the male genitalia ( +Figs 30-31 +), the main differences are in the vesica configuration; the new species has larger, broad based subbasal diverticulum with larger endcornutus and almost twice thicker tubular section of the vesica than in the + +D. musivula + +( +Figs 28-29 +). + + + + +Description +( +Figs 11-12 +). Forewing length +16-17 mm +, wingspan +32-33 mm +. Eyes globular, black; antennae light brown, finely setose-ciliate. Palpi covered with red-brown scales, third segment very tiny. Vertex brown, dark brown, collar black with broad yellow base, thorax vesture and legs red-brown, with long rows of dorsal setae; abdomen vesture pale ochre-brown. Forewing triangular, apex pointed. Ground colour of forewings dark red-brown, slightly lighter in the subterminal area. Costa broadly whitish until the tip of the reniform stigma, conjoining with the also whitish orbicular macula and the whitish-brownish reniform stigma. Claviform stigma is not visible. Basal dash black, broad, conspicuous. Transverse lines obscure, since only slightly lighter than the ground colour; antemedial line wavy, postmedial line slightly arched, subterminal line finely lacy; fringe brown. Hindwing whitish brown suffused in the basal area, then more and more dark towards the marginal field, without discal spot and medial line; fringe pale brown. + + +Male genitalia ( +Figs 30-31 +) characterized by the long, thin uncus with a long but slight depression in the distal section and a bunch of long hairs terminally; broad tegumen; broad juxta with slight dorsal-medial depression and small ventral medial extension; rather short, strong clavus, V-shaped vinculum; almost evenly broad, medially slightly broaden valvae with large slightly falciform harpe, slight ampulla, triangular, apically pointed pollex; cucullus section with corona; rather short, tube-like, distally slightly ventrad curved aedeagus; ample, subquadrangular vesica, with a basal-subbasal eversible sclerotized streak and one subbasal asymmetrically drop-like diverticulum apically armed with a cornutus on a longish base; distal part of vesica long, tubular, evenly broad, membranous, without apical diverticulum. + +Female is unknown. + +Bionomics and distribution. +The new species is known from the +type +locality only. + + + + +Etymology +. The new species is named as a combination of the name of the close relative + +D.(A.) musivula + +and the name of province, in which it was found. + + + + \ No newline at end of file diff --git a/data/03/93/87/039387C71E46EE542AAF46FB4966F8AB.xml b/data/03/93/87/039387C71E46EE542AAF46FB4966F8AB.xml new file mode 100644 index 00000000000..9277884c96b --- /dev/null +++ b/data/03/93/87/039387C71E46EE542AAF46FB4966F8AB.xml @@ -0,0 +1,64 @@ + + + +Notes on the subgenus Albocosta Fibiger & Lafontaine 1997, with descriptions of five new taxa from Asia (Lepidoptera, Noctuidae) + + + +Author + +Gyulai, Péter + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-24 + + +40 + + +26 +45 + + + + +http://dx.doi.org/10.37828/em.2021.40.2 + +journal article +10.37828/em.2021.40.2 +2336-9744 +urn:lsid:zoobank.org:pub:4D3DA677-4B23-4938-A5B8-E9982D4A5D63 + + + + + + + +Dichagyris (Albocosta) antevolans +sp. n. + +TL + +: +Nepal +, Annapurna + + + + + +Distribution: +Nepal +: Annapurna, Ganesh Himal. + + + + \ No newline at end of file diff --git a/data/03/93/87/039387C71E47EE512AAF41C1484FFBD1.xml b/data/03/93/87/039387C71E47EE512AAF41C1484FFBD1.xml new file mode 100644 index 00000000000..8eedc7abcef --- /dev/null +++ b/data/03/93/87/039387C71E47EE512AAF41C1484FFBD1.xml @@ -0,0 +1,870 @@ + + + +Notes on the subgenus Albocosta Fibiger & Lafontaine 1997, with descriptions of five new taxa from Asia (Lepidoptera, Noctuidae) + + + +Author + +Gyulai, Péter + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-24 + + +40 + + +26 +45 + + + + +http://dx.doi.org/10.37828/em.2021.40.2 + +journal article +10.37828/em.2021.40.2 +2336-9744 +urn:lsid:zoobank.org:pub:4D3DA677-4B23-4938-A5B8-E9982D4A5D63 + + + + + + + +Dichagyris (Albocosta) lasciva pamirpsychra + +ssp. n. + + + + + + +( +Figs 5-8 +, +26-27 +, 44-45) + + + + + + +Holotype +. + +Male +( +Fig. 5 +), +Tajikistan +, E-Pamir, + +3800 m + +, +N. Tanimas +range; Nat. Res., middle stream of +Shurali-Suu river +, + +15-20.VII.2018 + +, leg. +D. Goshko +, slide no. GYP 5224 (coll. +PGYM +, later to be deposited in the +HNHM +). + + + + + +Paratypes +. + +Tajikistan +: +25 males +, with the same data, (coll. +PGYM +) + +; + +11 males +, E-Pamir, + +3700 m + +, +Muzkol +range, +Muzkol +national reserve; +Sassik +riv., + +17-25.VII.2015 + +, leg. +D. Goshko +, (coll. +PGYM +) + +; + +4 males +, same data (colls +ASV +& +MDC +) + +; + +12 males +, E-Pamir, + +3700 m + +, +Muzkol +range, +Muzkol +national reserve, +Sassik +riv., + +18-19.VII.2016 + +, leg. +D. Goshko +, (coll. +PGYM +) + +; + +7 males ++ females, same data (coll +AFM +) + +; + +3 males +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +10-20.VII.2014 + +, leg. +V. Gurko +(colls +ASV +& +MDC +) + +; + +1 male +, + +3900 m + +, EPamir, +Zulumart Mt. range +, + +20-30.VII.2014 + +, leg. +V. Gurko +(coll. +PGYM +) + +; + +4 males +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +1-10.VIII.2014 + +, leg. +V. Gurko +(colls +ASV +& +MDC +) + +; + +2 males +, same data (colls +ASV +& +MDC +) + +; + +3 males +, +1 female +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +1-10.VII.2015 + +, leg.: +V. Gurko +(coll. +PGYM +) + +; + +3 males +, same data, (colls +ASV +& +MDC +) + +; + +8 males +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +10- 20.VII.2015 + +, leg. +V. Gurko +(coll. +PGYM +) + +; + +4 males +, +1 female +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +20- 30.VII.2015 + +, leg. +V. Gurko +(colls +ASV +& +MDC +) + +; + +8 males +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +1- 10.VIII.2015 + +, leg. +V. Gurko +(colls +ASV +& +MDC +) + +; + +2 males +, + +3900 m + +, E-Pamir, +Zulumart Mt. range +, + +10- 20.VIII.2015 + +, leg.: +V. Gurko +(coll. +PGYM +) + +; + +12 males +, +1 female +, same data (colls +ASV +& +MDC +) + +; + +6 males +, same data (colls +ASV +& +MDC +) + +; + +1 male +, +South -East Pamir Mts. +, +Murgab distr. +, +Ak-Bura +massif, +20 km +W from +Tokhtamish +vill., +Sulu-istik +riv., + +3900 m + +, + +11-27.VII.2016 + +, leg. +D. Goshko +(coll. +PGYM +) + +; + +8 males +, +C. Pamir +, S-Alichurskiy range, +Dzelandy +vill., + +3500 m + +, + +8-12.VII.2014 + +, leg. +D. Goshko +; (colls +ASV +& +MDC +) + +; + +23 males +, +C. Pamir +, S-Alichurskiy range, +Dzelandy +vill., + +3500 m + +, + +30.VII-2.VIII.2014 + +, leg. +D. Goshko +; (colls +ASV +& +MDC +) + +; + +1 male +, +C. Pamir +, S-Alichurskiy range, +Dzelandy +vill., + +3500 m + +, + +30.VII.2016 + +, leg. +D. Goshko +(coll. +PGYM +) + +; + +12 males ++females, same data, + +22-26. VII. 2016 + +( +AFM +) + +; + +8 males +, +C. Pamir +, Yuzno- +Alichurskiy +range, +Dzhylondy +vill. + +3500 m + +, + +29.VII. - 3.VIII.2014 + +, leg. +D. A. Safranov +(coll. +PGYM +) + +; + +2 males +, W-Pamir, +Shugnan +range; + +3100 m + +, n. +Chorog +, +Sangou-Dara +, + +24 -27.VI.2015 + +, leg. +D. Goshko +(coll. +PGYM +) + +; + +1 male +, W-Pamir, +Shugnan +range; + +3100 m + +, n. +Chorog +, +Sangou-Dara +, + +18.VI. -3.VII.2015 + +, leg. +D. Goshko +; (coll. +MDC +) + +; + +6 males ++females, W-Pamir, +Shugnan +range; + +3100 m + +, n. +Chorog +, +Sangou-Dara +, + +22- 27.VI.2013 + +, leg. +D. Goshko +(coll. +AFM +) + +; + +2 males +, W-Pamir, +Shugnan +range; + +3100 m + +, n. +Chorog +, +Sangou-Dara +, + +28.VI.-1.VII.2015 + +, leg. +D. Goshko +(coll. +PGYM +) + +; + +55 males +, W-Pamir, +Shugnan +range; + +3300 m + +, n. +Chorog +, +Sangou-Dara +, + +14-29.VI.2018 + +, leg. +D. Goshko +(coll. +PGYM +, +4 males +coll. +Z. Varga +) + +; + +7 males +, same data, (colls +ASV +& +MDC +) + +; + +2 males +, W-Pamir, +Shugnan +range; + +3800 m + +, n. +Chorog +, +Sangou-Dara +, + +15- 20.VII.2018 + +, leg. +D. Goshko +(coll. +PGYM +) + +; + +1 male +, same data, + +18.VI. -3.VII.2015 + +, (coll. +MDC +) + +. + +Slide nos. GYP 4428male, GYP 5223male, GYP 5226male, GYP 5233female. + + + +Diagnosis +. The new subspecies ( +Figs 5-8 +) is in average somewhat smaller than the nominotypical subspecies ( +Figs 1-4 +); forewing length is +13-17 mm +(males) and +16-21 mm +(females), wingspans +28-34 mm +and +35-39 mm +, respectively. However, the most distinctive features are in the colouration of wings. Forewings are dark brown, with reddish-brown and/or violet suffusion, mostly in the middle area, with diffuse darker crosslines. Hindwings are light brownish suffused, mostly in the marginal area, with slight greyish-brown discal spot and diffuse sub-discal stripe; while in the typical subspecies has a lighter reddish-brown colouration of forewings and shiny whitish - pale ochreous hindwings. + + +In the male genitalia ( +Figs 26, 27 +), the new subspecies has shorter distal section of the valvae with apically less elongate cucullus and shorter vesica with narrower subbasal diverticulum, than in the typical subspecies ( +Fig. 25 +) + +In the female genitalia (Figs 44-45), the new subspecies differs by the slightly longer, anteriorly broader, distally narrower, medially more constricted ductus bursae from the typical subspecies (Fig. 43). + + + +Figures 1–8 +. + +Dichagyris (Albocosta) + +spp. adults. 1. + +D. (A.) lasciva + +, male, Kirgisia, Alai, Tengizbai pass, 3000-3500 m, 10 km N of, Daraut Kurgan, 11-25. VII. 1995, leg. V. A. Lukhtanov (coll. PGYM); 2. + +D. (A.) lasciva + +, female, Kirgisia, Alai, Tengizbai pass, 3000-3500 m, 10 km N of Daraut Kurgan, 11-25. VII. 1995, leg. V. A. Lukhtanov (coll. PGYM); 3. + +D. (A.) lasciva + +, male, Tajikistan, Hissar Mts., Anzob pass, 3300 m, 3. VII. 2000, leg. Perepechenko, GYP 5221 (coll. PGYM); 4. + +D. (A.) lasciva + +, female, Tajikistan, Hissar Mts., Anzob pass, 3300 m, 3. VII. 2000, leg. Perepechenko, (coll. PGYM); 5. + +D. (A.) lasciva pamirpsychra + +ssp. n., HT, male, Tajikistan, E. Pamir, 3800 m, Tanimas range, Nat. Res., middle stream of Shurali-Suu river, 15-20.VII.2018, leg. D. Goshko, GYP 5224 (coll. PGYM); 6. + +D. (A.) lasciva pamirpsychra + +ssp. n., PT, male, Tajikistan, E. Pamir, Tanimas range, Nat. Res., middle stream of Shurali-Suu river, 15- 20.VII.2018, leg. D. Goshko, (coll. PGYM); 7. + +D. (A.) lasciva pamirpsychra + +ssp. n., PT, female, Tajikistan, E. Pamir, 3900 m, E-Pamir, Zulumart Mt. range, 1-10.VII.2015, leg. V. Gurko, GYP 5233 (coll. PGYM); 8. + +D. (A.) lasciva pamirpsychra + +ssp. n., PT, male, Tajikistan, W. Pamir, Shugnan range; 3300m, n. Chorog, Sangou-Dara, 14 -29. VI. 2018, leg. D. Goshko (coll. PGYM). + + + + +Figures 9–16 +. + +Dichagyris (Albocosta) + +spp. adults. 9. + +D. (A.) musivula + +, male, China, Qinghai, 3800 m, Anemaqing Mts., 10 km SE of Xue Shan, N of Dong Qing Gou, 10 - 11. VIII. 1999, leg. P. Gyulai & A. Garai (coll. PGYM); 10. + +D. (A.) musivula + +, male, China, Qinghai, 4450 m, Anemaqing Mts., N of Changman, Chang Ma He Wu Dao Ban, 9 -10. VIII. 1999, leg. P. Gyulai & A. Garai (coll. PGYM); 11. + +D. (A.) musichuana + +sp. n. +, HT, male, China, Sichuan, W Bamei Mts., 3750 m, 10. VIII. 2005, leg. S. Murzin, slide no. GYP 5276, (coll. PGYM); 12. + +D. (A.) musichuana + +sp. n. +, PT, male, China, Sichuan, W Bamei Mts., 3750 m, 10. VIII. 2005, leg. S. Murzin, slide no. GYP 5228, (coll. PGYM); 13. + +D. (A.) ulrici + +, female, Tajikistan, Khatlon, 20 km E of Kulab, 1870 m, 22. V. 2017, leg. Benedek & Ilniczky (coll. PGYM); 14. + +D. (A.) sugii +, PT + +, female, Nepal, Annapurna, 1 km N of Khangar, 4050m, 14. VI. 1996, leg. M. Hreblay & Cs. Szabóky, GYP 5234, (coll. PGYM); 15. + +D. (A.) ochrocosta + +sp. n. +, HT, female, Bhutan, Chili La pass (= Chelé La pass), 3830 m, 27° 22' N, 89° 21' E, 16-17. X. 2009, leg. Y. Bezvotshov & V. Siniaev, slide no. GYP 4409, (coll. PGYM); 16. + +D. (A.) sugii + +, male, Nepal, Kanchenjunga, Deorali Danda, Yalung, 3920 m, 12-13. VIII. 2000, leg. M. Hreblay & T. Csővári, GYP 2074, (coll. PGYM). + + + + +Figures 17–24. + +Dichagyris (Albocosta) + +spp. adults. 17. + +D. (A.) triangularis + +, male, +India, W Bengal, Darjeeling +, 27-29. IX. 1986, leg. Aulombard & J. Plante (coll. PGYM); 18. + +D. (A.) triangularis sinangularis + +ssp. n. +, HT, male, China, prov. Shaanxi, Tsinling Mts., Fopin Mt., 33 +o +45' N, 107 +o +38' E, 1900 m, 1 - 30. VI. 2004, leg. V. Siniaev & Team, slide no. GYP 5345m (coll. PGYM); 19. + +D. (A.) triangularis sinangularis + +ssp. n. +, PT, female, China, prov. Shaanxi, Tsinling Mts., Dudamen vill., 33 +o +55' N, 107 +o +44' E, 2600 m, 20 - 30. VI. 2005, leg. V. Siniaev & Team, (coll. PGYM); 20. + +D. (A.) antevolans + +sp. n. +, HT, male, Nepal, Annapurna region, Sudame, 1250 m, 24-25. III. 1995, leg. M. Hreblay & L. Németh, slide no. GYP 5349 (coll. PGYM); 21. + +D. (A.) antevolans + +sp. n. +, PT, female, Nepal, Annapurna region, Nangethanti, 2445 m, 19-20. III. 1995, leg. M. Hreblay & L. Németh slide no. GYP 5346, (coll. PGYM); 22. + +D. (A.) antevolans + +sp. n. +, PT, Nepal, Ganesh Himal, 2 km E of Yürekharka, 3000 m, 3. IV. 1995, leg. M. Hreblay & L. Németh (coll. PGYM); 23. + +D. (A.) stentzi + +, male, Russia, Kadilnaya, 80 km S. of Irkutsk, lake Baikal, 12. VIII. 1988, leg. I. Gyulai, slide no. Hreblay 13130, (coll. PGYM); 24. + +D. (A.) stentzi + +, female, Russia, Far East, Vladivostok distr., Nachodka, 1-31. VII. 1994, leg. Kuznecov (coll. PGYM). + + + + +Description +( +Figs 5-8 +). Forewing length +14-17 mm +, wingspan +29-34 mm +. Palpi covered with dark red-brown scales, third segment tiny, apically lighter. Vertex brown, dark brown, collar blackish brown with broad light brownish-ochreous base, thorax vesture and legs dark red-brown, abdomen vesture pale brown. Forewings triangular, apex pointed. Ground colour of forewings dark red - brown with more or less violet suffusion, slightly darker in the middle area and lighter, more violaceous grey in the subterminal area. Costa broadly pale ochreous-white or yellowish until the tip of the reniform stigma, conjoining with the same coloured orbicular macula and the yellowish-brownish reniform stigma. Transverse lines obscure, antemedial lines wavy, postmedial lines evenly arched, subterminal lines finely lacy; fringe brown. Hindwings light brownish, slightly darker suffused in the marginal field, with discal spot and without medial line; fringe pale brown. + + +Male genitalia ( +Figs 26-27 +). Characterized by the long, curved, terminally hooked, apically acute uncus with a long bunch of long hairs distally; broad tegumen; broad juxta with two symmetrical wing-like extensions dorsally, and with broadly v-shaped dorsal-medial incision. Clavus short, vinculum V-shaped. Valvae almost evenly broad with a long extension in the dorsal costa medially; harpe strong, straight or almost straight, cucullus corona with a row of fine spines and bushy, long hairs. Aedeagus straight with a long strongly sclerotized, eversible bar onto the basal section of vesica. Vesica tubular with a tiny apical diverticulum; subbasal diverticulum armed with a small acute cornutus apically. + +Female genitalia (Figs 44-45). The main characters are the setose, short papillae anales, short apophyses anteriores and longer but finer apophyses posteriores; sclerotized antrum with more sclerotized, pincer-like, bilateral, symmetrical lobi; anteriorly broad, then evenly tapering, medially slightly constricted, posteriorly longitudinally wrinkled sclerotized and extending ductus bursae; elongate, tubular appendix bursae and corpus bursae, from which the former one is somewhat longer. + +Bionomics and distribution +. The new subspecies is restricted to the Pamir Mts., while the nominotypical subspecies is widely distributed in the Transalai ( +type +locality), Alai, Tien Shan, Hissar and Vantsh mountains. + + + + +Etymology. +The new subspecies is named after the cold climatological characters of the habitats in the high Pamir, above +3000 m +. + + + + \ No newline at end of file diff --git a/data/03/93/87/039387C71E55EE442AAF42394836FA7A.xml b/data/03/93/87/039387C71E55EE442AAF42394836FA7A.xml new file mode 100644 index 00000000000..1dd6b304851 --- /dev/null +++ b/data/03/93/87/039387C71E55EE442AAF42394836FA7A.xml @@ -0,0 +1,687 @@ + + + +Notes on the subgenus Albocosta Fibiger & Lafontaine 1997, with descriptions of five new taxa from Asia (Lepidoptera, Noctuidae) + + + +Author + +Gyulai, Péter + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-24 + + +40 + + +26 +45 + + + + +http://dx.doi.org/10.37828/em.2021.40.2 + +journal article +10.37828/em.2021.40.2 +2336-9744 +urn:lsid:zoobank.org:pub:4D3DA677-4B23-4938-A5B8-E9982D4A5D63 + + + + + + +Dichagyris (Albocosta) antevolans +sp. n. + + + + + + +( +Figs 20-22 +, +40-41 +, +55-56 +) + + + + + + +Holotype +. + +Male +( +Fig. 20 +) +Nepal +, +Annapurna region +, +Sudame +, + +1250 m + +, +83°45' E +28°20' N +, + +24-25.III. 1995 + +, leg. +M. Hreblay +& +L. Németh +, slide no. GYP 5349 (coll. +PGYM +, later to be deposited in the +HNHM +). + + + + + +Paratypes + +. +1 male +, +1 female +, with same data (coll. +PGYM +) + +; + +1 male +, same data, (coll. +MH +/ +HNHM +) + +; + +1 female +, +Nepal +, +Annapurna region +, +Nangethanti +, + +2445 m + +, + +19-20.III.1995 + +, leg. +M. Hreblay +& +L. Németh +(coll. +PGYM +) + +; + +1 male +, +Nepal +, +Ganesh Himal +, + +2 km +E of Yürekharka + +, + +3000 m + +, + +3.IV.1995 + +, leg. +M. Hreblay +& +L. Németh +(coll. +PGYM +) + +; + +1 female +, +Nepal +, +Ganesh Himal +, +2 km +E from +Yurekharka +, + +3000 m + +, + +5.IV.1995 + +, +85°15' E +, +28°10' N +, leg. +M. Hreblay +& +L. Németh +(coll. +MH +/ +HNHM +) + +; + +1 female +, +Nepal +, +Ganesh Himal +, +3 km +SE from +Somdang +, + +3450 m + +, + +6.IV.1995 + +. +85°13' E +, +28°11' N +, leg. +M. Hreblay +& +L. Németh +(coll. +MH +/ +HNHM +) + +; + +1 male +, +1 female +, +Nepal +, +Ganesh Himal +, + +2 km +S of Somdang + +, + +3000 m + +, +85°12' E +, +28°10'N +, + +8.IV.1995 + +, leg. +M. Hreblay +& +L. Németh +(coll. +PGYM +) + +; + +1 female +, same data (coll. +MH +/ +HNHM +) + +; + +3 males +, +1 female +, +Nepal +, +Ganesh Himal +, + +12 km +S of Somdang + +, + +2500 m + +, +85°12' E +, +28°08'N +, + +9.IV.1995 + +, leg. +M. Hreblay +& +L. Németh +(coll. +PGYM +) + +; + +2 males +, +2 females +, same data (coll. +MH +/ +HNHM +) + +; + +1 female +, +Nepal +, +Ganesh Himal +, +1 km +E from +Gadrang +, + +2520 m + +, + +3-4.IV.1995 + +, +85°16' E +28°09'N +, leg. +M. Hreblay +& +L. Németh +(coll. +MH +/ +HNHM +) + +; + +2 males +, +Nepal +, +Ganesh Himal +, + +1 km +E of Gadrang + +, + +2520 m + +, + +9.IV.1995 + +, leg. +M. Hreblay +& +L. Németh +(coll. +PGYM +) + +; + +1 female +, +Nepal +, +Ganesh Himal +, + +2 km +E of Thangjet + +, + +2165 m + +, + +1.IV.1995 + +, +85°19' E +28°11'N +leg. +M. Hreblay +& +L. Németh +(coll. +MH +/ +HNHM +) + +; + +2 males +, +East +Nepal +, +Tinjure Danda +, + +2 km +SW of Chauki + +, + +2980 m + +, + +22.III.1999 + +, leg. +Márton Hreblay +(coll. +MH +/ +HNHM +) + +. + +Slide nos.: GYP 5346female, GYP 5347male, GYP 5348female + + + +Diagnosis +. The closest relatives of the new species ( +Figs 20-22 +,) are + +D. +( +A. +) +stentzi + +( +Figs 23-24 +) and + +D. +( +A. +) +triangularis + +( +Fig. 17 +). In the external features, new species is more reminiscent of typical + +D. +( +A. +) +triangularis + +, however in the genitalia structure, of + +D. +( +A. +) +stentzi + +( +Figs 23-24 +). In comparison of + +D. +( +A. +) +triangularis + +, it is lighter reddish-brown and concolorous in forewings, without blackish or violet glimmering; with lighter, slightly broader costal stripe, more defined, double reddish transverse lines, from which the antemedial line is not zigzag but only slightly sinuous; hindwings reddish brown suffused and not brown. In average, it is somewhat larger than + +D. +( +A. +) +stentzi + +; forewing length +17-20 mm +, wingspan +34-42 mm +, while those are in + +D. +( +A. +) +stentzi + +13-19 and +28-37 mm +, respectively. The new species is well distinguished from + +stentzi + +at first sight by the clear light yellowish costal area and the conspicuously lighter and concolorous reddish - brown forewings, without blackish or violet glimmering, and the lighter, reddish brown suffused hindwings. + + +In the male genitalia, compared to + +D. +( +A. +) +triangularis triangularis + +( +Figs 36-37 +), the new species ( +Figs 40-41 +) has somewhat longer, but slimmer uncus, without the distal long extension; almost evenly broad valva, much less convex medial section in the dorsal costa and more concave in the ventral side, while the „cucullus” section is much more extensive. Aedeagus is somewhat longer and thinner, vesica and the medial diverticulum less ample, while the apical cornutus in it is significantly smaller, thinner, straight and not hook-like, as in the + +D. +( +A. +) +triangularis triangularis + +. It is less distinctive from that of + +D. +( +A. +) +stentzi + +, due to the individual variability in the shape of valva. The best key for separation are the conspicuously longer subterminal diverticulum, longer, slimmer aedeagus and the longer distal tube of vesica. In the female genitalia, it well differs from that of the typical + +D. +( +A. +) +triangularis triangularis + +by the smaller papilla anales, more sclerotized antrum, significantly thinner ductus bursae, less ample corpus bursae and the foot-shaped appendix bursae. The differences are the same in comparison with + +D. +( +A. +) +triangularis sinangularis + +ssp. n. +( +Figs 38, 39 +), with the exception of the rather thin ductus bursae in both taxa (but it is somewhat longer in the new species) and the broaden distal section in + +D. +( +A. +) +sinangularis + +ssp. n +.. From + +D. +( +A. +) +stentzi + +( +Fig. 42 +), new species well differs in the more sclerotized antrum, significantly thinner, longer ductus bursae and less ample, foot-shaped appendix bursae. + + +It is worth to mention, that the single +type +of + +D. (A.) triangularis + +ab. +rufata +Warren, 1912 +is somewhat also similar, but it is only the reddish form of + +D. (A.) triangularis triangularis + +, and collected in May, with one and half month later, than all of the + +D. (A.) antevolans + +sp. n +.. Furthermore, lighter reddish forms occur very rarely in other + +Albocosta + +(see e.g. + +D. (A.) sugii + +, +Figs. 16 +, +33 +). The correct identification is supported by the phenology and distribution pattern; the new species has the earliest flight period (March and beginning of April) in + +Albocosta + +; while its two sister species are typical summer ones, only the + +D. (A.) triangularis triangularis + +starts in the Indian Himalaya in the second half of May. Both of relatives are known in late autumnal, rather worn specimens also, probably after the summer diapause. Sympatric occurrence is known only with + +D. (A.) triangularis triangularis + +in the Nepali Himalaya. + + + + +Description +( +Figs 1-3 +). Forewing length +17-20 mm +, wingspan +34-42 mm +. Eyes globular, black; antennae light brown, filiform, but finely and densely ciliated in males. Palpi covered with long brown vesture, but third joint only with brown scales. Vertex pale yellowish or pale brown, collar black with broad whitish-pale yellowish base; thorax vesture and legs red-brown, with long rows of dorsal setae; abdomen vesture pale brownish. Forewings triangle, apex rounded. Ground colour of forewings solid color red-brown. Wing pattern shows the typical characters of + +Albocosta + +; costa broadly whitish-pale yellowish until the tip of the reniform stigma, conjoining with the same coloured orbicular macula and the pale yellowish-brownish reniform stigma. Claviform stigma not visible. Basal dash shortly triangle, black, conspicuous. Transverse lines conspicuous, double, lighter than ground colour; antemedial line oblique, slightly wavy only, postmedial line slightly arched, subterminal line lighter, almost straight, finely wavy; fringe brown. Hindwings brown, reddish brown, discal spot darker brown, slight, medial line not distinctive; fringe reddish. + + +Male genitalia ( +Figs 40-41 +). Characterized by the long, thin uncus with a long bunch of long hairs terminally; broad tegumen; broadly heart shape juxta with slight dorsal-medial depression; rather short, strong clavus, V-shaped vinculum; almost evenly broad valva, with convex dorsad costa and concave in ventral side medially, with large, curved, apically rounded harpe; long but slight ampulla and small, apically rounded pollex; cucullus section broad, elongate dorsad, without corona; tube-like, distally slightly ventrad curved aedeagus with sclerotized carina. Vesica membranous, globularly twisted, then long, tubular and evenly thinning and curved distally, bearing a medial drop-like diverticulum, which apically armed with a small, straight cornutus; while the subterminal diverticulum long, tubular, curved. + + +Female genitalia. ( +Figs 55-56 +). Papillae anales setose, short and angular; apophyses anteriores and apophyses posteriores thin, last ones somewhat longer; antrum plate strongly sclerotized, V-shaped, with sclerotized, bilateral, symmetrical lobi. Ductus bursae tubular, long, posteriorly longitudinally slightly sclerotized-wrinkled. Appendix bursae elongate, distally foot-shaped, long; corpus bursae long, distally evenly more ample. + + +Bionomics and distribution. +The new species is known from the Nepali Himalaya. + + + + +Etymology +. The name of new species refers to the earliest flight period among +Albocosta +(„flies earlier than the rest of the relative taxa“). + + + + \ No newline at end of file diff --git a/data/03/9C/5C/039C5C52FFD5944CFF456F36FE86FD25.xml b/data/03/9C/5C/039C5C52FFD5944CFF456F36FE86FD25.xml new file mode 100644 index 00000000000..d76c74b774c --- /dev/null +++ b/data/03/9C/5C/039C5C52FFD5944CFF456F36FE86FD25.xml @@ -0,0 +1,368 @@ + + + +A new marine mite of the genus Litarachna Walter, 1925 from Guadeloupe, Caribbean Sea (Acari, Hydrachnidia, Pontarachnidae) + + + +Author + +Pešić, Vladimir +Department of Biology, University of Montenegro, Cetinjski put b. b., 81000 Podgorica, Montenegro. E-mail: vladopesic @ gmail. com + + + +Author + +Chatterjee, Tapas +Crescent International School, Bario, Govindpur, Dhanbad 828109, Jharkhand, India. E-mail: drtchatterjee @ yahoo. co. in + + + +Author + +Schizas, Nikolaos V. +Department of Marine Sciences, University of Puerto Rico, Mayagüez Call Box 9000, Mayagüez, PR 00681, Puerto Rico, USA. E-mail: nikolaos. schizas @ upr. edu + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-22 + + +38 + + +205 +209 + + + + +http://dx.doi.org/10.37828/em.2020.38.28 + +journal article +10.37828/em.2020.38.28 +2336-9744 +13232319 +urn:lsid:zoobank.org:pub:6BA03D35-4035-4148-A06C-05E3EE47CA96 + + + + + + + +Litarachna guadeloupensis + +sp. nov. + + + + + + +Figs. 1-2 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +4AAE1D6F-20A3-49EF-90EA-CA03D425EE32 + + + + + +Material examined +— + +Holotype +♂ +( +RMNH +), +Caribbean Sea +, +Guadeloupe +, +Ilet la Biche +, +16°20'19.3"N +61°38'51.7"W +, + +1-2 m +depth + +, + +February 4, 2008 + +, leg. +NV Schizas +, A Jassoud, dissected and slide mounted + +. + +Paratypes +: 3 deutonymphs, same place and data as the holotype, leg. +Schizas +, one of them dissected and slide mounted ( +RMNH +) + +. + + +Compared material +— + +Litarachna caribica + +, +holotype +♂ +, +paratype +deutonymph, +Curaçao +, Nieuwpoort, +12°02'50"N +, +68°49'21"W +, +24.x.2007 +, Schizas & Torres-Prats ( +RMNH +). + +Litarachna lopezae + +, +holotype +♂ +, +Puerto Rico +, Bajo de Sico, +18°14'41.676"N +, +67°24'45.791"W +, depth 69.5 m, +20.iv.2011 +( +NHMB +). Notes: As stated in the original description of + +L. caribica + +(see + +Pešić +et al +. 2008 + +) and + +L. lopezae + +(see + +Pešić +et al +. 2014 + +) the +holotypes +of these two species were planned to be deposited in the Museum of the Natural History in Podgorica, +Montenegro +( +MNH-PM +). However, the conditions for depositing and long-term curation of type material in MNH-PM are poor, not allowing the safe accommodation of the specimens. Therefore, the first author of the species’ descriptions ( +VP +) decided to transfer the type material to other reputable museums. + +Litarachna lopezae + +was transferred to the Museum of Natural History Basel ( +NHMB +) and the type material of + +L. caribica + +will be transferred to the Naturalis Biodiversity Center in Leiden ( +RMNH +). + + + + +Diagnosis +(Female unknown) — A pair of small platelets with coxoglandularia 4 and associated setae free in the integument between posterior apodemes of Cx-IV; posterior margin of Cx-IV with long medial posterior apodemes extending beyond anterior margin of the ring around gonopore; a ring around gonopore with two pairs of setae surrounded by 43-44 pairs of perigenital setae free in integument. + + + + +Description + + +Male +— Idiosoma L 289, W223. Coxal field: L 133, W 204; Cx-I separated medially; suture lines Cx-II/III and Cx-III/IV incomplete; posterior margin of Cx-IV with two pairs of apodemes, the medial ones long, posteriorly extending beyond the anterior margin of sclerotized ring around gonopore ( +Fig. 1A +). Sclerotized ring around gonopore L/W 27/25, with two pairs of setae, surrounded by 43-44 pairs of perigenital setae lying free in integument. Between the posterior apodemes of the fourth coxal plates a pair of glandularia-like structures and a pair of small platelets with coxoglandularia 4 and associated setae. Posterior to the genital field a pair of platelets with three pores (V3 [gland and seta sensu + +Wiles +et al +. 2002 + +] fused with Lgl-3) and three pairs of wheel-like acetabula sensu +Cook (1996) +. One of these wheel-like structures large with many radiating spokes, the most posterior ones small with relatively few radiating spokes. Excretory pore unsclerotized, near posterior end of idiosoma. + + +Palp: total L 210; dL/H, dL/H ratio: P-1, 16/14, 1.16; P-2, 65/33, 2.0; P-3, 25/27, 0.92; P-4, 77/17, 4.45; P-5, 27/11, 2.4; L ratio P-2/P-4, 0.85; P-2 ventral margin concave, dorsal margin convexly bowed; P-3 ventrally almost straight; P-4 with setal tubercle, dividing segment in two parts, both parts with a concave margin ( +Fig. 1B +). Legs: dL of I-L-1-6: 27, 30, 36, 42, 61, 78. dL of IV-L-1-6: 63, 42, 49, 83, 95, 106; III-L-5 and IV-L-5 each with two swimming setae. + +Female unknown. + + +Figure 1 +. + +Litarachna guadeloupensis + + +sp. nov +. + +, holotype ♂, Guadeloupe, Caribbean Sea: A – idiosoma, ventral view; B – palp; C – I-leg. Scale bar = 100 µm. + + + +Deutonymph: As in adult but lacking a genital field ( +Fig. 2A +). Idiosoma L 216, W 169; coxal field L 91, W 147; Palp ( +Fig. 2B +): total L 146; dL/H, dL/H ratio: P-1, 10/12, 0,85; P-2, 44/23, 1.87; P-3, 20/20, 1.0; P-4, 53/14, 3.8; P-5, 19/9, 2.0; L ratio P-2/P-4, 0.83; Legs: dL of I-L-1-6: 24, 24, 27, 28, 42, 58. dL of IV-L- 1-6: 41, 27, 31, 53, 64, 64; III-L-5 and IV-L-5 with one and two swimming setae, respectively. + + + + +Etymology +— Named after the island where the new species was found. + + + + +Discussion +— The new species belongs to the + +Litarachna duboscqi + +species group (see + +Pešić +et al +. 2008 + +for discussion) characterized primarily by the incomplete, medially obliterated, suture line Cx-III/IV and ventral margin of P-4 with a large tubercle. + + +Due to the glandularium-like structure posterior to Cx-IV not fused with adjoining coxoglandularia 4, and the higher number of perigenital setae (> 20 pairs) in male, the new species resembles + +Litarachna sagamiensis +Moto & Abé, 2013 + +from the Pacific coast of +Japan +and + +L. caribica + +from +Curaçao +. The latter species differs in the light fusion of the first coxal plates (unfused in + +guadeloupensis + +), and a moderate length of medial posterior apodemes of Cx-IV not extending beyond the anterior margin of the male sclerotized ring around gonopore (extending in + +guadeloupensis + +), the latter bearing four pairs of setae (two pairs in + +guadeloupensis + +). + +Litarachna sagamiensis +Moto & Abé, 2013 + +is similar to the new species in the unfused CxI, but can easily be separated from the male of new species in lower number of perigental setae (24–25, data taken from +Moto & Abé 2013 +) and a comparatively longer medial posterior apodemes of Cx-IV reaching posterior margin of the sclerotized ring around gonopore ( +Moto & Abé 2013 +) + + +Two other species known from the Caribbean Sea, + +L. degiustii + +and + +L. lopezae + +belong also to +duboscqi- +species group. + +Litarachna degiustii + +differs in the large fusion of the first coxal plates, the fusion of glandularium-like structure posterior of the fourth coxal plates with coxoglandularia 4, and the presence of four pairs of perigenital setae in the male ( +Cook 1958 +; + +Pešić +et al +. 2008 + +). + +Litarachna lopezae + +can be separated by the fused Cx-I, a glandularium-like structure fused with Cx-IV, a peg-like seta at the base of P- 4 ventral tubercle and the presence of four pairs of perigenital setae in the male ( + +Pešić +et al +. 2014 + +). + + +Conclusion +— This is the first report of a new pontarachnid mite species from +Guadeloupe +indicating both the lack of taxon-specific sampling efforts and the understudied species-rich meiofauna assemblages in the Caribbean Sea. + + + + \ No newline at end of file diff --git a/data/03/A1/87/03A187C0FFE5634096D5FCECFD15ADCA.xml b/data/03/A1/87/03A187C0FFE5634096D5FCECFD15ADCA.xml new file mode 100644 index 00000000000..7131c2e91c9 --- /dev/null +++ b/data/03/A1/87/03A187C0FFE5634096D5FCECFD15ADCA.xml @@ -0,0 +1,288 @@ + + + +Six new species of the genus Tumicla Wallengren, 1863 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia & E-mail: monstruncusarctia @ gmail. com + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & E-mail: gyulalaszlo @ anhrt. org. uk * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +36 +50 + + + + +http://dx.doi.org/10.37828/em.2020.38.6 + +journal article +10.37828/em.2020.38.6 +2336-9744 +13232544 +urn:lsid:zoobank.org:pub:7367D564-EB75-445C-A8A0-2E83C3A52FB3 + + + + + + + +Tumicla pringlei + +sp. n. + + + + + + +( +Figs 7, 8 +, +27 +, +39 +) + + + + +Type material. + + +Holotype + +( +Figs 7 +, +27 +): male, “ +Tanzania +: +Amani +, Malaria Institute, +G. Pringle +coll., +BM 1966-281 +” / “Mal Inst Amani P. 517 5/63” / “ +G. Pringle +coll. +BM 1966-281 +” / QR- code label with unique number +NHMUK 010915999 +, gen. slide No.: +NHMUK010314595 +(prepared by +Volynkin +) ( +NHMUK +). + + + + + +Paratypes + +. + +TANZANIA + +: +1 female +, with the same data as the holotype, +NHMUK + + +unique number: 010916000, gen. slide No.: +NHMUK010314596 +(prepared by Volynkin) + +; + +1 female +, +Tanzania +: +Amani +, +Malaria Institute +, +G. Pringle +coll., +BM 1966-281 + +, Mal Inst Amani P. 517 8/63; + +1 female +without abdomen, same data but +Mal Inst Amani P. +517 7/64 ( +NHMUK +) + +. + + + + +Diagnosis +. The forewing length is 10.5 mm in the male +holotype +and 11–11.5 mm in females. In its coloration and forewing markings, + +T. pringlei + +( +Figs 7, 8 +) is reminiscent of + +T. usa + +, + +T. mbeghai + +, + +T. chuquelae + +, + +T. elephantina + +( +Figs 1–6 +) and females of + +T. similis + +( +Figs 9–10 +) but easily recognized by its considerably smaller size, less elongate forewing and more rounded forewing apex. The male genitalia of + +T. pringlei + +( +Fig. 27 +) are most similar to those of + +T. similis + +( +Fig. 28 +) but easily distinguished by a number of diagnostic features as follows: in the male genital capsule of + +T. pringlei + +, the uncus is thicker and evenly curved (it is straight medially and curved distally in + +T. similis + +), the juxta is much smaller than that of + +T. similis + +and the vinculum is shorter and U-shaped (it is longer and V-shaped in + +T. similis + +). The valva of the new species is dilated medially but tapered distally whereas that of + +T. similis + +is evenly dilated distally. The distal section of the valva of + +T. pringlei + +bears two or three large triangular protrusions dorsally and one tiny protrusion ventrally, while the distal section of the valva of + +T. similis + +is irregularly dentate dorsally with short triangular protrusions but lacking any ventral protrusions. The sacculus of the new species is conspicuously narrower and shorter than in + +T. similis + +. The aedeagus of + +T. pringlei + +is considerably wider than in + +T. similis + +lacking a distal carinal process. The vesica of the new species is markedly wider than in + +T. similis + +, having a hook-like dorsal diverticulum scobinated apically, whereas the vesica of + +T. similis + +has two short but wide membranous diverticula. The ground plan of the female genitalia of + +T. pringlei + +( +Fig. 39 +) is reminiscent of + +T. similis + +( +Fig. 40 +), but in the new species the ostium and ductus bursae are markedly wider. The posterior section of the corpus bursae of the new species is considerably longer and wider than that of its congener. Additionally, the appendix bursae of + +T. pringlei + +is longer and curved apically whereas that of + +T. similis + +is very short and broadly conical. + + + + +Distribution +. The new species is currently only known from the East Usambara Mountains in northeastern +Tanzania +. + + + + +Etymology +. The new species is named after the collector of its +type +series, Dr Gerry Pringle, former director of the Malaria Institute in Amani, +Tanzania +. + + + + \ No newline at end of file diff --git a/data/03/A1/87/03A187C0FFE6634096D5F8F2FEECA889.xml b/data/03/A1/87/03A187C0FFE6634096D5F8F2FEECA889.xml new file mode 100644 index 00000000000..751c41d0159 --- /dev/null +++ b/data/03/A1/87/03A187C0FFE6634096D5F8F2FEECA889.xml @@ -0,0 +1,194 @@ + + + +Six new species of the genus Tumicla Wallengren, 1863 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia & E-mail: monstruncusarctia @ gmail. com + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & E-mail: gyulalaszlo @ anhrt. org. uk * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +36 +50 + + + + +http://dx.doi.org/10.37828/em.2020.38.6 + +journal article +10.37828/em.2020.38.6 +2336-9744 +13232544 +urn:lsid:zoobank.org:pub:7367D564-EB75-445C-A8A0-2E83C3A52FB3 + + + + + + + +Tumicla chuquelae + +sp. n. + + + + + + +( +Figs 5 +, +37 +) + + + + +Type material. + + +Holotype + +( +Figs 5 +, +37 +): female, “ +Mozambique +, + +630m + +, +Manica Province +, +Chimanimani National Reserve +, +Moribane Forest +, +Ndzou Camp +( +Moist Forest +), +19°44'01.4''S +, +33°20'15.1''E +, + +3–5.viii.2018 + +, +MV +Light Trap +, László, G., Miles, W., +Vetina, A. +leg., +ANHRT +:2018.30”, unique number: +ANHRT 00047089 +, gen. slide No.: AV4929 ( +ANHRT +). + + + + + +Diagnosis +. The forewing length is +14 mm +in the female +holotype +. + +Tumicla chuquelae + +( +Fig. 5 +) is the closest relative of + +T. elephantina + +( +Fig. 6 +), from which it differs externally by its pale yellow forewing ground color (which varies from brick red to honey in + +T. elephantina + +). The hindwing of + +T. chuquelae + +is pale yellow (carrot red in + +T. elephantina + +) lacking blackish streaks at its apex which are characteristic in + +T. elephantina + +. The female genitalia of + +T. chuquelae + +( +Fig. 37 +) differ from those of + +T. elephantina + +( +Fig. 38 +) in their slightly shorter apophyses anteriores and posteriores, the somewhat wider ostium bursae and the markedly narrower posterior section of the corpus bursae bearing considerably shorter left and right lateral protrusions. In addition, the ventral surface of the ductus bursae is smooth in the new species, whereas it is slightly wrinkled in + +T. elephantina + +. + +The male is unknown. + + + +Distribution +. The new species is known only from its type locality in central +Mozambique +. The +holotype +was collected in a moist forest on the western slopes of the Chimanimani Mountains. + + + + +Etymology +. The new species is dedicated to Dr Lucilia Chuquela, director of the Museu de História Natural de +Maputo +, expressing our gratitude for the fruitful collaboration between her institution and the ANHRT. + + + + \ No newline at end of file diff --git a/data/03/A1/87/03A187C0FFE6634396D5FD34FAC1AD63.xml b/data/03/A1/87/03A187C0FFE6634396D5FD34FAC1AD63.xml new file mode 100644 index 00000000000..7101847387d --- /dev/null +++ b/data/03/A1/87/03A187C0FFE6634396D5FD34FAC1AD63.xml @@ -0,0 +1,284 @@ + + + +Six new species of the genus Tumicla Wallengren, 1863 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia & E-mail: monstruncusarctia @ gmail. com + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & E-mail: gyulalaszlo @ anhrt. org. uk * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +36 +50 + + + + +http://dx.doi.org/10.37828/em.2020.38.6 + +journal article +10.37828/em.2020.38.6 +2336-9744 +13232544 +urn:lsid:zoobank.org:pub:7367D564-EB75-445C-A8A0-2E83C3A52FB3 + + + + + + + +Tumicla usa + +sp. n. + + + + + + +( +Figs 1, 2 +, +24 +, +34, 35 +) + + + + +Type material. + + +Holotype + +( +Figs 2 +, +34 +): female, “ +Africa +, +Tanzania +, +USA River + +3900 ft. + +, + +28.IX.1965 + +, leg. +Dr. J. Szunyoghy +”, gen. slide +No. +: AV5721 ( +HNHM +). + + + + + +Paratypes + +. + +TANZANIA + +: +1 male +, +1 female +, with the same locality and collector as the +holotype +but, IX.– + +II-1965 + +-66, gen. slides Nos.: AV5720 (male) and AV5996 (female) ( +HNHM +) + +. + + + + +Diagnosis +. The forewing length is +10 mm +in the male and +14–16 mm +in females. The new species ( +Figs 1, 2 +) is very similar externally to + +Tumicla mbeghai +Volynkin & László, 2019 + +( +Figs 3, 4 +) in its coloration and forewing markings but distinguished by its considerably smaller size. The male genital capsule of + +T. usa + +( +Fig. 24 +) is nearly identical to that of + +T. mbeghai + +( +Fig. 25 +) but differs in its noticeably wider valva and slightly larger vinculum. Compared to + +Tumicla elephantina +Volynkin & László, 2019 + +( +Fig. 26 +), the male genital capsule of + +T. usa + +has a more robust vinculum and a distally wider valva with a more dentate dorsal margin distally. The aedeagus of the new species is markedly thicker and somewhat shorter than in + +T. mbeghai + +and is nearly identical to that of + +T. elephantina + +. The vesica of + +T. usa + +is similar to that of + +T. mbeghai + +but is longer, its distal diverticulum is considerably shorter and the cornutus is slightly curved medially (whereas it is straight in + +T. mbeghai + +). The vesica of + +T. usa + +bears only a single cornutus, whereas that of + +T. elephantina + +is armed with two cornuti of different lengths. Additionally, the vesica of the new species is slightly shorter and distally narrower and its distal diverticulum is shorter but basally wider in comparison to those structures in + +T. elephantina + +. The female genitalia of + +T. usa + +( +Figs 34, 35 +) differ from those of + +T. mbeghai + +( +Fig. 36 +) more conspicuously than in the male genitalia and are easily recognized by their wider and longer ductus bursae. The posterior section of the corpus bursae of + +T. usa + +is shorter and narrower than in + +T. mbeghai + +and its right lateral protrusion is reduced to a small, rounded sclerotized plate, whereas this structure is represented by an elongate conical membranous process with a sclerotized plate at its base in + +T. mbeghai + +. The anterior section of the corpus bursae of + +T. usa + +is much smaller than that of + +T. mbeghai + +. The female genitalia of the new species differ from those of + +T. chuquelae + +( +Fig. 37 +) and + +T. elephantina + +( +Fig. 38 +) by their markedly longer and wider ductus bursae and the reduced right lateral protrusion of the posterior section of the corpus bursae. Additionally, in + +T. usa + +, the left margin of the posterior section of the corpus bursae and the base of the appendix bursae are more heavily sclerotized than in + +T. chuquelae + +and + +T. elephantina + +. The appendix bursae and the anterior section of the corpus bursae of the new species are considerably smaller than those of the related species. + + + + +Distribution +. The new species is currently known only from the lower slopes of Mount Meru, +Arusha Region +in northeastern +Tanzania +. + + + + +Etymology +. The species name refers to its +type +locality, the town of +Usa River +in +Tanzania +. + + + + \ No newline at end of file diff --git a/data/03/A1/87/03A187C0FFEB634F96D5F8BCFCB7AE59.xml b/data/03/A1/87/03A187C0FFEB634F96D5F8BCFCB7AE59.xml new file mode 100644 index 00000000000..58b9d8ca8e0 --- /dev/null +++ b/data/03/A1/87/03A187C0FFEB634F96D5F8BCFCB7AE59.xml @@ -0,0 +1,254 @@ + + + +Six new species of the genus Tumicla Wallengren, 1863 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia & E-mail: monstruncusarctia @ gmail. com + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & E-mail: gyulalaszlo @ anhrt. org. uk * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +36 +50 + + + + +http://dx.doi.org/10.37828/em.2020.38.6 + +journal article +10.37828/em.2020.38.6 +2336-9744 +13232544 +urn:lsid:zoobank.org:pub:7367D564-EB75-445C-A8A0-2E83C3A52FB3 + + + + + + + +Tumicla fisheri + +sp. n. + + + + + + +( +Figs 20, 21 +, +32 +, +45 +) + + + + +Type material. + + +Holotype + +( +Figs 20 +, +32 +): male, “ +Zambia +, + +1400m + +, +Hillwood +, +Ikelenge +( +Miombo +/ +Riverine forest +mosaic), +11°06'02''S +, +24°18'59''E +, + +23–30.xi.2019 + +, +LepiLED Light Trap +, Bashford, M., Miles, W., Mulvaney, L., +Smith +, +R +. leg., +ANHRT +:2019.25”, unique number +ANHRT 00132379 +, gen. slide No.: AV5955 ( +ANHRT +). + + + + + +Paratypes + +. + +ZAMBIA + +: +7 males +, +5 females +, with the same data as the holotype, unique numbers: ANHRTUK 00107622, 00132326, 00132346, 00132347, 00132378, 00132380, 00132459, 00132460, 00132461, 00132479, 00132480, 00132609, gen. slides Nos.: AV5956, AV5995 (females) ( +ANHRT +) + +. + + + + +Diagnosis +. The forewing length is +11–12 mm +in males and +13–14 mm +in females. The new species ( +Figs 20, 21 +) is easily recognized by the presence of a conspicuous black streak running along the Cu vein between the forewing base and the black outer forewing area and dilated between veins M +2 +and M +3 +, which is unique in this genus. The male genital capsule of + +T. fisheri + +( +Fig. 32 +) is similar to that of + +T. admiranda + +( +Fig. 33 +), but the uncus is somewhat longer and basally wider and the apical process of the valva is narrower than those of + +T. admiranda + +. The aedeagus of the new species is slightly shorter and wider than that of + +T. admiranda + +. The main chamber of the vesica of + +T. fisheri + +is relatively short, directed distally, bearing a dense row of numerous spine-like cornuti dorsally and apically, whereas that of + +T. admiranda + +is longer, strongly curved ventrally and almost entirely covered in spine-like cornuti. Additionally, the vesica of + +T. fisheri + +bears an isolated thorn-like cornutus laterally in its subbasal section which is absent in + +T. admiranda + +. In the female genitalia, the inner pocket-like protrusion of the 8 +th +sternite of + +T. fisheri + +is longer and thicker compared to + +T. admiranda + +. A similar structure is also found in + +Tumicla versicolor +Kühne, 2007 + +, a species which is fundamentally different from + +T. fisheri + +in its habitus and genitalia structures ( +Figs 22, 23 +, +33 +, +47 +). The new species has a strongly reduced ductus bursae consisting of a very short membranous section only, whereas in + +T. admiranda + +the ductus bursae is well-developed and subdivided into a wide funnel-like sclerotized posterior section (antrum) and an asymmetrical membranous anterior section. The sclerotized area of the posterior section of the corpus bursae of + +T. fisheri + +is wider with an evenly arcuate convex right margin, whereas in + +T. admiranda + +, it is narrower with a nearly straight right margin. The scobinated medial belt-like area of the corpus bursae is longer in + +T. fisheri + +compared to + +T. admiranda + +. + + + + +Distribution +. The species is only known from the vicinity of Ikelenge in northwestern +Zambia +. + + + + +Etymology +. This species is named after Mr Peter Fisher of Hillwood Farm, Ikelenge, the +type +locality of the new species, who together with his family have carefully managed and conserved the forests and grasslands of this incredibly biodiverse region of Africa. + + + + \ No newline at end of file diff --git a/data/03/A1/87/03A187C0FFEF634A96D5FC65FE7BAD63.xml b/data/03/A1/87/03A187C0FFEF634A96D5FC65FE7BAD63.xml new file mode 100644 index 00000000000..67650f88407 --- /dev/null +++ b/data/03/A1/87/03A187C0FFEF634A96D5FC65FE7BAD63.xml @@ -0,0 +1,246 @@ + + + +Six new species of the genus Tumicla Wallengren, 1863 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia & E-mail: monstruncusarctia @ gmail. com + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & E-mail: gyulalaszlo @ anhrt. org. uk * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +36 +50 + + + + +http://dx.doi.org/10.37828/em.2020.38.6 + +journal article +10.37828/em.2020.38.6 +2336-9744 +13232544 +urn:lsid:zoobank.org:pub:7367D564-EB75-445C-A8A0-2E83C3A52FB3 + + + + + + +Tumicla smithi +Volynkin & László, 2019 + + + + + + +( +Figs 16, 17 +, +30 +, +44 +) + + + + + +Tumicla smithi + +Volynkin & László, 2019 + + +, +Zootaxa +, +4668 +(3): 433, figs 23, 24, 44 ( +Type +locality: +Zambia +, +Changwena Falls +, +13°22’48’’S +, +29°33’18’’E +). + + + + +Type material examined +. + + +Holotype + +( +Figs 17 +, +44 +): female, “ +Zambia +, + +1456m + +, +Changwena Falls +, +N. Swaka +F. +R +., +Central Prov. +, +13°22'48''S +, +29°33'18''E +, + +27–30.I.2019 + +, +MV +Light Trap, Dérozier, +V +., Mulvaney, L., Takano, +H. Leg. +ANHRT +:2019.4”, unique number: ANHRTUK 00073348, slide No.: AV5243 ( +ANHRT +). + + + + + +Paratypes + +: +3 females +, with the same data as the holotype, unique numbers: ANHRTUK 00072417, 00072418, 00072419 ( +ANHRT +) + +. + + +Additional material examined +. + +1 male +, +Zambia +, + +1460m + +, +Mutinondo Wilderness +Area +, +Mpika +, +Northern Prov. +, +12°27'06''S +, +31°17'30''E +, + +14–17.II.2019 + +, +MV + + +Light Trap +, +Dérozier +, +V +., +Mulvaney, L. +, +Takano, H. +leg., +ANHRT + +:2019.4, unique number: ANHRTUK 00105168, gen. slide No.: AV5771 ( +ANHRT +). + + + + +Diagnosis of male +. The forewing length is +11 mm +. The male of + +T. smithi + +( +Fig. 16 +) is smaller (forewing length of females is 14.5– +15 mm +) and has a similar forewing pattern to that of the female ( +Fig. 17 +) but with a darker ground color. The hindwing of the male specimen is almost entirely black with only a narrow area of orange at the base and along the anal margin, whereas in the females the hindwing is pale orange with a black terminal area. The male of + +T. smithi + +differs from those of other similar species by its black hindwing and the presence of the large semilunar discal marking on the forewing. The male genitalia of + +T. smithi + +( +Fig. 30 +) are most similar to those of + +T. mutinondo + +( +Fig. 29 +) and the differences are discussed above under the latter species. + + + + +Distribution +. To date, the species is only known from two localities in the Central and +Muchinga +Provinces of +Zambia +. + + + + \ No newline at end of file diff --git a/data/03/A1/87/03A187C0FFEF634E96D5F8F2FE14A8C4.xml b/data/03/A1/87/03A187C0FFEF634E96D5F8F2FE14A8C4.xml new file mode 100644 index 00000000000..28e5b48ba9d --- /dev/null +++ b/data/03/A1/87/03A187C0FFEF634E96D5F8F2FE14A8C4.xml @@ -0,0 +1,209 @@ + + + +Six new species of the genus Tumicla Wallengren, 1863 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia & E-mail: monstruncusarctia @ gmail. com + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom & E-mail: gyulalaszlo @ anhrt. org. uk * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +36 +50 + + + + +http://dx.doi.org/10.37828/em.2020.38.6 + +journal article +10.37828/em.2020.38.6 +2336-9744 +13232544 +urn:lsid:zoobank.org:pub:7367D564-EB75-445C-A8A0-2E83C3A52FB3 + + + + + + + +Tumicla turlini + +sp. n. + + + + + + +( +Figs 18, 19 +, +41 +) + + + + +Type material. + + +Holotype + +( +Figs 18 +, +41 +): female, “ +Rwanda +, Butaré, 3-VI-[19]74, +B. Turlin +”, gen. slide No.: +ZSM +Arct. 2019-215 (prepared by Volynkin) ( +ZSM +). + + + + +Figures 31–33. + +Tumicla +spp. + +, male genitalia. Depositories of the specimens: 31 in NHMUK (©); 32 and 33 in ANHRT. + + + + +Figures 34–38. + +Tumicla +spp. + +, female genitalia. Depositories of the specimens: 34 and 35 in HNHM; 36 in NHMUK (©); 37 and 38 in ANHRT. + + + + +Figures 39–44. + +Tumicla +spp. + +, female genitalia. Depositories of the specimens: 39 and 40 in NHMUK (©); 41 in ZSM; 42–44 in ANHRT. + + + + + +Paratype + +: + +RWANDA + +: female, +Gashora Bugesera +, savane arbustive [shrubby savanna], 24.xi.[19]74, + +1400m + +, gen. slide No.: +ZSM + +Arct. 2019-533 (prepared by Volynkin) ( +ZSM +). + + + + +Diagnosis +. The forewing length is 13.5–14.5 mm in the females. The female of + +T. turlini + +( +Figs 18, 19 +) is externally most similar to + +T. smithi + +( +Fig. 17 +) but differs in the absence of the discal spot and the black longitudinal basal dash. The female genitalia of the new species ( +Fig. 41 +) are reminiscent of those of + +T. smithi + +( +Fig. 44 +) and + +T. mutinondo + +( +Figs 42, 43 +), but can easily be distinguished by their considerably shorter ductus bursae, the conspicuously wider posterior section and smaller anterior section of the corpus bursae as well as the much shorter appendix bursae. Additionally, compared to + +T. smithi + +, the posterior section of the corpus bursae of + +T. turlini + +is more widely protruding in its left margin and evenly sclerotized while in + +T. mutinondo + +the left margin is membranous. + +The male is unknown. + + + +Distribution +. The new species is known only from +Rwanda +, the +type +specimens having been collected in a savannah habitat. + + + + +Etymology +. The species is named after the renowned French lepidopterist and collector of its +type +specimens, Dr Bernard Turlin. + + + + \ No newline at end of file diff --git a/data/03/AA/87/03AA87AFFF80FFB95CE6F8A5FE04FE73.xml b/data/03/AA/87/03AA87AFFF80FFB95CE6F8A5FE04FE73.xml new file mode 100644 index 00000000000..4557592f30c --- /dev/null +++ b/data/03/AA/87/03AA87AFFF80FFB95CE6F8A5FE04FE73.xml @@ -0,0 +1,981 @@ + + + +Description of the female of Parvuspina tawaghatensis N. Singh, Kirti & Datta, 2019 with new data of its distribution (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-12 + + +38 + + +135 +140 + + + + +http://dx.doi.org/10.37828/em.2020.38.18 + +journal article +10.37828/em.2020.38.18 +2336-9744 +13232089 + + + + + + +Parvuspina tawaghatensis +N. +Singh, Kirti & Datta, 2019 + + + + + + +( +Figs 1–4 +, +7, 8 +, +10 +) + + + + + +Parvuspina tawaghatensis + +N. +Singh, Kirti & Datta, 2019 + + +, +Zootaxa +, +4686 +(1): 146, figs 1–2, 7–9 ( +Type +locality: “ +India +, +Uttarakhand +, +Tawaghat +”). + + + + +Figures 1–6. +Lithosiini spp.: adults. Depositories of the specimens: 1–4 in MWM/ZSM; 5 and 6 in NHMUK (©). + + + + +Material examined +. + + +INDIA + +. +UTTARAKHAND +: +1 female +, +Kumaon +, +Himalaya +, +Nainital Distr. +, +Bhimtal +, + +1500 m + +, leg. +Smetacek +, + +26.IX.1977 + + +; + +1 male +, the same locality but + +03.VII.1971 + +, leg. +de Freina +, +Himalaya Expedition + +; + +1 male +, U.P., +Bhimtal +, + +1500 m + +, + +11–20. +VI + + +.1975, leg. W. Thomas; + +1 male +, +Himalaya, U.P. +, +District Uttarkashi +, +Gangani +, + +14–19. +VI + + +.1981, +1300 m +, leg. C. Holzschuh; + +SIKKIM +: +1 male +, SE +Kanchenjunga Mt. +, + +2000m + +, + +22–31.VII.1995 + +, +27°30’N +88°20’E +, leg. +E. Afonin +& +V + +. + +Sinyaev +, gen. slide +No. +: +ZSM + + +Arct. +2019-695 (prepared by +Volynkin +) (MWM/ +ZSM +) + +; + + +NEPAL + +: +6 males +, +Annapurna Himal +, +Geirigan village +, + +1340 m + +, +83°45'E +, +28°20'N +, + +26.VII.1995 + +, leg. +Gy. M. László +& +G. Ronkay +, gen. slide +No. +: +ZSM + + +Arct. +2020-058 (prepared by +Volynkin +); +2 males +, the same locality and collectors but + +31. +V + + + +.1996; +27 males +, +3 females +, +Annapurna Himal +, valley of +Kali + + +Gandaki +, + +1300 m + +, near +Tatopani +, +83°39'E +, +28°29'N +, + +03. +VI + + +.1996, leg. Gy. M. László & G. Ronkay; + +4 males +, +1 female +, the same locality and collectors but + +20. +VI + + +.1996; + +5 males +, +7 females +, the same locality and collectors but + +1100 m + +, + +22.VII.1995 + + +; + +1 male +, +Annapurna Himal +, + +8 km +SW of Tatopani + +, + +1200 m + +, + +31.VIII.1996 + + +, + +83°37'E +, +28°27'N +, leg. +Chenga Sherpa +; +4 males +, +Annapurna Himal valley +of +Kali + + +Gandaki +, + +2080 m + +, near +Ghasa +, +83°39,5'E +, +28°36'N +, + +04. +VI + + +.1996, leg. Gy. M. László & G. Ronkay; + +4 males +, +1 female +, the same locality and collectors but + +18–19. +VI + + +.1996; + +3 males +, the same locality and collectors but + +2000 m + +, + +21.VII.1995 + + +; + +15 males +, +5 females +, +Annapurna Himal +, +Ulleri +, + +1900 m + + +, + +83°43'E +, +28°23'N +, + +3.X.1994 + +, leg. +Csorba +& +Ronkay +; +3 females +, +Annapurna Himal +, +Bhaleodar +, + +2400 m + +, + +2 km +SE Nangethanti + + +, + +83°44'E +, +28°23'N +, + +8.X.1994 + +, leg. +Csorba +& +Ronkay +; +1 female +, +Annapurna Himal +, +Nangethanti +, + +2500 m + + +, +83°43'E +, +28°23'N +, +4.X.1994 +, leg. Csorba & Ronkay; + +6 males +, +Annapurna Himal +, + +1950 m + +, +Talbagar +, 83'39''E, 28'34''N, + +24. +VI + + +.1996, leg. Hreblay & Szaboky; + +1 male +, +Annapurna Himal +, + +1700 m + +, + +1 km +N of Tal + +, 84'23''E, 28'28''N, + +08. +VI + + +.1996, leg. Hreblay & Szaboky; + +1 male +, +1 female +, + +1250 m + +, +Annapurna-Region +, +Sudame +, 24–25.III.95, 83'45'E, 28'20'N, leg. +M. Hreblay +& +L. Nemeth + +; + +4 males +, +East Nepal +, +Deorali Danda +, +Anpan +, + +11. +V + + +.1997, +1900 m +, leg. Hreblay & Szecsenyi; + +1 male +, +East Nepal +, +Deorali Danda +, + +1 km +N Yamphudin + +, + +12. +V + + +. +1997, 1850 m +, leg. Hreblay & Szecsenyi; + +2 males +, +Syangja district +, +Kahule village +, + +1600 m + +, + +26.VII.1995 + +, +No. +113, leg. +G. Csorba + +; + +27 males +, +1 female +, +Ganesh Himal +, +Syabrubesi +, + +1520 m + +, + +12. +VI + + +.1993, leg. M. Hreblay, G. Csorba; + +66 males +, +5 females +, +Ganesh Himal +, + +3 km +NE of Sunpati + +, + +2330 m + +, + +13. +VI + + + +.1993, leg. +M. Hreblay +, +G. Csorba +, gen. slides +Nos. +: +ZSM + + +Arct. +2019-729 (male) and 2019-730 (female) (prepared by +Volynkin +) + +; + +1 female +, +Ganesh Himal +, + +2 km +N of Dhunche + +, + +2050 m + +, + +15.IX.1995 + +, leg. +Lajos Németh + +; + +2 males +, +Ganesh Himal +, + +2200 m + +, + +4 km +SW Haku + + +, +85°15.5'E +, +28°06.5'N +, +22.IX.1995 +, leg. B. Herczig & Gy. M. László; +1 male +, Ganesh Himal, +1040 m +, Mallung Khola, 85'12.5'E, + +28°04.5’N +, + +24.X.1995 + +, leg. +L. Peregovits +& +L. Ronkay +; +1 male +, +Ganesh Himal +, + +2420 m + +, + +2 km +W Gholjong + + +, + +85°18'E +, +28°11'N +, + +12.IX.1995 + +, leg. +B. Herczig +& +Gy. M. László +; +8 males +, +Ganesh Himal +, + +2 km +E of Thangjet + + +, +85°19'E +, +28°10'N +, +2165 m +, +17.IX.1994 +, leg. Márton Hreblay & Tibor Csővári; + +3 males +, +4 females +, +Solu Khumbu Himal +, + +20 km +SE of Jiri + +, +Bhandar +, + +2125 m + +, + +6.VII.1993 + +, leg. +M. Hreblay +, +G. Csorba + +; +1 male +, + +Koshi +, +Taplejung area +, above +Yamphudin +, + +2600 m + +, +87°59'E +, +27°28'N +, + +5.IV.1996 + +, leg. +G. Csorba +& S. +T + +. + +Kovács +; +1 male +, +1 female +, + +1615 m + +, +Taplejung area +, +Shimbu +( +Pakora +), + +11.X.1994 + +, leg. +M. Hreblay +& +T + +. + +Csovari +; +6 males +, +2 females +, valley of +Tamea + + +Kosi +River +, + +5 km +S of Piguti + +, + +950 m + +, + +8–11.X.1995 + +, leg. +L. Németh + +; + +3 males +, +1 female +, +Langtang +, + +5 km +NNE of Dunche + +, +Barkhu + +, +85°18'E +, +28°08'N +, +1835 m +, +16.IX.1994 +, leg. Márton Hreblay & Tibor Csővári; + +1 female +, +Trisuli valley +, + +820 m + +, + +3 km +N Betrawati + + +, +85°11'E +, +27°59'N +, +25.X.1995 +, leg. L. Peregovits & L. Ronkay; + +2 males +, +East Nepal +, +Milke Danda +, +Nesum +, + +1500 m + +, + +21.VIII.2000 + +, leg. +Csővári +& +Hreblay + +; + +1 male +, +East Nepal +, +Surke Danda +, + +2000 m + +, + +1 km +W of Kesawa + +, + +17. +V + + +.1997, leg. Hreblay & Szecsenyi; + +1 female +, +Barambise +, +Piste de Dolan +, + +27. +VI + + + +.1976, +Alt. + +2500 m + +env., collection +Jaques Plante +(MWM/ +ZSM +) + +. + + + + +Figures 7–9. +Lithosiini spp.: male genitalia. Depositories of the specimens: 7 and 8 in MWM/ZSM; 9 in NHMUK (©). + + + + +Figures 10–12. +Lithosiini spp.: female genitalia. Depositories of the specimens: 10 in MWM/ZSM; 11 in SZMN; 12 in NHRS (photo by T. Malm, ©2017NHRS). + + + + +Distribution +. The species is distributed in the Himalayas, inhabiting the medium-elevation monsoon forest belt. It is known from North and North East +India +( +Uttarakhand +, +Himachal Pradesh +( + +Singh +et al. +2019 + +) and +Sikkim +) and +Nepal +. + + + + \ No newline at end of file diff --git a/data/03/AA/87/03AA87AFFF80FFBD5CE6FE68FD02F935.xml b/data/03/AA/87/03AA87AFFF80FFBD5CE6FE68FD02F935.xml new file mode 100644 index 00000000000..2c01f37cfd6 --- /dev/null +++ b/data/03/AA/87/03AA87AFFF80FFBD5CE6FE68FD02F935.xml @@ -0,0 +1,179 @@ + + + +Description of the female of Parvuspina tawaghatensis N. Singh, Kirti & Datta, 2019 with new data of its distribution (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-12 + + +38 + + +135 +140 + + + + +http://dx.doi.org/10.37828/em.2020.38.18 + +journal article +10.37828/em.2020.38.18 +2336-9744 +13232089 + + + + + + +Parvuspina +N. +Singh, Kirti & Datta, 2019 + + + + + + + +Parvuspina +N. +Singh, Kirti & Datta, 2019 + +, +Zootaxa +, +4686 +(1): 145. + + + + +Type +species: + +Parvuspina tawaghatensis +N. +Singh, Kirti & Datta, 2019 + +, by the original designation. + + + + +Diagnosis +. The forewing length is +10–13 mm +in males, 12.5–13.5 mm in females. The hitherto only known species of the genus ( +Figs 1–4 +) is similar externally to certain species of the genus + +Miltochrista + +according to their reduced forewing pattern represented by discal and subbasal markings only (e.g. + +M. calamaria + +) and the unmarked forms of the females of the + +M. dasara + +species-group (illustrated by +Volynkin & Bucsek 2016 +). The sexual dimorphism is limited: the females ( +Fig. 4 +) have weaker ciliation of the antennae and somewhat narrower forewing than the males ( +Figs 1–3 +). The male genital capsule of + +Parvuspina + +( +Figs 7, 8 +) is very characteristic and similar only to that of the genus + +Tumicla + +( +Figs 5, 6 +, +9 +, +12 +) due to its simple and apically pointed valva lacking processes (a synapomorphic feature of the two genera), but can easily be distinguished by its modified uncus bearing two short triangular processes subbasally (an autapomorphic feature) and the wide and rounded transtillae connected by a thin membrane (an autapomorphic feature, the transtillae are band-like and fused in + +Tumicla + +). The vesica structure of + +Parvuspina + +is reminiscent of that of many groups of the genus + +Miltochrista + +, but the long and narrow cornutus with a wide, rounded, plate-like base is diagnostic. The female genitalia of the genus ( +Fig. 10 +) are characterized by the presence of two protrusions of the corpus bursae: the postero-lateral one is membranous and broadly conical with a rounded tip, and the postero-ventral one is heavily sclerotized, flattened, crest-like (a unique feature in the + +Afrasura + +/ + +Miltochrista + +generic complex). Additionally, the ostium bursae of + +Parvuspina + +opens in a conspicuously deep depression of the 7 +th +sternite, which is also unique in the generic complex. Similar 7 +th +sternite-ostium bursae complex is also known in the + +Miltochrista obliquilinea + +species-group ( +Fig. 11 +, all species are illustrated in + +Volynkin +et al. +(2020)) + +, but the depression of the 7th sternite is considerably shallower. + + + + +Description of the female +. +External morphology +( +Fig. 4 +). Antenna weakly ciliate. Head pale yellow. Thorax pale yellow with two black dots postero-laterally and two dots medially. Abdomen pale yellow with intense admixture of ochreous scales. Forewing ground color pale yellow. Subbasal marking represented by a small, black dot. Costa black in the basal quarter. Discal spot black, small but conspicuous, rounded. Cilia pale yellow. Hindwing somewhat paler than forewing, without marking. +Female genitalia +( +Fig. 10 +). Papillae anales wide, trapezoid with rounded corners, weakly setose. Apophyses long and thin, apophyses anteriores somewhat longer and thicker than apophyses posteriores. Ostium bursae situated in a deep postero-medial depression of 7th sternite. Postvaginal plate narrow, rectangular with rounded corners, moderately sclerotized. Ductus bursae short, tubular, membranous. Posterior section of corpus bursae wider than anterior one, with a rectangular sclerotized plate ventrally and two protrusions on the left side: a membranous, broadly conical, apically rounded postero-lateral one and a heavily sclerotized, flattened, crest-like postero-ventral one. Right side of posterior section of corpus bursae swollen, membranous. Medial section of corpus bursae bearing a belt-like, curved cluster of robust spines. Anterior section globular, densely covered in tiny spinules. Appendix bursae very short, conical, membranous, projecting postero-laterally from the right side of corpus bursae. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605244FF68F872FAA1FF6E.xml b/data/03/B7/F8/03B7F81454605244FF68F872FAA1FF6E.xml new file mode 100644 index 00000000000..54fe9ff3c6b --- /dev/null +++ b/data/03/B7/F8/03B7F81454605244FF68F872FAA1FF6E.xml @@ -0,0 +1,118 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Stictopleurus crassicornis +(Linnaeus, 1758) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°16′44′′ N +, +87°57′12′′ E +, H = + +1750–1800 m + +, 4– + +7.08.2019 + +, +1 ♀ + +; + +15 km +NNE +Kosh-Agach Settlm +, H = + +2600–2800 m + +, +50°17′ N +, +88°02′ E +, 2– + +7.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Trans-Euroasian. Recorded from +Altai Republic +( +Kiritshenko 1916 +; +Kovrigin 1965 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68F91BFB59F8C5.xml b/data/03/B7/F8/03B7F81454605247FF68F91BFB59F8C5.xml new file mode 100644 index 00000000000..6777b2a6f07 --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68F91BFB59F8C5.xml @@ -0,0 +1,98 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Liorhyssus hyalinus +(Fabricius, 1794) + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +2.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Cosmopolitan. Recorded from +Altai Republic +( +Kanyukova & Vinokurov 2009 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68F9C1FAA2F939.xml b/data/03/B7/F8/03B7F81454605247FF68F9C1FAA2F939.xml new file mode 100644 index 00000000000..88d884dad39 --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68F9C1FAA2F939.xml @@ -0,0 +1,85 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Coreus marginatus marginatus +(Linnaeus, 1758) + + + + + + + +Material. +Kurai Mts, Kuraika River, +50°16′44′′ N +, +87°57′12′′ E +, H = +1750–1800 m +, 4– +7.08.2019 +, +1 ♂ +. +Distribution. +Transpalaearctic. Recorded from +Altai Republic +( +Kiritshenko 1916 +; +Kovrigin 1965 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FAF3FC4BFA0F.xml b/data/03/B7/F8/03B7F81454605247FF68FAF3FC4BFA0F.xml new file mode 100644 index 00000000000..b406e30d3d3 --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FAF3FC4BFA0F.xml @@ -0,0 +1,101 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Xanthochilus quadratus +(Fabricius, 1798) + + + + + + + +Fig. 3 + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +2.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +West-Central Palaearctic. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FB7AFBE9FB44.xml b/data/03/B7/F8/03B7F81454605247FF68FB7AFBE9FB44.xml new file mode 100644 index 00000000000..3304ee5b23b --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FB7AFBE9FB44.xml @@ -0,0 +1,85 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Rhyparochromus pini +(Linnaeus, 1758) + + + + + + + +Material. +Kurai steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +2 ♀ +. + + + + +Distribution. +Transpalaearctic. Recorded from +Altai Republic +(Vinokurov 2007). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FC21FB52FBDD.xml b/data/03/B7/F8/03B7F81454605247FF68FC21FB52FBDD.xml new file mode 100644 index 00000000000..7bfd83f1a9b --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FC21FB52FBDD.xml @@ -0,0 +1,124 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Ligyrocoris sylvestris +(Linnaeus, 1758) + + + + + + + +Material. + +Kurai +steppe, +50°15′ N +, +87°54′ E +, H = + +1600–1650 m + +, + +8.08.2019 + +, +1 ♀ + +; + +Kurai Mts +, +Kuraika River +: +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +2 ♂ + +; +50°16′44′′ N +, +87°57′12′′ E +, H = +1750– 1800 m +, 4– +7.08.2019 +, +1 ♀ +. + + + + +Distribution. +Holarctic. Recorded from +Altai Republic +( +Kiritshenko 1910b +; Vinokurov 2007). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FCA8FBE9FC13.xml b/data/03/B7/F8/03B7F81454605247FF68FCA8FBE9FC13.xml new file mode 100644 index 00000000000..70ced81582a --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FCA8FBE9FC13.xml @@ -0,0 +1,91 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Trapezonotus arenarius arenarius +(Linnaeus, 1758) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +1 ♀ +. +Distribution. +Transpalaearctic. Recorded from +Altai Republic +(Vinokurov 2007) + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FD53FC2DFCAC.xml b/data/03/B7/F8/03B7F81454605247FF68FD53FC2DFCAC.xml new file mode 100644 index 00000000000..4047a868c73 --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FD53FC2DFCAC.xml @@ -0,0 +1,85 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Cymus glandicolor +Hahn, 1832 + + + + + + + +Material. +Kurai steppe, +50°13′46′′ N +, +87°55′27′′ E +, H = +1486 m +, +28.08.2019 +, +2 ♀ +. + + + + +Distribution. +Trans-Euroasian. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FDDAFC2DFD25.xml b/data/03/B7/F8/03B7F81454605247FF68FDDAFC2DFD25.xml new file mode 100644 index 00000000000..cc4ee49dcec --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FDDAFC2DFD25.xml @@ -0,0 +1,90 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Kleidocerys resedae resedae +(Panzer, 1797) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +1 ♂ +. +Distribution. +Transpalaearctic. First record from +Altai Republic + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FE5CFC2DFDBE.xml b/data/03/B7/F8/03B7F81454605247FF68FE5CFC2DFDBE.xml new file mode 100644 index 00000000000..ea54fa2f596 --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FE5CFC2DFDBE.xml @@ -0,0 +1,90 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Ortholomus punctipennis +(Herrich-Schaeffer, 1838) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°16′44′′ N +, +87°57′12′′ E +, H = + +1750–1800 m + +, 4– + +7.08.2019 + +, +1 ♂ +. +Distribution. +Trans-Euroasian. First record from +Altai Republic + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454605247FF68FEE5FAFDFE37.xml b/data/03/B7/F8/03B7F81454605247FF68FEE5FAFDFE37.xml new file mode 100644 index 00000000000..1bde8e3acd8 --- /dev/null +++ b/data/03/B7/F8/03B7F81454605247FF68FEE5FAFDFE37.xml @@ -0,0 +1,106 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Nithecus jacobaeae +(Schilling, 1829) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +: +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +1 ♀ + +; +50°16′44′′ N +, +87°57′12′′ E +, H = +1750–1800 m +, 4– +7.08.2019 +, +1 ♀ +. + + + + +Distribution. +Transpalaearctic. Recorded from +Altai Republic +( +Kiritshenko 1910b +; Vinokurov 2007). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68F890FC49F86A.xml b/data/03/B7/F8/03B7F81454615246FF68F890FC49F86A.xml new file mode 100644 index 00000000000..3d41215c8a0 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68F890FC49F86A.xml @@ -0,0 +1,85 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Neides propinquus +Horváth, 1901 + + + + + + + +Material. +Kurai steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +1 ♀ +. + + + + +Distribution. +Dauro-Mongolian steppe. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68F97CFC62F8A0.xml b/data/03/B7/F8/03B7F81454615246FF68F97CFC62F8A0.xml new file mode 100644 index 00000000000..4efdc0513e2 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68F97CFC62F8A0.xml @@ -0,0 +1,98 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Galeatus affinis +(Herrrich-Schaeffer, 1835) + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Holarctic. Recorded from +Altai Republic +( +Petrova 1978 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FA48FC82F994.xml b/data/03/B7/F8/03B7F81454615246FF68FA48FC82F994.xml new file mode 100644 index 00000000000..a446f5688e5 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FA48FC82F994.xml @@ -0,0 +1,96 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Psallus betuleti +(Fallén, 1807) + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Holarctic. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FAF3FB79FACB.xml b/data/03/B7/F8/03B7F81454615246FF68FAF3FB79FACB.xml new file mode 100644 index 00000000000..eb83074a0f8 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FAF3FB79FACB.xml @@ -0,0 +1,93 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Plagiognathus chrysanthemi +(Wolff, 1804) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°19′21′′ N +, +87°58′28′′ E +, H = + +2150–2200 m + +, 2– + +4.08.2019 + +, +1 ♂ +. +Distribution. +Transpalaearctic. Recorded from +Altai Republic +( +Vinokurov & Golub 2009 +) + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FB7AFA95FB44.xml b/data/03/B7/F8/03B7F81454615246FF68FB7AFA95FB44.xml new file mode 100644 index 00000000000..b6060cbe066 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FB7AFA95FB44.xml @@ -0,0 +1,87 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Excentricoris pictipes +(Reuter, 1878) + + + + + + + +Material. +Kurai steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +1 ♀ +. + + + + +Distribution. +Dauro-Mongolian steppe. Recorded from +Altai Republic +( +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FC21FCE8FBDD.xml b/data/03/B7/F8/03B7F81454615246FF68FC21FCE8FBDD.xml new file mode 100644 index 00000000000..12d2504c210 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FC21FCE8FBDD.xml @@ -0,0 +1,102 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Hyoidea kerzhneri +Hoberlandt, 1963 + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Steppe and semidesert zones of Palaearctic. Recorded from +Altai Republic +( +Hoberlandt 1963 +; +Vinokurov & Golub 2007 +; +Knyshov & Konstantinov 2013 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FCA8FAD1FC13.xml b/data/03/B7/F8/03B7F81454615246FF68FCA8FAD1FC13.xml new file mode 100644 index 00000000000..a7e07ef943d --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FCA8FAD1FC13.xml @@ -0,0 +1,85 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Globiceps fulvicollis +Jakovlev, 1877 + + + + + + + +Material. +Kurai Steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +1 ♂ +. + + + + +Distribution. +From Europe to mountains of Middle Asia and +Mongolia +. First record from Altai Republic. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FD70FBCEFCAC.xml b/data/03/B7/F8/03B7F81454615246FF68FD70FBCEFCAC.xml new file mode 100644 index 00000000000..8a79f52a795 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FD70FBCEFCAC.xml @@ -0,0 +1,98 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Labops burmeisteri +Reuter, 1904 + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Holarctic. Recorded from +Altai Republic +( +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FDFBFA2CFDC3.xml b/data/03/B7/F8/03B7F81454615246FF68FDFBFA2CFDC3.xml new file mode 100644 index 00000000000..0f187fec86a --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FDFBFA2CFDC3.xml @@ -0,0 +1,91 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Euryopicoris nitidus +(Meyer-Dur, 1843) + + + + + + + +Material. +Kurai Steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +1 ♂ +, +1 ♀ +. + + + + +Distribution. +Euro-Siberian. Recorded from +Altai Republic +( +Kiritshenko 1910b +; +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FE62FB13FE5C.xml b/data/03/B7/F8/03B7F81454615246FF68FE62FB13FE5C.xml new file mode 100644 index 00000000000..b4d46cda683 --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FE62FB13FE5C.xml @@ -0,0 +1,95 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Salignus distinguendus +(Reuter, 1875) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +1 ♂ +. +Distribution. +Siberia, +Mongolia +, +China +. Recorded from Altai Republic ( +Kerzhner 1979 +) + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454615246FF68FF29FBA2FED5.xml b/data/03/B7/F8/03B7F81454615246FF68FF29FBA2FED5.xml new file mode 100644 index 00000000000..2b02aa8516d --- /dev/null +++ b/data/03/B7/F8/03B7F81454615246FF68FF29FBA2FED5.xml @@ -0,0 +1,130 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Polymerus unifasciatus +(Fabricius, 1794) + + + + + + + +Material. + +Kurai Mts +: +Kuraika River +: +50°16′44′′ N +, +87°57′12′′ E +, H = + +1750–1800 m + +, 4– + +7.08.2019 + +, +1 ♂ +, +2 ♀ + +; +50°19′19′′ N +, +87°58′23′′ E +, H = +2150–2200 m +, 26– +27.07.2019 +, +1 ♀ +; + +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +2 ♂ +, +2 ♀ + +. + + + + +Distribution. +Holarctic. Recorded from +Altai Republic +( +Kiritshenko 1910b +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454625245FF68F93AFAC0F8C8.xml b/data/03/B7/F8/03B7F81454625245FF68F93AFAC0F8C8.xml new file mode 100644 index 00000000000..b63622b0900 --- /dev/null +++ b/data/03/B7/F8/03B7F81454625245FF68F93AFAC0F8C8.xml @@ -0,0 +1,102 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Sciocoris abbreviatus +(Reuter, 1879) + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +2.08.2019 + +, +1 ♂ + +. + + + + +Distribution. +Kazakhstan-Mongolian steppe. This species recorded from +Altai +( +Kulik 1965 +). However, V.P. +Petrova (1975) +not included for the list of shield bugs of Western Siberia. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454625245FF68FF29FD63FEF4.xml b/data/03/B7/F8/03B7F81454625245FF68FF29FD63FEF4.xml new file mode 100644 index 00000000000..42fd13ee3e9 --- /dev/null +++ b/data/03/B7/F8/03B7F81454625245FF68FF29FD63FEF4.xml @@ -0,0 +1,91 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Carpocoris purpureipennis +(De Geer, 1773) + + + + + + + +Material. +Kurai Mts, Kuraika River, +50°16′44′′ N +, +87°57′12′′ E +, H = +1750–1800 m +, 4– +7.08.2019 +, +1 ♂ +. +Distribution. +Transpalaearctic. Recorded from +Altai Republic +( +Kiritshenko 1910b +; +Kovrigin 1958 +, +1965 +; +Petrova 1966 +; +Kerzhner 1976 +; Derzhankiy 1990). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F8145462524AFF68F84FFB6FFF6E.xml b/data/03/B7/F8/03B7F8145462524AFF68F84FFB6FFF6E.xml new file mode 100644 index 00000000000..4a652d8aaca --- /dev/null +++ b/data/03/B7/F8/03B7F8145462524AFF68F84FFB6FFF6E.xml @@ -0,0 +1,100 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Sciocoris distinctus +Fieber, 1851 + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +2.08.2019 + +, +1 ♂ + +. + + + + +Distribution. +West-Central Palearctic. Recorded from +Altai Republic +( +Petrova 1966 +, +1975 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454635244FF68F84AFBC4F7B5.xml b/data/03/B7/F8/03B7F81454635244FF68F84AFBC4F7B5.xml new file mode 100644 index 00000000000..398943ba65c --- /dev/null +++ b/data/03/B7/F8/03B7F81454635244FF68F84AFBC4F7B5.xml @@ -0,0 +1,91 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Antheminia varicornis +(Jakovlev, 1874) + + + + + + + +Material. +Kurai steppe, +50°13′46′′ N +, +87°55′27′′ E +, H = +1486 m +, +28.08.2019 +, +1 ♂ +, +2 ♀ +. + + + + +Distribution. +Trans-Euroasian. Recorded from +Altai Republic +( +Petrova 1966 +, +1975 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454635244FF68F974FB92F88A.xml b/data/03/B7/F8/03B7F81454635244FF68F974FB92F88A.xml new file mode 100644 index 00000000000..2e8829ae8ed --- /dev/null +++ b/data/03/B7/F8/03B7F81454635244FF68F974FB92F88A.xml @@ -0,0 +1,104 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Irochrotus caucasicus +Jakovlev, 1875 + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +2.08.2019 + +, +12 ♂ +, +6 ♀ + +. + + + + +Distribution. +Caucasus, mountains of South Siberia, Tien-Shan, Mongolian Altai, +China +. Recorded from Altai Republic ( +Kiritshenko & Kerzhner 1972 +; +Petrova 1975 +; +Kerzhner 1976 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454635244FF68FA22FBDDF99C.xml b/data/03/B7/F8/03B7F81454635244FF68FA22FBDDF99C.xml new file mode 100644 index 00000000000..6ee4473d4d3 --- /dev/null +++ b/data/03/B7/F8/03B7F81454635244FF68FA22FBDDF99C.xml @@ -0,0 +1,94 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Canthophorus impressus +(Horvath, 1880) + + + + + + + +Material. + +North-Chuyskiy Mts +, +50°08′32′′ N +, +87°48′34′′ E +, H = + +1782 m + +, + +23.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Euro-Baikalian. Recorded from +Altai Republic +( +Kiritshenko 1910b +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454635244FF68FE3FFBCFFD80.xml b/data/03/B7/F8/03B7F81454635244FF68FE3FFBCFFD80.xml new file mode 100644 index 00000000000..fdc235175db --- /dev/null +++ b/data/03/B7/F8/03B7F81454635244FF68FE3FFBCFFD80.xml @@ -0,0 +1,89 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Myrmus miriformis miriformis +(Fallen, 1807) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°19′21′′ N +, +87°58′28′′ E +, H = + +2150–2200 m + +, 2–04.8.2019, +1 ♀ +. +Distribution. +Trans-Euroasian. Recorded from +Altai Republic +( +Kiritshenko 1910b +) + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454635244FF68FEE5FC3EFE19.xml b/data/03/B7/F8/03B7F81454635244FF68FEE5FC3EFE19.xml new file mode 100644 index 00000000000..e7351f56688 --- /dev/null +++ b/data/03/B7/F8/03B7F81454635244FF68FEE5FC3EFE19.xml @@ -0,0 +1,122 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Myrmus calcaratus +Reuter, 1891 + + + + + + + +Material. + +Kurai +steppe, +50°15′ N +, +87°54′ E +, H = + +1600–1650 m + +, + +8.08.2019 + +, +2 ♂ +, +2 ♀ + +; + +Kurai Mts +, +Kuraika River +, +50°16′44′′ N +, +87°57′12′′ E +, H = + +1750–1800 m + +, 4– + +7.08.2019 + +, +2 ♂ + +. + + + + +Distribution. +Euroasian steppe. In Siberia known from +Tyumen Region +, south of +Krasnoyarsk Province +and +Tuva +( +Vinokurov et al. 2010 +). First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68F8B6FE35F84C.xml b/data/03/B7/F8/03B7F81454665241FF68F8B6FE35F84C.xml new file mode 100644 index 00000000000..0dfd6132f1f --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68F8B6FE35F84C.xml @@ -0,0 +1,116 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Lygus wagneri +Remane, 1955 + + + + + + + +Material. + +Kurai Mts +: +Kuraika River +, +50°19′21′′ N +, +87°58′28′′ E +, H = + +2150–2200 m + +, 2– + +4.08.2019 + +, +1 ♀ + +; + +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♂ + +. + + + + +Distribution. +Euro-Siberian. In West Siberia known from Kuznetsk Alatau ( +Zolotarev 2003 +). First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68F982FEC4F882.xml b/data/03/B7/F8/03B7F81454665241FF68F982FEC4F882.xml new file mode 100644 index 00000000000..0e834cf748b --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68F982FEC4F882.xml @@ -0,0 +1,132 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Lygus rugulipennis +Poppius, 1911 + + + + + + + +Material. + +Kurai Mts +: +Kuraika River +, +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +1 ♀ + +; + +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♀ + +; + +Kurai +steppe, +50°15′ N +, +87°54′ E +, H = + +1600–1650 m + +, + +8.08.2019 + +, +3 ♂ + +. + + + + +Distribution. +Holarctic. First record from +Altai Republic +of one of the most common species in the Palaearctic Region. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FA6EFD64F9F6.xml b/data/03/B7/F8/03B7F81454665241FF68FA6EFD64F9F6.xml new file mode 100644 index 00000000000..7bcbf6b2673 --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FA6EFD64F9F6.xml @@ -0,0 +1,110 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Lygidea illota +(Stål, 1858) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +: +50°19′19′′ N +, +87°58′23′′ E +, H = + +2150–2200 m + +, 26– + +27.07.2019 + +, +1 ♀ + +; +50°20′37′′ N +, +87°56′51′′ E +, H = +2500–2800 m +, 27– +29.07.2019 +, +1 ♀ +. + + + + +Distribution. +Siberia, south of the Far East of +Russia +, +Mongolia +, +China +. This species living on willow (Salix) in South Siberia known from north (upper sources of the Taz River) and Kuznetsk Alatau ( +Vinokurov & Golub 2007 +). First record from Altai Republic. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FB37FE66FAEA.xml b/data/03/B7/F8/03B7F81454665241FF68FB37FE66FAEA.xml new file mode 100644 index 00000000000..807a0f8ae81 --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FB37FE66FAEA.xml @@ -0,0 +1,107 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Closterotomus samojedorum +(J. Sahlberg, 1878) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +, +50°19′21′′ N +, +87°58′28′′ E +, H = + +2150–2200 m + +, 2– + +4.08.2019 + +, +1 ♂ +, +1 ♀ +. + +Distribution. +North of European + +part of +Russia +and +Siberia +, +West Sayan +and +Altai +Mts. Recorded +from +Altai Republic +( +Muminov 1987 +) + +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FBDFFCFAFB01.xml b/data/03/B7/F8/03B7F81454665241FF68FBDFFCFAFB01.xml new file mode 100644 index 00000000000..fb5b553318f --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FBDFFCFAFB01.xml @@ -0,0 +1,96 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Closterotomus fulvomaculatus +(De Geer, 1773) + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +02.08.2019 + +, +1 ♂ + +. + + + + +Distribution. +Holarctic. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FC64FE5DFBB8.xml b/data/03/B7/F8/03B7F81454665241FF68FC64FE5DFBB8.xml new file mode 100644 index 00000000000..439c73a1069 --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FC64FE5DFBB8.xml @@ -0,0 +1,89 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Apolygus nigronasutus +(Stål, 1858) + + + + + + + +Material. +Kurai Steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +2 ♂ +. + + + + +Distribution. +Siberia, South of the Far East of +Russia +, +Mongolia China +. Recorded from Altai Republic ( +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FD0DFDECFCEF.xml b/data/03/B7/F8/03B7F81454665241FF68FD0DFDECFCEF.xml new file mode 100644 index 00000000000..876ba357f2c --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FD0DFDECFCEF.xml @@ -0,0 +1,91 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Allorhinocoris flavus +J. Sahlberg, 1878 + + + + + + + +Material. +Kurai Steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +2 ♂ +. + + + + +Distribution. +Siberia, South of the Far East of +Russia +, +Kazakhstan +, South-West +China +. Recorded from Altai Republic ( +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FDFBFA8BFD07.xml b/data/03/B7/F8/03B7F81454665241FF68FDFBFA8BFD07.xml new file mode 100644 index 00000000000..94adb076810 --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FDFBFA8BFD07.xml @@ -0,0 +1,130 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Adelphocoris lineolatus +(Goeze, 1778) + + + + + + + +Material. + +Kurai Steppe +, +50°15′ N +, +87°54′ E +, H = + +1600–1650 m + +, + +8.08.2019 + +, +1 ♀ + +; + +Kurai Mts +, +Kuraika River +: +50°16′44′′ N +, +87°57′12′′ E +, H = + +1750–1800 m + +, 4– + +7.08.2019 + + +, 24– +26.07.2019 +, +2 ♂ +, +3 ♀ +; +50°19′19′′ N +, +87°58′23′′ E +, H = +2150–2200 m +, 26– +27.07.2019 +, +1 ♂ +. + + + + +Distribution. +Transpalaearctic. Recorded from +Altai Republic +( +Kiritshenko 1910b +; +Kovrigin 1965 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FE62FCC3FE5C.xml b/data/03/B7/F8/03B7F81454665241FF68FE62FCC3FE5C.xml new file mode 100644 index 00000000000..6ab252f5ee2 --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FE62FCC3FE5C.xml @@ -0,0 +1,85 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Deraeocoris ventralis ventralis +Reuter, 1904 + + + + + + + +Material. +Kurai steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +3 ♀ +. + + + + +Distribution. +Euro-Siberian. First record from +Altai Republic +. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454665241FF68FF29FD2AFED5.xml b/data/03/B7/F8/03B7F81454665241FF68FF29FD2AFED5.xml new file mode 100644 index 00000000000..81954e66efd --- /dev/null +++ b/data/03/B7/F8/03B7F81454665241FF68FF29FD2AFED5.xml @@ -0,0 +1,112 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Deraeocoris ater +(Jakovlev, 1889) + + + + + + + +Material. + +Kurai Mts +, +Kuraika River +: +50°16′44′′ N +, +87°57′12′′ E +, H = + +1750–1800 m + +, 4– + +7.08.2019 + +, +1 ♂ + +; +50°19′21′′ N +, +87°58′28′′ E +, H = +2150–2200 m +, 2– +4.08.2019 +, +1 ♀ +. + + + + +Distribution. +South of Siberia and the Far East of +Russia +, North-East +China +, +Korea +, +Japan +. Recorded from Altai Republic ( +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454675240FF68F86FFE8BF7B1.xml b/data/03/B7/F8/03B7F81454675240FF68F86FFE8BF7B1.xml new file mode 100644 index 00000000000..aa850071ac9 --- /dev/null +++ b/data/03/B7/F8/03B7F81454675240FF68F86FFE8BF7B1.xml @@ -0,0 +1,91 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Deraeocoris punctulatus +(Fallén, 1807) + + + + + + + +Material. +Kurai steppe, +50°15′ N +, +87°54′ E +, H = +1600–1650 m +, +8.08.2019 +, +1 ♂ +, +1 ♀ +. + + + + +Distribution. +Holarctic Euro-Siberian. Recorded from +Altai Republic +( +Kiritshenko 1910b +; +Vinokurov & Golub 2007 +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454675240FF68F97BFB13F8A5.xml b/data/03/B7/F8/03B7F81454675240FF68F97BFB13F8A5.xml new file mode 100644 index 00000000000..f72acd1438d --- /dev/null +++ b/data/03/B7/F8/03B7F81454675240FF68F97BFB13F8A5.xml @@ -0,0 +1,93 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Nabis punctatus mimoferus +Hsiao, 1964 + + + + + + + +Material. +Kurai Steppe, +50°15' N +, +87°54' E +, H = +1600–1650 m +, +8.08.2019 +, +1 ♂ +, +1 ♀ +. + + + + +Distribution. +East Palearcric subspecies of transpalaearctic species distributed in Siberia, Far East, Middle Asia, +China +, +Mongolia +, North +India +and north +Pakistan +. First record from Altai Republic. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F81454675240FF68F9E2FBCEF9DC.xml b/data/03/B7/F8/03B7F81454675240FF68F9E2FBCEF9DC.xml new file mode 100644 index 00000000000..c190523d489 --- /dev/null +++ b/data/03/B7/F8/03B7F81454675240FF68F9E2FBCEF9DC.xml @@ -0,0 +1,89 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Nabis ferus +(Linnaeus, 1758) + + + + + + + +Material. +Kurai Steppe, +50°13′46′′ N +, +87°55′27′′ E +, H = +1486 m +, +8.08.2019 +, +3 ♂ +, +3 ♀ +. + + + + +Distribution. +Trans-Euroasian. Recorded from +Altai Republic +( +Kiritshenko 1910b +). + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F814546D524AFF68FE5CFB44FC8E.xml b/data/03/B7/F8/03B7F814546D524AFF68FE5CFB44FC8E.xml new file mode 100644 index 00000000000..d939169e28a --- /dev/null +++ b/data/03/B7/F8/03B7F814546D524AFF68FE5CFB44FC8E.xml @@ -0,0 +1,183 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Bagrada stolida +( +Herrich-Schaeffer, 1839 +) + + + + + + + +Fig. 5 + + + + + + + +Eurydema stolidum +Herrich-Schaeffer, 1839: 101 + + +. + + + + + + +Bagrada (Nitilia) stolata +Horváth, 1936: 44 + + +(syn. + +Péricart, 2004: 372 + +). + + + + + + +Bagrada stolata +V.G. +Putshkov, 1961: 306 + + +; + +1965: 299 + +. + + + + + +Material. + +Russia +, +Altai Republic +, +Kosh-Agach District +, +Kurai Mts +, +Kuraika River Valley +, +50°16′44′′ N +87°57′12′′ E +, H = + +1750–1800 m + +, 24– + +26.07.2019 + +( +A. Naydenov +, +K. Naydenova +, +V +. +Rudoi +), +1 ♂ +, +1 ♀ + +. + + +Disribution. +Mediterranean (south +Italia +, Balkans Greek, +Turkey +), sick-Black Sea and +Kazakhstan +steppe, +Iran +, +Turkmenistan +, North-West +China +( +Putshkov 1961 +, +1965 +; Rieder 2006; +Esenbekova 2013 +). The species is recorded for the first time for Siberia. + + +According to +V +.G. +Putshkov (1961) +in +Ukraine +bugs occur in areas of virgin steppe on Alyssum, less often on other crucifers, in places they are found in large numbers. Two or three generations per year. + + + + \ No newline at end of file diff --git a/data/03/B7/F8/03B7F814546D524AFF68FEE5FB99FE37.xml b/data/03/B7/F8/03B7F814546D524AFF68FEE5FB99FE37.xml new file mode 100644 index 00000000000..6c782c6f5b0 --- /dev/null +++ b/data/03/B7/F8/03B7F814546D524AFF68FEE5FB99FE37.xml @@ -0,0 +1,100 @@ + + + +New materials on heteropterans from Kurai steppe (south-west of Russian Altai) + + + +Author + +Vinokurov, Nikolay N. +Institute for Biological Problems of Cryolithozone, Siberian Branch RAS, 677980 Yakutsk, 41 Lenin Av., Russia E-mail: vinok @ ibpc. ysn. ru + + + +Author + +Rudoi, Valentin V. +Altai State University, 656049, Barnaul, 61 Lenin Av., Russia * Corresponding author. E-mail: valentin. rudoi 97 @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-30 + + +38 + + +25 +35 + + + + +http://dx.doi.org/10.37828/em.2020.38.5 + +journal article +10.37828/em.2020.38.5 +2336-9744 +13231892 + + + + + + + +Sciocoris microphthalmus +Flor, 1860 + + + + + + + +Material. + +Kurai Mts +, +Teranjik +and +Right Kubadru Rivers +, +50°21′ N +, +87°55′ E +, H = + +2200–2600 m + +, 29.07– + +2.08.2019 + +, +1 ♀ + +. + + + + +Distribution. +Holarctic. Recorded from +Altai Republic +( +Petrova 1966 +, +1975 +). + + + + \ No newline at end of file diff --git a/data/03/B9/4F/03B94F0AFF950348D4FE699D6A178D21.xml b/data/03/B9/4F/03B94F0AFF950348D4FE699D6A178D21.xml new file mode 100644 index 00000000000..ec676399a87 --- /dev/null +++ b/data/03/B9/4F/03B94F0AFF950348D4FE699D6A178D21.xml @@ -0,0 +1,102 @@ + + + +New species of Patoptoformis Yakovlev, 2006 (Lepidoptera, Cossidae: Cossinae) from Northern Laos + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-02 + + +38 + + +63 +66 + + + + +http://dx.doi.org/10.37828/em.2020.38.8 + +journal article +10.37828/em.2020.38.8 +2336-9744 +13231862 +urn:lsid:zoobank.org:pub:39AB8520-46D1-42CC-A1A1-D6259BA15A19 + + + + + + + +Patoptoformis +Yakovlev, 2006 + + + + +Yakovlev, 2006: 203 + + + +Type +species (by original designation) + +Patoptoformis hanuman +Yakovlev, 2006 + + + +Composition. Four species: + +P. ganesha + +, + +P. hanuman + +, + +P. poltavskyi + +, and + +P. rimsaitae + +. + + +Distribution: SE Asia ( +Nepal +, Eastern +India +, +China +and Northern +Laos +) between 21− +29º N +. + + +Biology. In different altitude from +750 to 3760 m +. Flight period from April to July. + + + + \ No newline at end of file diff --git a/data/03/B9/4F/03B94F0AFF950348D4FE6D556CFA8C70.xml b/data/03/B9/4F/03B94F0AFF950348D4FE6D556CFA8C70.xml new file mode 100644 index 00000000000..5e40e96b502 --- /dev/null +++ b/data/03/B9/4F/03B94F0AFF950348D4FE6D556CFA8C70.xml @@ -0,0 +1,147 @@ + + + +New species of Patoptoformis Yakovlev, 2006 (Lepidoptera, Cossidae: Cossinae) from Northern Laos + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-02 + + +38 + + +63 +66 + + + + +http://dx.doi.org/10.37828/em.2020.38.8 + +journal article +10.37828/em.2020.38.8 +2336-9744 +13231862 +urn:lsid:zoobank.org:pub:39AB8520-46D1-42CC-A1A1-D6259BA15A19 + + + + + + + +Patoptoformis poltavskyi +Yakovlev + +, +sp. nov. + + + + + + +Figs 1, 5 +, +9 + + + + +Material examined +. + +Holotype +, male, +Laos +NW, + +5 km +E Muang Sing + +, +Chiang Tung +(Stupa) GH, + +750 m + +, + +26.iii.−05.iv.2010 + +, leg. local coll. (MWM). + + + + + +Description +. Antenna bipectinate, crest processes 2.5 times longer than antenna rod diameter. Length of fore wing +10 mm +. Fore wing relatively short, apically rounded, dark-brown, with poorly expressed dark pattern in root area and narrow black bands discally, postdiscally and submarginally, fringe dark-brown. Hind wing black, without pattern, fringe black. + + +Male genitalia (GenPr Heterocera MWM +N 25.261 +). Uncus long, apically semicircular; gnathos arms long, thin; gnathos robust, covered with fine spikes; valve basally wide, narrow in medium third, slightly widening to apex, membranous edge of valve obliquely connected with sclerotized part on abdominal edge, poorly expressed crest on costal edge; transtilla process strongly sclerotized, hooked, gradually narrowing from base to apex; juxta saddle-shaped with deep semicircular cut in medium part and two long thin lateral processes; saccus semicircular; aedeagus thick, strongly curved in medium third, apex sharp, obliquely cut, vesical aperture about 2/3 of aedeagus in length, vesical without cornuti. + + + + +Diagnosis +. The new species clearly differs from all the known species of the genus: + + +- from + +P. ganesha + +– externally: the new species is significantly smaller, in + +P. Ganesha + +the thin transverse bands on the fore wing are more expressed; + + +- from + +P. hanuman + +and + +P. rimsaitae + +– in the male genital structure (in the new species, the membranous edge of the valve is very blunt and short; in +P. Hanuman +, the saccus is significantly smaller, in + +P. rimsaitae + +– the juxta lateral processes are more robust). + + + + +Etymology +. The new species is named after my dear colleague and co-author, Dr. Alexandr N. Poltavsky (Rostov-na-Donu, +Russia +) (1954−2020) well- known entomologist, specialist in +Lepidoptera +on the Caucasus, who untimely left us during the pandemic. + + + + \ No newline at end of file diff --git a/data/03/B9/4F/03B94F0AFF95034AD4FE68716C4A8B72.xml b/data/03/B9/4F/03B94F0AFF95034AD4FE68716C4A8B72.xml new file mode 100644 index 00000000000..d8684175185 --- /dev/null +++ b/data/03/B9/4F/03B94F0AFF95034AD4FE68716C4A8B72.xml @@ -0,0 +1,153 @@ + + + +New species of Patoptoformis Yakovlev, 2006 (Lepidoptera, Cossidae: Cossinae) from Northern Laos + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-02 + + +38 + + +63 +66 + + + + +http://dx.doi.org/10.37828/em.2020.38.8 + +journal article +10.37828/em.2020.38.8 +2336-9744 +13231862 +urn:lsid:zoobank.org:pub:39AB8520-46D1-42CC-A1A1-D6259BA15A19 + + + + + + + +Patoptoformis ganesha +( +Yakovlev, 2004 +) + + + + + + + +Figs 2, 6 +, +9 + + + + + + + +Patopta +(sic!) +ganesha +Yakovlev, 2004: 370 + + +. + + + + + +Type material: +holotype +(male) in MWM. + + + +Figures 1−8. +Adult males (holotypes) (1−4) and male genitalia (5−8) of + +Patoptoformis +Yakovlev, 2006 + +(original and from + +Ivinskis +et al. +2012 + +): 1. + +P. poltavskyi + +; 2. + +P. ganesha + +; 3. + +P. hanuman + +; 4. + +P. rimsaitae + +; 5. + +P. poltavskyi + +; 6. + +P. ganesha + +; 7. + +P. hanuman + +; 8. +P. rimsaitae +. + + + + +Type +locality: +Nepal +, +Ganesh Himal +, valley of +Mailung Khola +, +N 28º05′ +/ +E 85º03′ + +. + + +Distribution: +Nepal +, Ganesh Himal. + + + + \ No newline at end of file diff --git a/data/03/B9/4F/03B94F0AFF97034AD4FE6D1A6FDF88E7.xml b/data/03/B9/4F/03B94F0AFF97034AD4FE6D1A6FDF88E7.xml new file mode 100644 index 00000000000..36bd5acadac --- /dev/null +++ b/data/03/B9/4F/03B94F0AFF97034AD4FE6D1A6FDF88E7.xml @@ -0,0 +1,78 @@ + + + +New species of Patoptoformis Yakovlev, 2006 (Lepidoptera, Cossidae: Cossinae) from Northern Laos + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-02 + + +38 + + +63 +66 + + + + +http://dx.doi.org/10.37828/em.2020.38.8 + +journal article +10.37828/em.2020.38.8 +2336-9744 +13231862 +urn:lsid:zoobank.org:pub:39AB8520-46D1-42CC-A1A1-D6259BA15A19 + + + + + + + +Patoptoformis poltavskyi + +, +sp. nov. + + + + + + +Type material: +holotype +(male) in MWM. + + + +Type +locality: +Laos +NW, +5 km +E +Muang Sing. + + + +Distribution: NW +Laos +. + + + + \ No newline at end of file diff --git a/data/03/B9/4F/03B94F0AFF97034AD4FE6DB26C2D89F3.xml b/data/03/B9/4F/03B94F0AFF97034AD4FE6DB26C2D89F3.xml new file mode 100644 index 00000000000..a7ae7caeb09 --- /dev/null +++ b/data/03/B9/4F/03B94F0AFF97034AD4FE6DB26C2D89F3.xml @@ -0,0 +1,85 @@ + + + +New species of Patoptoformis Yakovlev, 2006 (Lepidoptera, Cossidae: Cossinae) from Northern Laos + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-02 + + +38 + + +63 +66 + + + + +http://dx.doi.org/10.37828/em.2020.38.8 + +journal article +10.37828/em.2020.38.8 +2336-9744 +13231862 +urn:lsid:zoobank.org:pub:39AB8520-46D1-42CC-A1A1-D6259BA15A19 + + + + + + + +Patoptoformis rimsaitae +Saldaitis & Yakovlev + +in +Ivinskis et al., 2012 + + + + + + +Figs 4, 8−9 + +Saldaitis & Yakovlev, 2012: 40 + +Type material: +holotype +(male) in MWM. + + + +Type +locality: +China +, +Sichuan prov. + + +[province], Env. [environs] +Mianning Ling Shan Mts. +[mountains]. Distribution: +China +, +Sichuan Province + +. + + + + \ No newline at end of file diff --git a/data/03/B9/4F/03B94F0AFF97034AD4FE6E266C778B9E.xml b/data/03/B9/4F/03B94F0AFF97034AD4FE6E266C778B9E.xml new file mode 100644 index 00000000000..f66ec312a2a --- /dev/null +++ b/data/03/B9/4F/03B94F0AFF97034AD4FE6E266C778B9E.xml @@ -0,0 +1,102 @@ + + + +New species of Patoptoformis Yakovlev, 2006 (Lepidoptera, Cossidae: Cossinae) from Northern Laos + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-02 + + +38 + + +63 +66 + + + + +http://dx.doi.org/10.37828/em.2020.38.8 + +journal article +10.37828/em.2020.38.8 +2336-9744 +13231862 +urn:lsid:zoobank.org:pub:39AB8520-46D1-42CC-A1A1-D6259BA15A19 + + + + + + + +Patoptoformis hanuman +Yakovlev, 2006 + + + + + + + +Figs 3, 7 +, +9 + +Yakovlev, 2006: 203 + +Type material: +holotype +(male) in MWM. + + + +Type +locality: NE +India +, +Assam +, +Numeri NP +, +40 km +N +Tezpur +, + +27º20 +' +N + +/ + +93º15 +' +E + + +. + + +Distribution: NE +India +, +Assam +. + + + + \ No newline at end of file diff --git a/data/03/BB/87/03BB87F38427614BD5CFF91FFD3FFB75.xml b/data/03/BB/87/03BB87F38427614BD5CFF91FFD3FFB75.xml new file mode 100644 index 00000000000..678ce34e2ac --- /dev/null +++ b/data/03/BB/87/03BB87F38427614BD5CFF91FFD3FFB75.xml @@ -0,0 +1,184 @@ + + + +Bythinella charpentieri (Roth, 1855), found again after 165 years (Mollusca: Gastropoda: Bythinellidae) + + + +Author + +Glöer, Peter +Schulstrasse 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Porfyris, Anastasios +Blessa str. 33, 15669 Athens, Greece. E-mail: tasosporfyris @ yahoo. com + + + +Author + +. + + + +Author + +. + + + +Author + +. + + + +Author + +. + + + +Author + +B., B ... + + + +Author + +B. + + + +Author + +B. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-13 + + +38 + + +144 +146 + + + + +http://dx.doi.org/10.37828/em.2020.38.20 + +journal article +300846 +10.37828/em.2020.38.20 +1ae4b2e0-35dc-4f65-b531-8080db36cd5b +2336-9744 +13232331 + + + + + + + +Bythinella charpentieri +(Roth, 1855) + + + + + + + +Fig. 1 + + + + +Material examined: + +15 specimens +from the +type +locality: spring near the old +Monastery in Kaissariani +, +Hymettos Mt. +, +Attica +, +Greece + +. + + + + +Description: +The penis and the penial appendix are broader than usual in + +Bythinella + +. The tubular gland is proximally very thin but regularly thick from the second third part to the distal end of the gland. + + + + +Distribution +: +Greece +; nly known from the +type +locality. + + + +Figure 1 +. + +Bythinella charpentieri + +from the type locality. Abbreviations: e: eye, p: penis, pa: penial appendix, s: snout, su: sucker, tg: tubular gland. + + + +Habitat +: + +The +species lives in water coming from a spring ( +Fig. 2 +) just outside of the old +Monastery in Kaissariani +, at the foothils of +Hymettos +, +Attica +, +Greece +. +The +spot is quite small and the water is unsuitable for drinking. +It +also has a sulfur-like odour, which can discourage human interventions of any +type +. We suggest that no cleaning action should be done there (wiping the stone or collecting the rotten leaves), because this can badly affect the species population + +. + + + + \ No newline at end of file diff --git a/data/03/BB/F1/03BBF11A4311FFF0FF1E5A79FC84FEA6.xml b/data/03/BB/F1/03BBF11A4311FFF0FF1E5A79FC84FEA6.xml new file mode 100644 index 00000000000..22713b1dff6 --- /dev/null +++ b/data/03/BB/F1/03BBF11A4311FFF0FF1E5A79FC84FEA6.xml @@ -0,0 +1,175 @@ + + + +Afrikanetz kruegeri - New species of Cossinae (Lepidoptera, Cossidae) from Namibia + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-20 + + +40 + + +125 +127 + + + + +http://dx.doi.org/10.37828/em.2021.40.10 + +journal article +10.37828/em.2021.40.10 +2336-9744 +urn:lsid:zoobank.org:pub:CAC47715-65EF-4E82-B785-1E3F5692852E + + + + + + + +Afrikanetz kruegeri +Yakovlev + +, +sp. n. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +815440BE-A239-4295-87B6-A1E5D4DF6799 + + + + + +Figs 1−2 + + + + +Material +. + +Holotype +, male, +Namibia +[ +Kunene Region +], +Marple +[Marble] +Hill Camp +, +S 18º18.458′ +/ E 13º76.123′, + + +15.ix. +2010 + + +, 850 m, leg. +J. Cave +& +T +.A. Newton- +Chance +( +Museum Witt +, +Munich +, slide +Genitalpräparat Heterocera Nr. +26.771). + + + + + +Description. +Length of fore wing +13 mm +. Antenna bipectinate, crest processes 4 times longer than antenna rod diameter. Fore wing grey, dark-grey and black strokes and spots throughout all wing area, thin reticulated pattern postdiscally, blurred ocher round spot at top of discal cell, fringe mottled, brown at veins, light-grey between veins. Hind wing white with fine blurred grey reticulated pattern, fringe light-grey. + +Male genitalia. Uncus long, thin, uncinately bent at apex; gnathos arms relatively short, thin; gnathos small, compact, its surface densely covered with small spikes; valve gradually narrowing from base to medium third, distal half with parallel edges, apex blunt, membranous, three well expressed sclerotized ribs on costal edge; transtilla processes very long, thin, uncinately curved; juxta small, with long robust lateral processes diverged at an angle of 90º; saccus small, semicircular; phallus slightly longer than valve, poorly curved, obliquely cut apically, two small spikes at distal end on abdominal surface, vesica aperture in dorsoapical position, equals to 1/6 of phallus in length, vesica without cornuti. +Female unknown. + + + +Figures 1−2. + +Afrikanetz kruegeri +Yakovlev + +, +sp. n. +, holotype: 1. Adult specimen; 2. Male genitalia (Genitalpräparat Heterocera Nr. 26.771). + + + + +Diagnosis +. In the small size and color, the new species is most close to the recently described + +A. dargei +Yakovlev, 2019 + +( +Type +locality: +Tanzania +, +Arusha Region +, Mt. Meru), from which it clearly differs in the longer uncus (in + +A. dargei + +the uncus is shorter), more expressed ribs on the costal edge of the valve (in + +A. dargei + +the ribs on the costal edge of the valve are less expressed), the smaller saccus (in +A. dargei +he saccus is very big) and the thicker phallus (in + +A. dargei + +the phallus is thin). + + + + +Etymology +. The new species is named after my colleague Dr. Martin Krüger (1964−2019) ( +Fig. 3 +), a prominent south-African entomologist and the former director and curator of the entomological collection in Ditsong Museum (Pretoria), who made a great contribution into the study of +Geometridae +, +Erebidae +and several other groups of African moths ( +Staude 2019 +). Martin kindly received me at the museum and provided constant assistance in my study of +Cossidae +in Africa. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA0EE2FC29FEDEEFAC7FD4E.xml b/data/03/BD/CC/03BDCC27FFA0EE2FC29FEDEEFAC7FD4E.xml new file mode 100644 index 00000000000..3f3c3950a4e --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA0EE2FC29FEDEEFAC7FD4E.xml @@ -0,0 +1,772 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +3. + +Dolecta aroa +( +Schaus, 1894 +) + +comb. n. + + + + + + +Figs 3−7 +, 35−38, 60, 61, 65, 75 + + + + + + + +Langsdorfia aroa +Schaus, 1894: 235−236 + + + + + + + + +Type +locality: +Venezuela +, [ +Yaracuy State +, +Bolivar +Municipality], +Aroa +[ +10.437919°N +68.894078°W +] + +. + + +Type material ( +holotype +) in USNM, examined. + + +Material examined. + +Holotype +♂ +: +Aroa +, Venezuela ( +Genitalia Slide By P. Gentili +1988, +USNM 85.170 +) +Type No. +18583 ( +USNM +); +1 ♂ +, +Venezuela +, Carabobo, + +Cordillera de la Costa Bejuma + +, +Casa Maria +u. Umg. ca. + +500−1600 m + +, + +16. August – 04. September 2005 + +, leg. +F. & Th. Greifenstein +( +GenPr-Heterocera +MWM 28.590 +) ( +MWM +); +2 ♂♂ +, +ECUADOR +, +Esmeraldes prov. +, + +3.2 km +E Mompiche + +, + +10 km +SW Saraguro + +0°29′37′′ N +/ +79°59′46′′ W +, + +25.04.2012 + +, H= + +140 m + +, leg. +R. Brechlin +& +V. Sinyaev +(GenPr-Heterocera +MWM 28.592 +) ( +MWM +); +6 ♂♂ +, Ecuador, Esmeraldes, Alto Tambo, Chuchuvi, +0°53′02.82′′ N +; +78°31′01.15′′ W +; + + +Juni – August +2015 + + +, +780 m. +, leg. +H. Thöny +( +MWM +); +3 ♂♂ +, +Ecuador +, Esmeraldes, Alto Tambo, Chuchuvi, +0°53′02.82′′ N +/ +78°31′01.15′′ W +; + + +August +2014 + + +, 780 m, leg. +H. Thöny +( +MWM +); +3 ♂♂ +, Ecuador, Esmeraldes, Alto Tambo, Chuchuvi, +0°53′02.82′′ N +; +78°31′01.15′′ W +; May−July + +2014, 780 m + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, +ECUADOR +, Morona Santiago prov., +San Carlos de Limon +, +3°11′32′′ S +78°26′40′′ W +, + +24.11.2011 + +; H= + +937 m + +, leg. +V. Sinyaev +& +O. Romanov +( +MWM +); +1 ♂ +, Ecuador, +Esmeraldes prov. +, + +3 km +E Mompiche + +, + +140 m + +, +0°29′37′′ N +/ +79°59′46′′ W +; + +25−29.I.2013 + +; leg. +Sinyaev +& [coll.] +Dr. R. Brechlin +( +MWM +); +1 ♂ +, +Ecuador +, El Oro prov., +8 km +NW PINAS, +3°38′53′′ S +/ +79°45′04′′ W +, + +15.04.2012 + +, H= + +900 m + +, leg. +R. Brechlin +& +V. Sinyaev +( +MWM +); +1 ♂ +, Ecuador, El Oro prov., +8 km +NW PINAS, 3°38′53′′ / S +79°45′04′′ W +, + +15.04.2012 + +, H= + +900 m + +, legit +Victor Sinyaev +(Genital preparation №72 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, +Colombia +( +SW +), Valle del Cauca, Reserva forestal “La Albania”; H= + +1640 m + +, +03°37'32"N +/ +76°23'54"W +, + +5−8.i.2014 + +, leg. via Victor Sinyaev & [coll.] +Dr. R. Brechlin +; +1 ♂ +, +Colombia +, La Guajira, Carretera Via Palomino- Mingueo, +Cabañas El Bosque +, + +55 m + +, +11º13'0''N +/ +73º28'29''W +. + +06−09.X.2016 + +. leg. +V. Sinyaev +& [coll.] +Dr. R. Brechlin +; +1 ♂ +, Colombia, Magdalena, +Municipio de Minca +, +Reserva El Faunal. +11º07'56''N +/ +74º06'10''W +, + +19−21.xi.2014 + +; H= + +800 m + +, leg. +Viktor Sinyaev +& +Mildred Márquez +(Genital preparation № 74 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, +Colombia +, Quindío, +Valle del Cocora +, +E of Salento +, H= + +2300 m + +, 4˚38'32"N / 75˚30'47"W. + +11.iii.2017 + +, leg. +Victor Sinyaev +(Genital preparation № 77 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, Colombia, Valle del Cauca, Centella, km 38, vía al mar Cali +03°36'52"N +76°41'14"W +, + +01.11.2013 + +, H = + +950 m + +, leg. +Victor Sinyaev +& +Mildred Márquez +(Genital preparation № 78 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, +Colombia +, Valle del Cauca, +rd. La Elsa +- +El Queremal +, + +PN +Farallones de Cali + +, +3º31'57"N +/ +76º45'03"W +. + +1.iv.2017 + +, H= + +1300 m + +, leg. +Victor Sinyaev +& Cesar Pinilla (Genital preparation № 79 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, Colombia, Boyacá, road Otanche- Puerto Boyaca +5º44'10'' N +/ +74º13'04'' W +, H= + +685 m + +, 10−16.02.16, leg. +V. Sinyaev +& +Machado +(Genital preparation № 80 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, Brasil, Bahia, env. Camacan (SB), + +800 m + +, +15º25' S +/ +39º34' W +, + +October 2011 + +, leg. +H. Thöny +(GenPrHeterocera +MWM 28.591 +) ( +MWM +); +1 ♂ +, +Brasilien +, Bahia, Umg. Camacan +15º25' S +/ +39º34' W +, + +800 m + +, + +Oktober 2012 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, Brasilien, Bahia, Mun. Marau, Fanzenda Agua Boa +14°13´S +/ +39°29´W +, + +150 m + +, 15– + +22.11.2010 + +, leg. +Th. Greifenstein +(GenPr-Heterocera +MWM 37.003 +) ( +MWM +); +1 ♀ +, Brasil, Bahia, env. +Camacan +, +15º25'S +/ +39º34'W +, + +September 2011 + +, leg. +H. Thöny +(GenPr- +Heterocera +MWM +37.000) ( +MWM +); +1 ♂ +, NW +Argentina +, Jujuy Prov., + +10 km +SEE Caimancito + +, 23°44′38,5′′ / S +064°31′08.7′′ W +, H− + +371 m + +, + +05.11.2019 + +, leg. +R.V. Yakovlev +( +Genital +preparation № 172 coll. +Naydenov A.E. +) ( +RYB +); +2 ♂ +, NW Argentina, Jujuy Prov., + +10 km +SEE Caimancito + +, +23°44′38.5′′ S +064°31′08.7′′ W +, H− + +371m + +, + +05.11.2019 + +, leg. +R.V. Yakovlev +( +RYB +); +1 ♂ +, NW +Argentina +, Jujuy Prov., + +10 km +SEE Caimancito + +, +23°44′38,6′′ S +064°31′09,2′′ W +, H− + +405m + +, 25− + +26.10.2019 + +, leg. +R.V. Yakovlev +( +RYB +); +1 ♂ +, Paraguay, +Dep. Amambay +, +Laguna Ciervo, S +22º20' / W 56º11', + +24–26.i.2014 + +, leg. +U. Drechsel +( +Genital +preparation № 84 coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, +Paraguay +, Dep. Conception, +Garay Cue, S +22º41' / W 57º22', + +14–16.ii.2013 + +, leg. +U. Drechsel +( +Genital +preparation № 87 coll. +Naydenov A.E. +) ( +RYB +); +2 ♂♂ +, Paraguay, +Dep. Alto Parana +, +Limoy, S +24º48' / W 54º27', leg. +U. Drechsel +( +Genital +preparation № 88, № 89 coll. +Naydenov A.E. +) ( +RYB +); +1 ♀ +, +Paraguay +, +Dep. Amambay +, +Estancia Kai Rague, S +23º20' / W 56º18', + +23–27.xi.2013 + +, leg. +U. Drechsel +( +Genital +preparation № 85 coll. +Naydenov A.E. +) ( +RYB +). + + + + + +Redescription +. Male. Length of fore wing +18−20 mm +. Fore wing brown with oblique light- brown line from top of discal cell to anal angle, with dark-brown spots of various shapes throughout all wing, round dark-brown spot submarginally (at medial veins), fringe mottled, dark-brown at veins (in thick bundles), light-brown between veins. Hind wing dark-brown with series of dark-brown spots along outer edge of wing, fringe brown unicolorous. + +Male genitalia. Genitals of typical shape for the genus – with deeply split massive uncus; valve with slightly curved abdominal edge, practically even costal edge, small bump apically, outer edge semicircular; juxta scaphoid with long tapered apically sharp abdominal process; saccus poor;y elongated, tapered, apically semicircular; phallus short, apically evenly sharpened. + +Female. Length of fore wing +25 mm +. Wing pattern resembles that of the male, but paler. + +Female genitalia. Ovipositor short; papillae anales tapered, densely covered with small spikes; anterior and posterior apophyses very short, thick, posterior apophyses slightly longer than anterior; ostium wide, cup-like, framed with poorly sclerotized plate; ductus of bursae copulatrix short, relatively wide; bursa copulatrix bag-like, without signa. + + + +Diagnosis +. The species clearly differs from other species of the genus in a series of characters: + +- the oblique light-brown line on the fore wing from the discal cell top to the anal angle; +- the small bump on the costal edge of the valve closer to the apex. + + + +Distribution. +Venezuela +, +Ecuador +, +Colombia +, +Brazil +( +Bahia +), +Paraguay +, +Argentina +( +Jujuy +). + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA3EE2EC29FEB60FE60FDA8.xml b/data/03/BD/CC/03BDCC27FFA3EE2EC29FEB60FE60FDA8.xml new file mode 100644 index 00000000000..d8a29983986 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA3EE2EC29FEB60FE60FDA8.xml @@ -0,0 +1,187 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +5. + +Dolecta chekhovi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 9 +, 40, 65, 74 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +7776B869-F21D-4A34-8969-CCB0369142F4 + + + + + +Material examined. + +Holotype +♂ +: +Peru +, prov. +Huánuco +, +Yuyapichis +, ACP +Panguana +, 9°36′′ S / 74°56′′ W, + + +September +2013 + + +, 220 m, leg. +H. Thöny +(GenPr- Heterocera +MWM 36.986 +) ( +MWM +) + +; + +Paratype +1 ♂ +: +Peru +, prov. +Huánuco +, +Yuyapichis +, ACP +Panguana +, 9°36′′ S / 74°56′′ W, + + +September +2013 + + +, 220 m, leg. +H. Thöny +( +MWM +) + +. + + + + +Description +. Male. Length of fore wing +20 mm +. Fore wing light-brown with S-shaped wide light-brown stripe from wing root to anal angle and series of brown spots of various shape, fringe brown, unicolorous. Hind wing dark-grey, almost without pattern, fringe brown unicolorous. + +Male genitalia. Uncus relatively short, deeply bifurcated, each half of uncus with small tapered prong, directed medially; gnathos arms very short, thin, narrowing from base to apex; valve long, abdominal edge slightly curved, costal edge with deep cut on border between basal and medium thirds, long strongly curved spiky process in distal third, valve apically semicircular with long finger-like process; juxta very large with sharp subulate abdominal process; saccus tapered, apically blunt; phallus short, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs from all the known species in the shape of the valve: the slightly curved abdominal edge, the deep cut on the border between the basal and medium thirds of the costal edge, the long strongly curved spiky process in the distal third, the semicircular apex of the valve with a long finger-like process. The species is mostly close to + +D. bulgakovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +from which it differs by the long process on the apex of the valve. + + + + +Distribution. +Peru +(prov. +Huánuco +). + + + + +Etymology. +The new species is named after the Russian playwright and short-story writer Anton Pavlovich Chekhov. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA3EE2FC29FEE0EFDF8FA06.xml b/data/03/BD/CC/03BDCC27FFA3EE2FC29FEE0EFDF8FA06.xml new file mode 100644 index 00000000000..e72f9b2beb7 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA3EE2FC29FEE0EFDF8FA06.xml @@ -0,0 +1,154 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +4. + +Dolecta bulgakovi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 8 +, 39, 65 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +38F842D5-1666-488B-ABB8-D4AF370628FD + + + + + +Material examined. + +Holotype +♂ +: +Guyane +Franc., +Saül +, + +200m + +, + +19−23.i.1971 + +, +J.T. Betz +( +MNHN +). + + + + + +Description +. Male. Length of fore wing +19 mm +. Fore wing brown with S-shaped wide light-brown stripe from wing root to anal angle, series of dark-brown spots of various shapes, fringe brown, unicolorous. Hind wing light-grey, almost without pattern, fringe brown, unicolorous. + +Male genitalia. Uncus robust, relatively short, deeply forked, each half of uncus with small tapered prong, directed medially; gnathos arms very short, thin, narrowing from base to apex; valve with slightly curved abdominal edge, costal edge with deep notch on border between basal and medium thirds, long poorly curved spiky process in distal third, valve apically semicircular; juxta with sharp subulate abdominal process; saccus tapered, apically blunt; phallus short, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species reliably differs from all the known species of the genus in the valve shape (with the poorly curved abdominal edge, the deep notch on the border of basal and medium thirds of the costal edge, and the slightly curved spiky process in the distal third). The species is mostly close to + +D. chekhovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +from which it differs in the absence of the long process on the top of the valve. + + + + +Distribution. +French Guiana +. + + + + +Etymology. +The new species is named after the Russian writer, medical doctor and playwriter Mikhail Afanasyevich Bulgakov. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA6EE2DC29FE88EFDC0FE7E.xml b/data/03/BD/CC/03BDCC27FFA6EE2DC29FE88EFDC0FE7E.xml new file mode 100644 index 00000000000..ec938c1c2c9 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA6EE2DC29FE88EFDC0FE7E.xml @@ -0,0 +1,159 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +2. + +Dolecta amanosa +( +Schaus, 1911 +) + +comb. n. + + + + + + +Figs 2 +, 34, 65 + + + + + + + +Givira amanosa +Schaus, 1911: 629−630 + + + + + + + + +Type locality: C.[osta] R.[ica], [ +Cartago Province +, Turrialba Canton], +Tuis +[ +9.840193°N +/ +83.5608858°W +]. Type material ( +holotype +) in USNM, examined + +. + + +Material examined. + +Holotype +♂ +: +Tuis, C.R. +, +May +28− +June +4 ( +Genitalia Slide By P. Gentili +1988, +USNM 85.171 +) ( +USNM +). + + + + + +Redescription +. Male. Length of fore wing +22 mm +. Fore wing light-brown with semicircular dark-brown spots and light (milk and coffee colour) reticulated pattern throughout all wing, by its contrast resembling chess board, fringe mottled, dark-brown at veins, (in thick bundles), light-brown between veins. Hind wing brown with wide dark-brown band postdiscally (smoothly narrowing from fore edge to hind edge), semicircular dark-brown spots along outer edge of wing, fine brown reticulated pattern throughout all wing, fringe mottled, dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus massive, long, split into two parts by deep semicircular cut, halves of uncus diverged to sides, slightly widened apically, apices with small prongs diverged to sides; gnathos arms thin, ribbon-like, short; valve with wide almost even outer edge, costal and abdominal edges of valve slightly curved along all length; juxta massive, scaphoid, with cylindrical abdominal process tapered apically; saccus tiny, cylindrical, apically clavate; phallus short, apically tapered smoothly. +Female unknown. + + + +Diagnosis +. The species clearly differs from other species of the genus in its very contrast brown colouring, almost even outer edge of the valve and the apically clavate saccus. + + + + +Distribution. +Costa Rica +. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA7EE2BC29FE9BDFD81F800.xml b/data/03/BD/CC/03BDCC27FFA7EE2BC29FE9BDFD81F800.xml new file mode 100644 index 00000000000..16eba85c4a5 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA7EE2BC29FE9BDFD81F800.xml @@ -0,0 +1,147 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +1. + +Dolecta akhmatovae +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 1 +, 33, 65, 73 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +C5155913-1113-4C22-9E1C-F278CDC4B9D3 + + + + + +Material examined. + +Holotype +♂ +: +Brasilien +, Esp. Santo, +Santa +Leopoldina, Biriricas +, ca. + +700 m + +, 20.3−20.4.97, 1997, leg. +H. Thöny +(GenPr- Heterocera +MWM 36.994 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +16.5 mm +. Fore wing light-brown with dark-brown wide bands in root and discal areas of wing, big round dark-brown spot postdiscally (at base of medial veins), semicircular dark-brown spots along outer edge of wing and fine, colour of coffee with milk, reticulated pattern throughout all wing, fringe mottled – dark-brown at veins (in thick bundles) and light-brown between veins. Hind wing colour coffee with milk, light-brown round spots postdiscally, semicircular dark-brown spots along outer margin of wing, fine brown reticulated pattern throughout all wing, fringe dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus massive, split into two parts by deep semicircular cut, halves of uncus diverged to sides, slightly widened apically; gnathos arms thin, ribbon-like, short; valve relatively short, apically wide semicircular, costal edge of valve with small notch on border between basal and medium thirds, abdominal edge slightly curved evenly; juxta massive scaphoid, with cylindrical abdominal process; saccus tiny, cylindrical; phallus short, evenly sharpened to apex. +Female. Unknown. + + + +Diagnosis +. The new species differs well from the other known species of the genus in a series of characters: + +- the hind wing is much lighter than fore wing; +- the valve has slightly curved edges and a wide semicircular apex. + + + +Distribution. +Brazil +, Esp. Santo, Santa Leopoldina. + + + + +Etymology. +The new species is named after one of the most significant Russian poets of the 20th century Anna Andreyevna Akhmatova. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA7EE2BC29FEDCCFBC8FBB5.xml b/data/03/BD/CC/03BDCC27FFA7EE2BC29FEDCCFBC8FBB5.xml new file mode 100644 index 00000000000..13b999b796f --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA7EE2BC29FEDCCFBC8FBB5.xml @@ -0,0 +1,148 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +Genus + +Dolecta +Herrich-Schäffer, [1854] + +stat. res. + + + + + + +Type +species (by monotypy): + +Dolecta scariosa +Herrich-Schäffer, [1854] + +, +Sammlung neuer oder wenig bekannter Aussereuropäischer Schmetterlinge +: Fig. 148. + + + + +Description +. Size medium, colour dark; antenna relatively short (about 1/3 of fore wing in length), with short bipectinate crest. Fore wing apically rounded, dark, with expressed spotty and undulated pattern of darker and lighter elements. Hind wing relatively short, with the same spotty and undulated pattern as on fore wing, but less expressed. + + +Male genitalia. +Uncus long, massive, shaped as deeply bifurcated fork; gnathos arms thin, short, gradually narrowing from base to apex; gnathos absent; valve relatively short, often with a more or less expressed process on costal edge (in distal third); juxta cup-like with elongated, often sharp, abdominal process; saccus tiny; phallus very short (practically, shorter than valve, rarely longer), basally very wide, gradually narrowing to apex, vesica aperture in dorso-apical position, vesica without cornuti. + + +Female genitalia. +Ovipositor short; papillae anales tapered, densely covered with small spikes; anterior and posterior apophyses very short, approximately equal in length; ostium wide, cup-like; ductus of bursae copulatrix short, relatively wide; bursa copulatrix bag-like, without signa. + + + + +Diagnosis +. The new genus clearly differs from the genera which were previously considered its synonyms: + + +- from + +Hypopta + +– by the absence of the large plate-like harpe at costal edge of the valve with serrated edge, and by the bifurcated uncus; + + +- from + +Breyeriana + +– by the absence of the tooth-like cornutus in the vesica and by the bifurcated uncus; + + +- from the recently described genera with the forked uncus ( + +Yakovlev +et al. +2019 + +) – by the very short phallus without cornuti, and by the elongated abdominal process of the juxta. + + + + +Distribution. +Central and Southern America (from +Costa Rica +and +Panama +to Northern +Argentina +and +Paraguay +). The genus is endemic for the Neotropical biogeoraphic region. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA8EE24C29FEDEEFDA5FBFC.xml b/data/03/BD/CC/03BDCC27FFA8EE24C29FEDEEFDA5FBFC.xml new file mode 100644 index 00000000000..bde97afae98 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA8EE24C29FEDEEFDA5FBFC.xml @@ -0,0 +1,242 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +10. + +Dolecta gogoli +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 14 +, +45 +, +67 +, +76 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +4E780C5B-C50D-4B86-8CC6-2F5570A2E256 + + + + + +Material examined: + +Holotype +♂ +: +Ecuador +, +Morona Santiago prov. +, +San Carlos de Limon +, +3°11′32′′ S +/ +78°26′40′′ W +, + +24.11.2011 + +; H= + +937 m + +, leg. +V. Sinyaev +& +O. Romanov +(GenPr- Heterocera +MWM 36.985 +) ( +MWM +) + +; + +Paratypes +: +2 ♂♂ +, +Ecuador +, +Morona Santiago prov. +, +San Carlos de Limon +, +3°11′32′′ S +/ +78°26′40′′ W +, + +24.11.2011 + +; H= + +937 m + +, leg. +V. Sinyaev +& +O. Romanov +( +MWM +) + +; + +1 ♂ +, +C. America +, +Panama +, +Chiriqui prov. +, +Gualaca distr. +, +Reserva +forestal +de Fortuna +, +8.743111º N +/ +82.26275º W +, H= + +1107 m + +, + +19.vi.2017 + +, +A. Kozlov +& +Yu. Kovaleva +leg., ( +Genital +preparation №70 coll. +Naydenov A.E. +) + +( +RYB +). + + + + +Description +. Male. Length of fore wing +20 mm +. Fore wing grey with bright pattern of brown spots of various shape and size throughout all wing, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. Hind wing white with poorly expressed band discally, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus split by deep and very wide notch, halves of uncus thin, long, apically blunt; gnathos arms very short, thin; valve with poorly expressed notch in medium third, abdominal edge smooth, outer edge semicircular; juxta large, scaphoid with long spiky abdominal process; saccus cylindrical, apically semicircular; phallus short, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. Externally, the new species is mostly close to + +D. gertseni +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, from which it differs in its smaller size and the semicircular anal angle of the fore wing. From all the other species of the genus it clearly differs by the very thin halves of the uncus. + + + + +Distribution. +Panama +, +Ecuador +. + + + + +Etymology. +The new species is named after the Russian prose writer, playwright, poet, critic and publicist Nikolai Vasilievich Gogol. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA8EE27C29FE97AFCB4FBD3.xml b/data/03/BD/CC/03BDCC27FFA8EE27C29FE97AFCB4FBD3.xml new file mode 100644 index 00000000000..cb31ea69ed7 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA8EE27C29FE97AFCB4FBD3.xml @@ -0,0 +1,652 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +11. + +Dolecta juturna +Schaus, 1892 + + + + + + + +Figs 15−16 +, +46 +, +62 +, +67 + + +Schaus, 1892: 328 + + + + +Material examined. + +Holotype +♂ +: [ +Brazil +], +Rio Janeiro +( +Genitalia Slide +by +P. Gentili +, 1988, +USNM 85.173 +) ( +USNM +); +9 ♂♂ +, Brasilien, Santa Catarina, + +S. +Bento do Sul + +, + +Sierra +Rio Natal + +, + +850 m + +, + +April 1999 + +, leg. +H. Thöny +(GenPr- +Heterocera +MWM 37.161 +) ( +MWM +); +2 ♂♂ +, +Brasilien +, Santa Catarina, + +S. +Bento do Sul + +, + +Sierra +Rio Natal + +, + +850 m + +, 10– + +25.04.1998 + +, leg. +H. Thöny +( +MWM +); +2 ♂♂ +, Brasilien, Esp. Santo, +Santa +Leopoldina, Dorf Tirol +, ca. + +700 m + +, +40º50′ W +/ 24º75′′ S, 15.03− + +20.04.1997 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, Esp. Santo, Santa +Leopoldina, Dorf Tirol +, + +700 m + +, +40º50′ W +/ 24º75′′ S, + +15.05.1997 + +, leg. +H. Thöny +( +MWM +); +2 ♂♂ +, Brasilien, Esp. Santo, Santa +Leopoldina, Dorf Tirol +, ca. + +700m + +, +40º50′ W +/ 24º75′′ S, 20.02− + +30.03.1997 + +, leg. +H. Thöny +( +MWM +); +2 ♂♂ +, +Brasilien +, Espirito Santo, +Santa +Leopoldina, Dorf Tirol +, ca. + +700 m + +, + +Mai 2000 + +, leg. +H. Thöny +( +MWM +); +2 ♂♂ +, Brasilien, Espirito Santo, +Santa +Leopoldina, Dorf Tirol +, ca. + +700 m + +, +März +1999, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, Espirito Santo, +Dorf Tirol +, + +600 m + +, + +Nov. 2003 + +, leg. +Martini +, ex coll. +K. Martini +( +MWM +); +1 ♂ +, Brasilien ES, +Tirol +, + +600 m + +, 02/1999, +Thöny +, ex coll. +K. Martini +( +MWM +); +1 ♂ +, +Brasil +, Espirito Santo, +Santa Teresa +, + +650 m + +, + +February 1998 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, Brasil, Espirito Santo, +Santa Leopoldina +, + +700 m + +, + +January 1998 + +, leg. +H. Thöny +( +MWM +); +8 ♂♂ +, +Brasilien +, Mato Grosso, +Alto Paraguai +, ca. + +300 m + +, + +Feb. 1998 + +, leg. +H. Thöny +(GenPr- +Heterocera +MWM 28.565 +) ( +MWM +); +2 ♂♂ +, Brasilien, Espirito Santo, +Santa +Leopoldina, Biriricas +, ca. + +700 m + +, + +Februar 1998 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, Minas Gerais, +Poté +, + +500 m + +, + +15.xii.1996 + +– + +25.i.1997 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, Brasilien, Minas Gerais, +Poté +, ca. + +300 m + +, + +20.03.1994 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, Minas Gerais, +Poté +, ca. + +500 m + +, +März +1997, leg. +H. Thöny +( +MWM +); +1 ♀ +, Brasilien, Santa Catarina, + +S. +Bento do Sul + +, + +Sierra +Rio Natal + +, + +850 m + +, + +Januar 1999 + +, leg. +H. Thöny +(GenPr- +Heterocera +MWM 36.984 +) ( +MWM +); +1 ♂ +, +Argentina +, +Misiones +, +Iguazú +, + +Oct. 1928 + +, +Col. A. Breyer +( +MLP +); +1 ♂ +, +Argentina +, +Puerto Bemberg +, 1933, +Hayward Leg. +( +MLP +); +1 ♂ +, +Argentina +, +Dto. Candelaria +, +Leandro N. Alem +, + +Dic. 1954 + +, +Gaitopulo Leg. +( +MACN +); +1 ♂ +, +Argentina +, + +25 Sep. 1950 + +, +Orfila Leg. +( +IMZA +); +1 ♂ +, +Argentina +, +Parque Provincial Salto Encantado +, + +06−09 Nov. 2009 + +, +L. Aguado +leg. ( +FCP +); +1 ♂ +, +Bolivia +: +Chapare +, [sin fecha], + +400 m + +, +Zischka Leg. +( +MLP +); +1 ♂ +, +Paraguay +, +Puerto Primavera +, +Alto Paraguay +, + +02 Abr. 1960 + +( +IMZA +); +1 ♂ +, +Paraguay +, +Dep. Alto Parana +, +Estancia Dimas, S +25°33′ / W 55°13′, + +21–23.ii.2012 + +, leg. +U. Drechsel +( +Genital +preparation № 2, coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, +Paraguay +, +Dep. Alto Parana +, +Estancia Dimas, S +25°33′ / W 55°13′, + +20.10.2011 + +, leg. +U. Drechsel +( +Genital +preparation № 120, coll. +Naydenov A.E. +) ( +RYB +); +2 ♂♂ +, +Paraguay +, +Dep. Amambay +, +Estancia Kai Rague, S +23°20′ / W 56°18′, + +23–27.xi.2013 + +, leg. +U. Drechsel +( +Genital +preparation № 3, № 6, coll. +Naydenov A.E. +) ( +RYB +); +1 ♂ +, +Paraguay +, +Dep. Kanindeyu Mbaracayu, S +24°08′ / W 55°31′, + +13–15.xi.2017 + +, leg. +U. Drechsel +( +Genital +preparation №110, coll. +Naydenov A.E. +) ( +RYB +). + + + + + +Redescription +. Male. Length of fore wing +25 mm +. Fore wing brown with “chess board” pattern of dark-brown spots of various shape and size throughout all wing, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. Hind wing light-brown with poorly developed pattern of brown spots discally and postdiscally, and series of semicircular dark-brown spots along outer edge, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus completely split by deep notch, uncus arms very far apart, relatively short, strongly sclerotized; gnathos arms very short, thin; valve narrow, costal and abdominal edges almost smooth, outer edge rounded; juxta large, scaphoid, with long spiky abdominal process; saccus long, thin, cylindrical; phallus slightly shorter than valve, vesica without cornuti. + +Female. Length of fore wing +28 mm +. Pattern analogous to that of male but slightly dimmer and blurrier. + +Female genitalia. Ovipositor short; papillae anales tapered, wide, densely covered with small spikes; anterior apophyses very short, greatly narrowing apically, posterior apophyses thicker and 3 times longer than anterior apophyses; ostium wide, cup-like, framed in strongly sclerotized W-shaped plate; ductus of bursae copulatrix short, wide; bursa copulatrix bag-like, without signa. + + + +Diagnosis +. The species clearly differs from the known species in its short arms of the uncus, very far apart from each other. From the known females, the new species differs in its W-shaped sclerite framing the ostium. + + + + +Distribution. +Bolivia +, +Brazil +, +Argentina +, +Paraguay +. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA9EE25C29FE927FADAF82D.xml b/data/03/BD/CC/03BDCC27FFA9EE25C29FE927FADAF82D.xml new file mode 100644 index 00000000000..01282d1720f --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA9EE25C29FE927FADAF82D.xml @@ -0,0 +1,236 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +9. + +Dolecta gertseni +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 13 +, +44 +, +66 +, +76 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +C7BEAF06-44E4-431F-BF68-DAD7BE4816B2 + + + + + +Material examined. + +Holotype +♂ +: +Ecuador +, +Morona Santiago prov. +, +San Carlos de Limon +, +3°11′32′′ S +/ +78°26′40′′ W +, + +24.11.2011 + +, H= + +937 m + +, leg. +V. Sinyaev +& +O. Romanov +(GenPr- Heterocera +MWM 28.593 +) ( +MWM +) + +; + +Paratypes +: +2 ♂♂ +, +Ecuador +, +Morona Santiago prov. +, +San Carlos de Limon +, +3°11′32′′ S +/ +78°26′40′′ W +, + +24.11.2011 + +; H= + +937 m + +, leg. +V. Sinyaev +& +O. Romanov +(GenPr-Heterocera +MWM 37.162 +) ( +MWM +) + +; + +2 ♂♂ +, +Peru +, prov. +Huánuco +, +Yuyapichis +, +Faz. Tropical, S +09°37′ / +74°56′ W +, + + +July +2013 + + +, 210 m, leg. +A. Eichinger +(GenPr-Heterocera +MWM 36.998 +) ( +MWM +) + +. + + + + +Description +. Male. Length of fore wing in +holotype +28 mm +. Fore wing very elongated, apically sharp, light-brown with expressed dark-brown pattern of small spots of various shape along costal edge, big spots in radial area (discally, postdiscally and submarginally), small semicircular spots along wing edge in medial and cubital areas, fringe mottled dark-brown at veins (in thick bundles) and light-brown between veins. Hind wing white with strongly drawn anal angle, brown stroke discally, semicircular spots along wing edge, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus split by deep and very wide notch, halves of uncus thin, long, slightly curved, apically sharp; gnathos arms very short, thin; valve relatively short, costal edge smooth, abdominal edge strongly curved in medium third, outer edge slightly curved along all length; juxta large, scaphoid, with very long spiky abdominal process; saccus very long, cylindrical, apically with deep notch; phallus longer than valve, long, thin, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. Externally, the new species is mostly similar to + +Dolecta gogoli +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, from which it differs by the drawn anal angle of the hind wing. From all the species of the genus it reliably differs in the male genital structure: + +- very long phallus (longer than valve); +- very long saccus. + + + +Distribution. +Ecuador +, +Peru +. + + + + +Etymology +. The new species is named after the Russian writer Alexander Ivanovich Gertsen. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFA9EE25C29FEDEEFA82FC3B.xml b/data/03/BD/CC/03BDCC27FFA9EE25C29FEDEEFA82FC3B.xml new file mode 100644 index 00000000000..596b76c9a50 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFA9EE25C29FEDEEFA82FC3B.xml @@ -0,0 +1,157 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +8. + +Dolecta esenini +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 12 +, +43 +, +66 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +B7F1B203-671F-470A-B79C-307263DA1F86 + + + + + +Material examined: + +Holotype +♂ +: +Guyane +Française +, + +Piste +de Kaw + +, pk 36 (Camp Patawa), + +14.vii.1998 + +, +H. de Toulgoët +& +J. Navatte +( +MNHN +). Slide: Paris/loan 11, + +16.01.2019 + +. + + + + + +Description +. Male. Length of fore wing +18 mm +. Fore wing brown with bright pattern of dark-brown spotd of various shape along costal edge of wing (basally, discally and postdiscally) and in postdiscal area between medial veins, poorly expressed reticulated pattern at anal angle, fringe mottled: dark-brown at veins (in thick bundles) and light-brown between veins. Hind wing dark-brown, without pattern, fringe brown unicolorous. + +Male genitalia. Uncus completely split by a deep notch, each half of uncus apically with dentate relatively long process; gnathos arms very short, thin; costal edge of valve smooth, abdominal edge slightly curved along all length, outer edge semicircular; juxta massive, scaphoid with heavily sharpened long needle-like abdominal process; saccus cylindrical, apically semicircular with notch; phallus short, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs from the known species of the genus in the following characters: + +- a small notch on the saccus apically, +- dentate long processes on the apices of the uncus. + + + +Distribution. +French Guiana +. + + + + +Etymology. +The new species is named after the Russian lyric poet Sergei Alexandrovich Esenin. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFAAEE26C29FEFCAFE09F86E.xml b/data/03/BD/CC/03BDCC27FFAAEE26C29FEFCAFE09F86E.xml new file mode 100644 index 00000000000..20e7ac19fda --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFAAEE26C29FEFCAFE09F86E.xml @@ -0,0 +1,257 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +14. + +Dolecta macrochir +Schaus, 1892 + + + + + + + +Figs 19−20 +, +49 +, +63 +, +67 + + +Schaus, 1892: 328 + + + +Type +locality: [ +Brazil +], +Rio Janeiro + +. + + +Type material ( +holotype +) in USNM. + + + + +Material examined. + +Holotype +♀ +: [ +Brazil +], +Rio Janeiro +( +Genitalia Slide By P. Gentili +, 1988, +USNM 85.175 +) ( +USNM +); +4 ♂♂ +, Brasilien, +Santa Catarina +, + +S. +Bento do Sul + +, + +Serra +Rio Natal + +, + +850 m + +, + +Nov 1998 + +, leg. +H. Thöny +(GenPr- Heterocera +MWM 28.615 +) ( +MWM +); +3 ♂♂ +, +Brasil +, +Parana +Curitiba, +Serra Do Mar +, +Estrada De Castelhanos +, + +30.xi.1997 + +, ca. + +500 m + +, leg. +H. Thöny +(GenPr- Heterocera +MWM 28.501 +) ( +MWM +); +2 ♂♂ +, Brasilien, +Santa Catarina +, + +S. +Bento do Sul + +, + +Serra +Rio Natal + +, + +850 m + +, + +Januar 1999 + +, leg. +H. Thöny +( +MWM +); +3 ♂♂ +, +Brasilien +, +Espirito Santo +, +Santa +Leopoldina, Dorf Tirol +, ca. + +700 m + +, 40º50′′ W / 24º75′′S, + +Okt. 1999 + +, leg. +H. Thöny +( +MWM +). + + + + + +Redescription +. Male. Length of fore wing +19 mm +. Fore wing light-brown with “chess board” darkbrown and yellow pattern of spots of various size and shape and undulated stripes, fringe mottled brown at veins (in thick bundles), yellow between veins. Hind wing light-yellow with poorly expressed transverse light-brown band postdiscally (at radial veins), series of brown semicircular spots along wing edge, fringe mottled brown at veins (in thick bundles), yellow between veins. + +Male genitalia. Uncus split to base by deep notch, halves of uncus leaf-like, wide; gnathos arms very short, thin; valve with small notch on border between basal and medium thirds of costal edge, small bump in distal third of costal edge, abdominal edge heavily curved on border between basal and medium thirds, outer edge semicircular; juxta large, scaphoid with relatively short tapered abdominal process narrowing from base to apex; saccus short, tapered, apically sharp; phallus short, slightly curved, 1/3 shorter than valve, vesica without cornuti. + +Female. Length of fore wing +22 mm +. Fore wing analogous to that of male but slightly darker and more contrast. Hind wing light-brown with blurred mottled dark-brown pattern. + +Female genitalia. Ovipositor short; papillae anales tapered, densely covered with small spikes; anterior and posterior apophyses very short, thick, posterior apophyses with paddle-likely widened apices, slightly longer than anterior apophyses; ostium wide, cup-like, framed with poorly sclerotized plate; ductus bursae copulatrix short, relatively wide, sclerotized; bursa copulatrix bag-like, without signa. + + + +Diagnosis +. The species clearly differs from other representatives of the genus in its significantly lighter color, the short tapered saccus which is sharp apically. From the known females of the genus + +Dolecta + +the species differs by the sclerotized ductus bursae copulatrix and by the paddle-likely widened apices of the posterior apophyses. + + + + +Distribution. +Brazil +. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFABEE26C29FEA6CFE41FD6C.xml b/data/03/BD/CC/03BDCC27FFABEE26C29FEA6CFE41FD6C.xml new file mode 100644 index 00000000000..fd69aed3086 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFABEE26C29FEA6CFE41FD6C.xml @@ -0,0 +1,156 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +13. + +Dolecta lermontovi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 18 +, +48 +, +67 +, +77 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +3FFA334B-B8A2-47CD-B1A6-537051D79837 + + + + + +Material examined. + +Holotype +♂ +: +Colombia +, +Santander +, road Duitama- +Charala +6º03′38′′N +/ +73º12′53′′W +, H= + +2000 m + +, 11−14.03.16, leg. +Victor Sinyaev +& +Machado +(GenPr- Heterocera +MWM 37.001 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +13 mm +. Fore wing short, wide, brown, with dense reticulated pattern of brown undulated lines throughout all wing, fringe mottled: dark-brown at veins (in thick bundles), brown between veins. Hind wing dark-brown with poorly noticeable reticulated pattern, fringe mottled, brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus split to base by deep notch, uncus halves leaf-like, wide; gnathos arms very short, thin; valve short, costal and abdominal edges practically smooth, very long process of distal end of costal edge; juxta large, scaphoid abdominal process almost reduced; saccus poorly expressed, semicircular; phallus thick, slightly shorter than valve, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs from all known species of the genus by the very long process on the distal end of the costal edge of the valve. + + + + +Distribution. +Colombia +. + + + + +Etymology. +The new species is named after the Russian Romantic writer, poet and painter Mikhail Yuryevich Lermontov. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFABEE27C29FE949FE52F902.xml b/data/03/BD/CC/03BDCC27FFABEE27C29FE949FE52F902.xml new file mode 100644 index 00000000000..ae92533bda9 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFABEE27C29FE949FE52F902.xml @@ -0,0 +1,163 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +12. + +Dolecta karamzini +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 17 +, +47 +, +67 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +66668E5A-D9A0-47E2-947F-D64F62212CCD + + + + + +Material examined: + +Holotype +♂ +: +S. America +, +Peru +, +San Martin +reg. +San Martin prov. +, 06.61819º / S +076.18108º W +, H= + +260m + +, + +VII/2017 + +, +A. Kozlov +& +Yu. Kovaleva +leg. ( +Genital +preparation № 71 coll. +Naydenov A.E. +) ( +ZISP +). + + + + + +Description +. Male. Length of fore wing +27 mm +. Fore wing very narrow, long, apically sharp, brown, with dense pattern of dark-brown spots of various shape and size throughout all wing. Hind wing narrow, outer angle sharp, dark-brown basally and discally, slightly lighter distally. + +Male genitalia. Uncus relatively short, completely split, halves sharp, strongly diverged to sides; gnathos arms very short, thin; valve with small semicircular notch in medium third of costal edge, costal edge slightly curved along all length, outer edge semicircular; juxta large, scaphoid, with long spiky abdominal process; saccus short, apically blunt; phallus slightly shorter than valve, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs externally in its very narrow wings and the sharp outer angle of the hind wing. In morphology, the main diagnostic feature is the apically blunt saccus. + + + + +Distribution. +Peru +( +San Martin prov. +). + + + + +Etymology. +The new species is named after the Russian writer, poet, historian and critic Nikolay Mikhailovich Karamzin. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFACEE20C29FEDEEFD45FC87.xml b/data/03/BD/CC/03BDCC27FFACEE20C29FEDEEFD45FC87.xml new file mode 100644 index 00000000000..435fe7e7bb3 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFACEE20C29FEDEEFD45FC87.xml @@ -0,0 +1,154 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +6. + +Dolecta dostoevskyi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 10 +, 41, 66 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +C7198FBF-409A-48E8-AEDA-0ABCCE789249 + + + + + +Material examined. + +Holotype +♂ +: +Venezuela +, +Bolivar +, +Gran Sabana +, +Sierra Pacaraima +, +Rio Surukun +, +4°36.60′ N +/ +61°25.77′ W +, ca. + +950m + +, 21−23.08.08, leg. +F. & Th. Greifenstein +(GenPr- Heterocera +MWM 28.498 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +16 mm +. Fore wing relatively short, semicircular, light-brown with dense reticulated pattern of dark-brown undulated lines throughout all wing. Hind wing grey with poorly expressed reticulated pattern of dark-brown undulated lines throughout all wing, fringe brown unicolorous. + +Male genitalia. Uncus large, completely split into two parts by deep bifurcation; gnathos arms very short, thin; valve very short, with smooth costal and abdominal edges, wide semicircular outer edge; juxta robust, scaphoid with long spiky abdominal process; saccus cylindrical, apically semicircular; phallus equal to valve in length. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs from the other known species by its very short valve with smooth edges. + + + + +Distribution. +Venezuela +. + + + + +Etymology. +The new species is named after the Russian novelist, short story writer, essayist and journalist Fyodor Mikhailovich Dostoevsky. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFACEE20C29FEEE3FE09F84F.xml b/data/03/BD/CC/03BDCC27FFACEE20C29FEEE3FE09F84F.xml new file mode 100644 index 00000000000..202e24bcd88 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFACEE20C29FEEE3FE09F84F.xml @@ -0,0 +1,345 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +7. + +Dolecta egipan +( +Dognin, 1923 +) + +comb. n. + + + + + + +Figs 11 +, +42 +, +66 + + + + + + + +Givira egipan +Dognin, 1923: 30−31 + + + + + + + + +Type +locality: +Brasil + +. + + +Type material ( +holotype +) in USNM, examined. + + +Material examined. + +Holotype +♂ +: +Brasil +, + +apr 1924 + +, ( +Genitalia Slide By P. Gentili +, 1988, +USNM 85.174 +) ( +USNM +); +15 ♂♂ +, +Brasilien +, +Santa Catarina +, + +S. +Bento do Sul + +, + +Serra +Rio Natal + +, + +850 m + +, + +Feb. 1999 + +, leg. +H. Thöny +( +MWM +); +2 ♂♂ +, +Brasilien +, +Mato Grosso +, +Alto Paraguai +, ca. + + +300 m + +. + +, + +Feb. 1998 + +, leg. +H. Thöny +( +MWM +); +3 ♂♂ +, +Brasilien +, Esp. Santo, +Santa +Leopoldina, Dorf Tirol +, + +700 m + +, +40°50′ W +/ 24°75′ S, 15.03− + +20.04.1997 + +, leg. +H. Thöny +( +MWM +); +3 ♂♂ +, +Brasilien +, Esp. Santo, Santa +Leopoldina, Dorf Tirol +, + + +700 m + +. + +, +40°50′ W +/ 24°75′ S, + +15.05.1997 + +, leg. +H. Thöny +(GenPr- +Heterocera +MWM 28.563 +) ( +MWM +); +1 ♂ +, +Brasilien +, +Espirito Santo +, +Santa +Leopoldina, Dorf Tirol +, + +700 m + +, + +Feb. 2000 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, +Espirito Santo +, +Santa +Leopoldina, Biriricas +, ca. + +700 m + +, + +Februar 1998 + +, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, +Esp. Santo +, +Santa +Leopoldina, Biriricas +, ca. + +700 m + +, 20.03−20.04.97, leg. +H. Thöny +( +MWM +); +1 ♂ +, +Brasilien +, +Esp. Santo +, +Santa +Leopoldina, Boquerao +, ca. + +600 m + +, + +Feb. 1998 + +, leg. +H. Thöny +( +MWM +). + + + + + +Redescription +. Male. Length of fore wing +22 mm +. Fore wing brown, with poorly developed reticulated pattern, especially in distal parts of wing, series of dark-brown spots along costal margin (at root, discal and postdiscal zones), along posterior edge and at bases of medial trunk veins, fringe mottled: dark-brown at veins (in thick bundles), light-brown between veins. Hind wing light-brown with heavily darkened anal edge, fringe brown unicolorous. + +Male genitalia. Uncus large, long, split up to half by a slit bifurcation; gnathos arms very short, thin; costal and abdominal edges of valve poorly curved along their length, outer edge wide, semicircular; juxta large, scaphoid with relatively short spiky abdominal process; saccus small, cylindrical, apically semicircular; phallus short, vesica without cornuti. +Female unknown. + + + +Diagnosis +. The main feature of + +D. egipan + +is the uncus split up to its half but not completely as in the other species of the genus + +Dolecta + +. + + + + +Distribution. +Brazil +. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB1EE3DC29FE918FE4FF8A8.xml b/data/03/BD/CC/03BDCC27FFB1EE3DC29FE918FE4FF8A8.xml new file mode 100644 index 00000000000..9633c2c67ab --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB1EE3DC29FE918FE4FF8A8.xml @@ -0,0 +1,193 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +16. + +Dolecta nekrasovi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 22 +, +51 +, +68 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +66663C48-BE8C-4582-B807-A07BADB722CC + + + + + +Material examined. + +Holotype +♂ +: +Venezuela +, +Carabobo +, + +Cordillera de la Costa + +, +Yurubi Nationalpark +, ca. + +1500 m + +, + +Serra +de Aroa + +, + +24 August 2005 + +, leg. +F. & Th. Greifenstein +(GenPr-Heterocera +MWM 37.163 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +17 mm +. Fore wing grey with dense dark-grey reticulated pattern throughout all wing, poorly expressed dark spots in root area and discally, fringe grey, unicolorous. Hind wing white with dense dark-grey reticulated pattern, more expressed postdiscally and submarginally, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus robust, distally split to middle by deep notch, halves of uncus strongly widened; gnathos arms very short, thin; costal edge of valve slightly curved, with tapered finger-like process apically, abdominal edge strongly curved, outer edge semicircular; juxta large, scaphoid, with long sharp subulate abdominal process; saccus tapered, long, apically slightly sharpened; phallus shorter than valve, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. Externally, the species is mostly close to + +D. morosa +( +Schaus, 1911 +) + +, + +D. ostrovskyi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, + +D. pushkini +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +and + +D. rubtsovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +from which clearly differs by the tapered finger-like process apically on the costal edge of the valve. + + + + +Distribution. +Venezuela +. + + + + +Etymology. +The new species is named after the Russian poet, writer, critic and publisher Nikolay Alexeyevich Nekrasov. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB1EE3DC29FEDEEFDC0FC1F.xml b/data/03/BD/CC/03BDCC27FFB1EE3DC29FEDEEFDC0FC1F.xml new file mode 100644 index 00000000000..04b523aa5bc --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB1EE3DC29FEDEEFDC0FC1F.xml @@ -0,0 +1,193 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +15. + +Dolecta morosa +( +Schaus, 1911 +) + +comb. n. + + + + + + +Figs 21 +, +50 +, +68 + + + + + + + +Givira morosa +Schaus, 1911: 630 + + + + + + + + +Type +locality: C.[osta] R.[ica], [ +Cartago Province +, Jiménez canton], +Juan Viñas +[ +9.902166°N +83.7423297°W +] + +. + + +Type material ( +holotype +) in USNM, examined. + + +Material examined. + +Holotype +♂ +: +Juan Vinas, C.R. +( +Genitalia Slide By P. Gentili +, +USNM 85.254 +) ( +USNM +). + + + + + +Redescription +. Male. Length of fore wing +16 mm +. Fore wing grey with dense reticulated black pattern throughout all wing, fringe mottled dark-grey at veins (in thick bundles), light-grey between veins. Hind wing white with dense reticulated grey pattern throughout all wing, fringe mottled grey at veins (in thick bundles), white between veins. + +Male genitalia. Uncus robust, distally split to middle by deep notch, halves of uncus strongly widened; gnathos arms very short, thin; costal edge of valve smooth, with small bumpy process distally, abdominal edge heavily curved evenly, outer edge semicircular; juxta large, scaphoid, with sharp abdominal process; saccus long, cylindrical, apically sharp; phallus short, strongly tapered distally, with small cuneal thickening apically, vesica without cornuti. +Female unknown. + + + +Diagnosis +. Externally, the species is mostly close to + +D. nekrasovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, + +D. ostrovskyi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, + +D. pushkini +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +and + +D. rubtsovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +From which it clearly differs by the small bumpy process on the distal end of the costal edge of the valve. + + + + +Distribution. +Costa Rica +. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB2EE31C29FE99FFCCAFEDB.xml b/data/03/BD/CC/03BDCC27FFB2EE31C29FE99FFCCAFEDB.xml new file mode 100644 index 00000000000..6416220ede8 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB2EE31C29FE99FFCCAFEDB.xml @@ -0,0 +1,209 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +20. + +Dolecta scariosa +Herrich-Schäffer, [1854] + + + + + + + +Figs 26−27 +, +55 +, +69 + +Herrich-Schäffer, [1854]: 58, fig. 148 + + +Type +locality [Rio Grande], +Southern +Brazil + +?. + + +Type material ( +holotype +) in MNHN, examined. + + + + +Material examined. + +Holotype +♂ +: [Rio Grande] ( +MNHN +); +1 ♂ +, Guyane française, +Route +de +Régina, PK +79, + +12.ii.1994 + +, +L. & A. Sénécaux +( +MNHN +); +2 ♂♂ +, +C. America +, +Panama +, +Chiriqui prov. +, +Gualaca distr. +, +Reserva +forestal +de Fortuna +, +8.743111 N +, +82.26275 W +, H= + +1107 m + +, + +19.vi.2017 + +, +A. Kozlov +& +Yu. Kovaleva +leg. ( +Genital +preparation № 69, № 75 coll. +Naydenov A.E. +) ( +RYB +). + + + + +Probably +, +1 ♂ +, +Bolivia +: +Chapare +, + +400 m + +[no date], Zischka Leg. ( +MLP +), belongs to this species, but the definition has not been checked on the genitals + +. + + + + +Redescription +. Male. Length of fore wing +18−20 mm +. Fore wing light- brown with black spots of various shape along costal edge, at root, discally and postdiscally, the alternation of black and brown elements makes a special “chess board” pattern, fringe mottled brown at veins (in thick bundles), light- brown between veins. Hind wing light-brown, series of round spots of various size postdiscally and marginally, fringe mottled brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus robust, split to half of its length, halves of uncus strongly diverged to sides, their apices with wide semi-oval notches; gnathos arms very short, thin; costal edge of valve practically smooth, abdominal edge heavily curved, outer edge semicircular; juxta robust, scaphoid, with relatively wide cylindrical abdominal process apically slightly sharpened; saccus relatively robust, cylindrical, apically slightly sharpened; phallus shorter than vale, vesica without cornuti. +Female unknown. + + + +Diagnosis +. The species differs in its halves of the uncus, strongly diverged to sides, with apices having wide semi-oval notches. + + + + +Distribution. +Panama +, +French Guiana +,? +Bolivia +. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB2EE3EC29FEC9BFAA3FB93.xml b/data/03/BD/CC/03BDCC27FFB2EE3EC29FEC9BFAA3FB93.xml new file mode 100644 index 00000000000..7be58d9264a --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB2EE3EC29FEC9BFAA3FB93.xml @@ -0,0 +1,161 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +19. + +Dolecta rubtsovi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 25 +, +54 +, +68 +, +80 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +4E749112-2393-4C4E-9F9E-8A68D2ED2097 + + + + + +Material examined. + +Holotype +♂ +: +Bolivia +, +Santa Cruz +, +Amboro Nat. Park +. +17°59′S +, +63°59′W +, 03− + +04.11.2010 + +, H= + +1900 m + +, leg. +Viktor Sinyaev +& +Oleg Romanov +(GenPr- Heterocera +MWM 37.166 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +20 mm +. Fore wing dark-grey with dense black reticulate pattern throughout all wing, black narrow transverse bands discally and postdiscally, poorly noticeable brown portions discally (in discal cell and at cubital veins), fringe dark-grey unicolorous. Hind wing light-grey with dense reticulated dark-grey pattern throughout all wing, fringe mottled dark-grey at veins (in thick bundles), light-grey between veins + +Male genitalia. Uncus robust, completely split by deep and wide notch; gnathos arms very short, thin; valve narrow, long, costal and abdominal edges heavily curved, valve apically elongated; juxta robust, scaphoid, with robust tapered abdominal process apically rounded; saccus very thin, apically semicircular; phallus more than twice shorter than valve, thin, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs from the known ones by its long, narrow, apically elongated valve with the heavily curved costal and abdominal edges. + + + + +Distribution. +Bolivia +. + + + + +Etymology. +The new species is named after the Russian poet Nikolay Mikhaylovich Rubtsov. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB3EE3EC29FE958FE70FE9C.xml b/data/03/BD/CC/03BDCC27FFB3EE3EC29FE958FE70FE9C.xml new file mode 100644 index 00000000000..1226b298131 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB3EE3EC29FE958FE70FE9C.xml @@ -0,0 +1,297 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +18. + +Dolecta pushkini +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 24 +, +53 +, +68 +, +79 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +5A2DCE99-5261-4BB9-A9CE-4F1D6D82F9EA + + + + + +Material examined. + +Holotype +♂ +: +Ecuador +, +Napo prov. +, +Cordillera Guacamayos +, +0°37′15"S +; +77°49′28"W +, + +11.11.2011 + +, H= + +2181m + +. +Leg. Viktor Sinyaev +& +Oleg Romanov +(GenPr-Heterocera +MWM 28.609 +) ( +MWM +) + +; + +Paratypes +: +2 ♂♂ +, +Colombia +, +Magdalena +, +Municipio de Minca +, +Vereda Bella Vista +, Hostal Palo Alto. +11º05′47′′N +/ +74º04′34′′W +, + +24−28.xi.2014 + +; H= + +1680 m + +, leg. +Sinyaev +, +Márquez +& +Machado +, [coll.] +Dr. R. Brechlin +( +GenPr-Heterocera +MWM 37.164 +) ( +MWM +) + +; + +1 ♂ +, +Colombia +, +Boyacá +, + +Vereda El Palmar + +, +Parque Nacional El Virolín. +6º02′28′′N +73º13′18′′W +, H= + +2114 m + +, + +25.11.2013 + +. leg +Victor Sinyaev +& +Mildred Márquez +( +Genital +preparation №73, coll. +Naydenov A.E. +) ( +RYB +) + +; + +1 ♂ +, +Colombia +(NE), +Norte de Santander +, road № 70, near +Alto El Pozo. +8˚03′19"N / 73˚02′13"W. + +21−24.vii.2017 + +; H= + +2250 m + +, leg. +Victor Sinyaev +( +Genital +preparation №76, coll. +Naydenov A.E. +) ( +RYB +) + +. + + + + +Description +. Male. Length of fore wing +16 mm +. Fore wing dark-grey with dense reticulated black pattern postdiscally and submarginally, basal and discal area heavily darkened, brown triangle portion postdiscally (at cubital veins), fringe grey unicolorous. Hind wing grey with dense black reticulated pattern throughout all wing, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus robust, completely split by deep notch, halves of uncus apically rounded, of equal width along all length; gnathos arms very short, thin; costal edge of valve heavily curved, apically with long sharp process, abdominal edge heavily curved; juxta robust, scaphoid, with long tapered abdominal process apically rounded; saccus long, tapered, with poorly rounded process; phallus short, heavily curved on border between proximal and medium thirds, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. Externally, the new species is mostly close to the species group of + +D. morosa +( +Schaus, 1911 +) + +, + +D. nekrasovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, + +D. ostrovskyi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +and + +D. rubtsovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +from which it differs by the brown triangle portion on the fore wing postdiscally (at cubital veins) and by the long sharp process on the costal edge of the valve apically. + + + + +Distribution. +Ecuador +, +Colombia +. + + + + +Etymology. +The new species is named after the Russian poet, playwright, and novelist Alexander Sergeyevich Pushkin. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB3EE3FC29FEDEEFB54FBDE.xml b/data/03/BD/CC/03BDCC27FFB3EE3FC29FEDEEFB54FBDE.xml new file mode 100644 index 00000000000..2694b217a98 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB3EE3FC29FEDEEFB54FBDE.xml @@ -0,0 +1,225 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +17. + +Dolecta ostrovskyi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 23 +, +52 +, +68 +, +78 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +6C007AC5-BF77-4AAE-B73B-51CFA354EF6F + + + + + +Material examined. + +Holotype +♂ +: +Ecuador +, +Esmeraldas +, +Alto Tambo +, +Chuchuvi +, +0°53′02.82′′ N +/ +78°31′01.15′′ W +, + + +Juni – August +2015 + + +, 780 m, leg. +H. Thöny +(GenPr- Heterocera +MWM 37.165 +) ( +MWM +) + +; + +Paratype +1 ♂ +: +Ecuador +, +El Oro prov. +, road +Piñas − Saracay +, +3°38′57′′ N +/ +79°45′17′′ W +, + + +5. Dec. +2012 + + +, 850 m, leg. +Sinyaev +& +Romanov +, +Expedition Ron Brechlin +(GenPr-Heterocera +MWM 28.648 +) ( +MWM +) + +. + + + + +Description +. Male. Length of fore wing +17 mm +. Fore wing dark-grey with dense black reticulated pattern postdiscally and submarginally, dark portions at root and discally, fringe grey unicolorous. Hind wing dark-grey with very dense reticulated pattern throughout all wing, fringe mottled dark-brown at veins (in thick bundles), light-brown between veins. + +Male genitalia. Uncus robust, distally split to middle by deep notch, halves of uncus strongly widened; gnathos arms very short, thin; costal edge of valve slightly curved, with tapered finger-like process in distal third, abdominal edge heavily curved, outer edge semicircular; juxta robust, scaphoid, with long subulate abdominal process; saccus relatively short, robust, cylindrical, apically semicircular; phallus shorter than valve, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. Externally, the species is mostly close to + +D. morosa +( +Schaus, 1911 +) + +, + +D. nekrasovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, + +D. pushkini +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +and + +D. rubtsovi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +from which it clearly differs by the darker color of the wings and by the tapered finger-like process ion the distal third on the costal edge of the valve. + + + + +Distribution. +Ecuador +. + + + + +Etymology. +The new species is named after the Russian playwright, generally considered the greatest representative of the Russian realistic period Alexander Nikolayevich Ostrovsky. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB9EE35C29FE927FAFCF82D.xml b/data/03/BD/CC/03BDCC27FFB9EE35C29FE927FAFCF82D.xml new file mode 100644 index 00000000000..76201d4cb14 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB9EE35C29FE927FAFCF82D.xml @@ -0,0 +1,213 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +23. + +Dolecta tolstoyi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 30−31 +, +58 +, +64 +, +69 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +F2A21D64-2B20-49AA-A8E8-BA5EB3370514 + + + + + +Material examined. + +Holotype +♂ +: +Brasilien +, +Santa Catarina +, + +S. +Bento do Sul + +, + +Serra +Rio Natal + +, + +850 m + +, + +Feb. 1999 + +, leg. +H. Thöny +(GenPr- Heterocera +MWM 28.534 +) ( +MWM +) + +; + +Paratype +1 ♀ +: +Brasilien +, +Santa Catarina +, + +S. +Bento do Sul + +, + +Serra +Rio Natal + +, + +850 m + +, + +April 1999 + +, leg. +H. Thöny +(GenPr- Heterocera +MWM 37.002 +) ( +MWM +) + +. + + + + +Description +. Male. Length of fore wing +15 mm +. Fore wing very narrow, dark-brown, with light-brown transverse bands (of thin undulated lines) discally, postdiscally and submarginally, fringe mottled brown at veins (in thick bundles), light-brown between veins. Hind wing white coal-black in middle, basally and distally, fringe black unicolorous. + +Male genitalia. Uncus robust, forked, halves diverged to sides at acute angle, apices uneven; gnathos arms very short, thin; costal and abdominal edges of valve practically smooth, outer edge semicircular, apex slightly extended; juxta robust, scaphoid, with relatively short abdominal process semicircular apically, saccus very long, fisiform, apically sharp; phallus short, basally swollen, vesica without cornuti. + +Female. Length of fore wing +15 mm +. Fore wing slightly wider than that of male, dark-brown, with pattern of light-brown thin undulated lines forming bands discally, postdiscally and submarginally, fringe mottled: brown at veins (in thick bundles), light-brown between veins. Hind wing dark-brown, without pattern, fringe unicolorous, dark-brown. + +Female genitalia. Ovipositor short; papillae anales semicircular, wide, densely covered with small spikes; anterior and posterior apophyses very short, thick, practically of equal length; ostium wide, cup-like, framed with poorly sclerotized plate; ductus of bursae copulatrix short, membranous, relatively wide; bursa copulatrix bag-like, without signa. + + + +Diagnosis +. Externally, the new species differs sharply from all the other species of the genus by its narrow fore wing. In this feature it is similar to + +D. turgenevi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, but differs in its bigger size and the very long fusiform saccus. + + + + +Distribution. +Brazil +, +Santa Catarina +. + + + + +Etymology. +The new species is named after the Russian writer Lev Nikolayevich Tolstoy. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFB9EE35C29FEDEEFAFEFC38.xml b/data/03/BD/CC/03BDCC27FFB9EE35C29FEDEEFAFEFC38.xml new file mode 100644 index 00000000000..f8850e421c5 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFB9EE35C29FEDEEFAFEFC38.xml @@ -0,0 +1,183 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +22. + +Dolecta stanyukovichi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 29 +, +57 +, +69 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +E3BC3DBC-7F8D-4224-B334-CA8D6A5CB9EE + + + + + +Material examined. + +Holotype +♂ +: +Brasilien +, +Mato Grosso +, +Alto Paraguai +, ca. + +300 m + +, + +Feb. 1998 + +, leg. +H. Thöny +(GenPr- Heterocera +MWM 28.525 +) ( +MWM +) + +; + +Paratype +1 ♂ +: +Brasilien +, +Espirito Santo +, +Santa +Leopoldina, Dorf Tirol +, ca. + +700 m + +, + +April 2000 + +, leg. +H. Thöny +( +MWM +) + +. + + + + +Description +. Male. Length of fore wing +23 mm +. Fore wing of coffee with milk colour, with dark-brown spots and portions along costal edge, basally and discally, blurred reticulated dark-brown pattern postdiscally and submarginally, fringe mottled brown at veins (in thick bundles), light-brown between veins. Hind wing of coffee with milk colour, poorly expressed brown portions throughout all wing, fringe light-brown, unicolorous. + +Male genitalia. Uncus robust, split into two halves by deep cut, halves of uncus diverged at acute angle, with small prongs on apices; gnathos arms very short, thin; costal and abdominal edges of valve heavily curved along all length, outer edge semicircular, apex extended finger-shaped; juxta robust, scaphoid, with robust tapered apically sharp abdominal process; saccus cylindrical, apically rounded; phallus shorter than valve, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The species differs from the other species of the genus by its relatively large size, the light colouring and the robust abdominal process of the juxta. + + + + +Distribution. +Brazil +, +Mato Grosso +and +Espirito Santo +. + + + + +Etymology. +The new species is named after the Russian writer of the XIX-th century, remembered today mostly for his stories of the Russian Imperial Navy Konstantin Mikhaylovich Stanyukovich. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFBAEE36C29FEDEEFAC3FCA5.xml b/data/03/BD/CC/03BDCC27FFBAEE36C29FEDEEFAC3FCA5.xml new file mode 100644 index 00000000000..cff833e35d8 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFBAEE36C29FEDEEFAC3FCA5.xml @@ -0,0 +1,149 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +24. + +Dolecta turgenevi +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 32 +, +59 +, +69 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +FEABB19E-489F-41CA-8A0C-9959AD5CDA57 + + + + + +Material examined. + +Holotype +♂ +: +Argentina +, +Iguazu +, 23−26.11.93, J.R. (GenPr-Heterocera +MWM 26.733 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +9.5 mm +. Fore wing very narrow, dark-brown, with light-brown transverse bands (of thin undulated lines) discally, postdiscally and submarginally, fringe mottled brown at veins (in thick bundles), light-brown between veins. Hind wing coal-black basally, light-grey on distal portions, fringe black unicolorous. + +Male genitalia. Uncus robust, forked, halves diverged to sides at acute angle, apices uneven; gnathos arms very short, thin; costal edge of valve practically smooth, small semicircular bump in medium third, abdominal edge slightly curved, outer edge semicircular; juxta robust, scaphoid with relatively short abdominal process, semicircular apically; saccus short, apically round; phallus short, vesica without cornuti. +Female unknown. + + + +Diagnosis +. The species is mostly close to + +D. tolstoyi +Naydenov, Yakovlev, Penco & Sinyaev + + +sp. nov. + +, from which it differs in the smaller size and the short saccus, apically semicircular. + + + + +Distribution. +Argentina +, Iguazu. + + + + +Etymology. +The new species is named after the Russian novelist, short story writer, poet, playwright, translator and popularizer of Russian literature in the West Ivan Sergeyevich Turgenev. + + + + \ No newline at end of file diff --git a/data/03/BD/CC/03BDCC27FFBDEE31C29FE86DFDCAF7F8.xml b/data/03/BD/CC/03BDCC27FFBDEE31C29FE86DFDCAF7F8.xml new file mode 100644 index 00000000000..7a42c485f24 --- /dev/null +++ b/data/03/BD/CC/03BDCC27FFBDEE31C29FE86DFDCAF7F8.xml @@ -0,0 +1,163 @@ + + + +New data on Neotropical Carpenter-Moths of Subfamily Hypoptinae Neumoegen & Dyar, 1894 (Lepidoptera: Cossidae). II. A review of the genus Dolecta Herrich-Schäffer, [1854], with description of seventeen new species + + + +Author + +Naydenov, Artem E. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul 656049, Russia. E-mail: colias 24 @ mail. ru; yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenin pr. 36, 634050 Tomsk, Russia. E-mail: yakovlev _ asu @ mail. ru + + + +Author + +Penco, Fernando C. +Fundación de Historia Natural “ Félix de Azara ”, Departamento de Ciencias Naturales y Antropología, Universidad Maimónides, Hidalgo 775 piso 7 (1405 BDB) Ciudad Autónoma de Buenos Aires, Argentina. E-mail: fernando _ penco @ hotmail. com + + + +Author + +Sinyaev, Victor V. +Autonomous non-profit organization “ Eco-design studio ”, Yuzhnoportovy proezd 15 - 174, Moscow, 115432, Russia. E-mail: fieldcollector @ inbox. ru * Corresponding author + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-11 + + +35 + + +82 +114 + + + + +http://dx.doi.org/10.37828/em.2020.35.7 + +journal article +10.37828/em.2020.35.7 +2336-9744 +13232251 +urn:lsid:zoobank.org:pub:4835F8BC-AE6C-47F1-A436-58A275EAC1E0 + + + + + + +21. + +Dolecta saltykovishchedrini +Naydenov, Yakovlev, Penco & Sinyaev + +sp. nov. + + + + + + +Figs 28 +, +56 +, +69 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +F68C2C20-D7B5-4962-88B6-DC0C9D4E715C + + + + + +Material examined. + +Holotype +♂ +: +Brasilien +, +Santa Catarina +, + +S. +Bento do Sul + +, + +Serra +Rio Natal + +, + +850 m + +, + +April 1999 + +, leg. +H. Thöny +(GenPr- Heterocera +MWM 28.521 +) ( +MWM +). + + + + + +Description +. Male. Length of fore wing +12.5 mm +. Fore wing brown, with poorly expressed dark-brown pattern: series of small round spots along costal edge, portions discally (at cubital veins) and postdiscally (at radial veins), fringe mottled brown at veins (in thick bundles), light-brown between veins. Hind wing dark-brown, without pattern. + +Male genitalia. Uncus relatively short, robust, split into two halves by deep notch; gnathos arms very short, thin; costal edge of valve almost smooth, abdominal edge slightly curved along all length, outer edge semicircular; juxta robust, scaphoid, with triangle apically sharp abdominal process; saccus tapered, evenly narrowing from base to apex, apically blunt; phallus basally thick, apically gradually narrowing, vesica without cornuti. +Female. Unknown. + + + +Diagnosis +. The new species clearly differs from the other species of the genus in its relatively small size, poorly modified pattern, the valve without processes and the relatively short uncus. + + + + +Distribution. +Brazil +, +Santa Catarina +. + + + + +Etymology. +The new species is named after the major Russian satirist of the XIX century Mikhail Yevgrafovich Saltykov-Shchedrin. + + + + \ No newline at end of file diff --git a/data/03/C9/87/03C987E0FF897221FF73F91C8C2D9EB4.xml b/data/03/C9/87/03C987E0FF897221FF73F91C8C2D9EB4.xml new file mode 100644 index 00000000000..760904aa709 --- /dev/null +++ b/data/03/C9/87/03C987E0FF897221FF73F91C8C2D9EB4.xml @@ -0,0 +1,344 @@ + + + +The global freshwater bivalve checklist’s extension: Freshwater occurrences and phylogenetic position of Galatea clams from West Africa (Venerida: Donacidae) + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Northern Arctic Federal University, Northern Dvina Emb. 17, 163002 Arkhangelsk, Russia + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Northern Arctic Federal University, Northern Dvina Emb. 17, 163002 Arkhangelsk, Russia + + + +Author + +Adesanya, Abiona J. +Department of Animal Physiology, Federal University of Agriculture, P. M. B 2240, Alabata Road, Abeokuta, Ogun State, Nigeria + + + +Author + +Bespalaya, Yulia V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Northern Arctic Federal University, Northern Dvina Emb. 17, 163002 Arkhangelsk, Russia + + + +Author + +Braun, Jean J. +Géosciences Environnement Toulouse UMR 5563 (Université de Toulouse, CNRS, IRD), 14 avenue Edouard Belin, 31400 Toulouse, France & Institut de Recherches Géologiques et Minières / Centre de Recherches Hydrologiques, BP 4110, Yaoundé, Cameroon & International Joint Laboratory DYCOFAC, IRGM-UY 1 - IRD, BP 1857, Yaoundé, Cameroon * Corresponding author: es. konopleva @ gmail. com + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Northern Arctic Federal University, Northern Dvina Emb. 17, 163002 Arkhangelsk, Russia + + + +Author + +Lyubas, Artem A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Northern Arctic Federal University, Northern Dvina Emb. 17, 163002 Arkhangelsk, Russia + + + +Author + +Pokrovsky, Oleg S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Géosciences Environnement Toulouse UMR 5563 (Université de Toulouse, CNRS, IRD), 14 avenue Edouard Belin, 31400 Toulouse, France + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia & Northern Arctic Federal University, Northern Dvina Emb. 17, 163002 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-25 + + +35 + + +144 +158 + + + + +http://dx.doi.org/10.37828/em.2020.35.12 + +journal article +10.37828/em.2020.35.12 +2336-9744 +13232508 + + + + + + + +Galatea schwabi +(Clench, 1929) + + + + + + + += + +Egeria schwabi +Clench (1929) + +: 122, pl. 1, figs. 1-2; +Purchon (1963) +: 251; Daget (1998): 227. = + +Egeria paradoxa hermaphrodita +Clench (1929) + +: 121 [non +Gmelin (1791) +: 3278]. + + + += + + +Galatea schwabi +Huber (2010) +: 692 + + +. + + + +Figs. 1-3 +, +Table 1 +. + + + + + +Type: +Holotype +MCZ 78.072 +[ +Museum of Comparative Zoology +, +Harvard University +, +Cambridge +, +Massachusetts +, +USA +]. + + + + +Type locality: “Lobetal, lower Sanaga River” [ +CAMEROON +: +Sanaga River +at +Lobetal +(lower reaches, slightly brackish section), +3.6322°N +, +9.7704°E +, altitude + +5-6 m +a.s.l. + +, +Littoral Province +] (Clench 1929) + +. + + + +Topotypes +examined: +CAMEROON +: +Sanaga River +near +Mouanko +(lower reaches, slightly brackish section), +3.6360°N +, +9.8100°E +, altitude + +5-6 m +a.s.l. + +, +Littoral Province +, + +19-21.iii.2019 + +, +5 specimens +[ +RMBH +biv800: 2 shells; 5 ethanol-preserved tissue snips], +Oleg Pokrovsky +leg. +The +topotypes +were collected +4 km +east (upstream) of the type locality + +. + + +Other material examined: + +CAMEROON +: +Sanaga River +at +Monatélé +(middle reaches, freshwater section), +4.2710°N +, +11.1990°E +, altitude + +380 m +a.s.l. + +, +Central Province +, + +19-21.iii.2019 + +, +2 specimens +[ +RMBH +biv801: 2 shells; one ethanol-preserved tissue snip], +Oleg Pokrovsky +leg. + + +Conchological re-description: Shell triangular, rather thick and strong. Specific trait is radial rays running from the umbones to the ventral margin, which can vary in number and width on both valves. These rays are purplish and impregnated into prismatic layer, visible also in the inner side of the shell, but mainly along the margin, especially in the ventral and anterior edges. Umbones high, almost in the center of the shell, eroded. Periostracum smooth, thin, have a propensity for scaling off. Nacre whitish, not shining; muscle scars and basal areas of pseudocardinal teeth can be tinted in purple. Young specimens with greenish yellow coloration, which turning to dark brown or black in adult individuals. Hinge plate strong and well-developed. The right valve with one median, dissected pseudocardinal tooth and short, flat lateral tooth; tubercular tooth-like structure is also above anterior muscle scar. The left valve with three pseudocardinal teeth, intermediate tooth usually smaller than the other two, and serves to articulate into hollow space of dissected teeth from the right valve. Umbo cavity very deep. Muscle attachment scars are well-developed, anterior scar oval-shaped, posterior scar more circular. + + +Figure 3. +Shells of + +Galatea schwabi + +from Sanaga River, Cameroon. ( +A -B +) Topotypes RMBH biv800, Mouanko (lower reaches, slightly brackish section). ( +C -D +) Specimens RMBH biv801, Monatélé (middle reaches, freshwater section). Red arrows show well-developed muscle attachment scars. Scale bar = 10 mm. (Photos: Artem A. Lyubas). + + + + +Figure 4. +Shells of + +Galatea paradoxa + +from freshwater section of Niger River, Nigeria (sample RMBH biv1086, Yenagoa). Scale bar = 10 mm. (Photos: Ilya V. Vikhrev). + + + +Habitats: This species inhabits freshwater and slightly brackish sections of a large river (see +Fig. 2 +for a freshwater section). Its +type +locality is situated approximately +20 km +upstream of the river mouth, “just beyond tide water” (Clench 1929) but we recorded + +Galatea schwabi + +from the middle reaches of the Sanaga +River +at altitude +380 m +a.s.l. The Edea Hydroelectric Power Station’s dam separates this part of its population from the downstream stock ( +Fig. 1 +). + + +Distribution: Sanaga River in +Cameroon +( +Fig. 1 +and +Table 2 +). + + +Comments: This species may represent a separate taxon or a local population of the widespread + +Galatea paradoxa + +. DNA sequences of + +Galatea paradoxa + +samples from +Ghana +and +Nigeria +are urgently needed to produce a final solution on the status of these taxa. + + + + \ No newline at end of file diff --git a/data/03/CB/F9/03CBF90BFF844B66C7B09C3717705DA8.xml b/data/03/CB/F9/03CBF90BFF844B66C7B09C3717705DA8.xml new file mode 100644 index 00000000000..13fdebf1866 --- /dev/null +++ b/data/03/CB/F9/03CBF90BFF844B66C7B09C3717705DA8.xml @@ -0,0 +1,239 @@ + + + +On the taxonomy of the Chelis glaphyra (Eversmann, 1843) species-group, with description of a new subspecies of Chelis gratiosa (Grum-Grshimailo, 1890) from Kyrgyzstan, brachipterous females of Chelis kashmirica (Ferguson, 1985) and Chelis golbecki (Dubatolov, 1996), and the checklist of the species-group (Lepidoptera: Erebidae: Arctiinae: Arctiini) + + + +Author + +Saldaitis, Aidas +Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. E-mail: saldrasa @ gmail. com & Corresponding author + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mails: monstruncusarctia @ gmail. com; volynkin _ a @ mail. ru & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +51 +62 + + + + +http://dx.doi.org/10.37828/em.2020.38.7 + +journal article +10.37828/em.2020.38.7 +2336-9744 +13232632 +urn:lsid:zoobank.org:pub:4B85DA98-957E-4788-BC8B-25526047DC8B + + + + + + +Chelis golbecki +( +Dubatolov, 1996 +) + +, + +comb. nov. + + + + + + +( +Figs 15, 16 +, +23 +, +27 +) + + + + + +Palearctia +( +Palearctia +) +golbecki + +Dubatolov, 1996 + + +; +Neue entomologische Nachrichten +, +37 +: 19, figs 10a 10b ( +Type +locality: +Kyrgyzstan +, +Kyrgyz Ala-too Range +] “Prov. Syr- +Darja +, Jug. Alexandrinum, Loc. Tshai-Sandyk”). + + + + +Material examined +. + +13 males +, +Kyrgyzstan +, +Kyrgyz Mts. +, +Tjuz-Ashuu Pass +, + +3300m + +, + +12–15.VII.2000 + +, +E. Rut'jan +leg. (MWM/ +ZSM +) + +; + +4 males +, +8 females +, the same locality and collector, + +3150–3300m + +, + +27.VII.2000 + +, gen. slide +Nos. +: +ZSM + + +Arct. +2019–912 (male) and +ZSM + + +Arct. +2019–913 (female) (prepared by +Volynkin +) (MWM/ +ZSM +) + +; + +1 male +, +Suusamyr valley +, +Ala-Bel +pass, + +10–20.VII.2002 + +, + +3300m + +(MWM/ +ZSM +) + +; + +2 males +, +1 female +, the same locality, + +3200m + +, + +20–30.VII.2002 + +(MWM/ +ZSM +) + +; + +1 male +, +Kyrgyzstan +, +Otmek +pass., + +3000– 3300m + +, + +5.VIII.1999 + +(MWM/ +ZSM +) + +. + + + + +Description of female genitalia +( +Fig. 27 +). Papillae anales wide, trapezoid with rounded corners, setose. Apophyses posteriores elongate, thin. Apophyses anteriores fully reduced. Postvaginal area of 8 +th +sternite sclerotized laterally, with short but broad medial pocket-like triangular incision. Ostium bursae broad, with membranous margins. Ductus bursae elongate, narrow, dorso-ventrally flattened, sclerotized, with membranous anterior end. Corpus bursae ovoid, membranous, with dense spinulose scobination at the base of appendix bursae and two medium sized rounded signa bursae covered in tiny denticles. Appendix bursae elongate, tubular, membranous, situated postero-ventrally, directed to the left side. + + + + +Distribution +. The species is known from Kyrgyz Ala-too ( +Dubatolov 1996 +) and Talas Ala-too Ranges in +Kyrgyzstan +. + + + + \ No newline at end of file diff --git a/data/03/CB/F9/03CBF90BFF8B4B67C7B09B2A122F5E52.xml b/data/03/CB/F9/03CBF90BFF8B4B67C7B09B2A122F5E52.xml new file mode 100644 index 00000000000..506f1f32d81 --- /dev/null +++ b/data/03/CB/F9/03CBF90BFF8B4B67C7B09B2A122F5E52.xml @@ -0,0 +1,294 @@ + + + +On the taxonomy of the Chelis glaphyra (Eversmann, 1843) species-group, with description of a new subspecies of Chelis gratiosa (Grum-Grshimailo, 1890) from Kyrgyzstan, brachipterous females of Chelis kashmirica (Ferguson, 1985) and Chelis golbecki (Dubatolov, 1996), and the checklist of the species-group (Lepidoptera: Erebidae: Arctiinae: Arctiini) + + + +Author + +Saldaitis, Aidas +Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. E-mail: saldrasa @ gmail. com & Corresponding author + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mails: monstruncusarctia @ gmail. com; volynkin _ a @ mail. ru & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +51 +62 + + + + +http://dx.doi.org/10.37828/em.2020.38.7 + +journal article +10.37828/em.2020.38.7 +2336-9744 +13232632 +urn:lsid:zoobank.org:pub:4B85DA98-957E-4788-BC8B-25526047DC8B + + + + + + +Chelis kashmirica +( +Ferguson, 1985 +) + +, +stat. & comb. nov. + + + + + +( +Figs 10–12 +, +21 +, +26 +) + + + + + +Palearctia kashmirica + +Ferguson, 1985 + + +, +Entomography +, +3 +: 222, figs 44, 101, 102 ( +Type +locality: [ +Pakistan +, +Azad Kashmir +] “ +Baltistan +”). + + + + +Figures 10–16. + +Chelis +spp. + +: adults. The specimens are deposited in MWM/ZSM. + + + + +Figures 17–20. + +Chelis gratiosa + +sspp.: adults. Depositories of the specimens: 17 in ASV/WIGJ; 18–20 in MWM/ZSM. + + + + +Figures 21–23. + +Chelis +spp. + +: adults. The specimens are deposited in MWM/ZSM. + + + + +Figures 24–28. + +Chelis +spp. + +: adults. Depositories of the specimens: 24 in ASV; 25–28 in MWM/ZSM. + + + + +Material examined +. + +26 males +, +2 females +, +Pakistan +, +Kashmir +, +Himalaya Mts. +, +Kashmir Deosai +pass., + +4250– 4800 m + +, + +5.VII.2000 + +, leg. +Z. Varga +& +G. Ronkay +, gen. slide +Nos. +: +ZSM + +Arct. 2019–915 (male), +ZSM +Arct. 2019–916 (female) (prepared by Volynkin) (MWM/ +ZSM +). + + + + +Diagnosis +. Male of the species is smaller than those of subspecies of + +Ch. gratiosa + +. In the male genital capsule of + +Ch. kashmirica + +, the uncus is narrower medially, the vinculum is rather V-shaped (while that of + +Ch. gratiosa + +is U-shaped), the juxta is conspicuously shorter and narrower, the valva is less elongate and the cucullus is noticeably smaller than those structures of + +Ch. gratiosa + +. The aedeagus of + +Ch. kashmirica + +is much shorter than in + +Ch. gratiosa + +. In the aedeagus vesica of + +Ch. kashmirica + +, the medial diverticulum is C-like curved (in + +Ch. gratiosa + +, it is globular), and the distal section is conspicuously shorter than that of + +Ch. gratiosa + +. Female of + +Ch. kashmirica + +is brachipterous and has very short and narrow wings with strongly elongate and pointed apex, while all the subspecies of + +Ch. gratiosa + +have normal winged females. In the externally similar + +Ch. golbecki + +, the both female wings are much longer and broader than those of + +Ch. kashmirica + +and the forewing apex is more rounded. The female genitalia of + +Ch. kashmirica + +differ from those of + +Ch. gratiosa + +by the much narrower posterior section of the corpus bursae and the conspicuously smaller signa bursae. + + + + +Figure 29. +Kyrgyzstan, Transalai Range, Aram-Kungei valley, the type locality of + +Chelis gratiosa kartashovi + +(photo by V. Kartashov). + + + + +Description of female +. +External morphology +( +Figs 11, 12 +). Forewing length +8 mm +. Antenna short, thick, shortly serrate whitish basally and medially and blackish apically. Body robust, brown. Forewing narrow, elongate, with nearly parallel costal and anal margins and pointed apex. Forewing ground color and cilia pale brown. Pattern reduced to two elongate blackish brown spots in the cell connected to each other by thin and diffuse line, longitudinal blackish stroke in subbasal area, intense brown suffusion along the anal margin, and two small diffuse dots in subterminal area. Hindwing pale brown with intense dark brown suffusion basally and along the anal margin, with three diffuse dark brown spots in terminal area. Cilia brown. +Female genitalia +( +Fig. 26 +). Papillae anales wide, trapezoid with rounded corners, setose. Apophyses posteriores elongate, narrow. Apophyses anteriores fully reduced. Postvaginal area of 8 +th +sternite sclerotized laterally, with narrow and short medial pocket-like incision. Ostium bursae broad. Ductus bursae long, narrow, dorso-ventrally flattened, narrowed subposteriorly and dilated around ostium, sclerotized medially and posteriorly and membranous anteriorly. Corpus bursae ovoid, membranous, with weak spinulose scobination at the base of appendix bursae and two smalls round signa bursae medially. Appendix bursae broadly conical, membranous, situated postero-ventrally, directed to the left side. + + + + +Distribution +. The species is known from +Pakistan +(Azad Kashmir) ( +Ferguson 1985 +) and North +India +( +Himachal Pradesh +) ( +Reich 1932 +, as + +Micrarctia glaphyra + +ab. +nebulosa +Reich, 1932 +). + + + + \ No newline at end of file diff --git a/data/03/CB/F9/03CBF90BFF8C4B68C7B098CD14265CBC.xml b/data/03/CB/F9/03CBF90BFF8C4B68C7B098CD14265CBC.xml new file mode 100644 index 00000000000..2305da61796 --- /dev/null +++ b/data/03/CB/F9/03CBF90BFF8C4B68C7B098CD14265CBC.xml @@ -0,0 +1,306 @@ + + + +On the taxonomy of the Chelis glaphyra (Eversmann, 1843) species-group, with description of a new subspecies of Chelis gratiosa (Grum-Grshimailo, 1890) from Kyrgyzstan, brachipterous females of Chelis kashmirica (Ferguson, 1985) and Chelis golbecki (Dubatolov, 1996), and the checklist of the species-group (Lepidoptera: Erebidae: Arctiinae: Arctiini) + + + +Author + +Saldaitis, Aidas +Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. E-mail: saldrasa @ gmail. com & Corresponding author + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mails: monstruncusarctia @ gmail. com; volynkin _ a @ mail. ru & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-01 + + +38 + + +51 +62 + + + + +http://dx.doi.org/10.37828/em.2020.38.7 + +journal article +10.37828/em.2020.38.7 +2336-9744 +13232632 +urn:lsid:zoobank.org:pub:4B85DA98-957E-4788-BC8B-25526047DC8B + + + + + + + +Chelis gratiosa kartashovi + +ssp. nov. + + + + + + +( +Figs 1–4 +, +9 +, +17 +, +24 +) + + + + +Type material +. + + +Holotype + +( +Figs 1 +, +17 +): male, [ +Kyrgyzstan +, +Transalai Range +] “KIRGIZIA S., Chon- Alai reg., Zaalaisky mountains range, Doroot-Korgon vill., Altyn-dara river, Aram-Kungei valley, H~ + +3600m + +, original female + +15.vii.2018 + +, ex. ovo + +14–18.v.2019 + +, leg. +V +. Kartashov”, gen. slide No.: AV5839 (Coll. +ASV +, designated to +WIGJ +). + + + + + +Paratypes + +: +9 males +, +13 females +, the same data as in the +holotype +, gen. slide No.: AV5840 (female) ( +Colls +ASV +, +VKV +and +WIGJ +) + +; + +1 female +, [ +Kyrgyzstan +, Transalai Range] +Kirgizia +, Zaalaisky Ran., +Chon-Alaisky Distr. +, Altyn-Dara Riv., Aram-Kungei Val., + +15–21.vii.2018 + +, H- + +3600m + +, +V +. +Kartashov +leg. + +(Coll. +SDM +). + + + + +Etymology. +The new subspecies is dedicated to prominent Russian +Lepidoptera +collector +Vladimir +Kartashov. + + + + +Diagnosis +. The new subspecies ( +Figs 1–4 +) is most similar externally to + +Ch. gratiosa rupicola + +( +Fig. 5 +) and also + +Ch. rasa + +( +Figs 13, 14 +, +22 +, +28 +) and + +Ch. golbecki + +( +Figs 15, 16 +, +23 +, +27 +), but is distinguishable by the pinkish suffusion on the thorax and the forewing (it is absent in the three similar taxa), and the intense blackish suffusion on hindwing making it almost uniformly dark with only a small pale spot in the subterminal or terminal area medially (whereas in the three similar taxa, the hindwing has intense blackish or dark brown suffusion in the subterminal area only, while the medial and basal areas are weakly suffused with blackish scales and the discal spot is present). Additionally, the new subspecies differs from + +Ch. rasa + +and + +Ch. golbecki + +by the longer rami of the male antenna, and from + +Ch. rasa + +by its less elongate forewing apex. The male genital capsule of +Ch. g. kartashovi +( +Fig. 17 +) is nearly identical to that of +Ch. g. rupicola +( +Fig. 18 +) and is also similar to those of + +Ch. g. gratiosa + +( +Fig. 20 +) and +Ch. g. flavala +( +Fig. 19 +), but differs from the two latter subspecies by its more rectangular cucullus. The aedeagus of +Ch. g. kartashovi +differs from those of the three similar subspecies by its markedly narrower dentate carinal plate. The vesicae of the four subspecies display no remarkable differences. As the female genitalia of +Ch. g. rupicola +and +Ch. g. flavala +are unknown therefore the female genitalia morphology of the new species ( +Fig. 24 +) is compared to that of + +Ch. g. gratiosa + +( +Fig. 25 +): +Ch. g. kartashovi +has a somewhat narrower ductus bursae and its appendix bursae is longer than that of the nominate subspecies. + + + + +Description +. +External morphology of adults +( +Figs 1–4 +, +9 +). Forewing length +11-12 mm +in males and +11-13 mm +in females. Male antenna shortly bipectinate, female antenna serrate. Sexual dimorphism limited: compared to males, females have forewing with more rounded apex and more reduced markings and dark suffusion on hindwing less intense. Head dark brown with admixture of pinkish scales. Collar dark brown with pinkish margin. Thorax blackish brown with two pinkish longitudinal stripes and pinkish margins of tegulae. Upperside of abdomen blackish brown with ochreous brown triangular spots laterally, underside ochreous brown; tip of abdomen densely covered in ochreous brown scales. Forewing ground color creamy with intense pinkish suffusion. Markings blackish brown. Subbasal spot asymmetrically V-shaped. Subbasal area with large elongate triangular spot. Antemedial line strongly angled medially, consisting of two large elliptical spots connected to each other by an oblique stroke and a costal dash. Postmedial line angled on the Cu vein dilated in the cell and at costa and fused with antemedial line at anal wing margin. Subterminal line interrupted, represented by four large triangular spots. Terminal area and anal margin blackish brown, inner edge of terminal area strongly zigzagged. Cilia pinkish brown. Hindwing with intense dark suffusion making it nearly uniformly blackish brown. Subterminal area with a small pale medial spot which may be protruding to the terminal area. Cilia brown. +Male genitalia +( +Fig. 17 +). Uncus large, broadly triangular with elongate and tapered distal part pointed apically. Tuba analis broad, membranous. Tegumen short, with thick and heavily sclerotized arms. Juxta large, X-shaped with wide arms, moderately sclerotized. Vinculum large, heavily sclerotized, U-shaped. Valva short, its basal and medial sections wide, cucullus ca. 3 times narrower than base of valva, rectangular with rounded corners. Sacculus narrow, heavily sclerotized. Aedeagus large, elongate, its distal half somewhat curved dorsad; dorsal carinal plate narrow, triangular, covered in tiny denticles. Vesica broad, C-like curved dorsad and anteriorly, with a small membranous subbasal diverticulum dorsally, four short granulated diverticula outwardly and globular membranous subapical diverticulum inwardly. +Female genitalia +( +Fig. 24 +). Papillae anales wide, rectangular with rounded corners, setose. Apophyses posteriores elongate, thin, with rounded tips. Apophyses anteriores fully reduced. Postvaginal area with narrow pocket-like incision medially. Ostium bursae broad. Ductus bursae long, dorso-ventrally flattened, somewhat tapered anteriorly, its posterior three fifth heavily sclerotized, while anterior two fifth weakly sclerotized. Corpus bursae broad, elliptical, membranous, with area of weak granulation posteriorly. Medial section of corpus bursae armed with two round signa bursae covered with tiny denticles. Appendix bursae elongate with broad basal section, scobinated basally and membranous distally, situated postero-ventrally, directed laterally to the right side. + + + + +Figures 1–8. + +Chelis +spp. + +: adults. Depositories of the specimens: 1, 3 in ASV; 2 in WIGJ; 4 in SDM; 5–8 in MWM/ZSM. + + + + +Figure 9. + +Chelis gratiosa kartashovi + +, paratypes. The specimens are deposited in VKV (photo by V. Kartashov). + + + + +Distribution and bionomics +. The new subspecies is known from Transalai Range in southern +Kyrgyzstan +. Single female was found siting on ground in an alpine grassland (at ca +3600 m +altitude) where the vegetation was damaged by grazing livestock. + + +Descriptions of brachipterous females + + + + \ No newline at end of file diff --git a/data/03/CD/D7/03CDD70DC360FFEBFF4FF99995D4FE49.xml b/data/03/CD/D7/03CDD70DC360FFEBFF4FF99995D4FE49.xml new file mode 100644 index 00000000000..b2be2a96673 --- /dev/null +++ b/data/03/CD/D7/03CDD70DC360FFEBFF4FF99995D4FE49.xml @@ -0,0 +1,238 @@ + + + +Witteulisna, a new genus for a new species from North Vietnam (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia + + + +Author + +. + + + +Author + +.,. + + + +Author + +Ht + + + +Author + +Inu + + + +Author + +Mwm + + + +Author + +Zsm + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-12 + + +38 + + +127 +130 + + + + +http://dx.doi.org/10.37828/em.2020.38.16 + +journal article +10.37828/em.2020.38.16 +2336-9744 +13232721 +urn:lsid:zoobank.org:pub:90A457F5-5F77-4766-A8D8-704CF08193E5 + + + + + + +Witteulisna +Volynkin + +, + +gen. nov. + + + + + + +Type +species: + +Witteulisna paraxena + + +sp. nov. + + + + + +Diagnosis +. The male of the new genus (Fig, 1) is similar externally to members of the + +Thysanoptyx brevimacula + +species-group ( +Fig. 2 +) and the + +Teulisna plagiata + +species-group ( +Fig. 3 +). The male genital capsule of + +Witteulisna + +( +Fig. 5 +) is reminiscent of that of the + +Thysanoptyx brevimacula + +species-group ( +Fig. 6 +) but is easily distinguishable by its wide, dorso-ventrally flattened uncus (that is thin in the + +Th. brevimacula + +species-group), the shorter vinculum and the much longer valva with a convex costal margin and a larger cucullus. Compared to + +Teulisna plagiata + +species-group ( +Fig. 7 +; also illustrated by +Holloway 2001 +), the male genital capsule of the new genus has a dorso-ventrally flattened uncus (it is long and thin in the + +T. plagiata + +species-group), a short and narrow vinculum lacking androconial glands (it is broad, trapezoid and bearing two androconial glands in the + +T. plagiata + +species-group), a convex costal margin of the valva, a larger cucullus, and the distally tapered and apically pointed distal saccular process (it is curved and somewhat dilated distally and densely covered with tiny spinules in the + +T. plagiata + +species-group). The main autapomorphic feature of the new genus is in the aedeagus structure: the aedeagus of + +Witteulisna + +is short and extremely broad, and its dorsal part bears a robust thorn-like carinal process directed distally and fused with the base of the vesica. The similar large process of the aedeagus is known in the externally dissimilar genus + +Microlithosia +Daniel, 1954 + +(the +type +species: + +Microlithosia shaowuica +Daniel, 1954 + +) ( +Figs 4 +, +8 +, also illustrated by +Bayarsaikhan & Bae 2018 +; Bayarsaikhan +et al. +2018), but in this genus the process is not fused with the vesica base and the aedeagus is much smaller than that of + +Witteulisna + +in comparison to the genital capsule. Additionally, the male genital capsule of + +Microlithosia + +differs from that of + +Witteulisna + +by the long and thin uncus and the presence of a medial saccular process. + + + + +Figures 1–4. +Lithosiina +spp.: adults. Depositories of the specimens: 1–3 in MWM/ZSM; 4 in INU (photo by U. Bayarsaikhan). + + + + +Description +. +External morphology of male +( +Fig. 1 +). Forewing length 12–12.5 mm. Antenna blackish, weakly ciliate. Head blackish with ochreous yellow frons. Thorax blackish, with ochreous collar; patagia ochreous yellow basally and blackish distally. Abdomen brown with admixture of ochreous scales. Forewing elongate and narrow, its anal margin convex medially and curved posteriad distally. Forewing ground color greyish brown. Costa ochreous yellow along the cell. Cell with long cluster of greyish androconial scales. Medial area with large square black spot with rounded corners encircled with yellow scales. Postmedial and terminal areas greyish brown with ochreous yellow costa. Cilia ochreous yellow. Hindwing greyish brown medially and distally and ochreous yellow basally. Cilia ochreous yellow. +Male genitalia +( +Fig. 5 +). Uncus broad, triangular with rounded tip, almost fully fused with tuba analis except of its tip. Tuba analis broad, membranous. Tegumen short, with narrow arms. Juxta trapezoid with two curved longitudinal crests and an apical protrusion with a small medial incision. Vinculum weakly sclerotized, Vshaped with rounded apex having shallow medial depression. Valva lobe-like, its costal margin convex medially. Cucullus large, tapered distally and rounded apically. Sacculus relatively narrow, with weakly setose dorsal margin. Distal saccular process short but robust, somewhat curved dorsad and pointed apically, does not reach the tip of cucullus. Aedeagus short and extremely broad. Its dorsal section with a rugose sclerotized plate ending with a very large thorn directed distally. Vesica narrow and elongate, with a globular scobinated diverticulum laterally and a sclerotized plate covered in short denticles apically. Vesica ejaculatorius originates from the base of vesica and directed latero-anteriorly. + + + +Figures 5–8. +Lithosiina +spp.: male genitalia. Depositories of the specimens: 5–7 in MWM/ZSM; 8 in INU (photo by U. Bayarsaikhan). + + +Female unknown. + + + +Etymology +. ‘ + +Witteulisna + +’ is a combination of the surname Witt and the genus group name + +Teulisna + +. The genus name is dedicated to the memory of Dr Thomas J. Witt, a famous lepidopterist and a founder of the Museum Witt Munich having one of the largest collections of Heterocera in the world. Gender feminine. + + + + \ No newline at end of file diff --git a/data/03/CD/D7/03CDD70DC363FFEBFF4FFDB493F8FC21.xml b/data/03/CD/D7/03CDD70DC363FFEBFF4FFDB493F8FC21.xml new file mode 100644 index 00000000000..5bdc5031845 --- /dev/null +++ b/data/03/CD/D7/03CDD70DC363FFEBFF4FFDB493F8FC21.xml @@ -0,0 +1,186 @@ + + + +Witteulisna, a new genus for a new species from North Vietnam (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia + + + +Author + +. + + + +Author + +.,. + + + +Author + +Ht + + + +Author + +Inu + + + +Author + +Mwm + + + +Author + +Zsm + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-12 + + +38 + + +127 +130 + + + + +http://dx.doi.org/10.37828/em.2020.38.16 + +journal article +10.37828/em.2020.38.16 +2336-9744 +13232721 +urn:lsid:zoobank.org:pub:90A457F5-5F77-4766-A8D8-704CF08193E5 + + + + + + +Witteulisna paraxena +Volynkin + +, + +sp. nov. + + + + + + +( +Figs 1 +, +5 +) + + + + +Type material +. + + +Holotype + +( +Figs 1 +, +5 +): male, “ +Vietnam +, Prov. Vinh Phu, +Tam Dao +, +60 km +NW +Hanoi +, + +950– 1200m + +, +23°34’N +, +105°20’O +[E], Juni [June], 1994, Sinajev [Sinyaev] & +Simonov +leg.”, gen. slide +No. +: MWM 35984 (prepared by +Volynkin +) (MWM/ +ZSM +). + + + + + +Paratypes + +: +4 males +, the same data as the holotype + +; + +1 male +, Tam Dao, +Tonkin +( +A. Duport +) (MWM/ +ZSM +) + +. + + + + +Diagnosis and description +: see under the genus. + + + + +Distribution +. The new species is only known from North +Vietnam +( +Vĩnh Phúc Province +). + + + + +Etymology +. ‘Paraxenos’ is a Latin transliteration of the Greek word ‘παράξενος’ meaning ‘strange’. The specific epithet refers to the peculiar structure of its aedeagus. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC02FFAA548EFBE2FF63FB56.xml b/data/03/D1/87/03D187FECC02FFAA548EFBE2FF63FB56.xml new file mode 100644 index 00000000000..4557a7c7173 --- /dev/null +++ b/data/03/D1/87/03D187FECC02FFAA548EFBE2FF63FB56.xml @@ -0,0 +1,132 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Mesosa myops +(Dalman, 1817) + + + + + + +Material. 2 +: +1 ex. +, +3-4.VII.1999 +, +1 ex. +, +25-30.VII.2001 +, D. Маlygin; +4 +: +1 ex. +, +10-17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +Poland +, +Sweden +, +Finland +, +Lithuania +, +Latvia +, +Belarus +, +Ukraine +, +Russia +, +Kazakhstan +, +Mongolia +, +China +, +Korea +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC02FFAA548EFCD3FE2CFBAA.xml b/data/03/D1/87/03D187FECC02FFAA548EFCD3FE2CFBAA.xml new file mode 100644 index 00000000000..c2586ceb730 --- /dev/null +++ b/data/03/D1/87/03D187FECC02FFAA548EFCD3FE2CFBAA.xml @@ -0,0 +1,119 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Cyrtoclytus capra +(Germar, 1824) + + + + + + +Material. 2 +: +1 ex. +, +25-30.VII.2001 +, D. Маlygin. + + + + +Distribution. +Europe, +Russia +, Azerbaijan, +Kazakhstan +, +Mongolia +, +China +, +Korea +. + + + +Lamiinae Latreille, 1825 + + + + +Mesosini Mulsant, 1839 + + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC02FFAA548EFE62FE14FD7A.xml b/data/03/D1/87/03D187FECC02FFAA548EFE62FE14FD7A.xml new file mode 100644 index 00000000000..105448e3f60 --- /dev/null +++ b/data/03/D1/87/03D187FECC02FFAA548EFE62FE14FD7A.xml @@ -0,0 +1,130 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Leptura duodecimguttata +Fabricius, 1801 + + + + + + +Material. 1 +: +2 ex. +, +7-16.VIII.2003 +, A. Nikiforov; +2 +: +1 ex. +, +25-30.VII.2001 +, D. Маlygin; +4 +: +1 ex. +, +10- 17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +Russia +(Asian part), +Kazakhstan +, +Mongolia +, +China +, +Japan +. + + + +Cerambycinae Latreille, 1802 + + + + +Clytini Mulsant, 1839 + + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC02FFAA548EFEFBFC09FE68.xml b/data/03/D1/87/03D187FECC02FFAA548EFEFBFC09FE68.xml new file mode 100644 index 00000000000..48f8c81aeff --- /dev/null +++ b/data/03/D1/87/03D187FECC02FFAA548EFEFBFC09FE68.xml @@ -0,0 +1,115 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Leptura annularis annularis +Fabricius, 1801 + + + + + + +Material. 2 +: +1 ex. +, +25-30.VII.2001 +, D. Маlygin; +7 +: +1 ex. +, +29.VII.2003 +, A. Nikiforov. + + + + +Distribution. +Europe, +Russia +, +Kazakhstan +, +Mongolia +, +China +, +Korea +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC02FFAA548EFF52FB9DFEE1.xml b/data/03/D1/87/03D187FECC02FFAA548EFF52FB9DFEE1.xml new file mode 100644 index 00000000000..79b97c5859d --- /dev/null +++ b/data/03/D1/87/03D187FECC02FFAA548EFF52FB9DFEE1.xml @@ -0,0 +1,134 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Leptura thoracica +Creutzer, 1799 + + + + + + +Material. 4 +: +1 ex. +, +10-17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +Slovenia +, +Croatia +, +Bosnia and Herzegovina +, +Serbia +, +Romania +, +Slovakia +, +Poland +, +Finland +, +Estonia +, +Lithuania +, +Latvia +, +Belarus +, +Ukraine +, +Russia +, +Kazakhstan +, +Mongolia +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC04FFAC548EF942FCBEF8D7.xml b/data/03/D1/87/03D187FECC04FFAC548EF942FCBEF8D7.xml new file mode 100644 index 00000000000..02ecc96a695 --- /dev/null +++ b/data/03/D1/87/03D187FECC04FFAC548EF942FCBEF8D7.xml @@ -0,0 +1,156 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Nivellia sanguinosa +(Gyllenhal, 1827) + + + + + + +Material. 1 +: +2 ex. +, +7-16.VIII.2003 +, A. Nikiforov; +2 +: +7 ex. +, +25-30.VII.2001 +, D. Маlygin; +3 +: +2 ex. +, +4- 13.VIII.2000 +, D. Маlygin; +5 +: +1 ex. +, +25-26.VIII.2019 +, N. Kochunova; +7 +: +4 ex. +, +29.VII.2003 +, A. Nikiforov. + + + + +Distribution. +Germany +, +Austria +, +Serbia +, +Romania +, +Slovakia +, +Poland +, +Norway +, +Sweden +, +Finland +, +Estonia +, +Belarus +, +Ukraine +, +Russia +, +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC04FFAC548EFB4CFDE1F9C5.xml b/data/03/D1/87/03D187FECC04FFAC548EFB4CFDE1F9C5.xml new file mode 100644 index 00000000000..b3973e72fd0 --- /dev/null +++ b/data/03/D1/87/03D187FECC04FFAC548EFB4CFDE1F9C5.xml @@ -0,0 +1,167 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Gnathacmaeops pratensis +(Laicharting, 1784) + + + + + + +Material. 4 +: +4 ex. +, +10-17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +Europe, +Russia +, Transcaucasia, +Kazakhstan +, +Uzbekistan +, +Kyrgyzstan +, +Mongolia +, +China +, +Korea +. + + +* + +Lepturini Latreille, 1802 + + + +* + + +Cornumutila +Letzner, 1844 + + + + +* + +Cornumutila quadrivittata +(Gebler, 1830) + + + += + +Cornumutila semenovi +Plavilshchikov, 1936 + +( +Plavilshchikov, 1936 +): 313 – +Bolshoy Shantar Island +: “…( +8 VIII 1925 +, Dulkeit! ZIN)...”; ( +Lazarev, 2019 +): 1238 – +Bolshoy Shantar Island +: “Original name. + +Cornumutila semenovi +Plavilshchikov, 1936 + +…”, “Valid name. +Cornumutila quadrivittata (Gebler, 1830) +.” + + +Distribution. +Russia +(Asian part), +Korea +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC04FFAC548EFB86FC25FBCF.xml b/data/03/D1/87/03D187FECC04FFAC548EFB86FC25FBCF.xml new file mode 100644 index 00000000000..1e03fcea4bf --- /dev/null +++ b/data/03/D1/87/03D187FECC04FFAC548EFB86FC25FBCF.xml @@ -0,0 +1,112 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Euracmaeop sangusticollis +(Gebler, 1833) + + + + + + +Material. 6 +: +1 ex. +, +11.VIII.2019 +, N. Kochunova. + + + + +Distribution. +Poland +, +Belarus +, +Russia +, +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC04FFAC548EFCF0FEB0FC44.xml b/data/03/D1/87/03D187FECC04FFAC548EFCF0FEB0FC44.xml new file mode 100644 index 00000000000..1a5b9a70ac1 --- /dev/null +++ b/data/03/D1/87/03D187FECC04FFAC548EFCF0FEB0FC44.xml @@ -0,0 +1,128 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Euracmaeops smaragdulus +(Fabricius, 1793) + + + + + + +Material. 1 +: +1 ex. +, +20-27.VI.2002 +, A. Nikiforov; +4 +: +4 ex. +, +10-17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +France +, +Switzerland +, +Norway +, +Sweden +, +Finland +, +Lithuania +, +Belarus +, +Russia +, +Kazakhstan +, +Mongolia +, +China +, +Korea +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC04FFAC548EFDEDFD62FD58.xml b/data/03/D1/87/03D187FECC04FFAC548EFDEDFD62FD58.xml new file mode 100644 index 00000000000..9e01e50e12b --- /dev/null +++ b/data/03/D1/87/03D187FECC04FFAC548EFDEDFD62FD58.xml @@ -0,0 +1,132 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Brachyta sachalinensis +Matsumura, 1911 + + + + + + +Material. 1 +: +5 ex. +, + +20-27. +VI +.2002 + +, A. Nikiforov; +2 +: +6 ex. +, +3-4.VII.1999 +, D. Маlygin; +3 +: +10 ex. +, + +21-26. +VI +.1999 + +, D. Маlygin; +7 +: +7 ex. +, +1-3.VII.2003 +, A. Nikiforov. + + + + +Distribution. +Russia +(Far East), +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC04FFAC548EFE26FE76FDF3.xml b/data/03/D1/87/03D187FECC04FFAC548EFE26FE76FDF3.xml new file mode 100644 index 00000000000..cbd437e2822 --- /dev/null +++ b/data/03/D1/87/03D187FECC04FFAC548EFE26FE76FDF3.xml @@ -0,0 +1,135 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Brachyta variabilis testaceimembris +Pic, 1916 + + + + + + +Material. 2 +: +3 ex. +, +3-4.VII.1999 +, +7 ex. +, +25-30.VII.2001 +, D. Маlygin; +3 +: +2 ex. +, + +21-26. +VI +.1999 + +, +7 ex. +, +4- 13.VIII.2000 +, D. Маlygin; +4 +: +3 ex. +, +10-17.VIII.2001 +, A. Timchuk; +5 +: +3 ex. +, +25-26.VIII.2019 +, N. Kochunova; +7: +8 ex. +, +29.VII.2003 +, A. Nikiforov. + + + + +Distribution. +Russia +(Far East). + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EF942FC5FF8D7.xml b/data/03/D1/87/03D187FECC05FFAD548EF942FC5FF8D7.xml new file mode 100644 index 00000000000..047ae641a67 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EF942FC5FF8D7.xml @@ -0,0 +1,148 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Oedecnema gebleri +Ganglbauer, 1889 + + + + + + +Material. 1 +: +2 ex. +, +7-16.VIII.2003 +, A. Nikiforov; +2 +: +7 ex. +, +25-30.VII.2001 +, D. Маlygin; +3 +: +1 ex. +, + +21- 26. +VI +.1999 + +, +8 ex. +, +4-13.VIII.2000 +, D. Маlygin; +5 +: +2 ex. +, +25-26.VIII.2019 +, N. Kochunova; +7 +: +2 ex. +, +1- 3.VII.2003 +, +3 ex. +, +29.VII.2003 +, A. Nikiforov. + + + + +Distribution. +Ukraine +, +Russia +, +Kazakhstan +, +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EF99FFBF8F9C5.xml b/data/03/D1/87/03D187FECC05FFAD548EF99FFBF8F9C5.xml new file mode 100644 index 00000000000..bc9d3d17742 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EF99FFBF8F9C5.xml @@ -0,0 +1,108 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Judolia dentatofasciata +Mannerheim, 1852 + + + + + + +Material. 6 +: +8 ex. +, +11.VIII.2019 +, N. Kochunova. + + + + +Distribution. +Russia +(north of European part, Asian part), +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFAA9FCB9FA3F.xml b/data/03/D1/87/03D187FECC05FFAD548EFAA9FCB9FA3F.xml new file mode 100644 index 00000000000..b2c08a1df88 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFAA9FCB9FA3F.xml @@ -0,0 +1,107 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Lepturobosca virens +(Linnaeus, 1758) + + + + + + +Material. 4 +: +1 ex. +, +10-17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +Europe, +Russia +, +Kazakhstan +, +Mongolia +, +China +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFBE2FB3AFB71.xml b/data/03/D1/87/03D187FECC05FFAD548EFBE2FB3AFB71.xml new file mode 100644 index 00000000000..be80c2ef03b --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFBE2FB3AFB71.xml @@ -0,0 +1,108 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Anastrangalia renardi +(Gebler, 1848) + + + + + + +Material. 1 +: +1 ex. +, +7-16.VIII.2003 +, A. Nikiforov. + + + + +Distribution. +Russia +(north of European part, Asian part), +Kazakhstan +, +Mongolia +, +China +, +Korea +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFC5AFB80FBEE.xml b/data/03/D1/87/03D187FECC05FFAD548EFC5AFB80FBEE.xml new file mode 100644 index 00000000000..50976724aa6 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFC5AFB80FBEE.xml @@ -0,0 +1,122 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Anastrangalia sequensi +(Reitter, 1898) + + + + + + +Material. 1 +: +1 ex. +, +7-16.VIII.2003 +, A. Nikiforov; +4 +: +2 ex. +, +10-17.VIII.2001 +, A. Timchuk; +6 +: +4 ex. +, +11.VIII.2019 +, N. Kochunova. + + + + +Distribution. +Russia +(Asian part), +Kazakhstan +, +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFD76FF5CFCFD.xml b/data/03/D1/87/03D187FECC05FFAD548EFD76FF5CFCFD.xml new file mode 100644 index 00000000000..974555334cb --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFD76FF5CFCFD.xml @@ -0,0 +1,122 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Stictoleptura variicornis +(Dalman, 1817) + + + + + + +Material. 2 +: +1 ex. +, +25-30.VII.2001 +, D. Маlygin. + + + + +Distribution. +Poland +, +Estonia +, +Lithuania +, +Latvia +, +Belarus +, +Ukraine +, +Russia +, +Kazakhstan +, +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFDCFFC16FD15.xml b/data/03/D1/87/03D187FECC05FFAD548EFDCFFC16FD15.xml new file mode 100644 index 00000000000..23230a712c3 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFDCFFC16FD15.xml @@ -0,0 +1,106 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Stictoleptura dichroa +(Blanchard, 1871) + + + + + + +Material. 4 +: +1 ex. +, +10-17.VIII.2001 +, A. Timchuk. + + + + +Distribution. +Russia +(Eastern Siberia, Far East), +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFE18FB91FE4E.xml b/data/03/D1/87/03D187FECC05FFAD548EFE18FB91FE4E.xml new file mode 100644 index 00000000000..cda810ba521 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFE18FB91FE4E.xml @@ -0,0 +1,108 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Anoplodera cyanea +(Gebler, 1832) + + + + + + +Material. 1 +: +1 ex. +, +7-16.VIII.2003 +, A. Nikiforov. + + + + +Distribution. +Russia +(Eastern Siberia, Far East), +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D1/87/03D187FECC05FFAD548EFF52FB80FE80.xml b/data/03/D1/87/03D187FECC05FFAD548EFF52FB80FE80.xml new file mode 100644 index 00000000000..ba9b2fe3918 --- /dev/null +++ b/data/03/D1/87/03D187FECC05FFAD548EFF52FB80FE80.xml @@ -0,0 +1,110 @@ + + + +Longicorn beetles (Coleoptera, Cerambycidae) of the Shantar Islands (Khabarovsk Krai, Russia) + + + +Author + +Anisimov, Nikolay S. +All-Russian Scientific Research Institute of Soybean, Ignatevskoye Shosse 19, Blagoveshchensk 675027 Russia. + + + +Author + +Bezborodov, Vitaly G. +Amur Branch of the Botanical Garden-Institute FEB RAS, Ignatevskoye Shosse 2 - d km, Blagoveshchensk 675000 Russia. * Corresponding Author: e-mail: havamal 1 @ mail. ru + + + +Author + +.,. + + + +Author + +., B + + + +Author + +., .. + + + +Author + +.,. + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-07 + + +34 + + +43 +48 + + + + +http://dx.doi.org/10.37828/em.2020.34.5 + +journal article +10.37828/em.2020.34.5 +2336-9744 +13232059 + + + + + + +Alosterna tabacicolor erythropus +(Gebler, 1841) + + + + + + +Material. 6 +: +6 ex. +, +11.VIII.2019 +, N. Kochunova. + + + + +Distribution. +Russia +(Asian part), +Kazakhstan +, +Mongolia +, +China +, +Korea +, +Japan +. + + + + \ No newline at end of file diff --git a/data/03/D9/87/03D9878D4010B852E1D5FDB98A191D3D.xml b/data/03/D9/87/03D9878D4010B852E1D5FDB98A191D3D.xml new file mode 100644 index 00000000000..8c9670c9a5a --- /dev/null +++ b/data/03/D9/87/03D9878D4010B852E1D5FDB98A191D3D.xml @@ -0,0 +1,378 @@ + + + +Miltochrista bachma, a new species from southern Vietnam (Lepidoptera, Erebidae, Arctiinae) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia & Corresponding author + + + +Author + +Derzhinsky, Yevgeniy A. +Vitebsk State University named after P. M. Masherov, Moskovskiy Av., 33, Vitebsk 210038 Belarus. E-mail: dernoctuid @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-22 + + +35 + + +123 +128 + + + + +http://dx.doi.org/10.37828/em.2020.35.9 + +journal article +10.37828/em.2020.35.9 +2336-9744 +13232397 +urn:lsid:zoobank.org:pub:080E40CD-453A-426C-9395-9246BC75C3C8 + + + + + + +Miltochrista bachma +Volynkin & Derzhinsky + +, + +sp. nov. + + + + + + +( +Figs 1–3 +, +9, 10 +, +15 +) + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +F29932B8-689F-4E13-83C1-77270A33B10E + + + + + +Type material. + + +Holotype + +( +Figs 1 +, +9 +): male, “S. [C] +Vietnam +, Bach- +Ma Nat. Park + +1200m + +, +16°10’N +107°54’E +, + +26.VII.–6.VIII.1996 + +, leg. +Sinjaev +[Sinyaev] & Afonin, ex coll. +A. Schintlmeister +” / “Slide +ZSM +Arct. 2019- +754♂ +A. Volynkin +” (Coll. MWM/ +ZSM +). + + + + + +Paratypes + +: +2 females +with the same data as for the holotype, slide +ZSM + +Arct. 2019-755 Volynkin (Coll. MWM/ +ZSM +); + +1 female +, + +3–7.IV.2014 + +, Central +Vietnam +, Thừa Thiên- Huế +Province +, +Annamite Mts +, Bạch +Mã National Park +, + +1400m + +, leg. local collector (Coll. +CAV +) + +; + +2 males +, +2 females +, + +13.VIII.2019 + +, +Central +Vietnam +, +Th +ừa Thiên- +Hu +ế +Province +, + +Annamite Mts +, B + +ạch +Mã National Park +, + +1250m + +, +16°11’34’’N +107°51’12’’E +, edge of tropical forest, +Ye.A. Derzhinsky +leg., slides AV5887 and AV5888 (males) +Volynkin +(Coll. +CAV +) + +. + + + + +Diagnosis +. The new species ( +Figs 1–3 +) is similar to + +M. testata + +( +Figs 4–6 +), but can be easily distinguished by its more shortly ciliate male antenna, slightly less elongate forewing apex, rose forewing coloration (in + +M. testata + +that is brick red in male and pale brick red in female), and pure rose male hindwing (in + +M. testata + +that is black with rose basal area and anal margin). The male genital capsule of the new species ( +Figs 9, 10 +) differs clearly from that of + +M. testata + +( +Figs 11, 12 +) by the evenly narrow uncus (in + +M. testata + +that is broadened subapically), the more heavily setose subscaphium, the shorter juxta lacking a basal medial concavity (that is present in + +M. testata + +), the broader and more rectangular vinculum (in + +M. testata + +that is narrower and U-shaped), the valva of uniform width (in + +M. testata + +that is broadened distally), the costa being narrower apically and not protruding to the distal lobe of valva, the conspicuously narrower distal lobe of valva (‘cucullus’), the slightly broader sacculus, and the slightly more robust and elongate distal saccular process. The aedeagus of the new species is conspicuously shorter and narrower than that of + +M. testata + +. The vesica of + +M. bachma + + +sp. nov. + +is conspicuously shorter and narrower than that of + +M. testata + +, has the broad and bilobate largest ventral diverticulum (in + +M. testata + +that is conical and strongly elongate), and the conspicuously smaller, hook-shaped distal cornutus (that is very large and straight in + +M. testata + +). The female genitalia of + +M. bachma + + +sp. nov. + +( +Fig. 15 +) differ from those of + +M. testata + +( +Fig. 16 +) by the calyculate ostium bursae with a heavily sclerotized margins (whereas in + +M. testata + +there is a large rectangular antrum), the shorter and narrower membranous anterior section of the ductus bursae, the narrower corpus bursae bearing the elliptical signum (in + +M. testata + +that is round and slightly larger) and lacking a sclerotized lateral plate with spines and a sclerotized dentate posterior plate (both are present in + +M. testata + +), and the much shorter and narrower appendix bursae. The male genital capsule of the new species is also reminiscent of that of the recently described + +M. lyclenoides + +( +Figs 7, 8 +, +13, 14 +), but differs by the juxta lacking a basal medial concavity, the valva being not broadened distally with the distal part of the costa not protruding to the distal lobe of valva. However, despite the similarity of the genital capsules, the male vesica structure and the female genitalia of the new species and + +M. lyclenoides + +are fundamentally different. + + + + +Description + + +External morphology of adults +( +Figs 1–3 +). Forewing length 8.5– +9 mm +in males and 9.5– +10 mm +in females. Male antenna ciliate, female antenna filiform. Sexual dimorphism weakly expressed: female slightly larger than male only. Head rose with a black dot on frons. Thorax rose with four black dots. Abdomen brown with admixture of rose scales. Forewing ground color rose, pattern black. Basal line represents two dots. Subbasal area with large subbasal dot and series of various sized short longitudinal strokes broadened distally. Subbasal part of costa edged with black. Antemedial line arcuate and W-like zigzagged medially. Medial line oblique, nearly straight. Postmedial line strongly loop-like curved around the cell and strongly regularly zigzagged on veins. Discal spot comma-like. Subterminal line parallel the postmedial line, strongly loop-like curved around the cell, interrupted into row of spots which are thin, stroke-like along the costa. Terminal line thin, entire. Cilia brown. Hindwing monotonous pale rose. +Male genitalia +( +Figs 9, 10 +). Uncus narrow, evenly curved, apically pointed. Tuba analis moderately broad; scaphium very weakly sclerotized, thin; subscaphium represents broad setose area. Tegumen moderately short and narrow. Transtillae fused, moderately broad. Juxta short, trapezoid, moderately sclerotized. Vinculum robust, rectangular with rounded corners. Valva elongate, relatively narrow, with nearly parallel margins. Costa narrow, slightly convex subapically, without processes. Distal lobe of valva elongate, distally narrowed, rounded apically. Sacculus moderately broad, distal saccular process strongly elongate, narrow but robust, slightly curved dorsally, with pointed tip. Aedeagus elongate, nearly straight, with slightly broadened proximal end. Vesica short, membranous, with one small subbasal diverticulum; large, nearly sack-like bilobate largest diverticulum situated medio-ventrally with the smaller lobe being granulated; and short round granulated distal diverticulum bearing short hook-like cornutus on broad base. Distal plate of vesica short and moderately broad. +Female genitalia +( +Fig. 15 +). Papilla analis broad, rectangular with rounded corners. Apophyses long and thin, equal in length. Ostium bursae moderately broad, its ventral margin edged with horseshoe-shaped sclerotized plate; dorsal part of subostial area of ductus bursae weakly granulated. Ductus bursae very short, narrow, membranous. Corpus bursae pear-shaped, membranous, with elliptical weakly dentate signum. Appendix bursae short, conical, membranous, situated posteriorly. + + + + +Figures 1–8. + +Miltochrista +spp. + +, adults. Depositories of the specimens: 1 and 3–6 in MWM/ZSM; 2 in CAV; 7 and 8 in CKC + + + + +Figures 9–12. + +Miltochrista +spp. + +, male genitalia. Depositories of the specimens: 9 and 11 in MWM/ZSM; 10 and 12 in CAV. + + + + +Figures 13–16. + +Miltochrista +spp. + +, male (13) and female (14–16) genitalia. Depositories of the specimens: 13 and 14 in CKC; 15 and 16 in MWM/ZSM. + + + + +Distribution +. The new species is known from its +type +locality, Bạch Mã National Park in central +Vietnam +only. + + + + +Etymology +. The specific epithet refers to the +type +locality. + + + + \ No newline at end of file diff --git a/data/03/DD/BE/03DDBE2194645130FF69FBC90D99F91B.xml b/data/03/DD/BE/03DDBE2194645130FF69FBC90D99F91B.xml new file mode 100644 index 00000000000..26743f0dadd --- /dev/null +++ b/data/03/DD/BE/03DDBE2194645130FF69FBC90D99F91B.xml @@ -0,0 +1,170 @@ + + + +A new genus of ultra-elongate freshwater mussels from Vietnam and eastern China (Bivalvia: Unionidae) + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +.,. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-04 + + +39 + + +1 +6 + + + + +http://dx.doi.org/10.37828/em.2021.39.1 + +journal article +10.37828/em.2021.39.1 +2336-9744 +13232789 +urn:lsid:zoobank.org:pub:DDA69FE1-8F86-483D-B824-E2D109A41936 + + + + + + +Genus + +Sinosolenaia + +gen. nov. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +F6329FCD-887E-4104-8ECA-0268B89A3E53 + + + + + +Type +species: + +Micetopus +[sic!] +recognitus +Heude, 1877 + +. + + +Etymology: The name of this genus is compiled using words “ +Sino +” (i.e. Chinese) and “ + +Solenaia + +” (the former generic name for this clade). + + +Differential diagnosis: The new genus can be distinguished from the sister taxon + +Solenaia + +by more elongated concentric ridges on shell surface, less developed umbo, and narrower hinge plate. + + +Description: This genus was found to be a separate clade within the tribe +Gonideini +. Its members share an ultra-elongate, thin shell, tapering anteriorly, with a narrow anterior margin. Posterior slope triangularly shaped, pointed at the end ventrally and posteriorly. Gonial ridge prominent. Umbo not prominent, with weak sculpture of waved, concentric ridges. Hinge plate narrow, with traces of lateral teeth. + + +Distribution: Red (Hồng Hà) River basin in northern +Vietnam +to the Yangtze River basin in eastern +China +. + + +Comments: This group appears to contain not less than four valid species, which are listed below. Among them, + +Sinosolenaia carinata +( +Heude, 1877 +) + + +comb. nov. + +can be distinguished from other species by having the narrowest, sometimes pointed anterior margin (vs. broader and rounded) ( +Fig. 1C +). The other three species can be joined into the + +Sinosolenaia iridinea + +species complex and could not clearly be separated based on morphological criteria ( +Fig. 1 +A-B). + + + + \ No newline at end of file diff --git a/data/03/DD/BE/03DDBE2194645130FF69FD5C0ED0FBF8.xml b/data/03/DD/BE/03DDBE2194645130FF69FD5C0ED0FBF8.xml new file mode 100644 index 00000000000..ad352671797 --- /dev/null +++ b/data/03/DD/BE/03DDBE2194645130FF69FD5C0ED0FBF8.xml @@ -0,0 +1,153 @@ + + + +A new genus of ultra-elongate freshwater mussels from Vietnam and eastern China (Bivalvia: Unionidae) + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +.,. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-04 + + +39 + + +1 +6 + + + + +http://dx.doi.org/10.37828/em.2021.39.1 + +journal article +10.37828/em.2021.39.1 +2336-9744 +13232789 +urn:lsid:zoobank.org:pub:DDA69FE1-8F86-483D-B824-E2D109A41936 + + + + + + +Genus + +Solenaia +Conrad, 1869 + + + + + + + + +Type species: + +Mycetopus emarginatus +Lea, 1860 + +[ +holotype +USNM 86787 +; deposited in the +National Museum of Natural History +, +Washington +, +USA +; type locality: “Siam”] (by original designation) + + + +Comments: + +Solenaia khwaenoiensis +Panha & +Deein, 2004 + +[ +holotype +PRDC +10001; deposited in the Museum of +Phitsanulok +Inland Fisheries Research and Development Center, +Phitsanulok +, +Thailand +; type locality: “Khwae Noi River at Ban Ta Ngam, Wat Bot District, +Phitsanulok Province +, +Thailand +”] was considered a synonym of + +S. emarginata +(Lea, 1860) + +( +Deein et al. 2004 +; +Pfeiffer et al. 2020 +). Hence, it is currently a monotypic genus. + + + + \ No newline at end of file diff --git a/data/03/DD/BE/03DDBE2194645133FF69F8A90DCBFE1C.xml b/data/03/DD/BE/03DDBE2194645133FF69F8A90DCBFE1C.xml new file mode 100644 index 00000000000..093fef1b42d --- /dev/null +++ b/data/03/DD/BE/03DDBE2194645133FF69F8A90DCBFE1C.xml @@ -0,0 +1,202 @@ + + + +A new genus of ultra-elongate freshwater mussels from Vietnam and eastern China (Bivalvia: Unionidae) + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +.,. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-04 + + +39 + + +1 +6 + + + + +http://dx.doi.org/10.37828/em.2021.39.1 + +journal article +10.37828/em.2021.39.1 +2336-9744 +13232789 +urn:lsid:zoobank.org:pub:DDA69FE1-8F86-483D-B824-E2D109A41936 + + + + + + + +Sinosolenaia recognita +( +Heude, 1877 +) + +gen. & comb. nov. + + + + + + += + +Micetopus +[sic!] +recognitus +Heude (1877) + +: pl. 22, fig. 47. + + + + + +Type: +Syntype +MNHN +MP 3423 +; labelled: “Ngan Noue, Chine”; deposited in the +Muséum National d'Histoire Naturelle +, +Paris +, +France + +. + + + +Type +locality: “La Hoai supérieure, département de Ing- tch'eou” [ +Upper Huai River +, +Yangtze River +basin, +Anhui Province +, +China +] ( +Heude 1877 +) + +. + + +Reference DNA sequence data: Mitogenome: not available; +COI +barcode: KY561639 ( +Bolotov et al. 2017 +: as + +Solenaia +sp. + +) and +MG +463092 ( +Huang et al. 2019 +: as + +Solenaia oleivora + +). + + +Distribution: Red (Hồng Hà) River basin in northern +Vietnam +to the Yangtze River basin in eastern +China +. + + +Comments: Two distant lineages of this species are known to occur in +East Asia +( +COI p +-distance = 2.9%), i.e. those from +Vietnam +( +Bolotov et al. 2017 +) and eastern +China +( +Huang et al. 2019 +; +Lopes-Lima et al. 2020 +). Based on conchological similarity of our sample from +Vietnam +with the nominal taxon + +recognitus +Heude, 1877 + +, we tentatively assign the latter name to this species. It shares a slightly broader anterior margin compared with other species in the genus ( +Fig. 1A +). + + + + \ No newline at end of file diff --git a/data/03/DD/BE/03DDBE2194675133FF69F9F20BE0F80C.xml b/data/03/DD/BE/03DDBE2194675133FF69F9F20BE0F80C.xml new file mode 100644 index 00000000000..943792a43dc --- /dev/null +++ b/data/03/DD/BE/03DDBE2194675133FF69F9F20BE0F80C.xml @@ -0,0 +1,192 @@ + + + +A new genus of ultra-elongate freshwater mussels from Vietnam and eastern China (Bivalvia: Unionidae) + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +.,. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-04 + + +39 + + +1 +6 + + + + +http://dx.doi.org/10.37828/em.2021.39.1 + +journal article +10.37828/em.2021.39.1 +2336-9744 +13232789 +urn:lsid:zoobank.org:pub:DDA69FE1-8F86-483D-B824-E2D109A41936 + + + + + + + +Sinosolenaia oleivora +( +Heude, 1877 +) + +comb. nov. + + + + + + += + +Mycetopus oleivorus +Heude (1877) + +: pl. 22, fig. 46 [adult specimen]; pl. 23, fig. 48 [juvenile specimen]. + + + + + +Type: +Syntype +MNHN +MP 3368 +; labelled: “Ngan Houe, Chine”; deposited in the +National Museum of Natural History +, +Washington +, +USA + +. + + + +Type +locality: “La Hoai supérieure, département de Ing- tch'eou” [ +Upper Huai River +, +Yangtze River +basin, +Anhui Province +, +China +] ( +Heude 1877 +) + +. + + +Reference DNA sequence data: Mitogenome: NC_022701 ( +Wu et al. 2019 +; +Froufe et al. 2020 +); +COI +barcode: +MG +742249, +MG +463090, +MG +463093, +MG +463095, +MG +463096, and KX822670 ( +Lopes-Lima et al. 2017 +; +Huang et al. 2019 +). + + +Distribution: Yangtze River basin in eastern +China +( +Huang et al. 2019 +). + + +Comments: This species was identified as + +Solenaia oleivora + +in earlier works ( +Lopes-Lima et al. 2017 +; +Huang et al. 2019 +; +Wu et al. 2019 +; +Froufe et al. 2020 +), and we agree with that solution. + + + + \ No newline at end of file diff --git a/data/03/DD/BE/03DDBE2194675133FF69FB8E0A5CF9D4.xml b/data/03/DD/BE/03DDBE2194675133FF69FB8E0A5CF9D4.xml new file mode 100644 index 00000000000..9fe04749a83 --- /dev/null +++ b/data/03/DD/BE/03DDBE2194675133FF69FB8E0A5CF9D4.xml @@ -0,0 +1,216 @@ + + + +A new genus of ultra-elongate freshwater mussels from Vietnam and eastern China (Bivalvia: Unionidae) + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +.,. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-04 + + +39 + + +1 +6 + + + + +http://dx.doi.org/10.37828/em.2021.39.1 + +journal article +10.37828/em.2021.39.1 +2336-9744 +13232789 +urn:lsid:zoobank.org:pub:DDA69FE1-8F86-483D-B824-E2D109A41936 + + + + + + + +Sinosolenaia iridinea +( +Heude, 1874 +) + +comb. nov. + + + + + + + += + + +Mycetopus iridineus +Heude (1874) +: 117 + + +. + + + + + + +Type: +Syntype +USNM 126494 +; labelled: “Ngan- hue, +China +”; deposited in the +National Museum of Natural History +, +Washington +, USA + +. + + + +Type +locality: “Rivieres de Tai- ping-fou et de Fou-tcheou-fou” [rivers near +Nanchang +and +Fuzhou +, +Yangtze River +basin, +Jiangxi Province +, +China +] ( +Heude 1874 +) + +. + + +Reference DNA sequence data: Mitogenome: +MT +477834 ( +Chen et al. 2020 +: as + +Solenaia oleivora + +); +COI +barcode: +MG +463089, +MG +463091, +MG +463094, and +MG +463097 ( +Huang et al. 2019 +: as + +Solenaia oleivora + +). + + +Distribution: Yangtze River basin in eastern +China +( +Huang et al. 2019 +). + + +Comments: The DNA sequences and a mitogenome of this species were published under the name + +Solenaia oleivora + +( +Huang et al. 2019 +; +Chen et al. 2020 +). Conversely, it is distant phylogenetically from + +Solenaia oleivora + +identified in several papers ( +Lopes-Lima et al. 2017 +; +Huang et al. 2019 +; +Wu et al. 2019 +; +Froufe et al. 2020 +). Here, we tentatively assign the available name + +iridineus +Heude, 1874 + +to this species. + + + + \ No newline at end of file diff --git a/data/03/DD/BE/03DDBE2194675133FF69FDAA0EFEFBF8.xml b/data/03/DD/BE/03DDBE2194675133FF69FDAA0EFEFBF8.xml new file mode 100644 index 00000000000..eedbf3e6b66 --- /dev/null +++ b/data/03/DD/BE/03DDBE2194675133FF69FDAA0EFEFBF8.xml @@ -0,0 +1,187 @@ + + + +A new genus of ultra-elongate freshwater mussels from Vietnam and eastern China (Bivalvia: Unionidae) + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Konopleva, Ekaterina S. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +Vikhrev, Ilya V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia * Corresponding author. E-mail: es. konopleva @ gmail. com + + + +Author + +.,. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-04 + + +39 + + +1 +6 + + + + +http://dx.doi.org/10.37828/em.2021.39.1 + +journal article +10.37828/em.2021.39.1 +2336-9744 +13232789 +urn:lsid:zoobank.org:pub:DDA69FE1-8F86-483D-B824-E2D109A41936 + + + + + + + +Sinosolenaia carinata +( +Heude, 1877 +) + +comb. nov. + + + + + + += + +Micetopus +[sic!] +carinatus +Heude (1877) + +: pl. 21, fig. 45. + + + + + +Type +: +Whereabouts +unknown; probably deposited in the +Muséum National d'Histoire Naturelle +, +Paris +, +France + +. + + + +Type +locality: “probablement des lacs de Mien- iang-tch'eou (Hou-pé); se trouve au Kiang- si, riviere de Foutch'eou?” [probably some lakes on a river near Fuzhou, south of +Nanchang +, +Yangtze River +basin, +Jiangxi Province +, +China +] ( +Heude 1877 +) + +. + + +Reference DNA sequence data: Mitogenome: NC_023250 ( +Wu et al. 2019 +; +Froufe et al. 2020 +); +COI +barcode: +MG +463087, +MG +463088, +MG +933744, +MG +742248, and KX822669 ( +Lopes-Lima et al. 2017 +; +Wu et al. 2018 +; +Huang et al. 2019 +). + + +Distribution: Yangtze River basin in eastern +China +( +Huang et al. 2019 +). + + +Comments: This species was unambiguously identified based on morphological features, i.e. the specific shell shape with very narrow, somewhat pointed anterior margin ( +Lopes-Lima et al. 2017 +; +Wu et al. 2018 +; +Huang et al. 2019 +). + + + + \ No newline at end of file diff --git a/data/03/EB/87/03EB87B6E118FFA2FF6FFEC61FA0FDC9.xml b/data/03/EB/87/03EB87B6E118FFA2FF6FFEC61FA0FDC9.xml new file mode 100644 index 00000000000..97a7bbbff08 --- /dev/null +++ b/data/03/EB/87/03EB87B6E118FFA2FF6FFEC61FA0FDC9.xml @@ -0,0 +1,355 @@ + + + +Asiodonus lobanovi Legalov & Reshetnikov, a new species of the tribe Hyperini (Coleoptera: Curculionidae) from Altai (Western Siberia) + + + +Author + +Legalov, Andrei A. +Institute of Systematics and Ecology of Animals, SB RAS, Frunze street 11, Novosibirsk, 630091, Russia. & Altai State University, Lenina 61, Barnaul, 656049, Russia. +fossilweevils@gmail.com + + + +Author + +Reshetnikov, Sergei V. +Kropotkina street 273, Novosibirsk, 630111, Russia. E-mail: reshetnikov-art @ yandex. ru Corresponding author. E-mail: fossilweevils @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +46 +52 + + + + +http://dx.doi.org/10.37828/em.2020.36.4 + +journal article +10.37828/em.2020.36.4 +2336-9744 +13232614 +urn:lsid:zoobank.org:pub:E4D2873B-F41C-41FE-887B-6AAFF02012FB + + + + + + +Asiodonus lobanovi +Legalov & Reshetnikov + +, +sp. nov. + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +8C00E428-64F3-4AA7-8656-CD2AA0990857 + + + + + +( +Figs. 1 +, +2 +) + + + + +Type material +: + +Holotype +, male ( +ISEA +), +RUSSIA +, +Altaiskii +krai, eastern part of +Tigiretsky mountain range +, headwaters of +Kytma river +, + +1900-2200 m + +, +50°49.5 'N +, +83°55.2' E +, + +4.VII.2019 + +, +A.A. Gurina +, +R +. +Yu. +and E. +R +. +Dudko + +. + +Paratypes +: +2 females +( +ISEA +), idem + +; + +1 male +( +ISEA +) + +, + +4 males +( +CSRN +) + +, + +1 female +( +ISEA +) + +, + +10 females +( +CSRN +), +Korgon mountain range +, watershed of +Kumir +and +Korgon +rivers, headwaters of +Antonov Korgon River +, + +27 km +SW Ust-Kumir + +, + +1900-2100 m + +, alpine meadow, +50°51.9 'N +, +84°00.2' E +, + +3-4.VII. 2019 + +, +A.A. Gurina +, +R + +. + +Yu. +and E. +R + +. + +Dudko +, S. +V + +. + +Reshetnikov + +. + + + + +Description +. + +Body black, with densely quite wide scales bifid at apex, with weak metallic pink lustre. Scape partially redbrown. + + +Figure 2 + +Asiodonus lobanovi + +sp. nov. +, aedeagus, paratype: a – doesal view, b – laretal view. + + + +Male: Rostrum quite long, weakly curved, without middle carina, sparsely punctate in basal and middle thirds, finely punctate at apex, 2.4-2.7 times as long as wide at apex, 2.5-3.0 times as long as wide in middle, 2.8-3.3 times as long as wide at base, 0.8-0.9 times as long as pronotum. Mandibles massive with two teeth on inner edge. Forehead weakly narrower than rostrum base width, flat, punctate. Eyes large, transversely oval, not protruding from contour of head. Temples short. Antennae inserted before apex of rostrum. Antennae long. Scapus long, not reaching eyes. Antennomeres 2 and 3 long conical. Antennomere 3 shorter and narrower than antennomere 2. Antennomeres 4 and 5 subconical. Antennomere 4 two times as short as antennomere 2. Antennomere 6 almost rounded. Antennomeres 7 and 8 almost conical. Antennomere 7 longer than antennomere 6. Antennomere 8 wider than antennomere 7. Club compact. Antennomere 9 shorter than antennomeres 7 and 8 combined. Antennomere 10 longer than antennomere 9. Antennomere 11 longer than antennomere 10. Pronotum 1.3-1.4 times as long as wide at apex, 0.8-0.9 times as long as wide in middle, 0.9-1.0 times as long as wide at base. Greatest width before apex. Disk densely punctate. Scutellum small, trapezoidal. Elytra oval, 2.1 times as long as wide at base, 1.6 times as long as wide in middle, 2.7-2.9 times as long as wide at apex, 2.8-3.2 times as long as pronotum. Humeri smoothed. Greatest width in middle. Interstriae quite wide, almost flat, finely punctate. Striae quite deep. Procoxal cavities rounded and contiguous. Precoxal portion of prosternum slightly shorter than postcoxal portion. Mesocoxal cavities narrowly separated. Metaventrite slightly shorter than abdominasl ventrite 1. Metanepisterna narrow, punctate. Abdomen weakly convex. Andominal ventrites 1 and 2 quite long, equal in length, fused, with slight depression in middle. Ventrite 1 subequal in length to metacoxal cavity. Ventrites 3 and 4 quite short, subequal in length. Ventrite 3 distinctly shorter than ventrite 2. Ventrite 5 long, as long as ventrites 4 and 5 combined. Pygidium completely covered by elytra. Legs long. Femora widened. Tibiae weakly biconcave, with apical comb of setae and mucro. Tarsi long. Tarsomeres 1-3 with pulvilli ventrally. Tarsomeres 1 and 2 wide-conical, flattened. Tarsomere 2 slightly shorter than tarsomere 1. Tarsomere 3 wide bilobed. Tarsomere 4 very short. Tarsomere 5 elongated. Claws long and free. Aedeagus distinctly pointed and curved ( +Fig. 3 +). Length of body: +6.8-7.1 mm +. Length of rostrum: +1.3-1.4 mm +. + +Female: Rostrum 2.5 times as long as wide at apex, 2.7-2.8 times as long as wide in middle, 2.6-2.7 times as long as wide at base, 0.8 times as long as pronotum. Pronotum 1.3 times as long as wide at apex, 0.8-1.0 times as long as wide in middle, 0.9 times as long as wide at base. Elytra wider, 1.9 times as long as wide at base, 15-1.6 times as long as wide in middle, 2.6-2.9 times as long as wide at apex, 3.1-3.4 times as long as pronotum. Abdomen convex. Ventrites 1 and 2 without depression in middle. + +Length of body: +7.5-7.8 mm +. Length of rostrum: +1.3-1.4 mm +. + + + + +Differential diagnosis +. The new species is similar to + +A +. +herteshensis + +from East Sayan Mountains but differs in the scapus not reaching eyes, wider elytral and pronotal scales bifid at apex, more elongated elytra, narrower rostrum, partially reddish-brown antennae, distinctly pointed and curved aedeagus. It differs from + +Asiodonus opanassenkoi +(Legalov, 1997) + +in the body covered with scales, larger body sizes, and long aedeagus with elongated apex. + + + + +Figure 3. +Distribution of + +Asiodonus +spp. + +: star – + +A +. +lobanovi + +sp. nov. +, rhombus – + +A +. herteshensis + +. + + + + +Figure 4. +Habitat of + +Asiodonus lobanovi + +sp. nov. + + + + +Figure 5. +Collection plant of + +Asiodonus lobanovi + +sp. nov. + + + + +Etymology +. The species is named in honor of the late Dr. A.L. Lobanov (Zoological Institute RAS, +Saint-Petersburg +, +Russia +). + + + + +Distribution +. The new species are described from the Korgon mountain range, +Altai +Mountains ( +Figure 3 +), while a species closely related to it lives on the Akademika Obrucheva Mts, East Sayan Mountains ( +Figure 3 +). + + + + +Remarks +. The new species occurs in mountain meadows ( +Figure 4 +) and was found on + +Hedysarum coronarium + +L. ( +Figure 5 +). + +Asiodonus opanassenkoi + +, + +Donus cupreus +(Legalov, 1997) + +, + +D +. +lepidus +(Capiomont, 1868) + +and + +Boreohypera kirejtshuki +Legalov, 2011 + +from +Hyperini +were collected together with the new species. + + + + \ No newline at end of file diff --git a/data/03/EC/01/03EC016B1170FFF70CB9FD954E17F9C9.xml b/data/03/EC/01/03EC016B1170FFF70CB9FD954E17F9C9.xml new file mode 100644 index 00000000000..808cbf0e834 --- /dev/null +++ b/data/03/EC/01/03EC016B1170FFF70CB9FD954E17F9C9.xml @@ -0,0 +1,134 @@ + + + +Two new species of Roepkiella Yakovlev & Witt, 2009 (Lepidoptera, Cossidae) from Indonesia and Thailand + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-10 + + +38 + + +102 +106 + + + + +http://dx.doi.org/10.37828/em.2020.38.12 + +journal article +10.37828/em.2020.38.12 +2336-9744 +13231852 +urn:lsid:zoobank.org:pub:05A73DF2-AC30-4CDD-A01E-E1999D5B1A3D + + + + + + + +Roepkiella korshunovi + +sp. nov. + + + + + + +Figs 5−6 +, +9 +. + + + + +Material examined +. + +Holotype +, male, +Thailand +, +Khon Kaen Prov. +, +Phu Wiang Wat, N +16.75.660 / E102.35.698, + +28.x.2011 + +(MWM, Slide Genitalpräparat Heterocera No 27.414) + +. + +Paratype +, male, +Thailand +, +Udon Thani Prov. +, +Ban Nong Phai, N +17.24.812 / E 102.89.700, + +20.x.2011 + +(MWM, Slide Genitalpräparat Heterocera No 27.413) + +. + + + + +Description +. Length of fore wing +13−15 mm +. Antenna simple, not pectinate. Tegulae light- brown, thorax dirty-white from above. Fore wing light-brown with rare pattern of strokes from base to postdiscal area, tow oblique black parallel bands (from costal edge to anal angle), postdiscal and submarginal area light-grey with dense pattern of strokes, small brown spots on outer edge at tops of veins, fringe mottled: dark at veins, light between veins. Hind wing dark-grey, without pattern, fringe grey unicolorous. + +Male genitalia. Uncus triangle, long, apex uncinately bent, strongly sclerotized; gnathos arms thick, short; gnathos of medium size; valve basally wide, gradually narrowing to apex, apex lanceolate, distal end of valve membranous, small double dentate process on costal edge of valve (at transition of sclerotized part to membranous one); transtilla processes strongly sclerotized, apically sharp, gradually narrowing from base to apex, almost straight; juxta scaphoid with strongly sclerotized short thick lateral processes; saccus semicircular, of medium size; phallus robust, almost straight, of even thickness along the entire length, vesical aperture in dorso-apical position, takes about ½ of phallus in length, vesica without cornuti. + + + +Diagnosis +. The new species differs from all the known species of the genus in the following characters: + +- two clearly expressed oblique parallel black bands on the fore wing (from the costal edge to the anal angle) - the double bump on the costal edge of the valve. + + + +Distribution +. North-Eastern +Thailand +( +Khon Kaen +and +Udon Thani +Provinces). + + + + +Etymology +. The new species is named after the well-known Russian entomologist Yury P. Korshunov (1933−2002), a prominent specialist in the fauna of +Lepidoptera +of the USSR and Siberia, who gave me numerous invaluable lessons in faunistics and taxonomy. + + + + \ No newline at end of file diff --git a/data/03/EC/01/03EC016B1172FFF70CB9FEE64CF0FD9E.xml b/data/03/EC/01/03EC016B1172FFF70CB9FEE64CF0FD9E.xml new file mode 100644 index 00000000000..67dbe610f4a --- /dev/null +++ b/data/03/EC/01/03EC016B1172FFF70CB9FEE64CF0FD9E.xml @@ -0,0 +1,264 @@ + + + +Two new species of Roepkiella Yakovlev & Witt, 2009 (Lepidoptera, Cossidae) from Indonesia and Thailand + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-10 + + +38 + + +102 +106 + + + + +http://dx.doi.org/10.37828/em.2020.38.12 + +journal article +10.37828/em.2020.38.12 +2336-9744 +13231852 +urn:lsid:zoobank.org:pub:05A73DF2-AC30-4CDD-A01E-E1999D5B1A3D + + + + + + + +Roepkiella jakli + +sp. nov. + + + + + + +Figs 1−2 +, +7 + + + + +Material examined +. + +Holotype +, male, +Indonesia +, +Sangir Isl. +, +Tahuna Distr. +, +Bukit Bembalut Hill +, + +600 m + +, + +14−21.xi.2009 + +, leg. + +St. +Jakl + +(MWM, Slide Genitalpräparat Heterocera No 27.411) + +. + +Paratypes +, +3 males +, same locality and data (MWM) + +. + + + + +Figures 1−6 +. Adult specimens (males) of + +Roepkiella + +: 1. + +R. jakli + + +sp. nov. + +, holotype (MWM); 2. + +R. jakli + + +sp. nov. + +, paratype (MWM); 3. + +R. celebensis +( +Roepke, 1957 +) + +, holotype (RMNH); 4. + +R. celebensis +( +Roepke, 1957 +) + +, Z. Sulawesi, Kulawi, 1º26′S / 120ºE, 7−8.ii.1995, 1000 m, Tarasov & Sinjaev leg. (MWM); 5. + +R. korshunovi + + +sp. nov. + +, holotype (MWM); 6. + +R. korshunovi + + +sp. nov. + +, paratype (MWM). + + + + +Description +. Length of fore wing +18−20 mm +. Antenna unipectinate, crest processes very short – about ½ of antenna rod diameter. Thorax covered with light-brown scales from above, medium part of thorax – with milky-white scales. Fore wing light-grey with dense pattern of thin transverse strokes and wavy lines, grey strokes along costal edge, light-brown portion discally (closer to hind edge, light portion in discal cell, brown portion postdiscally (medially), small brown spots at tops of veins on outer edge, fringe mottled: dark at veins, light between veins. Hind wing dark-grey, without pattern, fringe grey, unicolorous. + +Male genitalia. Uncus triangle, long, apex uncinately bent, strongly sclerotized; gnathos arms thick, of medium length; gnathos of medium size; valve basally wide, gradually narrowing to apex, apex lanceolate, distal end of valve membranous, small dentate process on costal edge of valve (at transition of sclerotized part to membranous one); transtilla processes strongly sclerotized, apically sharp, gradually narrowing from base to apex, slightly curved in medium third; juxta scaphoid with strongly sclerotized lateral processes of medium length; saccus semicircular, of medium size; phallus robust, almost straight, of even thickness along the entire length, vesical aperture in dorso-apical position, takes about ¼ of phallus in length, vesica without cornuti. + + + +Figures 7−9 +. Male genitalia of + +Roepkiella + +: 7. + +R. jakli + + +sp. nov. + +, holotype (Slide Genitalpräparat Heterocera No 27.411); 8. + +R. celebensis +( +Roepke, 1957 +) + +, Z. Sulawesi, Kulawi, 1º26′S / 120ºE, 7−8.ii.1995, 1000 m, Tarasov & Sinjaev leg. (Slide Genitalpräparat Heterocera No 27.410); 9. + +R. korshunovi + + +sp. nov. + +, holotype +( +Slide Genitalpräparat Heterocera No 27.414). + + + + +Diagnosis +. + +Concerning the distribution and morphology, the new species is mostly close to the endemic of +Sulawesi +– + +R. celebensis +( +Roepke, 1957 +) + +( +type +locality: N. +Celebes +[ +Indonesia +, N. +Sulawesi +]) ( +Figs 3−4 +, +8 +) from which it differs in a series of characters + +: + + +- the light-grey portion on the discal cell (in + +R. celebensis + +, the portion is brown); + + +- the dark pattern of strokes on the fore wing postdiscally (in + +R. celebensis + +, there are thin dark bands); + + +- the transtilla processes slightly curved in medium third (in + +R. celebensis + +, the processes are almost straight). + + + + +Distribution. +Sangir Island ( +North Sulawesi province +, +Indonesia +). + + + + +Etymology +. The new species is named after the well-known Czech entomologist Stanislav Jákl (Prague), the collector of the +type +series. + + + + \ No newline at end of file diff --git a/data/03/EC/87/03EC87DDFFCAFFA8449DFC47093458C6.xml b/data/03/EC/87/03EC87DDFFCAFFA8449DFC47093458C6.xml index 397d8995993..3d48f1f722a 100644 --- a/data/03/EC/87/03EC87DDFFCAFFA8449DFC47093458C6.xml +++ b/data/03/EC/87/03EC87DDFFCAFFA8449DFC47093458C6.xml @@ -1,50 +1,51 @@ - - - -A new species of the genus Parabitecta Hering, 1926 from Northern Vietnam and Southwestern China, with notes on the taxonomy of the genus Manulea Wallengren, 1872 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +A new species of the genus Parabitecta Hering, 1926 from Northern Vietnam and Southwestern China, with notes on the taxonomy of the genus Manulea Wallengren, 1872 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) - - -Author + + +Author -Volynkin, Anton V. -Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia - - -Author + + +Author -Saldaitis, Aidas -Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. & Corresponding author. E-mail: saldrasa @ gmail. com +Saldaitis, Aidas +Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. & Corresponding author. E-mail: saldrasa @ gmail. com -text - - -Ecologica Montenegrina +text + + +Ecologica Montenegrina - -2020 - -2020-12-10 + +2020 + +2020-12-10 - -38 + +38 - -107 -113 + +107 +113 - -http://dx.doi.org/10.37828/em.2020.38.13 + +http://dx.doi.org/10.37828/em.2020.38.13 -journal article -10.37828/em.2020.38.13 -2336-9744 -urn:lsid:zoobank.org:pub:6799E5E9-6EF0-46B2-A3D2-51301E101CE4 +journal article +10.37828/em.2020.38.13 +2336-9744 +13231767 +urn:lsid:zoobank.org:pub:6799E5E9-6EF0-46B2-A3D2-51301E101CE4 - + @@ -62,11 +63,11 @@ Volynkin & Saldaitis ( -Figs 1–3 +Figs 1–3 , -7, 8 +7, 8 , -11 +11 ) @@ -78,9 +79,9 @@ Volynkin & Saldaitis Holotype ( -Figs 1 +Figs 1 , -7 +7 ): male, “ Vietnam (N), @@ -112,7 +113,7 @@ MWM/ ). - + Figures 11–12 . diff --git a/data/03/EC/87/03EC87DDFFCBFFA8449DFC0209405C0D.xml b/data/03/EC/87/03EC87DDFFCBFFA8449DFC0209405C0D.xml index 3689c04f409..b1af9a36eb6 100644 --- a/data/03/EC/87/03EC87DDFFCBFFA8449DFC0209405C0D.xml +++ b/data/03/EC/87/03EC87DDFFCBFFA8449DFC0209405C0D.xml @@ -1,50 +1,51 @@ - - - -A new species of the genus Parabitecta Hering, 1926 from Northern Vietnam and Southwestern China, with notes on the taxonomy of the genus Manulea Wallengren, 1872 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +A new species of the genus Parabitecta Hering, 1926 from Northern Vietnam and Southwestern China, with notes on the taxonomy of the genus Manulea Wallengren, 1872 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) - - -Author + + +Author -Volynkin, Anton V. -Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia - - -Author + + +Author -Saldaitis, Aidas -Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. & Corresponding author. E-mail: saldrasa @ gmail. com +Saldaitis, Aidas +Nature Research Centre, Akademijos str., 2, LT- 08412, Vilnius- 21, Lithuania. & Corresponding author. E-mail: saldrasa @ gmail. com -text - - -Ecologica Montenegrina +text + + +Ecologica Montenegrina - -2020 - -2020-12-10 + +2020 + +2020-12-10 - -38 + +38 - -107 -113 + +107 +113 - -http://dx.doi.org/10.37828/em.2020.38.13 + +http://dx.doi.org/10.37828/em.2020.38.13 -journal article -10.37828/em.2020.38.13 -2336-9744 -urn:lsid:zoobank.org:pub:6799E5E9-6EF0-46B2-A3D2-51301E101CE4 +journal article +10.37828/em.2020.38.13 +2336-9744 +13231767 +urn:lsid:zoobank.org:pub:6799E5E9-6EF0-46B2-A3D2-51301E101CE4 - + @@ -58,11 +59,11 @@ Hering, 1926 ( -Figs 4–6 +Figs 4–6 , -9, 10 +9, 10 , -12 +12 ) @@ -94,9 +95,9 @@ locality: [ Holotype ( -Figs 4 +Figs 4 , -9 +9 ): male, [SW China , diff --git a/data/08/76/87/087687C68311FF84FF0E00B24AB3FE41.xml b/data/08/76/87/087687C68311FF84FF0E00B24AB3FE41.xml new file mode 100644 index 00000000000..9882b86bd6e --- /dev/null +++ b/data/08/76/87/087687C68311FF84FF0E00B24AB3FE41.xml @@ -0,0 +1,170 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + + +Hollowarbela kinabalua +( +Holloway, 1976 +) + +comb. nov. + + + + + + +Figs 11−12 +, +28 + + + + + +Indarbela kinabalua +Holloway, 1976 + +, Moths of Borneo with Special Reference to Mount Kinabalu: 88 + + + + +Type +locality: Borneo, Kinabalu. + + +Type material: +holotype +(male) in +NHMUK +. + + +Material examined +: + +2 males +, +Borneo +, +Sabah +, +Mt. Trus Madi +, 4− + +24.04.2002 + +, leg. +Martini +( +MWM +) + +; + +1 male +, +Nordborneo +, +Trus Madi +, + +1150 m + +, 9− + +14.04.1996 + +, leg. +Martini +( +MWM +) + +; + +1 male +, +1 male +, +Borneo +, +Sabah +, +Trus Madi +, + +1200 m + +, 4.2004, +Martini +( +MWM +) + +. + + +Habitat +. Montane forests between +1500−2000 m +( +Holloway 1986 +) ( +Fig. 30 +). + +The species probably has a daily activity, as the robust thorax allows a strong and complicated search flight. + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68311FF87FF0E05014C6CF953.xml b/data/08/76/87/087687C68311FF87FF0E05014C6CF953.xml new file mode 100644 index 00000000000..7051b88b5a5 --- /dev/null +++ b/data/08/76/87/087687C68311FF87FF0E05014C6CF953.xml @@ -0,0 +1,106 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Hollowarbela + +gen. nov. + + + + + + +Type +species (here designated): + +Indarbela kinabalua +Holloway, 1976 + +. + + + + +Description +. Medium sized, firmly built species with wide thorax. Antenna bipectinate, crest processes twice longer than antenna rod diameter in medium part. Antenna equal to ½ of fore wing costal edge length. Fore wing pale brown, narrow, with dense dotty dark-brown pattern, more developed at costal edge and cubitally, apex sharp. Hind wing light-brown, with poorly developed reticulated pattern throughout all wing. + +Male genitalia. Uncus large, long, slightly extending apically, apex rounded; tegumen of medium size; gnathos arms very short, not fused, gnathos reduced; costal edge of valve smooth, abdominal edge slightly curved in medium third, strongly sclerotized, small dentate process on border between proximal and medium third of abdominal edge, outer edge of valve semicircular; juxta small, with small slightly curved lateral processes. Phallus simple, tabulate, vesica without cornuti. +Female unknown. + + + +Diagnosis +. The genus has the following distinctive features: the robust thorax, the fore wing with a specific fine spotty pattern and a sharp apex, the non-split clavately expanding robust uncus, the sclerotized abdominal edge of the valve and the vesica without cornuti. + + +Composition +. A monotypic genus. + + + + +Etymology +. The new Genus is named after Dr. Jeremy D. Holloway, a well-known British entomologist – specialist in Oriental Fauna. + + + + +Distribution +. Known only from Northern Borneo ( +Fig. 27 +). + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68314FF82FF0E05774D30F851.xml b/data/08/76/87/087687C68314FF82FF0E05774D30F851.xml new file mode 100644 index 00000000000..420a54f797e --- /dev/null +++ b/data/08/76/87/087687C68314FF82FF0E05774D30F851.xml @@ -0,0 +1,171 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + + +Encaumaptera devyatkini + +sp. nov. + + + + + + +Figs 8 +, +21 + + + + +Material +. + +Holotype +: male, C. +Vietnam +, +Kon Tum Prov. +, +Sa Thay Distr. +, +Bargok +, +Chu Mot Ray NP +, +14º25′N +/ +107º43′E +, + +680 m + +, + +20−23.iii.2012 + +, leg. +V +. +Zolotuhin +( +MWM +, slide +Genitalpräparat Heterocera Nr. +27.986). + + + + + +Description +. Length of fore wing +15 mm +.Thorax and abdomen densely covered with dark-brown scales. Fore wing dark-brown, with poorly expressed pattern of lighter brown bands: postdiscally transverse, medially longitudinal, and rare black transverse strokes throughout all wing area. Hind wing dark-brown without pattern. + +Male genitalia. Uncus relatively short, robust, apically rounded, basally strongly sclerotized; tegumen massive, with wide leaf-like processes at gnathos arms bases; gnathos arms thick, long; gnathos massive; valve narrow, slightly narrowing from base to apex, with very small cut on border between medial and distal third of costal edge, long leaf-like process at base of costal edge of valve, costal and abdominal edges strongly sclerotized, in medium third connected with narrow bridge, tip of abdominal edge slightly drawn, small triangle harpe on inner surface of valve closer to costal edge; juxta scaphoid; saccus semicircular, tiny; phallus thick, short, almost straight, with small paired cornuti on lateral surfaces of vesica. + + + +Diagnosis +.The new species differs externally from + +E. aurora + +sp. n. +in the dark hind wings, from + +E. stigmata + +in the poorly modified pattern on the fore wing. From both species it clearly differs in the genital structure: the shorter uncus, the thin sclerotized bridge between the costal and abdominal margins of the valve, the poorly expressed cut on the costal edge of the valve. + + +Habitat and details of biology +( +Fig. 29 +).The species was collected in the rainy season in an undisturbed very dense tropical mountain forest, attracted to the light, near a sheer rock wall cut along a mountain road above a mountain stream. At rest, folds its wings and sits like a Cossid moth without lifting the abdomen up. + + + + +Etymology +. The species is named after Alexey L. Devyatkin (1957–2012) ( +Fig. 31 +), who worked at the Department of Entomology, Faculty of Biology, the Moscow University. He was one of the largest specialists in Oriental +Hesperiidae +, +Lepidoptera +of +Vietnam +, and also in metalmarks of the genera + +Melitaea + +and + +Mellicta + +. He is the author of more than 60 taxa of Rhopalocera from the Palaearctic and Oriental region, first of all of the fauna of +Vietnam +. + + + + +Distribution +. Central +Vietnam +. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68315FF83FF0E020E4C7BF823.xml b/data/08/76/87/087687C68315FF83FF0E020E4C7BF823.xml new file mode 100644 index 00000000000..70a5b30c6e3 --- /dev/null +++ b/data/08/76/87/087687C68315FF83FF0E020E4C7BF823.xml @@ -0,0 +1,145 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Orgyarbela + +gen. nov. + + + + + + +Type +species ( +here designated +): + +Arbela millemaculata +Hampson, 1897 + +. + + + + +Description +. Basing on the known material, the genus is strongly sexually dimorphic. + + +Male. Small species, male fore wing length +9–10 mm +. Antenna bipectinate, crest processes three times longer than antenna rod diameter in its medium third. Fore wing narrow, often with fine spotty pattern, hind wing smaller, without pattern. Bunch of very long hairs on tip of abdomen. + +Male genitalia. Uncus very robust, strongly expanded towards top, apically with deep semicircular bifurcation; tegumen robust; gnathos arms of medium length; gnathos small; valve short, abdominal edge hypertrophied, strongly sclerotized, small dentate harpe on abdominal edge; juxta cup-like; saccus tiny; phallus short, slightly sharpened apically. + +Female (only the female of + +O. millemaculata + +is known). Slightly larger than male, colored brightly and lighter. Antenna bipectinate, crest processes approximately equal to antenna rod diameter in its medium third. Pattern of fore wing mottled. Hind wing with longitudinal dark band. Bunch of very long hairs on tip of abdomen. Genitalia not examined. + + + + +Diagnosis +. The new genus differs from the known +Metarbelidae +genera in the gracility, dimorphism in color and size, relatively bright coloration of females, the presence of a bundle of very long scales at the apex of the abdomen in both sexes, a very powerful split uncus. The split uncus, the reduced hind wing size and the dimorphism may be considered the autapomorphies of the genus. + +The bright color and the extreme rarity of both sexes in collections suggest their daily activity and this may be also a unique autapomorphic feature of this group / genus. + +Composition +. The new genus includes three species: + +O. millemaculata +( +Hampson, 1897 +) + + +comb. nov. +, + + +O. kerri + + +sp. nov. + +and + +O. mackwoodi + + +sp. nov. + + + + + +Distribution +. Eastern +India +, +Myanmar +and +Laos +( +Fig. 28 +). + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68316FF80FF0E02C44D47F81C.xml b/data/08/76/87/087687C68316FF80FF0E02C44D47F81C.xml new file mode 100644 index 00000000000..975e2af3790 --- /dev/null +++ b/data/08/76/87/087687C68316FF80FF0E02C44D47F81C.xml @@ -0,0 +1,142 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + + +Orgyarbela kerri + +sp. nov. + + + + + + +Figs 15 +, +24 + + + + +Material +. + +Holotype +: male, +Laos +, +Nam Guak +[Yuak river Valley, Wiengchau], + +300 m + +, + +25.iv.1932 + +. +French Ind. +China +, +Dr. A. Kerr +( +NHMUK +, individual number 012832503; slide +NHMUK 010315534 +). + + + + + +Description +. Male. Length of fore wing +10 mm +. Thorax and abdomen densely covered with brown scales, bunch of long dark-brown scales on tip of abdomen. Fore wing light-brown with dense spotty dark-brown pattern of strokes throughout all wing, fringe mottled: dark at veins, light between veins. Hind wing dark-brown with yellow costal edge and yellow fringe. + +Male genitalia. Uncus very robust, strongly extended from base to apex, with deep triangle incision (for half of uncus length); tegumen robust; gnathos arms of medium length; gnathos small; valve short, poorly sclerotized, lanceolate, costal edge almost smooth, abdominal edge hypertrophied, strongly sclerotized, small dentate harpe on abdominal edge (in medium third); juxta cup-like; saccus tiny; phallus short, curved in medium third, gradually narrowing from middle to top. +Female unknown. + + + +Diagnosis +. Externally, the new species is closer to + +O. millemaculata + +, from which it differs in the darker color, more split uncus and the harpe situated closer to the abdominal edge of the valve. + + + + +Distribution +. Northern +Laos +( +Kerr 1933 +; +Jacobs 1962 +). + + + + +Etymology +. The new species is named after its collector – the most active researcher if the Indo-China fauna, the Irish doctor A.F.G. Kerr (1877–1942) ( +Fig. 32 +), who made a trip to the highest point of +Laos +in 1932 and collected insects along the way. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68316FF80FF0E06974B82FB8A.xml b/data/08/76/87/087687C68316FF80FF0E06974B82FB8A.xml new file mode 100644 index 00000000000..bac4dae56de --- /dev/null +++ b/data/08/76/87/087687C68316FF80FF0E06974B82FB8A.xml @@ -0,0 +1,147 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + + +Orgyarbela millemaculata +( +Hampson, 1897 +) + +comb.nov. + + + + + + +Figs 13−14 +, +23 + + + + + + + +Arbela millemaculata +Hampson, 1897: 286 + + +. + + + + + + +Type +locality: +Khásis +[Khasi Hills, +Meghalaya +, Eastern +India +] + +. + + +Type material: + +syntypes +in +BMNH + +. + + +Material examined +. + +1 male +, +1 female +, Khasis ( +NHMUK +, individual number 012832507; slide +NHMUK 010315538 +) + +. + + +Re-description +. Male. Length of fore wing +9−10 mm +. Thorax and abdomen densely covered with brown scales, bunch of long dark-brown scales on tip of abdomen. Fore wing light-brown with very dense spotty pattern of dark-brown spots arranged in transverse rows, fringe mottled, dark at veins, light between veins. Hind wing brown, without pattern, fringe yellow unicolorous. + +Male genitalia. Uncus very robust, strongly expended from base to apex, with small semicircular incision (for quarter of uncus length); tegumen robust; gnathos arms of medium length; gnathos small; valve short, poorly sclerotized, apex wide semicircular, costal edge smooth, abdominal edge strongly sclerotized, small cut in basal third of abdominal edge, small dentate harpe on abdominal edge (closer to apex); juxta cup-like; saccus tiny; phallus short, strongly bent along all length, apically slightly sharpened. + +Female. Length of fore +13−14 mm +. Thorax covered with dark- brown scales, abdomen – with bright orange scales, bunch of very long dark scales on tip of abdomen. Fore wing bright orange, with black large basal spot, wide band discally, more narrow band postdiscally, small black spots submarginally, marginally and between discal and postdiscal bands (in radial area) + +Female genitalia not examined. + + + +Diagnosis +. The new species is externally closer to + +O. kerri + +, from which is differs in the smaller incision on the uncus, and in the harpe on the abdominal edge of the valve strongly moved to its apex. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68317FF81FF0E020E4D46F805.xml b/data/08/76/87/087687C68317FF81FF0E020E4D46F805.xml new file mode 100644 index 00000000000..1fd71770702 --- /dev/null +++ b/data/08/76/87/087687C68317FF81FF0E020E4D46F805.xml @@ -0,0 +1,130 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + + +Orgyarbela mackwoodi + +sp. nov. + + + + + + +Figs 16 +, +25 + + + + +Material +. + +Holotype +: male, Burma, +Kawkerait +[ +16°33′20″N +98°14′24″E +, Kawkarike, Karen Prov., +Myanmar +], + +v.1912 + +, +F.M. Mackwood +( +NHMUK +, individual number 012832505; slide +NHMUK 010315536 +). + + + + + +Description +. Male. Length of fore wing +9 mm +. Thorax and abdomen densely covered with brown scales, bunch of long dark-brown scales on tip of abdomen. Fore wing dark-brown, without pattern, fringe mottled: dark at veins, light between veins. Hind wing dark-brown without pattern, fringe pale brown. + +Male genitalia. Uncus very robust, strongly extended from base to apex, with deep semicircular incision (for one third of uncus length); tegumen robust; gnathos arms of medium length; gnathos small; valve short, poorly sclerotized, with slightly sharpened apex,costal edge curved, abdominal edge hypertrophied, strongly sclerotized, small dentate harpe on abdominal edge (in medium third); juxta cup-like; saccus tiny; phallus short, straight, apically slightly sharpened. +Female unknown. + + + +Diagnosis +.The new species differs from both other species of the genus in the poorly modified coloring (the fore wing is dark-brown, without pattern), an important diagnostic feature in the genitals is the lanceolate narrowing distal tip of the valve. + + + + +Etymology +. The new species is named after F. M. Mackwood (1843−1931) ( +Fig. 33 +), a businessman (one of the founders of the tea house Mackwood’s Limited) in Colombo, a keen amateur lepidopterist. His specimens are kept at the Natural History Museum, Londonand the National Museum, Colombo ( +Wijesekara & Wijesinghe, 2003 +). + + + + +Distribution +. +Myanmar +: Karen Province. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68318FF8EFF0E02004B03FB77.xml b/data/08/76/87/087687C68318FF8EFF0E02004B03FB77.xml new file mode 100644 index 00000000000..80efc228ba9 --- /dev/null +++ b/data/08/76/87/087687C68318FF8EFF0E02004B03FB77.xml @@ -0,0 +1,82 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Squamura +Heylaerts, 1890 + + + + + +Heylaerts, 1890 +, Ann. Soc. Entomol. Belg. 34: xxvi. + + + + +Type +species (by monotypy): + +Squamura maculata +Heylaerts, 1890 + +( +Figs 4 +, +19 +). + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68318FF8EFF0E02894D6CFA5B.xml b/data/08/76/87/087687C68318FF8EFF0E02894D6CFA5B.xml new file mode 100644 index 00000000000..ee8ced4eac4 --- /dev/null +++ b/data/08/76/87/087687C68318FF8EFF0E02894D6CFA5B.xml @@ -0,0 +1,85 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Stueningeria +Lehmann, 2019 + + + + + +Lehmann, 2019b +, Heterocera Sumatrana 13(2): 52, +Figs 1−6 +. + + + + +Type +species (by original designation): + +Stueningeria nepalensis +Lehmann, 2019 + +. + + +In the first part of our revision of the Oriental +Metarbelidae +we are revising one of the known genera and describing two genera new to science. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68318FF8EFF0E059F4BD2FBEC.xml b/data/08/76/87/087687C68318FF8EFF0E059F4BD2FBEC.xml new file mode 100644 index 00000000000..78e6dd18d7f --- /dev/null +++ b/data/08/76/87/087687C68318FF8EFF0E059F4BD2FBEC.xml @@ -0,0 +1,84 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Squamicapilla +W. +Schultze, 1908 + + + + + +Schultze, 1908 +, Philippine journ. science, A. Gen. Science 3 (1): 29. + + + + +Type +species (by original designation): + +Squamicapilla arenata +W. +Schultze, 1908 + +( +Figs 3 +, +18 +). + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68318FF8EFF0E07E24CA6FDC8.xml b/data/08/76/87/087687C68318FF8EFF0E07E24CA6FDC8.xml new file mode 100644 index 00000000000..4f72d5ddd48 --- /dev/null +++ b/data/08/76/87/087687C68318FF8EFF0E07E24CA6FDC8.xml @@ -0,0 +1,80 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Encaumaptera +Hampson, 1893 + + + + + +Hampson, 1893 +, Fauna Brit. +India +, Moths 1: 314. + + + + +Type +species (by monotypy): + +Brachylia stigmata +Hampson, 1891 + +. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C68318FF8FFF0E03944C54FE2A.xml b/data/08/76/87/087687C68318FF8FFF0E03944C54FE2A.xml new file mode 100644 index 00000000000..905f66d6853 --- /dev/null +++ b/data/08/76/87/087687C68318FF8FFF0E03944C54FE2A.xml @@ -0,0 +1,146 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + +Genus + +Encaumaptera +Hampson, 1893 + + + + + + + +Type +genus (by original designation) + +Brachylia stigmata +Hampson, 1891 + +. + + + + +Redescription +. Adults of medium size, similar to the representatives of the сossid genera + +Roerichiora +Yakovlev & Witt, 2009 + +( +type +species + +Zeuzera stigmatica +Moore, 1879 + +). Antenna bipectinate along all length, antenna processes about two times longer than antenna rod diameter in its medium third. Fore wingwith poorly expressed pattern, hind wing without pattern, noticeably shorter. Abdomen apically without modified scales collected in a brush. + +Male genitalia.Uncus robust, tapered, apically rounded; tegumen large; gnathos arms thick, relatively long, large leaf-like processes at bases of gnathos arms (more dorsally) on tegumen; gnathos massive; valve narrow, slightly narrowing from base to apex, with small notchon border between medium and distal thirds of costal edge, with small triangle harpe; juxta small cup-like; saccus tiny; aedeagus robust, short, straight, with small paired linear-shaped cornuti along lateral surfaces of vesica. +Females unknown. + + + +Diagnosis +. The new genus is distinguished in the weak wing pattern, the absence of modified abdomen scales, large tapered uncus, big leaf-like processes at bases of gnathos arms, narrow valve with a small harpe, straight thick phallus with small paired linear-shaped cornuti along the lateral surface of the vesica. + + +Composition +. The genus + +Encaumaptera + +includes three species so far: + +E. stigmata +( +Hampson, 1891 +) + +, + +E. aurora + + +sp. nov. + +, and + +E. devyatkini + + +sp. nov. + + + + + +Distribution +. Indochina ( +Vietnam +and +Thailand +), south-eastern or Southern +India +( +Tamil Nadu +), +Sri Lanka +( +Fig. 27 +); its range strongly disjunct and incompletely known. + + + + \ No newline at end of file diff --git a/data/08/76/87/087687C6831BFF82FF0E007F4B42FD1E.xml b/data/08/76/87/087687C6831BFF82FF0E007F4B42FD1E.xml new file mode 100644 index 00000000000..c72ef0a57f3 --- /dev/null +++ b/data/08/76/87/087687C6831BFF82FF0E007F4B42FD1E.xml @@ -0,0 +1,199 @@ + + + +Revision of the family Metarbelidae (Lepidoptera) of the Oriental Region. I. Introduction and genera Encaumaptera Hampson 1893, Orgyarbela gen. nov., and Hollowarbela gen. nov. + + + +Author + +Yakovlev, Roman V. +Altai State University, pr. Lenina 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +Zolotuhin, Vadim V. +Ulyanovsk State Pedagogical University, pl. 100 - letia Lenina 4, RUS- 432700, Ulyanovsk, Russia. E-Mail: v. zolot @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-07 + + +38 + + +84 +101 + + + + +http://dx.doi.org/10.37828/em.2020.38.11 + +journal article +10.37828/em.2020.38.11 +2336-9744 +13232753 +urn:lsid:zoobank.org:pub:D378D47B-66B4-4DC0-9F52-C27614E0E523 + + + + + + + +Encaumaptera aurora + +sp. nov. + + + + + + +Figs 9−10 +, +22 + + + + +Material +. + +Holotype +: male, +Thailand +, +Changwat Nan +, +5 km +N of +Bo Luang +, + +1000 m + +, + +4.ii.2000 + +, leg. +Hreblay +& +Szabó +( +MWM +, slide +Genitalpräparat Heterocera Nr. +26.648) + +. + +Paratypes +: +1 male +, +Thailand +, +Changwat Nan +, +25 km +N of +Bo Luang +, + +1150 m + +, + +29.iii.1998 + +, leg. +Tibor Csôváry +& +Pál Stéger +( +MWM +) + +; + +1 male +, +Thailand +, +Isthmus of Kra +, +Ranong +[ +9°57′ N +98°38′ E +], TV-station, 500 ms, +Mitte + +April 2002 + +, leg. loc. coll., ex coll. +S. Loeffler +( +RYB +, slide +RYB 2017 +/6) + +. + + + + +Description +. Length of fore wing +12−14 mm +( +holotype +– +13 mm +).Thorax covered with dark-brown scales, abdomen – with light-pink scales. Antenna pale brown, bipectinate along all length, crest processes about twice longer than antenna rod diameter in its medium third. Fore wing light-brown with poorly expressed pattern of darker blurred spots and thin orange rim along outer edge, fringe brown. Hind wing pink, without pattern, fringe light-brown. + + +Male genitalia. Uncus very robust, tapered, apically rounded, basally strongly sclerotized; tegumen massive, with wide leaf-like processes at gnathos arms bases; gnathos arms thick, relatively long; gnathos massive; valve narrow, slightly narrowing from base to apex, with small semi-oval cut on border between medium and distal third of costal edge, valve basally (on costal edge) with small narrow leaf-like processes, small triangle harpe on inner surface of valve at base of cut on costal edge, medium third of costal and abdominal edges strongly sclerotized, narrow sclerotized bridge from costal to abdominal edge of valve; juxta small, cup-like; saccus tiny; phallus thick, short, straight, slightly widening apically, with long longitudinal linear +sclerite +on abdominal surface and small paired linear-shaped cornuti on lateral surfaces of vesica. + + + + +Diagnosis +.The new species differs from the other species of the genus in the pink scales on the abdomen, the bright pink hind wing and the phallus slightly widening to the apex. + + + + +Distribution +. +Thailand +( +Nan +and +Ranong +Provinces). + + +Etimology +. +Aurora +– Goddess of Dawn because of hind wings colored as rising Sun. + + + + \ No newline at end of file diff --git a/data/1B/4D/87/1B4D879A0759D02700F8FF7E277D4660.xml b/data/1B/4D/87/1B4D879A0759D02700F8FF7E277D4660.xml new file mode 100644 index 00000000000..aa6c3b1238b --- /dev/null +++ b/data/1B/4D/87/1B4D879A0759D02700F8FF7E277D4660.xml @@ -0,0 +1,224 @@ + + + +Two new species of the genus Bythinella Moquin-Tandona, 1856 from the Greek island of Evia (Gastropoda: Bythinellidae) + + + +Author + +Glöer, Peter +Biodiversity Research Lab, Schulstrasse 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Pešić, Vladimir +Department of Biology, Faculty of Sciences, University of Montenegro, Cetinjski put b. b., 81000 Podgorica, Montenegro. E-mail: vladopesic @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-01 + + +36 + + +1 +5 + + + + +http://dx.doi.org/10.37828/em.2020.36.1 + +journal article +10.37828/em.2020.36.1 +2336-9744 +13232063 +urn:lsid:zoobank.org:pub:1878F3DE-C9F8-4D7F-B562-73A99B9C552B + + + + + + + +Bythinella reuselaarsi + +n. sp. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +FD39E451-4938-40DE-BD06-DE100A94AA53 + + + + + +Figs 9-10 + + + + +Material examined +— + +Holotype +( +ZMH140807 +): shell height +3.1 mm +, width +1.9 mm +; +paratypes +: +64 specimens +in isopropanol ( +ZMH140808 +), +15 specimens +in coll. +Glöer. + + + + + +Type +locality + +— +Greece +, +Evia Island +, the region of + +Mount Ochi +, GR + +4 limnocrene spring within + +Platanus + +grove along the road, near +Melissonas village +, +38°5'26.43"N +, +24°23'54.97"E +, + +30.06.2007 + +leg. +Pešić. + + + + + +Etymology +— Named after Robert Reuselaars (Assen, +The Netherlands +) in appreciation of his work in collecting + +Bythinella + +samples in +Greece +. + + + + +Description + + +Shell +— Shell ovate-cylindrical with 4.5 slightly convex whorls separated by a deep suture. The aperture is ovate, somewhat oblique. The peristome is sharp. The umbilicus is closed. The shell is +3.1 mm +high and +1.9 mm +broad. + + +Anatomy +— The penis is much shorter than the penial appendix. The tubular gland is thin at the proximal end and brod at the distal end ( +Fig. 10 +), with six half-loops. + + +Differentiating characters +— The shell of + +Bythinella reuselaarsi + +n. sp. +is ovate-cylindrical, not elongated like in + +B. charpentieri + +. On the other hand, + +B. dimitrosensis + +can be distinguished from the new species by a smaller size, ovate shell. The body whorl of + +B. reuselaarsi + +n. sp. +is convex and not straight like in + +B. kastanolongosensis + +n. sp. +The tubular gland of + +B. reuselaaarsi + +n. sp. +is longer (6 half-loops) vs. four half-loops in + +B +. +kastanolongosensis + +n. sp. + + +Habitat +— Specimens were collected from a limnocrene spring with a well developed starwort ( + +Callitriche +sp. + +) vegetation ( +Fig. 12 +). + + + + +Distribution +— +Greece +; Only known from the +type +locality in the region of the Mt. Ochi in the southern part of the island of Evia. + + + + \ No newline at end of file diff --git a/data/1B/4D/87/1B4D879A075BD02500F8FA68262444BD.xml b/data/1B/4D/87/1B4D879A075BD02500F8FA68262444BD.xml new file mode 100644 index 00000000000..98b5d22302f --- /dev/null +++ b/data/1B/4D/87/1B4D879A075BD02500F8FA68262444BD.xml @@ -0,0 +1,114 @@ + + + +Two new species of the genus Bythinella Moquin-Tandona, 1856 from the Greek island of Evia (Gastropoda: Bythinellidae) + + + +Author + +Glöer, Peter +Biodiversity Research Lab, Schulstrasse 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Pešić, Vladimir +Department of Biology, Faculty of Sciences, University of Montenegro, Cetinjski put b. b., 81000 Podgorica, Montenegro. E-mail: vladopesic @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-01 + + +36 + + +1 +5 + + + + +http://dx.doi.org/10.37828/em.2020.36.1 + +journal article +10.37828/em.2020.36.1 +2336-9744 +13232063 +urn:lsid:zoobank.org:pub:1878F3DE-C9F8-4D7F-B562-73A99B9C552B + + + + + + + +Bythinella dimitrosensis +Glöer & Reuselaars, 2020 + + + + + +New records +— + +Greece +, +Evia Island +, the region of +Mount Ochi +: GR9 a big spring on road towards +Lenosei village +, +38°7'22.88"N +, +24°29'14.88"E +, + +30.06.2007 + +leg. +Pešić + +; + +GR16 +Metochi +spring in +Metochi village +, +38°0'32.91"N +, +24°27'58.21"E +, + +30.06.2007 + +leg. +Pešić. + + + + + +Remarks +— + +Bythinella dimitrosensis + +was recently described from the spring of Aghios Dimotros located in the southern part of Evia Island ( +Glöer and Reuselaars 2020a +). + + + + \ No newline at end of file diff --git a/data/1B/4D/87/1B4D879A075BD02600F8F89920C645B7.xml b/data/1B/4D/87/1B4D879A075BD02600F8F89920C645B7.xml new file mode 100644 index 00000000000..a03cf86b700 --- /dev/null +++ b/data/1B/4D/87/1B4D879A075BD02600F8F89920C645B7.xml @@ -0,0 +1,276 @@ + + + +Two new species of the genus Bythinella Moquin-Tandona, 1856 from the Greek island of Evia (Gastropoda: Bythinellidae) + + + +Author + +Glöer, Peter +Biodiversity Research Lab, Schulstrasse 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Pešić, Vladimir +Department of Biology, Faculty of Sciences, University of Montenegro, Cetinjski put b. b., 81000 Podgorica, Montenegro. E-mail: vladopesic @ gmail. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-01 + + +36 + + +1 +5 + + + + +http://dx.doi.org/10.37828/em.2020.36.1 + +journal article +10.37828/em.2020.36.1 +2336-9744 +13232063 +urn:lsid:zoobank.org:pub:1878F3DE-C9F8-4D7F-B562-73A99B9C552B + + + + + + + +Bythinella kastanolongosensis + +n. sp. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +A6B46268-5A30-4100-A33F-F08B7F28ABFB + + + + + +Figs 6-8 + + + + +Material examined +— + +Holotype +( +ZMH140809 +): shell height +3.1 mm +, width +1.8 mm +; +paratypes +: +96 specimens +in isopropanol ( +ZMH140810 +), +16 specimens +coll. +Glöer. + + + + + +Type +locality + +— +Greece +, +Evia Island +, the region of + +Mount Ochi +, GR + +15 +Kastanolongos +, helocrenic spring, +38°3'8.72"N +, +24°28'15.83"E +, + +01.07.2007 + +leg. +Pešić. + + + + + +Etymology +— Named after the beautiful chestnut tree forest (“Kastanolongos”) on the slopes of Mount Ochi ("Oche") where the +locus typicus +of the new species is located. + + + + +Figures 2-10 +. +2 +: + +Bythinella charpentieri + +(lectotype), +3-5 +: + +B. dimitrosensis +Glöer & Reuselaars, 2020a + +, +4 +: + +B. dimitrosensis + +from Evia Island, the region of Mount Ochi, Metochi spring; +5 +: + +B. dimitrosensis + +from Evia Island, the region of Mount Ochi, spring near Lenosei village; +6 +: + +B. kastanolongosensis + +n. sp. +(holotype), +7 +: penis with tubular gland, 8: + +B. kastanolongosensis + +n. sp. +(paratype), +9 +: + +B. reuselaarsi + +n. sp. +, +10 +: penis with tubular gland. + + + + +Description + + +Shell +— Cylindrical with 4.5 slightly convex whorls with a deep suture. The body whorl has a straight vertical tangent line. The aperture is ovate, slightly angled at the top. The peristome is sharp with a brown periostracum. The umbilicus is closed. The shell is +2.8-3.1 mm +high and +1.8-1.9 mm +broad. + + +Animal +— The head is light-brown with a white border. + + +Anatomy +— The penis is much shorter than the penial appendix ( +Fig. 7 +). Tubular gland thin at the proximal end, broader at the distal part, with four half-loops. + + +Differentiating characters +— The new species resembles + +Bythinella charpentieri + +. The latter species was recently redescribed by +Georgiev & Glöer (2020) +on the basis of a +syntype +material from Hymettus, +Attica +. The shell of + +B. charpentieri + +is elongated conical and not cylindrical as in + +B. kastanolongosensis + +n. sp. +Moreover the tangent line of the body whorl in + +B +. +charpentieri + +is not straight as in the new species ( +Fig. 2 +). The shell of + +B. dimitrosensis + +, a species known from southern part of the island of Evia, is ovate and the species is smaller than + +B. kastanolongosensis + +n. sp. + + +Due to its size the new species is similar to + +B. reuselaarsi + +n. sp. +(see there for further discussion). + + +Habitat +— Specimens were collected from the stones in a small seepage spring in old-growth chestnut wood ( +Fig. 11 +). + + + + +Distribution +— +Greece +; only known from the +type +locality in the southern part of the island of Evia. + + + + \ No newline at end of file diff --git a/data/1F/6F/87/1F6F87F72660FFC9FF19F8BD6279E4CB.xml b/data/1F/6F/87/1F6F87F72660FFC9FF19F8BD6279E4CB.xml new file mode 100644 index 00000000000..00058da7315 --- /dev/null +++ b/data/1F/6F/87/1F6F87F72660FFC9FF19F8BD6279E4CB.xml @@ -0,0 +1,84 @@ + + + +New and recent records of hawk moths (Lepidoptera: Sphingidae) from Seychelles, with a description of a new insular subspecies + + + +Author + +Bolotov, Ivan N. + + + +Author + +Kolosova, Yulia S. + + + +Author + +Spitsyna, Elizaveta A. + + + +Author + +Spitsyn, Vitaly M. + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-17 + + +39 + + +109 +120 + + + + +http://dx.doi.org/10.37828/em.2021.39.12 + +journal article +10.37828/em.2021.39.12 +2336-9744 +13232914 +urn:lsid:zoobank.org:pub:8586E0DE-2671-467B-8D7E-E5D3AA0E4FB9 + + + + + +Genus + +Temnora +Walker, 1856 + + + + + + +Type +species: + +Temnora natalis +Walker, 1856 + +[subsequent designation by Kirby, 1892] ( +De Prins and De Prins 2021 +). + + + + \ No newline at end of file diff --git a/data/1F/6F/87/1F6F87F72664FFCDFF19F8A66279E4D7.xml b/data/1F/6F/87/1F6F87F72664FFCDFF19F8A66279E4D7.xml new file mode 100644 index 00000000000..8de9d0268eb --- /dev/null +++ b/data/1F/6F/87/1F6F87F72664FFCDFF19F8A66279E4D7.xml @@ -0,0 +1,84 @@ + + + +New and recent records of hawk moths (Lepidoptera: Sphingidae) from Seychelles, with a description of a new insular subspecies + + + +Author + +Bolotov, Ivan N. + + + +Author + +Kolosova, Yulia S. + + + +Author + +Spitsyna, Elizaveta A. + + + +Author + +Spitsyn, Vitaly M. + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-17 + + +39 + + +109 +120 + + + + +http://dx.doi.org/10.37828/em.2021.39.12 + +journal article +10.37828/em.2021.39.12 +2336-9744 +13232914 +urn:lsid:zoobank.org:pub:8586E0DE-2671-467B-8D7E-E5D3AA0E4FB9 + + + + + +Genus + +Agrius +Hübner, 1819 + + + + + + +Type +species: + +Sphinx cingulata +Fabricius, 1775 + +[subsequent designation by Tutt, 1902] ( +De Prins and De Prins 2021 +). + + + + \ No newline at end of file diff --git a/data/1F/6F/87/1F6F87F72666FFCDFF19FF1D670FE45E.xml b/data/1F/6F/87/1F6F87F72666FFCDFF19FF1D670FE45E.xml new file mode 100644 index 00000000000..ecefddb0ebd --- /dev/null +++ b/data/1F/6F/87/1F6F87F72666FFCDFF19FF1D670FE45E.xml @@ -0,0 +1,442 @@ + + + +New and recent records of hawk moths (Lepidoptera: Sphingidae) from Seychelles, with a description of a new insular subspecies + + + +Author + +Bolotov, Ivan N. + + + +Author + +Kolosova, Yulia S. + + + +Author + +Spitsyna, Elizaveta A. + + + +Author + +Spitsyn, Vitaly M. + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-17 + + +39 + + +109 +120 + + + + +http://dx.doi.org/10.37828/em.2021.39.12 + +journal article +10.37828/em.2021.39.12 +2336-9744 +13232914 +urn:lsid:zoobank.org:pub:8586E0DE-2671-467B-8D7E-E5D3AA0E4FB9 + + + + + + + +Temnora fumosa seychellensis +Bolotov & Spitsyn + +ssp. nov. + + + + + + + += + + +Diodosida peckoveri +De Joannis (1894) +: 432 + + +[ +Mahé +]. + + + + += + + +Temnora fumosa peckoveri +Fryer (1912) +: 15 + + +[ +Mahé +, Silhouette]; + +Legrand (1966) +: 169 + +, pl. 13, fig. 2 [ +Mahé +, Silhouette]; + +Matyot (2005) +: 67 + +[ +Mahé +, Silhouette, Denis]; + +Gerlach & Matyot (2006) +: 91 + +[ +Mahé +, Silhouette, Denis]. + + + + += + + +Temnora peckoveri +Lawrence & Henwood (2009) +: 50 + + +, figs 1-2; + +De Prins & Mazzei (2016) +: 26 + +, fig. 25 [La Digue]. + + + +Figs 1-5 +, +Table 1 +. + + + + +Type material. + +Holotype +male +RMBH +Sph +0913 +SEYCHELLES +: +Praslin Island +, + +La Plaine Hollandaise + +, +4.3234°S +, +55.7262°E +, alt. + +120 m + +, sedge- fern swamp with pandanus trees surrounded by palm-cinnamon forest, + +08 February 2016 + +, at +UV +light, +Bolotov +leg. ( +Fig. 2 +A-B). + + + + + +Diagnosis. +The new subspecies could be distinguished from + +Temnora fumosa fumosa + +based on the structure of harpe ( +Figs. 3-4 +). + +T. fumosa fumosa + +shares a long, narrow, sickle-shaped harpe ( +Fig. 4D +). In contrast, the new subspecies shares a much wider and shorter, straight harpe with an upcurved, claw-like end ( +Fig. 4E +). Furthermore, both the new subspecies and + +T. fumosa fumosa + +differ from + +T. peckoveri + +by the lack of a strong long tooth at the distal end of aedeagus (compare +Fig. 4A, 4B, and 4C +). The harpe of the new subspecies is much broader proximally and narrower distally compared with that of + +T. peckoveri + +( +Fig. 4F +). + + + + +Figure 3. +Male genitalia and aedeagus of + +Temnora fumosa seychellensis + + +ssp. nov. + +(holotype) from La Plaine Hollandaise, Praslin, Seychelles, 08 February 2016. ( +A +) Male genitalia (lateral view). ( +B +) Aedeagus (lateral view). (Photos: Elizaveta A. Spitsyna). + + + + +Description. +Male +( +Fig. 2 +): Wingspan +50 mm +, forewing length +25 mm +. Eye, antenna, and head dark olive. Labial palpus somewhat elongated (approximately two eye’s diameter), dark olive dorsally, light grey ventrally. Thorax, patagium, and tegula dark olive. Legs light grey, slightly darkened dorsally. Forewing outer margin with deep, rounded excavation below apex. Forewing upperside dark olive with broad darker brown antemedial and postmedial bands; postmarginal area greyish olive, with a dark, inconspicuous zig zag subterminal band and a small white spot at costa subterminally. Small white discal spot present. Forewing underside dark olive, with unclear blackish or dark brown triangular patch from the base to the discal area. Hindwing upperside uniformly dark brown with long dark olive scales. Hindwing underside dark olive, with a row of submarginal black spots and a dark patch between veins CuA1 and CuA2. Abdomen dark olive. +Male genitalia +( +Figs 3-4 +): Tegumen very broad, strongly sclerotized. Uncus bifurcated apically; uncus and gnathos form a typical macroglossine “bird- beak” structure. Valva slightly elongated, rounded apically. Harpe broad, straight, upcurved and pointed near the distal end. The base of harpe very broad. Aedeagus long, straight, with an oblique densely serrated ridge. Vesica long, with a bunch of ultra-elongate spines. + + +Female +: +Not +examined. + + + + +Etymology. +This subspecies is named after the +Seychelles +Archipelago, where it is distributed. + + + + +Figure 4. +Comparative analysis of the male genitalia and aedeagi of + +Temnora fumosa fumosa +, +T. fumosa seychellensis + +ssp. nov. +(holotype), and + +T. peckoveri +( +Butler, 1876 +) + +. ( +A-C +) Distal end of the aedeagus (lateral view): ( +A +) + +T. fumosa fumosa + +; ( +B +) + +T. fumosa seychellensis + +ssp. nov. +; and ( +C +) + +T. peckoveri + +. ( +D-F +) Valva and harpe (lateral view): ( +D +) + +T. fumosa fumosa + +; ( +E +) + +T. fumosa seychellensis + +ssp. nov. +; and ( +F +) + +T. peckoveri + +. The red arrow indicates a strong long tooth at the distal end of + +T. peckoveri + +aedeagus, a diagnostic feature of this species. (Photos: I. J. Kitching, +Sphingidae +Taxonomic Inventory Portal, Natural History Museum, London, UK [A, C, D, F; +Kitching 2020a +, b] and Elizaveta A. Spitsyna [B, E]). + + + + +Distribution. +Endemic to the Inner +Seychelles +( +Fig. 1 +). So far it is known to occur on the granitic islands of +Mahé +( +De Joannis 1894 +), Silhouette ( +Fryer 1912 +), La Digue ( +De Prins and Mazzei 2016 +), Cousine ( +Lawrence and Henwood 2009 +), and Praslin (this study), and on the coralline island of Denis ( +Matyot 2005 +). + + +Habitat. +The +holotype +was collected from a somewhat unusual habitat, i.e. at the middle of a continuous highland wetland densely covered by Ferns + +Dicranopteris linearis +(Burm. f.) Underw. + +( +Gleicheniaceae +) and Bog Bulrush + +Schoenoplectiella mucronata + +(L.) Jung & Choi ( +Cyperaceae +), with patches of Nutrush + +Scleria sumatrensis +Retz. + +( +Cyperaceae +) and groups of Horne’s Pandanus + +Martellidendron hornei +(Balf. f.) Callm. & Chassot + +( +Pandanaceae +) ( +Fig. 5 +). However, the moth most likely came from the edge of surrounding mixed secondary forest dominated by various endemic palms and cinnamon trees. This forest patch also houses Indian Mulberry + +Morinda citrifolia + +L. ( +Rubiaceae +), a host plant of this taxon on the Inner +Seychelles +( +Matyot 2005 +). + + + +Figure 5. +Type locality and habitat of + +Temnora fumosa seychellensis + + +ssp. nov. + +: sedge-fern swamp with pandanus trees surrounded by palm-cinnamon forest at La Plaine Hollandaise, Praslin, Seychelles. (Photo: Ivan N. Bolotov). + + + +Conservation. +The new subspecies appears to be Endangered [EN B1, B2 + aс(iii)]. It has an estimated extent of occurrence (EOO) of +330 km +2 +and an area of occupancy (AOO) of +174 km +2 +( +Gerlach and Matyot 2006 +). Furthermore, it has a highly fragmented range, is known to occur on a few islands, and shares extreme fluctuations in number of subpopulations. Previously, this subspecies was accessed as Vulnerable [VU B1abiii, B2abiii] in +Seychelles +but that assessment was based on its earlier treatment as a population of the more widespread taxon + +Temnora peckoveri + +(see +Gerlach and Matyot 2006 +). + + + + \ No newline at end of file diff --git a/data/26/18/5A/26185A62FFCEFFCC5DF384A97229FA2F.xml b/data/26/18/5A/26185A62FFCEFFCC5DF384A97229FA2F.xml new file mode 100644 index 00000000000..cb97b02ab00 --- /dev/null +++ b/data/26/18/5A/26185A62FFCEFFCC5DF384A97229FA2F.xml @@ -0,0 +1,516 @@ + + + +A new species of Scheloribates (Acari, Oribatida, Scheloribatidae) from South Africa + + + +Author + +Ermilov, Sergey G. +Institute of Environmental and Agricultural Biology (X-BIO), Tyumen State University, 10 Semakova Str., Tyumen 625003, Russia. E-mail: ermilovacari @ yandex. ru, alex 1973 khaustov @ gmail. com + + + +Author + +Hugo-Coetzee, Elizabeth A. +National Museum, 36 Aliwal St., Bloemfontein 9301, South Africa. E-mail: lhugo @ nasmus. co. za & University of the Free State, 205 Nelson Mandela Dr., Park West, Bloemfontein 9301, South Africa + + + +Author + +Khaustov, Alexander A. +Institute of Environmental and Agricultural Biology (X-BIO), Tyumen State University, 10 Semakova Str., Tyumen 625003, Russia. E-mail: ermilovacari @ yandex. ru, alex 1973 khaustov @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-02-13 + + +39 + + +86 +91 + + + + +http://dx.doi.org/10.37828/em.2021.39.10 + +journal article +10.37828/em.2021.39.10 +2336-9744 +13232856 +urn:lsid:zoobank.org:pub:3D342BE7-B458-4F8D-9D3C-D757ECEB9C76 + + + + + + + +Scheloribates +( +Scheloribates +) +curviprolamellatus + +sp. nov. + + + + + + +( +Figs 1–10 +) + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +7A1B1C9D-FD4A-4540-8FB9-9BD857A1BDFA + + + + + +Material examined. +Holotype +(female) and +11 paratypes +( +seven males +and +four females +): +South Africa +, Amathole mountains in the +Eastern Cape Province +, Hogsback State Forest at the village of Hogsback, +32°35’21.6”S +, +26°57’38.5’’E +, indigenous Afromontane mixed forest ( +Mucina & Geldenhuys 2006 +), consisting of tall trees (dominant species + +Afrocarpus falcatus + +(yellowwood), + +Celtis africana + +(white stinkwood), + +Calodendrum capense + +( +Cape +chestnut) and + +Vepris lanceolata + +(white ironwood)) and a dense understorey of shrubs, herbs and moss, in soil, +14.IX.2019 +, collected by +V +.A. Khaustov, S.G. Ermilov, E.A. Hugo-Coetzee, and A.A. Khaustov. + + +Type deposition. +The +holotype +and + +one paratype +are deposited in +NMB + +; +one paratype +is deposited in SMG; + +nine paratypes +are deposited in +TSUMZ + +. All specimens are preserved in ethanol with a drop of glycerol. + + + + +Diagnosis. +Body size 464–548 × 315–364. Lateral side of prodorsum with several ridges between insertion of rostral seta and acetabulum I. Prolamella thick, specifically curved (concave). Translamella absent, only two short ridges developed near lamellae. Rostral, lamellar and interlamellar setae long, setiform, barbed; +ro +shortest, inserted before prolamella, +in +longest. Bothridial seta of medium length, with long stalk and small, rounded, slightly barbed head. All notogastral setae minute, simple. Four pairs of sacculi drop-like. Epimeral and anogenital setae short, setiform, thin, slightly barbed; +g +1 +distinctly longer than other genital setae. Circumpedal carina short. Leg tarsus I with 19 setae ( +l” +absent), genu II with two setae ( +v’ +absent). + + + + +Figures 1–3. + +Scheloribates +( +Scheloribates +) +curviprolamellatus + + +sp. nov. + +, adult: 1 – dorsal view; 2 – ventral view (gnathosoma and legs not shown); 3 – lateral view (gnathosoma and legs not shown). Scale bar 100 μm. + + + + +Description of adult. +Measurements +. Body length 514 ( +holotype +), 464–548 ( +11 paratypes +); body width 332 ( +holotype +), 315–364 ( +11 paratypes +). No difference between males and females. + + + +Figures 4–10. + +Scheloribates +( +Scheloribates +) +curviprolamellatus + + +sp. nov. + +, adult: 4 – subcapitulum, ventral view; 5 – palp, left, paraxial view; 6 – chelicera, left, paraxial view; 7 – leg I, without trochanter, right, antiaxial view; 8 – leg II, without trochanter and tarsus, right, antiaxial view; 9 – leg III, without trochanter and tarsus, left, antiaxial view; 10 – leg IV, left, antiaxial view. Scale bar 20 μm (4, 6–10), scale bar 10 μm (5). + + + +Integument +. Body color brown. Cuticle microporose (visible under high magnification, ×1000). Lateral side of body with microgranulate cerotegument between bothridium and acetabula I–III. Lateral side of prodorsum with several strong ridges between insertion of rostral seta and acetabulum I; and with dense stria lateral to lamella. Ventrolateral side of pedotectum I slightly striate. + + +Prodorsum +( +Figs 1, 3 +). Rostrum rounded. Lamella about 1/2 length of prodorsum. Prolamella thick, specifically curved backward. Sublamella linear, similar to lamella in length. Sublamellar porose area (12 × 8) oval. Translamella absent, only two short ridges developed near lamellae. Lateral keel-shaped ridge distinct. Rostral (82–86), lamellar (98–106) and interlamellar (131–139) setae setiform, barbed; +ro +inserted anterior to prolamella. Exobothridial seta (10–12) setiform, thin, slightly barbed. Bothridial seta (65–69) with long, smooth stalk and short, rounded, barbed head. Bothridium with lateral scale. Dorsosejugal porose area (18–20 × 8–10) elongate oval. Dorsophragma slightly elongate. + + +Notogaster +( +Figs 1, 3 +). Ten pairs of notogastral setae (6) setiform, thin, smooth. Four pairs of sacculi drop-like. Opisthonotal gland opening and all lyrifissures distinct. + + +Gnathosoma +( +Figs 4–6 +). Subcapitulum longer than wide (114–118 × 77–82). All subcapitular (20) and adoral (10–12) setae setiform, barbed. Palp (69–73) with typical setation 0-2-1-3-9 (+ω). Postpalpal seta (4) spiniform, smooth. Chelicera (118–123) with two setiform, barbed setae ( +cha +36; +chb +24). + + +Epimeral and lateral podosomal regions +( +Figs 2, 3 +). Epimeral formula 3-1-3-3. All setae ( +1b +, +3b +, +3c +, +4c +20–24; others 12–16) setiform, thin, slightly barbed. Humeral porose areas not observed. Pedotecta I and II represented by small lamina. Discidium triangular, rounded apically. Circumpedal carina comparatively short, anteriorly not reaching pedotectum II, posteriorly not reaching margin of ventral plate. + + +Anogenital region +( +Figs 2, 3 +). Genital ( +g +1 +24–28; others 12–16), aggenital (12–16), anal (20–24), and adanal (20–24) setae setiform, thin, slightly barbed. Adanal lyrifissure distinct. Marginal porose area bandlike, complete. + + +Legs +( +Figs 7–10 +). Median claw distinctly thicker than lateral claws, all barbed on dorsal side. Lateral claws with minute tubercle ventrodistally. Typical porose area on all femora, tarsi and tibiae, and on trochanters III, IV well visible. Formulas of leg setation and solenidia: I (1-5-3-4-19) [1-2-2], II (1-5-2-4-15) [1-1-2], III (2-3-1-3-15) [1-1-0], IV (1-2-2-3-12) [0-1-0]; homology of setae and solenidia indicated in +Table 1 +. Famulus of tarsus I short, erect, slightly swollen distally, inserted posterior to solenidion ω +2 +. Solenidion ω +1 +on tarsus I, ω +1 +and ω +2 +on tarsus II and σ on genu III slightly bacilliform, other solenidia setiform. + + + + +TABLE 1 +. Leg setation and solenidia of adult + +Scheloribates +( +Scheloribates +) +curviprolamellatus + +sp. nov. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
Leg +Tr + +Fe + +Ge + +Ti + +Ta +
I +v’ + +d +, +(l) +, +bv”, v” + +(l) +, +l’, +σ + +(l) +, +(v) +, φ1, φ2 + +(ft) +, +(tc) +, +(it) +, +(p) +, +(u) +, +(a) +, +s +, +(pv) +, +v’ +, +(pl) +, ɛ, ω1, ω2 +
II +v’ + +d +, +(l) +, +bv”, v” + +(l) +, σ + +(l) +, +(v) +, φ + +(ft) +, +(tc) +, +(it) +, +(p) +, +(u) +, +(a) +, +s +, +(pv) +, ω1, ω2 +
III +l’ +, +v’ + +d +, +l’ +, +ev’ + +l’ +, σ + +l’ +, +(v) +, φ + +(ft) +, +(tc) +, +(it) +, +(p) +, +(u) +, +(a) +, +s +, +(pv) +
IV +v’ + +d +, +ev’ + +d +, +l’ + +l’ +, +(v) +, φ + +ft” +, +(tc) +, +(p) +, +(u) +, +(a) +, +s +, (pv) +
+ + + +Note: Roman letters refer to normal setae, Greek letters to solenidia (except ɛ = famulus). Single quotation mark ( +’ +) designates setae on the anterior and double quotation mark ( +” +) setae on the posterior side of a given leg segment. Parentheses refer to a pair of setae + + + + +Etymology. +The species name + +curviprolamellatus + +refer to the specifically curved prolamella. +Remarks. + +Scheloribates +( +Scheloribates +) +curviprolamellatus + + +sp. n. + +differs from all species of the subgenus by the thick, specifically curved (backward) prolamella (versus prolamella simple, straight). + + + + \ No newline at end of file diff --git a/data/2A/5A/22/2A5A221EFFD15177FF2AED3AFBD4D583.xml b/data/2A/5A/22/2A5A221EFFD15177FF2AED3AFBD4D583.xml new file mode 100644 index 00000000000..7dd0b469510 --- /dev/null +++ b/data/2A/5A/22/2A5A221EFFD15177FF2AED3AFBD4D583.xml @@ -0,0 +1,485 @@ + + + +Two new species of Strigocossus Houlbert, 1916 (Lepidoptera, Cossidae, Zeuzerinae) from Togo and Zambia + + + +Author + +Yakovlev, Roman V. +Altai State University, Lenina pr. 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +László, Gyula M. +African Natural History Research Trust, Leominster, Street Court, Kingsland, Herefordshire, HR 6 9 QA, G. B. E-mail: gyula @ anhrt. org. uk * Corresponding author. E-mail: yakovlev _ asu @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-22 + + +34 + + +64 +72 + + + + +http://dx.doi.org/10.37828/em.2020.34.7 + +journal article +10.37828/em.2020.34.7 +2336-9744 +13232358 +urn:lsid:zoobank.org:pub:991A3458-2A5C-4F8F-B349-BE86B8F5F711 + + + + + + + +Strigocossus takanoi +Yakovlev & László + +, +sp. n. + + + + + + +Figs 1−2 +, +4−5 +, +7 +. + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +DC9AAAB9-35DA-4271-BBF4-1DF7B051796B + + + + +Holotype +. +Male +, “ +ZAMBIA +, + +1400m + +, Hillwood, Ikelenge, +S11°16ʹ02ʹʹ +, +E24°18ʹ59ʹʹ +, 25−27.xi.14, +Light Trap +, leg. +Smith +, +R +. & Takano, H.”, +ANHRT +:2017.12, slide +ANHRT 00058 +, unique number ANHRTUK 00052303 ( +ANHRT +). + + + + +Paratypes +(all in +ANHRT +). +Zambia + +. + +12 males +, +1 female +, with the same data as the holotype, unique numbers: ANHRTUK 00052304, 00007723, 00007724, 00098478-00098485, 00098487, slides +ANHRT 00059 +(male), LG 5193 (female) + +; + +4 males +, same locality, + +21−28.x.2013 + +, leg. +Smith +, +R +., +Takano, H. +, +Chmurova, L. +, +Smith +, L., +ANHRT +:2017.10, unique numbers: ANHRTUK 00098486, 00098489-00098491 + +; + +3 males +, same locality, + +7-10.xi.2019 + +, +MV +Light Trap +, +Bashford, M. +, +Miles +, W., +Mulvaney, L. +leg., +ANHRT +:2019.25, unique numbers: ANHRTUK 00133157-00133159 + +; + +14 males +, same locality, + +23−30.xi.2019 + +, +MV +light trap, +Bashford, M. +, +Miles, W. +, +Mulvaney +, L., +Smith +, +R +. leg., +ANHRT 2019 +.25, unique numbers: ANHRTUK 00133133-00133146 + +; + +4 males +, +Chitunta +plain ( +Miombo +/ +Dambo +mosaic), + +1396 m + +, +S11°29ʹ12ʹʹ +, +E24°24ʹ18ʹʹ +, + +29.xi.−4.xii.2019 + +, LepiLED and +MV +light trap, +Bashford, M. +, +Miles, W. +, +Mulvaney, L. +leg., +ANHRT 2019 +.25, unique numbers: ANHRTUK 00133149-00133152 + +; + +3 males +, +Nyangombe Falls +( +Miombo +/ +Riverine forest +mosaic), + +1300 m + +, +S11°48ʹ25ʹʹ +, +E24°32ʹ12ʹʹ +, + +17−23.xi.2019 + +, +MV +light trap, +Bashford, M. +, +Miles, W. +, +Mulvaney, L. +, +Smith +, +R +. leg. +ANHRT 2019 +.25, unique numbers: ANHRTUK 00133122, 00133124, 00133125 + +; + +3 males +, +Dambo +near +Kanyama +( +Miombo +/ +Riverine +/ +Dambo +mosaic), + +1375 m + +, +S11°25ʹ36ʹʹ +/ +E24°40ʹ00ʹʹ +, + +4−7.xii.2019 + +, +MV +and +Actinic +light trap, +Bashford, M. +, +Miles, W. +, +Mulvaney, L. +leg., +ANHRT 2019 +.25, unique numbers: ANHRTUK 00133153-00133155 + +; + +6 males +, +Jiwundu Swamp +, + +1340 m + +, +S11°51ʹ54ʹʹ +/ +E 25°33ʹ20ʹʹ +, + +21−24.xi.2014 + +, leg. +Smith +, +R +. & +Takano, H. +, +ANHRT +:2017.12, unique numbers: ANHRTUK 00098477, 00098488, 00098492-00098495 + +; + +12 males +, +Zambezi Rapids +( +Miombo +/ +Riverine forest +mosaic), + +1205 m + +, 11º7ʹ30ʹʹS, 24º11ʹ6ʹʹE, + +4‒9.xi.2018 + +, +MV +and +Actinic +light trap, +Aristophanous, M. +, +Deroziér +, +V +., +László, G. +, +Oram, D. +leg., +ANHRT 2018 +.40, unique numbers ANHRTUK 00052901, 00054827-00054829, 00054834, 00054835, 00054837, 00054840, 00054871, 00054872, 00070905, 00070988 + +. + + + +Figures 1−3. +Adult specimens of + +Strigocossus + +(coll. ANHRT): 1. + +S. takanoi + +sp. n. +, holotype, male; 2. + +S. takanoi + +sp. n. +, paratype, female; 3. + +S. sanbenai + +sp. n. +, holotype, male. + + + +Description. Male ( +Fig. 1 +). Length of forewing +27 mm +in +holotype +, +24-47 mm +in +paratypes +. Wingspan +52- 102 mm +. Antenna bipectinate in proximal half, filiform in distal half. Head moderately large, palps very short and thin, slightly upcurved, blackish; frons very narrow between the large, globular compound eyes, covered in short dark brown scales; vertex blackish brown. Collar and tegulae pale brownish grey densely covered in admixture of pale brown, grey and blackish scales, thorax dark blackish brown. Forewing grey with dense, finely reticulated pattern, a short, longitudinal blackish streak in cell CuA +2 +−CuP (discally) and a conspicuous, rather thick, dark brown submarginal crescent; discal area pale-brown with sparse reticulated pattern, costal margin dark brown, with small blackish patches along costa. Fringe mottled, pale grey between veins, blackish at veins. Hindwing pale greyish-brown, anal angle lighter brown, with weakly expressed reticulated pattern on wing periphery, fringe mottled, light brown between veins, dark brown at veins. + + +Male genitalia ( +Fig. 4 +). Uncus elongate-trigonal, robust, broad at base then slightly tapered distally, apically rounded; gnathos arms very short, ribbon-like, wide basally, narrowing apically without medial plate of gnathos; valva evenly broad in its basal two-thirds with very slightly convex costal and straight ventral margins, valva margins more or less parallel, apex evenly rounded; juxta large with long narrow ribbon-like lateral processes directed ventro-distally; saccus large, semicircular; phallus robust, extremely short, thick; vesica with longitudinally rugose, largely dilated, globular basal section, smooth surfaced, inflated medial section bearing a well-developed lateral lobe and gradually tapered, tubular distal section. + + +Female ( +Fig. 2 +). Length of forewing +53 mm +. Antenna filiform. Sexual dimorphism limited, wingpattern analogous to that of the male, forewing somewhat lighter compared to that of males. + + +Female genitalia ( +Fig. 5 +). Ovipositor extremely long, retractable, papillae anales very long and narrow, tubular, poorly sclerotized; apophyses posteriores heavily sclerotized, thin, anteriorly slightly dilated with rounded tip, conspicuously long, reaching ostium bursae; apophyses anteriores long, relatively thick in full length, apically rounded. 8 +th +tergite long and narrow with a shield-like medial sclerotization and fine, but heavily slerotized processi connected with apophyses anteriores. Ostium bursae conspicuously wide, somewhat cup-shaped, weakly sclerotized; ovary globular, oviduct very thin; ductus bursae membranous, posteriorly constricted, anteriorly dilated, relatively thick and short with rugose surface, bearing a well-developed lateral diverticulum; cervix bursae extremely broad, ductus seminalis thick, rugose; corpus bursae globular, signum bursae circular, heavily sclerotized, strongly spinose marginally with less, shorter spines on its medial surface. + + + +Diagnosis. The closest relative of the new species is the recently described + +S. otti +Yakovlev, Sulak & Witt, 2019 + +( +type +locality − +Angola +, Prov. +Cuanza Sul +, +26 km +E +Cassongue +), from which it differs in the following characters + +: + + +- the light-brown hind wing with lightened anal angle and the fine, reticulated pattern on the wing periphery whereas in + +S. otti + +, the hindwing is uniformly dark-brown, almost without pattern; + + +- the valva with straight ventral margin, while that of + +S. otti + +is slightly curved medially. + + +Distribution ( +Fig. 5 +). + +S. takanoi + +is hitherto known only from the +North-Western Province +of the +Republic of Zambia +. It inhabits medium high altitude (ca. +1400 m +a.s.l.) Miombo woodland habitats, variegated by narrow strips of riverine forests (Muchito). + + +Etymology. The new species is named after the dedicated entomologist Dr Hitoshi Takano (ANHRT), specialist of + +Catharsius + +dung beetles, Rhopalocera and +Sphingidae +, organizer and participant of numerous entomological expeditions in Africa, one of the collectors of the new species. + + + + \ No newline at end of file diff --git a/data/2A/5A/22/2A5A221EFFD35172FF2AEFFEFC38D54F.xml b/data/2A/5A/22/2A5A221EFFD35172FF2AEFFEFC38D54F.xml new file mode 100644 index 00000000000..726744a35e0 --- /dev/null +++ b/data/2A/5A/22/2A5A221EFFD35172FF2AEFFEFC38D54F.xml @@ -0,0 +1,272 @@ + + + +Two new species of Strigocossus Houlbert, 1916 (Lepidoptera, Cossidae, Zeuzerinae) from Togo and Zambia + + + +Author + +Yakovlev, Roman V. +Altai State University, Lenina pr. 61, Barnaul, 656049, Russia. E-mail: yakovlev _ asu @ mail. ru & Tomsk State University, Laboratory of Biodiversity and Ecology, Lenina pr. 36, 634050 Tomsk, Russia + + + +Author + +László, Gyula M. +African Natural History Research Trust, Leominster, Street Court, Kingsland, Herefordshire, HR 6 9 QA, G. B. E-mail: gyula @ anhrt. org. uk * Corresponding author. E-mail: yakovlev _ asu @ mail. ru + +text + + +Ecologica Montenegrina + + +2020 + +2020-09-22 + + +34 + + +64 +72 + + + + +http://dx.doi.org/10.37828/em.2020.34.7 + +journal article +10.37828/em.2020.34.7 +2336-9744 +13232358 +urn:lsid:zoobank.org:pub:991A3458-2A5C-4F8F-B349-BE86B8F5F711 + + + + + + + +Strigocossus sanbenai +Yakovlev & László + +, +sp. n. + + + + + + +Figs 3 +, +6 +, +8 +. + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +D4D4B38D-DE59-4500-BE56-FC27DF3104C3 + + + + +Holotype +. +Male +, “ +Togo +, + +505m + +, +Fazao-Malfakassa NP +, +Mare +aux crocodiles campsite (Sudanian savannah/dry forest), 8°44'58.8"N, 0°48'51.8"E, + +26.viii.-7.ix.2018 + +, +MV +Light Trap +, +Aristophanous, M. +, +Geiser, M. +, +Moretto, P. +, +Sanbena, B. +leg. +ANHRT +:2018.31, slide +ANHRT 00060 +, unique number ANHRTUK 00047587 ( +ANHRT +). + + + + +Figures 4−6. +Genitalia of + +Strigocossus + +(coll. ANHRT): 4. + +S. takanoi + +sp. n. +, holotype; 5. + +S. takanoi + +sp. n. +, paratype, female; 6. + +S. sanbenai + +sp. n. +, holotype. + + + + +Figures 7−8. +Habitats of the new + +Strigocossus +species + +: 7. Hillwood Farm, Ikelenge, NW Zambia, habitat of + +S. takanoi + +(photo by Lydia Mulvaney); 8. Fazao-Malfakassa National Park, Togo, habitat of + +S. sanbenai + +(photo by Marios Aristophanous). + + + + +Paratypes +(all in +ANHRT +). +Togo +. +37 males +, with the same data as the holotype, unique numbers: ANHRTUK 00046216, 00047378, 00047557-00047573, 00047577-00047586, 00047588-00047595; +8 males +, +Fazao-Malfakassa NP +, +Point +de vue campsite (Sudanian savannah), + +415m + +, 8°48'50"N, 0°49'3.2"E, + +16- 23.viii.2018 + +, +MV +Light Trap, +Aristophanous, M. +, +Geiser, M. +, +Moretto, P. +, +Sanbena, B. +leg. +ANHRT +:2018.31, unique numbers: ANHRTUK 00046219-00046226 + +. + + +Description. Male ( +Fig. 3 +). Length of forewing +52 mm +in +holotype +, +43-54 mm +in +paratypes +. Wingspan +90- 115 mm +. Antenna typical of the genus: bipectinate from base to middle, rami 3−4 times longer than antenna rod diameter, shortened distally, apical half of antenna filiform. + +Head moderately large, palps very short and thin, slightly upcurved, shining anthracite black; frons reversed trapezoidal; compound eyes large, globular; vertex pale brown frontally, graphite grey dorsally. Patagia pale brownish grey with admixture of shining black scales, tegulae dark brownish grey; thorax dark brown with some reddish sheen, bearing two short but conspicuous prominences posteriorly consisting of admixture of long black, creamy yellow, pale brown and off white hair scales; abdomen uniformly greyish brown, somewhat paler along anterior margins of each segments. +Forewing pale grey with dense reticulated pattern defined by numerous short, thin, undulate darkgrey transverse lines throughout the wing area with a conspicuous, short longitudinal light brown streak discally at base of cubital veins and with a relatively thick, dark brownish crescent band submarginally; costal margin pale grey, with dark brown narrow streaks of various length. Hindwing brownish grey, with dense, very fine, dark brownish reticulate pattern throughout the wing except for the anal angle. + +Male genitalia ( +Fig. 5 +). Uncus elongate-trigonal, robust, relatively broad at base, gradually tapered distally, apically rounded; gnathos arms short, basally wide, apically narrowing without medial plate of gnathos; valva broad costal margin almost straight, ventral margin conspicuously angled medially, apex broadly rounded; juxta large semicircular basally, with two long narrow ribbon-like lateral processes directed ventro-distally; saccus large, semicircular; phallus robust, extremely short, thick; vesica with longitudinally rugose, largely dilated, globular basal section, smooth surfaced, inflated medial section bearing a short sacklike lateral diverticulum and gradually tapered distal section. + +Female unknown. + +Diagnosis. The new species’ closest relative is + +S. otti + +, from which it differs in the following characters: + + +- the abdomen is covered in its whole length in paler greyish brown scales dorsally, whereas in + +S. otti + +, the abdomen is covered in darker brown scales, only apically in light-grey scales; + + +- the hindwing is paler grey, with dense reticulate brownish pattern throughout the wing surface except for the anal edge, while in + +S. otti + +, the hindwing is considerably darker brown almost without pattern; + + +- the ventral margin of the valva is strongly angled medially, while that is only slightly curved medially in + +S. otti + +. + + +Distribution ( +Fig. 6 +). + +S. sanbenai + +was collected in dry Sudanian Savannah habitat in the Fazao-Malfakassa National Park in +Togo +, during the rainy season. + + +Etymology. The new species is dedicated to Mr Banibéa Bassan Sanbena (Laboratoire d’Entomologie Appliquée, Département de Zoologie et de Biologie Animale, Université de Lomé, +Togo +) as a thank for his epic effort made during the field work organized by ANHRT in +Togo +. + + + + \ No newline at end of file diff --git a/data/2F/1D/31/2F1D3109FFEC6E77FF79FEB0FB4244F6.xml b/data/2F/1D/31/2F1D3109FFEC6E77FF79FEB0FB4244F6.xml new file mode 100644 index 00000000000..87fae061929 --- /dev/null +++ b/data/2F/1D/31/2F1D3109FFEC6E77FF79FEB0FB4244F6.xml @@ -0,0 +1,237 @@ + + + +Ovipennis (Coccinigripennis) lisu, a new species from China (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Huang, Si-Yao +Department of Entomology, College of Plant Protection, South China Agricultural University, Guangzhou 510642, Guangdong, China. E-mail: huangsiyao 2007 @ aliyun. com + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia. * Corresponding author: E-mail: monstruncusarctia @ gmail. com + + + +Author + +. + + + +Author + +. + + + +Author + +. + + + +Author + +., O. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-13 + + +38 + + +147 +150 + + + + +http://dx.doi.org/10.37828/em.2020.38.21 + +journal article +10.37828/em.2020.38.21 +2336-9744 +13232209 +urn:lsid:zoobank.org:pub:1F6BCB21-F9A0-4545-8237-77EB5F4EE968 + + + + + + + +Ovipennis +( +Coccinigripennis +) +fansipana + +( +Volynkin & Černý, 2017 +) + + + + + + +( +Figs 2–4 +, +6–8 +) + + + + +Type material examined +. + + +Holotype + +( +Figs 2 +, +7 +): male,” N. +Vietnam +, Mt. Fan-si-pan, 16[00]– + +1800 m + +, near +Chapa +, +22°20'N +, +103°40'E +, secondary forest, + +May 1995 + +, leg. local collectors, ex coll. +A. Schintlmeister +” / “Museum Witt München”, gen. slide +No. +: +MWM 31432 +(prepared by +Volynkin +) ( +MWM +/ +ZSM +). + + + + + +Paratypes +: + +43 males +, +21 female +from N +Vietnam +, Fan-si-pan +Mt +, as listed by +Volynkin & Černý (2017) + +. + + +Additional material examined +. + +2 male +, +1 female +, + +26. +VI + + + +.2018, +Gaoligong Natural Reserve +, +Baoshan City +, +Yunnan Province +, + +1600m + +, leg. +Tian-tian Yu +, +Zhou Chang +& +Zhi-wei Dong +, gen. preps. in glycerol by +Huang +( +SCAU +) + +. + + + + +Remarks +. In the original description of the female, +Volynkin & Černý (2017) +mentioned that the corpus bursae of the female genitalia bears a “small rounded signum situated medially” and that “signum” is well visible in the figure. However after a more careful examination of the female genitalia photo of the +paratype +illustrated in +Volynkin & Černý (2017) +and the dissection of the female from +China +, we found that the so-called “signum” is actually a remaining fragment of spermatophore or something similar to that. Concerning its position and the quality of the photo, it is easily misunderstood as a signum. For this reason we conclude that the female genitalia of + +O. fansipana + +lack a signum bursae. + + + + +Distribution +. The species is currently known from North +Vietnam +( +Lào Cai Province +) ( +Volynkin & Černý 2017 +) and Southwestern +China +( +Yunnan Province +) (the first record from +China +). + + + + \ No newline at end of file diff --git a/data/2F/1D/31/2F1D3109FFEF6E77FF79F902FDE24610.xml b/data/2F/1D/31/2F1D3109FFEF6E77FF79F902FDE24610.xml new file mode 100644 index 00000000000..ab62c8570f0 --- /dev/null +++ b/data/2F/1D/31/2F1D3109FFEF6E77FF79F902FDE24610.xml @@ -0,0 +1,242 @@ + + + +Ovipennis (Coccinigripennis) lisu, a new species from China (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Huang, Si-Yao +Department of Entomology, College of Plant Protection, South China Agricultural University, Guangzhou 510642, Guangdong, China. E-mail: huangsiyao 2007 @ aliyun. com + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia. * Corresponding author: E-mail: monstruncusarctia @ gmail. com + + + +Author + +. + + + +Author + +. + + + +Author + +. + + + +Author + +., O. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-13 + + +38 + + +147 +150 + + + + +http://dx.doi.org/10.37828/em.2020.38.21 + +journal article +10.37828/em.2020.38.21 +2336-9744 +13232209 +urn:lsid:zoobank.org:pub:1F6BCB21-F9A0-4545-8237-77EB5F4EE968 + + + + + + + +Ovipennis +( +Coccinigripennis +) +lisu + +Huang & Volynkin + +, + +sp. nov. + + + + + + +( +Figs 1 +, +5 +) + + + + +Type material. + + +Holotype + +( +Figs 1 +, +5 +): male, “ + +16.VII.2018 + +, +Pianma Town +, Lushui City, Nujiang Lisu Autonomous Prefecture, +Yunnan Province +, leg. +Si-yao Huang +” [in Chinese], gen. prep. in glycerol by Huang ( +SCAU +). + + + + + +Diagnosis +. The new species is identical externally to + +O. fansipana + +and can be distinguished by the examination of genitalia structures only. The male genital capsule of + +O. lisu + +is very similar to that of + +O. fansipana + +but differs by the somewhat smaller transtillar process and the broader distal saccular process. The aedeagus of the new species is narrower than in + +O. fansipana + +and slightly S-like curved, whereas it is nearly straight in + +O. fansipana + +. The vesica of + +O. lisu + +is conspicuously narrower than in + +O. fansipana + +, bears much smaller medial diverticula and two clusters of numerous small spine-like cornuti, whereas in + +O. fansipana + +there is only one cluster on the tip of a lateral diverticulum. Additionally, the distal ventral diverticulum of the new species is markedly shorter and narrower than that of + +O. fansipana + +and bears much smaller cluster of weaker cornuti. + + + + +Description +. +External morphology of the male +( +Fig. 1 +). Forewing length 12.8 mm in +holotype +. Antenna ciliate. Head and thorax pale red, abdomen dark brown. Forewing broad with elongated and rounded apex. Forewing ground color crimson. Pattern consisting of a narrow longitudinal trigonal black strip along vein Cu, reaching wing margin between M +1 +and M +2 +and narrowed distally, and two short and thin additional strips subapically on veins R +5 +and M +1 +. Cilia crimson. Hind wing dark brown. Cilia dark brown. +Male genitalia +( +Fig. 5 +). Uncus long, narrow, laterally flattened, apically pointed, C-like curved. Tuba analis with weakly setose cluster in subscaphial area. Tegumen short and moderately broad; vinculum large, U-like; juxta shield-like, weakly sclerotized. Valva narrow, elongated. Costa moderately sclerotized, slightly S-like curved, with strongly sclerotized trigonal distal process directed dorsally. Medial costal process reduced, tiny, triangular. Transtillar process tubercle-like, swollen, heavily setose. Distal membranous lobe of valva short, wide and rounded. Sacculus strongly setose dorsad, with large, strongly setose, apically dilated distal process curved dorsally. Aedeagus short, broad, slightly S-like curved; vesica with few short membranous diverticula medially, one long tubular distal ventral diverticulum bearing several small spine-like cornuti at the distal end, and two clusters of numerous small spine-like cornuti medially. + + + + +Figures 1–4. + +Ovipennis +spp. + +: adults. Depositories of the specimens: 1, 3 and 4 in SCAU; 2 in MWM/ZSM. + + + + +Distribution +. The species is currently known only from its +type +locality in the province of +Yunnan +, + + +Southwestern +China +. + + + + +Figures 5–8. + +Ovipennis +spp. + +: male genitalia. Depositories of the specimens: 5, 6 and 8 in SCAU; 7 in MWM/ZSM. + + + + +Etymology +. The species is named after the local Lisu people in Nujiang Lisu Autonomous + + +Prefecture of the +Yunnan Province +. + + + + \ No newline at end of file diff --git a/data/30/34/87/30348788E239FFAAFF39FED7B02DFB51.xml b/data/30/34/87/30348788E239FFAAFF39FED7B02DFB51.xml new file mode 100644 index 00000000000..c0897328d10 --- /dev/null +++ b/data/30/34/87/30348788E239FFAAFF39FED7B02DFB51.xml @@ -0,0 +1,141 @@ + + + +New species of Arctiocossus Felder, 1874 (Lepidoptera, Cossidae: Cossinae) from Republic of South Africa + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-28 + + +41 + + +1 +5 + + + + +http://dx.doi.org/10.37828/em.2021.41.1 + +journal article +10.37828/em.2021.41.1 +2336-9744 +urn:lsid:zoobank.org:pub:A3E57105-7ADD-4693-8EF6-A7BAE8C01C34 + + + + + + + +Arctiocossus stroehlei +Yakovlev + +sp. n. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +3F8D3F2F-6709-4407-B30C-130499DFE0DC + + + + + +Figs 1−2 +, +5 + + + + +Material +. + +Holotype +, male, +South Africa +, +Free State Province +, +Clarens +, +Sunny Side +lodge, +28º32′09.0′′ S +/ +028º31′07.9′′ E +, + +1813 m + +, + +19−22.xi.2012 + +, leg. +Ströhle +( +MSW +, slide +MSW 2015 +/25 Coss). + + + + + +Description +. Length of fore wing 11.5 mm. Antenna bipectinate, crest processes long, 4 times longer than antenna rod diameter. Fore wing brown, with wide longitudinal light colored stroke basally (in basal third of costal edge, in discal cell and between veins M +2 +and CuA +1 +); bright black strokes in medial area postdiscally and along vein CuP (in medium third), small black strokes on wing apically; fringe brown unicolorous. Hind wing brown, slightly lighter colored in anal area, with light-brown rim and unicolorous brown fringe. + +Male genitalia. Uncus long, cylindrical, with parallel edges, apically rounded; gnathos arms thick, long; gnathos small; valve evenly narrowing from base to apex, costal edge almost smooth (very poorly developed bumps in medium third of costal edge), valve apically rounded; transtilla processes short, uncinately bent, basally very thick, apically sharp; juxta saddle-like with two lateral processes clavately widened apically and diverged at an angle of 90º; saccus tiny, semicircular; phallus shorter than valve, gradually narrowing from base to apex, strongly curved on border between medium and basal third; vesica aperture in dorso-apical position, takes about 1/3 of phallus in length, vesica without cornuti. +Female unknown. + + + +Diagnosis +. Externally, the new species is most close to A. + +antargyreus +Felder, 1874 + +( +Figs 3−4 +), from which it distinctively differs in a series of characters in the male genital structure: + +- the expressed ledge on the costal edge of the valve (on border between medium and distal thirds; +- very thin transtilla processes. + + + +Etymology +. The new species is named after my colleague and friend, Manfred Ströhle (Weiden, +Germany +) an explorer of the African fauna of +Lepidoptera +. + + + + \ No newline at end of file diff --git a/data/36/72/57/36725714382CFF8A01BCF88BFD68FD1B.xml b/data/36/72/57/36725714382CFF8A01BCF88BFD68FD1B.xml new file mode 100644 index 00000000000..b6278673c40 --- /dev/null +++ b/data/36/72/57/36725714382CFF8A01BCF88BFD68FD1B.xml @@ -0,0 +1,138 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + +Amur +Lemming + +Lemmus amurensis +Vinogradov, 1924 + + + + + + + + +Type locality: +Near Pikan +[River mouth] on +Zeya River +, +Amursk Oblast +[ +cytb +sequence of the +holotype +: KX455628] ( +Baranova +& +Gromov +2003; +Abramson +& +Petrova +2018) + +. + +Synonyms: Not available. + +Distribution: East Siberian mountain species with a restricted range: Transbaikalia, South Yakutia, and the Upper +Amur +Basin (Abramson & Petrova 2018). + +Comments: The taxonomy and distribution of this species was clarified recently based on DNA sequence data (Abramson & Petrova 2018). + + + \ No newline at end of file diff --git a/data/36/72/57/36725714382CFF8B01BCFA62FBC9FB15.xml b/data/36/72/57/36725714382CFF8B01BCFA62FBC9FB15.xml new file mode 100644 index 00000000000..f731909a294 --- /dev/null +++ b/data/36/72/57/36725714382CFF8B01BCFA62FBC9FB15.xml @@ -0,0 +1,183 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + +Siberian Lemming + +Lemmus sibiricus +(Kerr, 1792) + + + + + + + + +Type locality: +The +northern parts of the +Uralian +chain of mountains, and on the +river Oby +[ +cytb +sequence of a +topotype +: +AJ012671 +] (Kerr 1792; Fedorov +et al. +1999) + +. + + +Synonyms: + +L. obensis +Brants, 1827 + +[TL: Mouth of the Obi River, Siberia, +Russia +] (Ellerman 1949; Hinton 1926); + +L. obensis bungei +Vinogradov, 1926 + +[TL: Mostakh Island near the Lena River mouth, Yakutia, +Russia +; +cytb +sequence of a +topotype +: FJ025981] (Abramson +et al. +2008; Baranova & Gromov 2003); + +L. sibiricus + +West Palearctic sensu Abramson +et al +., 2008 (Abramson +et al. +2008). + + +Distribution: Euro-Siberian Arctic species. Arctic Europe east of the Kola Peninsula and Arctic Siberia up to the Lena Delta (Abramson +et al. +2008; Abramson & Petrova 2018). + + +Comments: + +L. obensis + +was considered a junior synonym of Kerr’s taxon based on a close proximity of the type localities and morphological data (Ellerman 1949). This solution was confirmed on the basis of molecular genetic research (Abramson +et al. +2008). +Topotypes +of + +L. obensis bungei + +were considered belonging to + +L. sibiricus + +based on DNA sequence data (Abramson +et al. +2008). + + + + \ No newline at end of file diff --git a/data/36/72/57/36725714382CFF8B01BCFBF6FD62F92D.xml b/data/36/72/57/36725714382CFF8B01BCFBF6FD62F92D.xml new file mode 100644 index 00000000000..6aaccd9b5ba --- /dev/null +++ b/data/36/72/57/36725714382CFF8B01BCFBF6FD62F92D.xml @@ -0,0 +1,165 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + +Norwegian Lemming + +Lemmus lemmus +(Linnaeus, 1758) + + + + + + + + +Type +locality: alpibus +Lapponicus +[Mountains of Lappmark, +Sweden +] ( +Linnaei +, 1758) + +. + + +Synonyms: + +L. norvegicus +Desmarest, 1822 + +[TL: Les montagnes de la Norwege et la Laponie suedoise <...> les montagnes de la Laponie russe] (Desmarest 1822; Wilson & Reeder 2005; Wilson +et al. +2017); + +L. borealis +Nilsson, 1829 + +[a replacement name for + +Mus lemmus +Linnaeus, 1758 + +] (Wilson & Reeder 2005; Wilson +et al. +2017); + +Cuniculus iterator +Gistel, 1850 + +[TL: Russian Lapland =Kola Peninsula, +Russia +] (Wilson & Reeder 2005; Wilson +et al. +2017). + + +Distribution: European mountain species with a disjunctive range: Fennoscandia (nominate subspecies) and Novaya Zemlya ( + +L. lemmus chernovi + +ssp. nov. +). + + +Comments: The insular geographic race on Novaya Zemlya is isolated from the nominate subspecies by a +600 km +wide marine barrier ( +Fig. 1A +). + + + + \ No newline at end of file diff --git a/data/36/72/57/36725714382CFF8B01BCFE57FD67FDBE.xml b/data/36/72/57/36725714382CFF8B01BCFE57FD67FDBE.xml new file mode 100644 index 00000000000..4e584b70d31 --- /dev/null +++ b/data/36/72/57/36725714382CFF8B01BCFE57FD67FDBE.xml @@ -0,0 +1,115 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + +Genus + +Lemmus +Link, 1795 + + + + + + + +Type +species: + +Mus lemmus +Linnaeus, 1758 + +. + + + + \ No newline at end of file diff --git a/data/36/72/57/36725714382DFF8501BCF8E4FD86FEEF.xml b/data/36/72/57/36725714382DFF8501BCF8E4FD86FEEF.xml new file mode 100644 index 00000000000..d8df3baacd3 --- /dev/null +++ b/data/36/72/57/36725714382DFF8501BCF8E4FD86FEEF.xml @@ -0,0 +1,277 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + +Beringian Lemming + +Lemmus nigripes +(True, 1894) + + + + + + + + +Type locality: +Saint George Island +, approx. +56.5950°N +, +169.5168°W +, +Pribilof Islands +, +Alaska +, +USA +[ +cytb +sequence of a +topotype +: AY219164] ( +Miller +& +Kellogg +1955; +Fedorov +et al. +2003) + +. + + +Synonyms: + +L. alascensis +Merriam, 1900 + +[TL: Point Barrow, approx. +71.3338°N +, +156.5970°W +, +Alaska +, +USA +; +cytb +sequence of a +topotype +: AY219147] (Miller & Kellogg 1955; Fedorov +et al. +2003); + +L. yukonensis +Merriam, 1900 + +[TL: Charlie Creek (=Charley River), approx. +65.2968°N +, +142.7363°W +, Yukon River, +Alaska +, +USA +] (Miller & Kellogg 1955); + +L. obensis chrysogaster +Allen, 1903 + +[TL: vicinity of Gichiga, approx. +61.9492°N +, +160.3810°E +, +Magadan Region +, +Russia +; +cytb +sequence of a +topotype +: KT877362] (Abramson +et al. +2018); + +L. minusculus +Osgood, 1904 + +[TL: Kakhtul River near its junction with Malchatna River, approx. +59.6514°N +, +157.0733°W +, +Alaska +, +USA +; +cytb +sequence of a +topotype +: AY219153] (Miller & Kellogg 1955; Fedorov +et al. +2003); + +L. flavescens +Vinogradov, 1926 + +[TL: +Kamchatka +, +Russia +; +cytb +sequence of the +lectotype +: KX455619] (Abramson & Petrova 2018); + +L. harroldi +Swarth, 1931 + +[TL: Nunivak Island, approx. +60.3646°N +, +166.2422°W +, +Alaska +, +USA +] (Miller & Kellogg 1955). + + +Distribution: Beringian species, the range of which covers northeastern Asia ( +Chukotka +, northeastern edge of the +Magadan Region +, and a local isolate on +Kamchatka +) and northwestern North America (Aleutian Islands, +Alaska +, and western edge of +Yukon +) (Fedorov +et al. +2003; Abramson & Petrova 2018). + + + +Comments: This species has no less than six synonyms introduced for samples from both sides of the Bering Strait. Most of these names were revised on the basis of sequenced +topotypes +( +Fedorov +et al. +2003; +Abramson +& +Petrova +2018; +Abramson +et al. +2018). Several samples of + +Lemmus nigripes + +from +Kamchatka +and southern +Chukotka +share divergent +cytb +haplotypes, and populations in these regions can represent subspecies-level taxa. Hence, the intraspecific taxonomy of the Beringian Lemming needs to be revised based on an expanded molecular dataset + +. + + + + \ No newline at end of file diff --git a/data/36/72/57/36725714382DFF8A01BCFAC3FE44FAB6.xml b/data/36/72/57/36725714382DFF8A01BCFAC3FE44FAB6.xml new file mode 100644 index 00000000000..2a1e604567c --- /dev/null +++ b/data/36/72/57/36725714382DFF8A01BCFAC3FE44FAB6.xml @@ -0,0 +1,183 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + +Canadian Lemming + +Lemmus trimucronatus +(Richardson, 1825) + + + + + + + + +Type locality: +Point Lake +, +65.2523°N +, +113.1862°W +, +Mackenzie District +, +Northwest Territories +, +Canada +[ +cytb +sequence of a +topotype +: AY219162] ( +Miller +& +Kellogg +1955; +Fedorov +et al. +2003) + +. + + +Synonyms: + +Arvicola +( +Lemmus +) +helvolus +Richardson, 1828 + +[TL: Near headwaters of one of southern tributaries of Peace River, or between there and Jasper House region, +Alberta +, +Canada +] (Miller & Kellogg 1955). + + +Distribution: Nearctic species, the range of which covers northern North America from the eastern edge of +Alaska +through +Yukon +and +Northwest Territories +to +Nunavut +(Fedorov +et al. +2003). + + +Comments: Previously, this name was applied to both species-level clades of this species complex (Fedorov +et al. +2003), and + +Lemmus trimucronatus + +was thought to occur in eastern +Russia +(Fedorov +et al. +2003; Wilson & Reeder 2005; Abramson +et al. +2008; Wilson +et al. +2017; Abramson & Petrova 2018; Abramson +et al. +2018). However, it is a Nearctic species, which, in contrast to the next taxon, did not cross the Bering Land Bridge. + + + + \ No newline at end of file diff --git a/data/36/72/57/367257143836FF9201BCF9C9FE00FBA2.xml b/data/36/72/57/367257143836FF9201BCF9C9FE00FBA2.xml new file mode 100644 index 00000000000..6db654ee251 --- /dev/null +++ b/data/36/72/57/367257143836FF9201BCF9C9FE00FBA2.xml @@ -0,0 +1,724 @@ + + + +A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia + + + +Author + +Spitsyn, Vitaly M. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Bolotov, Ivan N. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Kondakov, Alexander V. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Klass, Anna L. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Mizin, Ivan A. +Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia * Corresponding author: spitsyn. v. m. 91993 @ yandex. ru + + + +Author + +Tomilova, Alena A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Zubrii, Natalia A. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + + + +Author + +Gofarov, Mikhail Y. +N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-17 + + +40 + + +93 +117 + + + + +http://dx.doi.org/10.37828/em.2021.40.8 + +journal article +10.37828/em.2021.40.8 +2336-9744 +urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80 + + + + + + + +Lemmus lemmus chernovi +Spitsyn, Bolotov & Kondakov + +ssp. nov. + + + + + + +Figs 6A +, +7 +A-C, 7G-H, 7K-L, +Table 7 + +Common name: Novaya Zemlya Lemming + + +Holotype +: +Male +RMBH +Lem +005: type locality: +Russia +, +Novaya Zemlya +, +Southern Island +, near +Malye Karmakuly Polar Station +, +72.3822°N +, +52.7506°E +, altitude + +17 m + +, wet saxifrage- roseroot communities, + +23.vii.2015 + +, +Spitsyn +leg. + + + +Paratypes +: +Russia +, Novaya Zemlya, Southern Island: type locality, +27.vii–01.viii.2015 +, +11 specimens +(RMBH Lem001 – Lem004, Lem006, Lem007, Lem011, Lem019, Lem022, Lem023, Lem027), Spitsyn leg.; near Malye Karmakuly Polar Station, +72.3575°N +, +52.7799°E +, altitude +27 m +, dry lichen- moss rocky tundra, +1.viii.2015 +, +1 specimen +(RMBH Lem028), Spitsyn leg.; near Malye Karmakuly Polar Station, +72.3934°N +, +52.7566°E +, altitude +40 m +, dry lichen- moss rocky tundra, +23.vii.2015 +, +2 specimens +(RMBH Lem008, Lem009), Spitsyn leg.; near Malye Karmakuly Polar Station, +72.4058°N +, +52.8285°E +, altitude +60 m +, dry tundra with + +Dryas octopetala + +and + +Astragalus alpinus + +, +27.vii.2015 +, +2 specimens +(RMBH Lem020, Lem021), Spitsyn leg.; near Malye Karmakuly Polar Station, +72.3797°N +, +52.7525°E +, altitude +20 m +, wet moss-sedge-willow tundra, +28–31.vii.2015 +, +4 specimens +(RMBH Lem017, Lem018, Lem024, Lem025), Spitsyn leg.; near Malye Karmakuly Polar Station, +72.3739°N +, +52.7167°E +, altitude +28 m +, stinkweed ( + +Artemisia tilesii + +) assemblages, +5.viii.2015 +, +1 specimen +(RMBH Lem031), Spitsyn leg.; Bezymyannaya Bay, +72.8°N +, +52.5°E +, 2017, +1 specimen +(RMBH Lem029), local collector leg. + + +Molecular diagnosis: The novel subspecies differs from + +Lemmus lemmus lemmus + +by fixed nucleotide substitutions in the mitochondrial +cytb +(12A, 36C, 189T, 441T, 573A, 726G, 765T) and +COI +(198C, 200A, 302T, 542A, 602C), and the nuclear +GHR +(860C) and +RAG1 +(599T) gene fragments ( +Tables 4 +-5). + + +Differential diagnosis: The Novaya Zemlya Lemming differs from the nominate subspecies by having a cryptic coloration of dorsal surface that is dark gray with yellow and reddish hairs in adults ( +Fig. 6A +) to reddish in juveniles, with an unclear longitudinal black stripe in anterior part from neck to nose (vs bright yellow coloration with black anterior part of the trunk and large black spots on head). The new subspecies is morphologically similar to + +Lemmus sibiricus + +but adult specimens from Novaya Zemlya could be distinguished from it by dorsal coloration with yellow and reddish hairs (vs brown and reddish hairs). + + + +Figure 6. +Dorsal view of lemming specimens: ( +A +) Novaya Zemlya Lemming ( + +Lemmus lemmus chernovi + + +ssp. nov. + +) [holotype RMBH Lem005], and ( +B +) Norwegian Lemming ( + +L. lemmus lemmus + +) [RMBH Lem040, Kola Peninsula]. Scale bar = 10 mm. (Photos: Vitaly M. Spitsyn). + + + + +Figure 7. +Comparison of crania, molar rows, and lower jaws of Novaya Zemlya ( + +Lemmus lemmus chernovi + + +ssp. nov. + +) [holotype RMBH Lem005] and Norwegian ( + +L. +l. lemmus + +) lemmings [specimen RMBH Lem040, Kola Peninsula]. ( +A +, +B +, +C +) Crania of Novaya Zemlya Lemming: ( +A +) dorsal view, ( +B +) ventral view, and ( +C +) lateral view. ( +D +, +E +, +F +) Crania of Norwegian Lemming: ( +D +) dorsal view, ( +E +) ventral view, and ( +F +) lateral view. Scale bar = 5 mm. ( +G +, +H +) Molar rows of Novaya Zemlya Lemming: ( +G +) maxillary, and ( +H +) mandibular. ( +I +, +J +) Molar rows of Norwegian Lemming: ( +I +) maxillary, and ( +J +) mandibular. Scale bar = 1 mm. ( +K +, +L +) Lower jaw of Novaya Zemlya Lemming: ( +K +) outer lateral view, and ( +L +) inner lateral view. +(M, N) +Lower jaw of Norwegian Lemming: ( +M +) outer lateral view, and ( +N +) inner lateral view. Scale bar = 5 mm. (Photos: Vitaly M. Spitsyn). + + + +Description: + +Holotype +male + +( +Figs 6A +, +7 +A-C, 7G-H, 7K-L, +Table 7 +). Body weight +74 g +; body length +130 mm +, tail +13 mm +. Length of hind foot +15 mm +. Length of upper molar row +8.5 mm +, lower molar row +8.3 mm +. Color of dorsal surface grayish yellow, with an unclear longitudinal black stripe in anterior part from neck to nose. Cheeks dark gray, nose brownish gray. Ventral surface light-colored, creamy-yellow. Tail creamy. Vibrissae up to +33 mm +long, black with yellow apex. Rostrum shorter than 2/3 greatest skull length; nasals do not proceed beyond the frontal edge of the incisors, rear edge rounded; gnathic process not pronounced; premaxilla rounded. Lacrimals with small ledge on the back side. Zygomatic arches parallel, jugal bone broad. Zygomatic plate broad, with slightly concave frontal margin. Zygomatic notch shallow. Nasolacrimal foramen with irregular shape, broad. Interorbital region narrow. Braincase region broad, almost square, with concavities behind the zygomatic arches. Lambdoidal ridge well developed. Postglenoid foramen elongated. Diastema long, concave; incisive foramina long and narrow. Mesopterygoid fossa broad, biconcave; parapterygoid fossa large; auditory bulla large, drop-shaped. Lower jaw large, angular process, condylar process и coronoid process large, well developed. Maxillary incisors yellowish-orange. +Morphological variability. +Mean body length of the type specimens (±s.e.m.) 110.9± +19.6 mm +(min- max = +85-160 mm +; +n += 21). Color of dorsal surface grayish yellow in adults to reddish in juveniles, with an unclear longitudinal black stripe ( +Fig. 6A +). + + + +Table 7. +Body and cranial measurements (mm) of Novaya Zemlya and Norwegian lemmings. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ +Lemmus lemmus chernovi + +ssp. nov. +(Novaya Zemlya, type series, + + + +Lemmus lemmus lemmus + +(Kola Peninsula, adults, + +
+Parameters + +Holotype Lem005 + + +adults, +N += 4) Paratype Paratype Lem028 Lem019 + + +Paratype Lem029 + +Mean ± s.e.m. + +Lem036 + +N = 3) Lem035 Lem038 + +Mean ± s.e.m. +
Body length130125145125131±5100110110107±3
Tail length1312151313.3±0.611121211.7±0.3
Hind foot length1514161515.0±0.414161515.0±0.6
Greatest skull length31.431.732.730.431.6±0.525.427.227.026.5±0.6
Interorbital breadth4.14.0N/A4.24.1±0.14.04.44.04.1±0.1
Zygomatic breadth21.821.423.421.222.0±0.518.419.418.418.7±0.3
Length of rostrum8.78.79.38.38.8±0.2N/A7.36.97.1±0.2
Breadth of rostrum6.56.56.96.46.6±0.15.55.55.65.5±0.0
Breadth of braincase16.014.916.615.015.6±0.414.114.114.114.1±0.0
Height of braincase10.510.111.510.210.6±0.39.59.59.19.4±0.1
Length of diastema11.111.111.210.811.1±0.19.49.49.39.4±0.0
Length of incisive6.26.66.66.26.4±0.15.25.96.45.8±0.3
foramina
Breadth of incisive1.31.31.51.41.4±0.01.01.11.21.1±0.1
foramina
Palatal length7.87.58.07.87.8±0.17.87.67.87.7±0.1
Postpalatal length9.19.09.78.89.2±0.28.39.08.48.6±0.2
Breadth of3.94.44.64.34.3±0.14.24.24.14.2±0.0
mesopterygoid fossa
Length of bulla9.99.19.98.29.3±0.47.97.97.97.9±0.0
Crown length of8.58.68.98.28.6±0.17.27.27.27.2±0.0
maxillary molar row
Crown length of8.38.18.57.98.2±0.17.07.07.17.0±0.0
mandibular row
+ +Etymology: This subspecies is named in memory of the late Academician of the Russian Academy of Sciences Yury I. Chernov (1934-2012), a prominent Russian zoologist, biogeographer, and Arctic explorer. + +Distribution and habitat: This subspecies is endemic to the Southern Island of Novaya Zemlya, while its reliable records from the Northern Island of this archipelago are unknown ( +Fig. 1A +). It inhabits a broad range of meadow-like ( +Fig. 1B +) and tundra habitats. + + +Comments: The species delimitation modeling ( +Fig. 2 +) suggests that + +Lemmus lemmus + +and + +L. sibiricus + +may belong to one polymorphic species, although molecular distances between these taxa correspond to an interspecific difference ( +Tables 4 +-5) supporting the modern concept of two young allopatric species ( + +Lagerholm +et al. +2014 + +, +2017 +; +Abramson & Petrova 2018 +; +Wilson & Reeder 2005 +; + +Wilson +et al. +2017 + +; Abramson +et al. +2018). + + + + \ No newline at end of file diff --git a/data/39/5F/EB/395FEB71FFE5FFB254AAFBB0FB64FAC5.xml b/data/39/5F/EB/395FEB71FFE5FFB254AAFBB0FB64FAC5.xml new file mode 100644 index 00000000000..9bd7b0fa376 --- /dev/null +++ b/data/39/5F/EB/395FEB71FFE5FFB254AAFBB0FB64FAC5.xml @@ -0,0 +1,222 @@ + + + +New records of the water mite genus Hygrobates Koch, 1877 from Kyrgyzstan (Acari, Hydrachnidia, Hygrobatidae), with the description of one new species + + + +Author + +Pešić, Vladimir +Department of Biology, University of Montenegro, Cetinjski put b. b., 81000 Podgorica, Montenegro. E-mail: vladopesic @ gmail. com + + + +Author + +Smit, Harry +Naturalis Biodiversity Center, P. O. Box 9517, 2300 RA Leiden, the Netherlands. E-mail: harry. smit @ naturalis. nl + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-05 + + +39 + + +7 +14 + + + + +http://dx.doi.org/10.37828/em.2021.39.2 + +journal article +10.37828/em.2021.39.2 +2336-9744 +13232799 +urn:lsid:zoobank.org:pub:0546B032-4AFE-420F-BEAD-A9E6C791BD1C + + + + + + + +Hygrobates kirgizicus +Sokolow, 1935 + + + + + + + +Figs. 1-2 + + + + +Material examined +— + +Kyrgyzstan +: KR26 +Kochkor region +, rheocrenes + slow flowing stream, along road +Kochkor-Balysky +, +42º16.391' N +, +75º51.204' E +, + +1761 m +asl + +., + +15.viii.2013 + +leg. +Pešić +& +Smit +, 24/21/2 (2/1/0 dissected and slide mounted) + +. + + +Morphology +— Both sexes: Integument finely striated; dorsal and ventrocaudal idiosoma without sclerotized muscle insertions. Posteromedial margin of Cx-I+II parabola-shaped. Cx-IV sub-triangular, with anterior and posterior margins converging towards the median line ( +Figs. 1 +A-B). Acetabula rounded, in triangular arrangement. P-2 distoventrally protruding in a short, rounded projection covered by small denticles, P-3 with denticles covering distal two thirds of ventral margin, P-4 slightly protruding near ventral setae insertions ( +Figs. 1 +F-G). IV-L-6 proximoventral seta similar in size to distoventral one ( +Fig. 2A +), L 7-8 µm. Male: Anterior margin of genital field convex with a small knob- shaped medial projection, posterior margin indented, with a medial protrusion ( +Figs. 1 +C-D). Female: Medial margin of the genital plate indented in the centre. + + +Measurements +. +Male +(n=1) — Idiosoma: L 975, W 800; coxal field: L 453; Cx-III W 575; mL of CxI + gnathosoma L 377; distance between lateralmost ends of Cx-II apodemes, 175; genital field L/W 225/181, ratio 1,24; L Ac-1-3: 61-66, 69, 70-75. Ejaculatory complex ( +Fig. 3E +) 163. + +Palp – total L 509; dL/H, dL/H ratio: P-1, 38/47, 0.82; P-2, 144/88, 1.64; P-3, 97/73, 1.33; P-4, 167/43 [basal 42], 3.9 [4.0]; P-5, 63/23, 2.75; P-2/P-4 ratio 0.86. Chelicera total L 381, L basal segment 247, claw 140, L ratio basal segment/claw 1.8. +Legs – dL of I-L-1-6: 88, 103, 134, 200, 205, 216. dL of IV-L-1-6: 156, 159, 241, 341, 341, 312. + +Female +(n=1) — Idiosoma: L 950, W 750; coxal field: L 478; Cx-III W 641; mL of Cx-I + gnathosoma L 409; distance between lateralmost ends of Cx-II apodemes, 213; genital field L/W 216/291; genital plate L 184-199; gonopore L 188; L gonopore/genital plate ratio 0.95-1.02; L Ac-1-3: 72-77, 75-83, 53-63. + +Palp – total L 565; dL/H, dL/H ratio: P-1, 45/55, 0.82; P-2, 155/97, 1.6; P-3, 106/83, 1.28; P-4, 188/50[basal 47], 3.75 [4.0]; P-5, 71/25, 2.8; P-2/P-4 ratio 0.83. Chelicera total L 500, L basal segment 350, claw 153, L ratio basal segment/claw 2.3. +Legs – dL of I-L-1-6: 88, 116, 153, 225, 234, 234. dL of IV-L-1-6: 178, 183, 275, 375, 381, 350. + + + +Figure 1 +. Photographs of + +Hygrobates kirgizicus +Sokolow, 1935 + +(A, C-E, G – male; B, F – female): A-B – coxal and genital field; C-D – genital field; E – ejaculatory complex; F-G – palp. + + + + +Figure 2 +. + +Hygrobates kirgizicus +Sokolow, 1935 + +, male: A – IV-L-5 and -6 (arrows indicate ventral setae, 2X); B – palp. Scale bars = 100 µm. + + + + +Remarks +— Considering the morphology of palp and genital field, the specimens reported here agree with + +Hygrobates kirgizicus +Sokolow, 1935 + +, originally described from a tributary of the Chui River in the Ortotokoy valley, +Kazakhstan +(Tian Shian Mountains) at altitudes of +1700-1800 m +. In addition, +Sokolow (1935) +reported the species from a depth of +10 m +in Nizhneye Mul’tinskoye Lake ( +Altai +, +1700 m +asl, +Russia +). + + +In regard to the shape of palp and idiosoma, + +H. kirgizicus + +is most similar to + +H. longipalpis +(Hermann, 1804) + +. For a long time, the latter had been considered a species with a Holarctic distribution, but a recent study conducted by Pešić +et al +. (2019) revealed within + +H. longipalpis + +the presence of two distinct lineages, with + +H. prosiliens +Koenike, 1915 + +, for a long time considered its junior synonym and now reestablished, having a preference for standing waters, and + +H. longipalpis +s. str. + +inhabiting slow flowing sectors of running waters. From both species, + +H. kirgizicus + +can be separated in Cx-IV sub-triangular in shape, with anterior and posterior margins converging towards the median line. + + + + +Distribution +— +Kazakhstan +, +Russia +( +Altai +) ( +Sokolow 1935 +); +Kyrgyzstan +(this study). + + + + \ No newline at end of file diff --git a/data/39/5F/EB/395FEB71FFE7FFB254AAFA39FBCEF9F5.xml b/data/39/5F/EB/395FEB71FFE7FFB254AAFA39FBCEF9F5.xml new file mode 100644 index 00000000000..0cab0fc28c2 --- /dev/null +++ b/data/39/5F/EB/395FEB71FFE7FFB254AAFA39FBCEF9F5.xml @@ -0,0 +1,113 @@ + + + +New records of the water mite genus Hygrobates Koch, 1877 from Kyrgyzstan (Acari, Hydrachnidia, Hygrobatidae), with the description of one new species + + + +Author + +Pešić, Vladimir +Department of Biology, University of Montenegro, Cetinjski put b. b., 81000 Podgorica, Montenegro. E-mail: vladopesic @ gmail. com + + + +Author + +Smit, Harry +Naturalis Biodiversity Center, P. O. Box 9517, 2300 RA Leiden, the Netherlands. E-mail: harry. smit @ naturalis. nl + +text + + +Ecologica Montenegrina + + +2021 + +2021-01-05 + + +39 + + +7 +14 + + + + +http://dx.doi.org/10.37828/em.2021.39.2 + +journal article +10.37828/em.2021.39.2 +2336-9744 +13232799 +urn:lsid:zoobank.org:pub:0546B032-4AFE-420F-BEAD-A9E6C791BD1C + + + + + + + +Hygrobates bucharicus +Sokolow, 1928 + + + + + + + +Material examined +— + +Kyrgyzstan +, +Side +stream of +Shuy River +, +42°31.522' N +, +75°49.229' E +, + +1511 m +asl + +, + +11.viii.2013 + +leg. +Smit + +, 0/3/0. + + + + +Remarks +— The specimens collected in +Kyrgyzstan +agree well with the description given by +Pešić (2004) +, except for the posterior margin of Cx-I+II being rounded and not pointed. + + + + +Distribution +— Uzbekhistan, +Iran +( +Pešić 2004 +), +Kyrgyzstan +(this study). + + + + \ No newline at end of file diff --git a/data/3A/2D/87/3A2D87A5181A227887B4982EFE75F808.xml b/data/3A/2D/87/3A2D87A5181A227887B4982EFE75F808.xml new file mode 100644 index 00000000000..1456e6f8af0 --- /dev/null +++ b/data/3A/2D/87/3A2D87A5181A227887B4982EFE75F808.xml @@ -0,0 +1,250 @@ + + + +Redescription of Styphlus orthochaetinus (Reitter, 1916) from Siberia with new taxonomic data + + + +Author + +Legalov, Andrei A. +Institute of Systematics and Ecology of Animals, SB RAS, Frunze street 11, Novosibirsk, 630091, Russia. & Altai State University, Lenina 61, Barnaul, 656049, Russia. & Tomsk State University, Lenina Prospekt 36, 634050 Tomsk, Russia + + + +Author + +Reshetnikov, Sergei V. +Kropotkina street 273, Novosibirsk, 630111, Russia. E-mail: reshetnikov-art @ yandex. ru * Corresponding author. E-mail: fossilweevils @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-18 + + +40 + + +118 +124 + + + + +http://dx.doi.org/10.37828/em.2021.40.9 + +journal article +10.37828/em.2021.40.9 +2336-9744 + + + + + + + +Styphlus +( +Styphlomimus +) +orthochaetinus + +( +Reitter, 1916 +) + +, +comb. and placem. nov. + + + + + + + + +Pseudostyphlus orthochaetinus +Reitter, 1916: 197 + + +. + + + +( +Figs. 1-3 +) + + + + +Material: + + +Holotype + +. +Female +( +HNHM +), “ +Altai +”, “Siberia, +Altai +”, “ + +Pseudostyphlus orthochaetinus + +, mi, 1912, +Fn. Germ. +”, “ +Coll. Reitter +”, “ +Holotypus +, 1916, + +Pseudostyphlus orthochaetinus +Reitter + +”. +Specimens +: +1 male +( +CSRN +), +1 female +( +CSRN +), +Russia +, +Altaiskii Krai +, +Charyshskii District +, +Korgon mountain range +, + +25 km +SSW Vladimirovka + +, +E of Antonov Korgon River +, + +1960 m +a.s.l. + +, alpine meadow, +50°51’56.9” N +, +84°00’14.8” E +, + +3-4.VII. 2019 + +, +S.V. Reshetnikov. + + + + + +Description + +Body red-brown, covered with narrow decumbent light scales. Antennae and legs lighter. Even elytral interstriae with decumbent scales and odd interstriae with appressed scales. + +Male. +Rostrum equal in length to pronotum, subcylindrical, 3.5 times as long as wide, distinctly curved, with three longitudinal carinas, punctate. Antennal scrobes directed to base of rostrum, close located to lower edge of rostrum. Eyes quite large, coarsely-faceted, slightly convex, located towards bottom. Forehead flattened, punctuate, barely wider than width of rostrum basally. Temples slightly longer than eye. Vertex convex, densely punctate. Head widened behind eyes. Antennae inserted subbasally of rostrum. Scape long, 5.3 times as long as wide at apex, not reaching eye. Antennomeres 2-7 conical. Antennomere 2 about 2.0 times as long as wide in apex, 0.4 times as long as and 0.8 times as narrow as scape. Antennomere 3 1.2 times as long as wide in middle, 0.4 times as long as and 0.7 times as narrow as antennomere 2. Antennomere 4 equal in length and wide, 0.8 times as long as and slightly narrower than antennomere 3. Antennomere 5 0.9 times as long as wide, slightly shorter and wider than antennomere 4. Antennomere 6 0.8 times as long as wide, equal in length and slightly wider than antennomere 5. Antennomere 7 0.8 times as long as wide, 0.9 times as long as and 1.1 times as wide as antennomere 6. Antennomere 8 rounded, 0.7 times as long as wide, equal in length and 1.2 times as wide as antennomere 7. Antennal club compact, 2.1 times as long as wide in middle, 0.6 times as long as antennomeres 2-8 combined. Pronotum campanulate, 1.4 times as long as wide at apex, 1.1 times as long as wide in middle, 1.2 times as long as wide at base, with almost straight sides. Maximal wide before base. Disk convex, coarsely punctate. Distances between points much less diameter of points. Scutellum small, flat, semi-oval. Elytra 2.3 times as long as wide at base, 1.9 times as long as wide at middle, 3.1 times as long as wide at apical fourth, 2.5 times as long as pronotum. Humeri slightly flattened. Elytral striae distinct. Stria 9 long, not merging with stria 10 near level of metacoxa. Interstriae wide, weakly convex, 2.0-3.0 times as wide as elytral stria, finely punctate. Odd interstriae more convex. Prosternum punctate, without impression. Precoxal portion of prosternum slightly longer than length of procoxal cavity. Procoxal cavities contiguous. Postcoxal portion of prosternum two times shorter than length of procoxal cavity. Metanepisternum quite narrow, punctate. Metaventrite 1.7 times as long as length of metacoxal cavity, flattened, punctate. Abdomen flattened, densely punctate. Abdominal ventrite 1 1.2 times as long as metacoxal length. Ventrite 2 1.3 times as long as ventrite 1. Ventrites 1 and 2 weakly impressed in middle. Ventrite 3 0.5 times as long as ventrite 2. Ventrite 4 equal in length to ventrite 3. Ventrite 5 2.4 times as long as ventrite 4, without anal setae. Procoxae large, conical. Mesocoxae narrowly separated. Metacoxae transverse. Femora thickened, without tooth. Tibiae almost biconcave, with small uncus. Tarsi quite long. Tarsomere 1 conical. Tarsomere 2 wide-conical. Tarsomere 3 bilobed. Tarsomere 5 elongate. Claws free, without teeth. Length of body (without rostrum): +3.1 mm +. Length of rostrum: +0.7 mm +. + + + +Figure 1. + +Styphlus +( +Styphlomimus +) +orthochaetinus + +: a - male, dorsally, b - male, ventrally, c - female, dorsally, d - female, ventrally. Scale bar for b and d = 1.0 mm. + + + + +Figure 2. + +Styphlus +( +Styphlomimus +) +orthochaetinus + +: a – male, laterally, b – aedeagus, dorsally, с – aedeagus, laterally, c – tegmen, dorsally, c – armament of endophallus, dorsally. Scale bar for 1 = 1.0 mm, for b-d = 0.5 mm, for e = 0.2 mm. + + + +Female +. Rostrum narrower, 3.9 times as long as wide as, slightly longer than pronotum. Antennae inserted in middle of rostrum. Pronotum wider, 1.2 times as long as wide at apex, slightly shorter than wide in middle, 1.1 times as long as wide at base. Elytra 1.9 times as long as wide at base, 1.7 times as long as wide at middle, 3.4 times as long as wide at apical fourth, 2.7 times as long as pronotum. Precoxal portion of prosternum 0.8 times as long as length of procoxal cavity. Postcoxal portion of prosternum two times shorter than length of procoxal cavity. Metaventrite 1.3 times as long as length of metacoxal cavity. Abdominal ventrite 1 0.8 times as long as metacoxal length. Ventrite 2 equal to ventrite 1. Ventrites 1 and 2 without impression in middle. Ventrite 3 0.5 times as long as ventrite 2. Ventrite 4 equal in length to ventrite 3. Ventrite 5 2.1 times as long as ventrite 4, without apical carina. Length of body (without rostrum): +4.4 mm +. Length of rostrum: +0.8 mm +. + + + + +Figure 3. + +Styphlus +( +Styphlomimus +) +orthochaetinus + +, holotype. + + + + +Remarks +: Placement of this species in the genus + +Styphlus + +is based on the seven-segmented antennal funicle, punctuate pronotum, subapical inserted antennae, second tarsomere bilobed, more convex odd interstriae of the elytra with decumbent scales, and odd interstriae with appressed scales. This species belongs to the subgenus + +Styphlomimus + +based on the forehead wider than width of the rostrum basally, distinct scutellum, and simple abdominal ventrite +5 in +female. + + + + +Distribution +: Western Siberia ( +type +and present material) and probably South-Eastern +Kazakhstan +( +Davidian & Savitsky 2000 +) ( +Fig. 4 +). + + + + \ No newline at end of file diff --git a/data/40/48/87/404887BE8E129E15E688F9DE26A0F9D8.xml b/data/40/48/87/404887BE8E129E15E688F9DE26A0F9D8.xml new file mode 100644 index 00000000000..1c30641ff3d --- /dev/null +++ b/data/40/48/87/404887BE8E129E15E688F9DE26A0F9D8.xml @@ -0,0 +1,824 @@ + + + +Re-characterization of two Lithosiini species recently described from the island of Taiwan, with establishing of a new combination and the corrected checklist of the genus Aberrasine Volynkin & Huang, 2019 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-10 + + +38 + + +119 +126 + + + + +http://dx.doi.org/10.37828/em.2020.38.15 + +journal article +10.37828/em.2020.38.15 +2336-9744 +13232618 +39DF7AA5-0077-4F13-9915-EE585ACDBEC6 + + + + + + +Aberrasine shiou +( +Wu & Kishida, 2020 +) + +, + +comb. nov. + + + + + + +( +Figs 1, 2 +, +9 +, +13 +) + + + + + +Ammatho shiou + +Wu & Kishida, 2020 + + +, + +Japan +Heterocerists’ Journal + +, +293 +: 452, figs 4, 5, 12, 17 ( +Type +locality: “ +Taiwan +, +Nantou +Co., +Meifeng +, + +2,100 m + +”). + + + + +Material examined +. + + +TAIWAN + +: +2 males +, +Prov. +Nantou +, + +15 km +N of Puli + +, + +500 m + +, + +14–15.X.1996 + +, leg. +Gy. Fábián +& +F. Nemes + +, + +gen. slide +No. +: +ZSM +Arct. +2019-715 (prepared by +Volynkin +) + +; + +5 males +, +1 female +, +Prov. +Nantou +, + +5 km +SW of Tayüling + +, 121'17''E 24'09''N, + +2900 m + +, +21. + +V +.1995, leg. +M. Hreblay +& +P. Steger +; + +2 males +, +1 female +, +Prov. +Nantou +, +Tungpu +, +Yu-Shan Nat. Park +, + +1400 m + +, + +24–25.IV.1997 + +, leg. +Gy. Fábián + +& + +S. +T +. +Kovács + +; + +2 males +, +Prov. +Nantou +, + +17 km +E of Kuchsing + +, 121'00''E – 24'05''N, + +560 m + +, +Ursun Forest +Camping, 6/7. +VI +.97, lg. +C. Szaboky +& +I. Soos + +; + +2 males +, +Prov. +Nantou +, + +3 km +SW of Tsuifeng + +, 121'10''E – 24'06''N, + +2100 m + +, +22. + +V +.1995, leg. +M. Hreblay +& +P. Steger +; + +2 males +, +1 female +, +Prov. +Nantou +, + +3 km +SW of Tsuifeng + +, + +2100 m + +, + +11.X.1995 + +, +121°10'E +, +24°06'N +, leg. +Tibor Csővári +& +Pál Stéger + +; + +1 male +, +Prov. +Nantou +, + +3 km +E of Tili + +, 120'58''E – 23'47''N, + +500 m + +, +17. + +III +.1996, + +leg. +T +. +Csovary +& +P. Steger + +; + +3 females +, +Prov. +Nantou +, + +3 km +S Hoshe + +, +Yu Shan Nat. Park +, + +1400 m + +, + +16.X.1996 + +, leg. +Gy. Fábián +& +F. Nemes + +, + +gen. slide +No. +: +ZSM +Arct. +2019-716 (prepared by +Volynkin +) + +; + +1 male +, +Prov. +Nantou +, + +2100 m + +, 121'10''E – 24'06''N, + +3 km +SW of Tsuifeng + +, +5. + +VI +.1997, leg. +C. Szaboky +& +I. Soos +; + +14 males +, +1 female +, +Prov. +Kaohsiung +, + +15 km +NE +Taoyuan + +, + +1850 m + +, +07. + +VII +.1996, leg. +G. Csorba +& +L. Németh +; + +1 male +, +1 female +, +Prov. +Kaohsiung +, + +26 km +SE of +Taoyüan + +, 120'52''E – 23'17''N, + +1370 m + +, +19. + +III +.1996, leg. +M. Hreblay +& +P. Steger +; + +4 males +, +Prov. +Hualien +, + +10 km +NE of Tienchih + +, 121'20''E – 24'04''N, + +2100 m + +, +23. + +V +.1995, leg. +M. Hreblay +& +P. Steger +; + +9 males +, +Prov. +Hualien +, + +1400 m + +, +Taroko National Park +, at the +Road +8, + +2.IV.1997 + +, leg. +Csorba +& +Ronkay + +; + +7 males +, +Prov. +Taitung +, + +5 km +NW of Lirao + +, 120'59''E – 23'13''N, + +1760 m + +, +28. + +V +.1995, leg. +M. Hreblay +& +P. Steger +; + +6 males +, +3 females +, +Prov. +Taitung +, +Anmashan +, lower forest zone, + +1650 m + +, +20. + +VI +.1997, leg. +B. Herczig +& +L. Ronkay +; + +1 female +, +Prov. +Taitung +, + +350 m + +, +3 km +W village +Hungyeh +, +30. + +VI +.1997, 120'52''E, 22'28''N, lg. Csővary & Mikus; + +1 male +, +Prov. +Taitung +, + +2 km +N Liyusan + +, + +1760 m + +, + +23.X.1996 + +, leg. +Gy. Fábián +& +L. Nemes + +; + +1 male +, +Prov. +Taitung +, +Tahsuehshan Forest Recreation Area +, + +2000 m + +, +25. + +V +.1997, leg. +Gy. M. László +& +G. László +; + +1 male +, +Prov. +Taichung +, + +17 km +SW Lishan + +, +Techi Vila +, + +1500 m + +, +26–27. + +V +.1997, leg. +Gy. M. László +& +G. László +; + +1 male +, +1 female +, +Prov. +Taoyuan +, + +14 km +E of Fuhsing + +, + +800 m + +, + +28.X.1995 + + +, 121'23'E, 24'50'N, lg. Csovary & Steger; + +1 female +, +Prov. +Taoyuan +, +Ming Chyr Forest Recreation Area +, + +1160 m + +, + +17–18.IV.1997 + +, leg. +Gy. Fábián + +& + +S. +T +. +Kovács + +; + +1 female +, +Prov. +Taoyuan +, +Ming Chyr Forest Recreation Area +, + +1160 m + +, + +05– 06.X.1996 + +, leg. +Gy. Fábián +& +F. Nemes + +(MWM/ +ZSM +). + + + + +Figures 1–8. + +Aberrasine +spp. + +: adults. Depositories of the specimens: 1, 2, 5 and 6 in MWM/ZSM; 3, 4, 7 and 8 in NHMUK (©). + + + + +Figures 9–12. + +Aberrasine +spp. + +: male genitalia. Depositories of the specimens: 9 and 11 in MWM/ZSM; 10 and 12 in NHMUK (©). + + + + +Figures 13–16. + +Aberrasine +spp. + +: female genitalia. Depositories of the specimens: 13 and 15 in MWM/ZSM; 14 and 16 in NHMUK (©). + + + + +Remarks +. (1) In the original male genitalia illustration of + +A. shiou + +( +Wu & Kishida 2020 +: fig. 12), the authors erroneously provided a photo of the male genital capsule of + +Ammatho +( +Striatella +) +takamukui +(Matsumura, 1927) + +(illustrated by Volynkin +et al. +2019a: figs 188, 189) while the aedeagus illustrated belongs to + +A. shiou + +. For this reason, the species was originally described under the subgenus + +Striatella + +of the genus + +Ammatho + +. (2) For the purpose of a comparison with + +A. shiou +, +Wu & Kishida (2020 + +: fig. 13) illustrated the male genitalia of + +A. takamukui + +which, however, clearly belong to + +Ammatho +( +Striatella +) +karenkensis +(Matsumura, 1930) + +(illustrated by Volynkin +et al. +2019a: figs 194, 195) and not + +A. takamukui + +. + + + + +Diagnosis +. + +Aberrasine shiou + +is very similar externally to the form of + +A. aberrans + +lacking a discal spot of the forewing, but can be distinguished by its markedly less curved posterior part of the medial transverse fascia and the somewhat shorter subterminal area of the forewing. The male genitalia of + +A. shiou + +are very similar to those of + +A. expressa + +( +Figs 3, 4 +, +10 +, +14 +) which is easily separable externally by its smaller size and dissimilar forewing markings. Compared to that of + +A. expressa + +, the male genital capsule of + +A. shiou + +has the somewhat thicker uncus, the slightly shorter vinculum, the broader valva with the more convex costa, the larger distal costal process directed rather dorsally (whereas it is smaller and directed distally in + +A. expressa + +), and the more robust distal saccular process. The vesica configuration of + +A. expressa + +is unknown, but the smaller cluster of spines is wider and the elongate cluster of spines is conspicuously longer in + +A. shiou + +. The female genitalia of + +A. shiou + +differ from those of + +A. expressa + +by the longer apophyses anteriores, the shorter and narrower ductus bursae, the shorter corpus bursae with the spinulose posterior section (it is evenly weakly sclerotized and lacking spinules in + +A. expressa + +), and the somewhat longer appendix bursae more densely covered in larger spinules. + + + + +Distribution +. The species is endemic to +Taiwan Island +. + + + + \ No newline at end of file diff --git a/data/40/48/87/404887BE8E169E16E688F9DE26A0FB2E.xml b/data/40/48/87/404887BE8E169E16E688F9DE26A0FB2E.xml new file mode 100644 index 00000000000..9899c533196 --- /dev/null +++ b/data/40/48/87/404887BE8E169E16E688F9DE26A0FB2E.xml @@ -0,0 +1,661 @@ + + + +Re-characterization of two Lithosiini species recently described from the island of Taiwan, with establishing of a new combination and the corrected checklist of the genus Aberrasine Volynkin & Huang, 2019 (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Av. 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Av., 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-10 + + +38 + + +119 +126 + + + + +http://dx.doi.org/10.37828/em.2020.38.15 + +journal article +10.37828/em.2020.38.15 +2336-9744 +13232618 +39DF7AA5-0077-4F13-9915-EE585ACDBEC6 + + + + + + +Aberrasine lichenshihi +Wu & Kishida, 2020 + + + + + + +( +Figs 5, 6 +, +11 +, +15 +) + + + + + +Aberrasine lichenshihi + +Wu & Kishida, 2020 + + +, + +Japan +Heterocerists’ Journal + +, +293 +: 454, figs 7, 8, 14, 18 ( +Type +locality: “ +Taiwan +, +Taipei +Co., +Wulai +, +Fushan +, + +310 m + +,”). + + + + +Material examined +. + + +TAIWAN + +: +1 male +, +Prov. +Nantou +, + +10 km +SE Shenmu + +, +Yushan Nat. Park +, + +2200m + +, + +14.III.1996 + +, leg. +Gy. Fábián +& +L. Németh + +, + +gen. slide +No. +: +ZSM +Arct. +2019-719 (prepared by +Volynkin +) + +; + +6 males +, +3 females +, +Prov. +Nantou +, + +3 km +SW of Tsuifeng + +, + +2100 m + +, 31.X.96, ( +121°10'E +, +24°06'N +), leg. +T +. +Csővári +& +C. Szaboky + +; + +2 males +, +2 females +, +Prov. +Nantou +, + +3 km +SW of Tsuifeng + +, + +2100 m + +, 25/ + + +26. +VI +.1997 + + +, 121'10''E, 24'06''N, lg. +Csővári +& +Mikus + +; + +1 female +, +Prov. +Nantou +, +Tungpu +, Yu- +Shan Nat. Park +, + +1400 m + +, + +24– 25.IV.1997 + +, leg. +Gy. Fábián + +& + +S. +T +. +Kovács + +; + +1 female +, +Prov. +, +Taipei +, + +10 km +SE of Pinglin + +, +Pihou +, + +450m + +, + + +3. +V +.1997 + + +, leg. +Gy. Fábián + +& + +S. +T +. +Kovács +, gen. slide +No. +: +ZSM +Arct. +2019-726 (prepared by +Volynkin +) + +; + +2 males +, +Prov. +Taichung +, +Tahsuehshan Forest Recreation Area +, + +2000 m + +, + + +25. +V +.1997 + + +, leg. +Gy. M. László +& +G. László + +; + +2 males +, +Prov. +Taichung +, +Hui Sun Exp. Forest +, +Guandashi +LTER +site, + +950 m + +, 24°04'49'', 121°02'08'', + +12–13.IV.1997 + +, leg. +Peregovits +& +Kun + +; + +2 males +, +Prov. +Taitung +, +Mutien +, + +1500 m + +, + + +21. +V +.1997 + + +, leg. +Gy. M. László +& +G. László + +; + +1 male +, +Prov. +Taitung +, above +Liyuan +, + +1950 m + +, upper forest zone, + + +15. +VI +.1997 + + +, leg. +B. Herczig +& +L. Ronkay + +; + +3 females +, +Prov. +Miaoli +, + +20 km +E of Tungshih + +, + +1335 m + +, 18.X.95 ( +121°03'E +, +24°19'N +), leg. +T +. +Csővári +& +P. Stéger + +; + +1 female +, +Prov. +Taoyuan +, + +7 km +E of Fuhsing + +, 121'23''E – 24'49''N, + + +28– 29.XI. +1997 + + +, 600 m, leg. +S. Simonyi +& +A. Szabo + +; + +3 males +, +Prov. +Pingtung +, + +10 km +SE of Mutan + +, + +470 m + +, 03/ + +04.VII.1996 + +, leg. +G. Csorba +& +L. Németh + +; + +1 female +, +Prov. +Kaohsiung +, + +26 km +SE of +Taoyüan + +, + +1370 m + +, 4.XI.96 ( +120°52'E +, +23°17'N +), leg. +T +. +Csővári +& +C. Szaboky + +; + +1 male +, +Prov. +Kaohsiung +, + +3 km +E Chiashen + +, + +460 m + +, + +18.X.1996 + +, leg. +Gy. Fábián +& +F. Nemes + +; + +1 female +, +Prov. Ilan +, + +1550 m + +, +Suyuan +, near +Pinan +, at the +Road +7/1, + + +6. +VI +.1997 + + +, leg. +B. Herczig +& +L. Ronkay + +(MWM/ +ZSM +). + + + + +Remarks +. (1) In the original female genitalia illustration of + +A. lichenshihi + +( +Wu & Kishida 2020 +: fig. 18), the authors erroneously provided a photo of an unidentified species of the genus + +Nephelomilta +Hampson, 1900 + +most similar to + +Nephelomilta karenkonis + +(illustrated by +Volynkin & Černý 2018 +: fig. 140). (2) In the original diagnosis ( +Wu & Kishida 2020 +), the species was compared with the genitally rather dissimilar + +A. aberrans + +and not the closely related + +A. dingjiai + +( +Figs 7, 8 +, +12 +, +16 +) described recently from Lanyu Island ( + +Hsu +et al. +2018 + +). The comparison with the latter is provided below. + + + + +Diagnosis +. + +Aberrasine lichenshihi + +is similar externally to + +A. aberrans + +(illustrated by + +Volynkin +et al. +2019b + +and +Wu & Kishida 2020 +) and + +A. peraffinis + +(illustrated by Volynkin 2018), but differs from the former one by its slightly more reddish forewing coloration and the posterior part of the medial line curved closer to the antemedial line (in + +A. aberrans + +, the area between the lines is markedly wider), and from the latter one by the antemedial line more strongly angular in the cell and the sinuous medial line (it is nearly straight in + +A. peraffinis + +). The male genitalia of + +A. lichenshihi + +are very similar to those of + +A. dingjiai + +which has clearly different forewing pattern. The male genital capsule of + +A. lichenshihi + +differs from that of + +A. dingjiai + +by the longer and wider distal section of costa which is more strongly curved dorsad, and the somewhat larger ventral plate of the costa. The aedeagus of + +A. lichenshihi + +is conspicuously smaller than that of + +A. dingjiai + +. Compared to that of + +A. dingjiai + +, the vesica of + +A. lichenshihi + +is narrower and slightly shorter, the elongate cluster consists of thinner but more numerous spines, and the smaller cluster of spines is wider. In the female genitalia of + +A. lichenshihi + +, the ductus bursae is wider and somewhat narrower, the corpus bursae is longer and the sclerotized area of its posterior end is wider than in + +A. dingjiai + +. Additionally, the appendix bursae of + +A. lichenshihi + +is slightly longer than in + +A. dingjiai + +and covered in more numerous but smaller spinules. + + + + +Distribution +. The species is endemic to +Taiwan Island +. + + + + \ No newline at end of file diff --git a/data/60/1D/6B/601D6B40F250E36DFF3EF98BFEAAFE60.xml b/data/60/1D/6B/601D6B40F250E36DFF3EF98BFEAAFE60.xml new file mode 100644 index 00000000000..64e05e61b71 --- /dev/null +++ b/data/60/1D/6B/601D6B40F250E36DFF3EF98BFEAAFE60.xml @@ -0,0 +1,259 @@ + + + +A new species of Agdistis Hübner, 1825 (Lepidoptera: Pterophoridae) from Tajikistan + + + +Author + +Ustjuzhanin, Petr +Altai State University, Lenina 61, Barnaul, 656049, Russia. & Biological Institute, Tomsk State University, Lenina Prospekt 36, Tomsk 634050, Russia. + + + +Author + +Kovtunovich, Vasily +Moscow Society of Nature Explorers, Bolshaya Nikitskaya 2, Moscow, RU- 125009, Russia. E-mail: vasko- 69 @ mail. ru + + + +Author + +Streltzov, Alexander +Herzen State Pedagogical University of Russia, 48, Moika Emb., Saint-Petersburg, 191186, Russia. E-mail: streltzov @ mail. ru Corresponding author. E-mail: petrust @ mail. ru + + + +Author + +. + + + +Author + +. + + + +Author + +-,. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-24 + + +38 + + +245 +248 + + + + +http://dx.doi.org/10.37828/em.2020.38.33 + +journal article +300848 +10.37828/em.2020.38.33 +351e780b-9c8a-464f-a84b-2d5e77e541fe +2336-9744 +13232221 +urn:lsid:zoobank.org:pub:E4F4DC88-AEC9-4F8B-BD0D-1649C36A5386 + + + + + + +Agdistis paki +Ustjuzhanin & Kovtunovich + +, +sp. nov. + + + + + +( +Figs 1-4 +) + + + + +Type material +: + +Holotype +, male ( +ZISP +, gen.pr. Nr. 1929), +TAJIKISTAN +, +Khozratishoh Mt. Range +, +Shuroabad distr. +, + +8 km +ESE Shuroabad + +, +Tiryay Mts. +, + +1635 m + +, +37°49'20"N +, +70°07'40"E +, + +15.vii.2018 + +, +O. Pak + +. + +Paratype +, +1 female +( +ZISP +, gen.pr. Nr. 1930), same locality and data + +. + + +External characters + + +Wingspan +19 mm +. Head covered with clinging grey scales, forehead tapered; labial palpi light-grey, short, directed upwards. Antennae more or less ringed with brown-white scales, shortly ciliated. Thorax and tegulae covered with clinging light-grey scales. Fore wing grey-brown with four dark spots of scales along costal edge and medially. Hind wing grey unicolorous. + + + +Figure 1 +. + +Agdistis paki +Ustjuzhanin & Kovtunovich + +, + +sp. nov +. + +Holotype, male (ZISP). + + + +Male genitalia + +Valves symmetric, elongated, narrow-oval, widened in medium part, apically narrow; costal arms of equal length, with finger-like processes on apices. Uncus narrow, straight. Tegumen wide. Sternum VIII with Vshaped notch, forming two equal prongs basally wide, distally narrow. Aedeagus arched, with process in medium part. + +Female genitalia + +Papillae anales narrow-triangle. Posterior apophyses thin, straight, twice longer than papillae anales. Anterior apophyses short, wide. Lamina vaginalis consists of two wide lobes, forming narrow notch in medium part. Antrum narrow, tubulate, strongly sclerotized, ductus bursae short, slightly wider than antrum; bursa copulatrix poorly sclerotized, oval. Sternum VII with auricular appendages laterally. + + + +Differential diagnosis +. In the male genitalia, in the shape of the tegumen and uncus and in the general structure of the valves and aedeagus, the new species is close to + +A. iranica + +, but clearly differs in the wider valve and another structure of the processes on the costal edge of the valves. Moreover, in the new species the aedeagus is more curved and has a process in the medium part, while in + +A. iranica + +it is less curved and has no similar process. The prongs on sternum VIII in the new species are of equal length, while in + +A. iranica + +they are different in length and shape. In the female genitalia, in the shape of the lamina vaginalis, auricular appendages on the lateral sides of sternum VII and presence of the anterior apophyses, the new species is close to + +A. falkovitshi +Zagulajev, 1986 + +, but reliably differs in the narrow tubulate antrum. + + + +Figures 2−3. + +Agdistis paki +Ustjuzhanin & Kovtunovich + +, + +sp. nov +. + +2 +(Left). Holotype, male genitalia (ZISP, Slide Nr. 1929); +3 +(Right). Paratype, female genitalia (ZISP, Slide Nr. 1930). + + + + +Figure 4 +. + +Agdistis paki +Ustjuzhanin & Kovtunovich + +, + +sp. nov +. + +Biotope (photo by Oleg Pak). + + + +Flight period. +July. + + + + +Distribution +. +Tajikistan +(Khozratishoh Mountains Range). + + + + +Etymology +. The species is named after the Ukrainian entomologist Oleg Pak who collected the new species in +Tajikistan +. + + + + \ No newline at end of file diff --git a/data/87/7A/AD/877AAD7B7F7FFF8F1481FDDFFBD4F832.xml b/data/87/7A/AD/877AAD7B7F7FFF8F1481FDDFFBD4F832.xml new file mode 100644 index 00000000000..f7aef31bf9e --- /dev/null +++ b/data/87/7A/AD/877AAD7B7F7FFF8F1481FDDFFBD4F832.xml @@ -0,0 +1,212 @@ + + + +Wittoecia - a new genus of Zeuzerinae (Lepidoptera, Cossidae) from the Federal Democratic Republic of Ethiopia + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-08-04 + + +34 + + +1 +7 + + + + +http://dx.doi.org/10.37828/em.2020.34.1 + +journal article +10.37828/em.2020.34.1 +2336-9744 +13232071 +urn:lsid:zoobank.org:pub:D9ED9E59-18C6-4DD0-BC0E-EB3D91C259EC + + + + + + + +Wittoecia + +gen. n. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +C6EC2069-700E-44AF-8DE1-0CD9583CE1E1 + + + + + +Type +species (by monotypy) + +Azygophleps brehmi +Yakovlev & Witt, 2016 + +( +Figs 1−2 +, +8 +) + + + + +Description +. Size medium (fore wing length +22−24 mm +). Antenna goblet- like, bipectinate, very long crest processes in two proximal thirds of antenna (processes 4 times longer than rod diameter), very short crest processes in distal third (processes equal to antenna rod diameter). Thorax and abdomen covered with lightyellow hairs. Fore wing elongated, creamy, with reticulated pattern of black strokes: more dense and wide along costa, anal edge and in distal cell, significantly thinner submarginally. No pattern of strokes in cubital area. Hind wing creamy, with poorly expressed reticulated pattern of thin grey undulated strokes in submarginal and marginal areas (except for anal area). Fringe on all wings light-creamy, almost white. + +Male genitalia (GenPrMWM 25284, 33185). Uncus short, triangle, apically sharp; tegumen wide; gnathos arms short, not fused, basally thick, distally narrowing gradually; valve narrow, long, with smooth parallel edges, apically rounded; juxta large, oval, with small semicircular cut on dorsal surface; saccus long, massive, tapered, apically sharp; aedeagus thin, 1/4 shorter than valve, basally thick, slightly narrowing to distal end, slightly curved throughout its length, small rod-like cornutus in lateral surface of vesica. +Female unknown. + + + +Diagnosis +. Externally, the new genus is most close to the genus + +Azygophleps + +( +Figs 3−4 +, +9−10 +), from which it clearly differs in the male genitalia (in + +Azygophleps +, + +the aedeagus is thick with a large cornutus in the lateral surface of the vesica, the gnathos arms are long and thin, not fused). From the genus + +Phragmacossia +Schawerda, 1924 + +( +type +species, by original designation − + +Phragmatoecia +(sic) +reticulata +Püngeler, 1900 + +) ( +Figs 5 +, +11 +) distributed in the south of Palaearctic and south-east Asia the new genus differs in a more variable pattern on the fore wing, the massive uncus and the short gnathos arms. In the male genital structure, it is most close to the genus + +Phragmataecia +Newman, 1850 + +( +type +species, by monotypy − + +Noctua arundinis +Hübner, 1808 + +) ( +Figs 6 +, +12 +), widely spread in the Palaearctic and Paleotropics, from which it differs in the more variable fore wing pattern, larger size and very thick base of the uncus. Externally, the new genus resembles to the genus + +Zeuzeropecten +Gaede, 1930 + +( +type +species, by original designation − + +Zeuzeropecten lactescens +Gaede, 1930 + +) ( +Figs 7 +, +13 +), distributed in east Africa and +Madagascar +, but differs in its very short saccus (in + +Zeuzeropecten +sp. + +, the saccus is very long) and longer uncus (in + +Zeuzeropecten +sp. + +, the uncus is very short). + + +Composition +. The new genus is monotypic, it includes only one species – + +Wittoecia brehmi +( +Yakovlev & Witt, 2016 +) + + +comb. n. + + + + + +Distribution +. Recorded only for Central +Ethiopia +( +Oromia region +) ( +Fig. 14 +). + + +Habitat +. Mountain forests on the alt. of +2350−2388 m +( +Fig. 15 +). Adult flight period: April–May. + + + + +Etymology +. The new genus is named after Thomas J. Witt (1947−2019) ( +Fig. 16 +) the world largest collector of +Lepidoptera +, founder of the Witt Museum (Munich, +Germany +), organizer of the fund “Thomas- Witt- Stiftung zur Förderung der Wissenschaft und Forschung im Bereich der Zoologischen Systematik”. Thomas J. Witt was awarded with the Ritter-von-Spix-Medal of Zoologischen Staatssammlung Munchen in 2001. He also received an honorary doctorate from the University of Munich in 2013. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA5859FFB765B8FA1BFD47CE8B.xml b/data/8B/0C/87/8B0C87FA5859FFB765B8FA1BFD47CE8B.xml new file mode 100644 index 00000000000..8b57f3a55f7 --- /dev/null +++ b/data/8B/0C/87/8B0C87FA5859FFB765B8FA1BFD47CE8B.xml @@ -0,0 +1,836 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +RHYACOPHILIDAE Stephens, 1836 + + + + + + + +Genus: + +Rhyacophila +Pictet, 1834 + + + + + +Rhyacophila aurata +Brauer, 1857 + + + +D1: +12.07.2010 +. +1 ♀ +- l, D3: +25.05.2010 +. +1 ♂ +, +1 ♀ +- l, D5: +15.06.2010 +. +1 ♀ +- l, +23.09.2010 +. +1 ♀ +- e, +25.09.2010 +. +1 ♀ +- l, +24.10.2010 +. +1 ♀ +- e, +13.11.2010 +. +1 ♂ +, +2 ♀♀ +- l, D6: +6.07.2010 +. +1 ♂ +- l, +27.09.2010 +. +1 ♂ +, +1 ♀ +- l, +14.11.2010 +. +2 ♂♂ +- l, D7: +15.09.2010 +. +1 ♀ +- e, +16.09.2010 +. +13 ♂♂ +, +6 ♀♀ +- l, D8: +13.09.2010 +. +1 ♂ +- l, +14.10.2010 +. +1 ♀ +- l, K1: +27.05.2010 +. +1 ♀ +- l, +24.08.2010 +. +1 ♂ +- l, K2: +27.05.2010 +. +1 ♀ +- e, +29.06.2010 +. +2 ♂♂ +- l, +24.08.2010 +. +2 ♂♂ +- l, +30.09.2010 +. +1 ♀ +- l, +23.10.2010 +. +3 ♀♀ +- l, K3: +15.11.2009 +. +1 ♀ +- e, +15.11.2009 +. +4 ♂♂ +, +5 ♀♀ +- l, +28.04.2010 +. +1 ♂ +- l, +27.05.2010 +. +4 ♂♂ +, +3 ♀♀ +- l, +29.06.2010 +. +10 ♂♂ +, +2 ♀♀ +- l, +27.07.2010 +. +2 ♂♂ +, +4 ♀♀ +- l, +31.08.2010 +. +12 ♂♂ +, +1 ♀ +- l, +29.09.2010 +. +3 ♂♂ +, +1 ♀ +- l, +30.09.2010 +. +1 ♀ +- e, +23.10.2010 +. +16 ♂♂ +, +8 ♀♀ +- l, +31.10.2010 +. +9 ♂♂ +, +2 ♀♀ +- e, +15.11.2010 +. +1 ♀ +- e, +15.11.2010 +. +2 ♂♂ +, +5 ♀♀ +- l, SR: +27.06.2010 +. +1 ♂ +- l, KK: +15.07.2010 +. +1 ♂ +- l. + + + +Rhyacophila dorsalis persimilis +McLachlan, 1879 + + + +D2: +12.06.2010 +. +2 ♂♂ +- l, +30.07.2010 +. +1 ♂ +- e, +22.08.2010 +. +1 ♂ +, +1 ♀ +- l, +28.09.2010 +. +1 ♀ +- l, D6: +19.08.2010 +. +1 ♂ +- e, +14.11.2010 +. +1 ♂ +- l, D7: +24.05.2010 +. +1 ♀ +- l, D8: +11.06.2010 +. +1 ♂ +- l, +14.10.2010 +. +1 ♂ +- l, K2: +24.08.2010 +. +1 ♂ +- l, K3: +15.11.2009 +. +1 ♀ +- l, +29.06.2010 +. +2 ♂♂ +- l, +27.07.2010 +. +2 ♂♂ +, +1 ♀ + + +- l, +31.08.2010 +. +2 ♀♀ +- l, +15.11.2010 +. +1 ♂ +, +1 ♀ +- l. + + + +Rhyacophila fasciata +Hagen, 1859 + + + +D1: +30.04.2010 +. +1 ♀ +- e, +30.05.2010 +1 ♂ +- e, +30.05.2010 +1 ♀ +- l, +12.06.2010 +. +5 ♂♂ +, +1 ♀ +- l, +12.07.2010 +. +1 ♂ +- l, +22.08.2010 +. +4 ♂♂ +, +5 ♀♀ +- l, +29.08.2010 +. +1 ♀ +- e, +28.09.2010 +. +2 ♂♂ +- e, +28.09.2010 +. +1 ♂ +- l, D3: +24.12.2009 +. +1 ♂ +- l, +8.04.2010 +. +1 ♂ +- l, +25.05.2010 +. +1 ♂ +- l, +23.06.2010 +. +1 ♂ +- l, D4: +24.12.2009 +. +1 ♂ +- l, +24.05.2010 +. +3 ♂♂ +- l, +28.06.2010 +. +1 ♀ +- e, +28.06.2010 +. +1 ♂ +- l, +30.10.2010 +. +1 ♂ +- l, D5: +8.07.2010 +. +1 ♂ +- l, D6: +12.10.2010 +. +1 ♂ +- e, D8: +14.10.2010 +. +1 ♀ +- l, K1: +15.11.2009 +. +1 ♀ +- e, +15.11.2009 +. +13 ♂♂ +, +5 ♀♀ +- l, +27.05.2010 +. +8 ♂♂ +- l, +30.06.2010 +. +1 ♂ +, +1 ♀ +- e, +30.06.2010 +. +26 ♂♂ +- l, +31.07.2010 +. +13 ♂♂ +, +2 ♀♀ +- l, +24.08.2010 +. +31 ♂♂ +- l, +29.10.2010 +. +2 ♂♂ +, +1 ♀ +- l, K2: +15.11.2009 +. +1 ♀ +- e, +15.11.2009 +. +7 ♂♂ +, +2 ♀♀ +- l, +27.05.2010 +. +3 ♂♂ +, +2 ♀♀ +- e, +27.05.2010 +. +2 ♂♂ +- l, +29.06.2010 +. +8 ♂♂ +- l, +31.07.2010 +. +6 ♂♂ +- l, +24.08.2010 +. +1 ♂ +- l, +29.09.2010 +. +1 ♂ +- e, +30.09.2010 +. +1 ♂ +- l, +23.10.2010 +. +5 ♂♂ +, +1 ♀ +- l, +20.11.2010 +. +2 ♂♂ +- l, K3: +15.11.2009 +. +9 ♂♂ +, +1 ♀ +- l, +28.04.2010 +. +2 ♂♂ +- l, +27.05.2010 +. +5 ♂♂ +- l, +29.06.2010 +. +10 ♂♂ +- l, +27.07.2010 +. +3 ♂♂ +- l, +31.08.2010 +. +3 ♂♂ +- l, +29.09.2010 +. +2 ♂♂ +- l, +30.09.2010 +. +1 ♂ +- e, +23.10.2010 +. +4 ♂♂ +, +1 ♀ +- l, +31.10.2010 +. +1 ♂ +, +4 ♀ +- e, +15.11.2010 +. +1 ♀ +- l, ZM: +12.05.2010 +. +1 ♂ +- l, +25.06.2010 +. +1 ♂ +- e, +23.08.2010 +. +2 ♂♂ +- l, +24.10.2010 +. +1 ♀ +- e, +24.10.2010 +. +1 ♂ +- l, KK: +15.07.2010 +. +1 ♂ +- l. + + + +Rhyacophila laevis +Pictet, 1834 + + + +D1: +30.05.2010 +. +4 ♂♂ +- e. + + + +Rhyacophila palmeni +McLachlan, 1879 + + + +D2: +15.11.2010 +. +1 ♀ +- l, D5: +18.11.2009 +. +1 ♂ +- l, +15.06.2010 +. +1 ♂ +- l, +27.08.2010 +. +1 ♂ +- l, +25.09.2010 +. +3 ♂♂ +- l, D6: +19.05.2010 +. +1 ♀ +- l, +10.06.2010 +. +1 ♀ +- l, +19.08.2010 +. +8 ♀♀ +- l, +27.09.2010 +. +1 ♀ +- l, +13.10.2010 +. +2 ♀♀ +- l, +5.11.2010 +. +2 ♂♂ +, +1 ♀ +- e, +14.11.2010 +. +1 ♂ +- l, D7: +9.06.2010 +. +1 ♀ +- l, +29.07.2010 +. +1 ♂ +- e, +18.08.2010 +. +1 ♂ +, +1 ♀ +- l, +15.09.2010 +. +2 ♀♀ +- e, +16.09.2010 +. +8 ♂♂ +, +9 ♀♀ +- l, +12.10.2010 +. +2 ♂♂ +- e, +11.11.2010 +. +1 ♂ +- l, D8: +30.11.2009 +. +4 ♂♂ +, +1 ♀ +- l, +14.05.2010 +. +1 ♂ +- e, +14.07.2010 +. +1 ♂ +- l, +27.08.2010 +. +1 ♂ +- l, +13.09.2010 +. +1 ♀ +- l, +14.10.2010 +. +2 ♂♂ +, +2 ♀♀ +- l, +23.10.2010 +. +3 ♂♂ +- e, +7.11.2010 +. +1 ♂ +- e, +7.11.2010 +. +1 ♂ +- l, K3: +27.07.2010 +. +1 ♀ +- l, +31.10.2010 +. +1 ♂ +, +1 ♀ +- e, +15.11.2010 +. +1 ♂ +- l, KK: +6.11.2010 +. +1 ♂ +- e, +7.11.2010 +. +1 ♀ +- l. + + + +Rhyacophila schmidinarica +Urbanič, Krušnik & Malicky, 2000 + + + +D1: +30.05.2010 +. +1 ♂ +- e, +12.06.2010 +. +1 ♂ +- e, +12.07.2010 +. +2 ♂♂ +- l, +22.08.2010 +. +1 ♂ +, +3 ♀♀ +- l, +28.09.2010 +. +1 ♂ +- l, +15.11.2010 +. +1 ♂ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585AFFB665B8F8A1FDFDCF85.xml b/data/8B/0C/87/8B0C87FA585AFFB665B8F8A1FDFDCF85.xml new file mode 100644 index 00000000000..59f55124fbb --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585AFFB665B8F8A1FDFDCF85.xml @@ -0,0 +1,659 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +HYDROPTILIDAE Stephens, 1836 + + + + + + + +Genus: + +Hydroptila +Dalman, 1834 + + + + + +Hydroptila forcipata +Eaton, 1873 + + + +D3: +29.04.2010 +. +2 ♂♂ +, +9 ♀♀ +- l, +25.05.2010 +. +1 ♀ +- l, +23.06.2010 +. +1 ♀ +- l, D4: +24.05.2010 +. +2 ♀♀ +- l, + + +28.06.2010 +. +2 ♂♂ +, +1 ♀ +- l, +25.08.2010 +. +2 ♂♂ +, +3 ♀♀ +- l, D5: +25.04.2010 +. +7 ♀♀ +- l, +26.05.2010 +. +9 ♂♂ +, +21 ♀♀ +- l, D6: +10.06.2010 +. +1 ♀ +- l, +19.08.2010 +. +12 ♂♂ +, +50 ♀♀ +- l, D7: +9.06.2010 +. +2 ♀♀ +- l, +7.07.2010 +. +1 ♂ +, +2 ♀♀ +- l, +18.08.2010 +. +1 ♂ +- l, +16.09.2010 +. +3 ♂♂ +, +20 ♀♀ +- l, D8: +27.04.2010 +. +24 ♂♂ +, +2 ♀♀ +- l, +14.05.2010 +. +1 ♀ +- l, +11.06.2010 +. +9 ♀♀ +- l, +18.06.2010 +. +1 ♀ +- e, +14.07.2010 +. +14 ♂♂ +, +58 ♀♀ +- l, +27.08.2010 +. +10 ♂♂ +, +18 ♀♀ +- l, K3: +27.07.2010 +. +1 ♀ +- l, KK: +27.04.2010 +. +42 ♂♂ +, +77 ♀♀ +- l, +18.06.2010 +. +1 ♀ +- l, +15.07.2010 +. +1 ♂ +, +11 ♀♀ +- l. + + + +Hydroptila lotensis +Mosely, 1930 + + + +D3: +29.04.2010 +. +3 ♂♂ +- l, +25.05.2010 +. +8 ♂♂ +- l, D4: +24.05.2010 +. +2 ♂♂ +- l, +25.08.2010 +. +2 ♂♂ +- l, D5: +26.05.2010 +. +1 ♂ +- l, D6: +19.08.2010 +. +2 ♂♂ +- l, D7: +9.06.2010 +. +1 ♂ +- l, D8: +27.04.2010 +. +2 ♂♂ +- l, +14.05.2010 +. +4 ♂♂ +- l, +11.06.2010 +. +39 ♂♂ +- l, +18.06.2010 +. +1 ♂ +- e, +14.07.2010 +. +7 ♂♂ +- l, +27.08.2010 +. +12 ♂♂ +- l, ZM: +23.08.2010 +. +1 ♂ +- l, KK: +18.06.2010 +. +4 ♂♂ +- l, +15.07.2010 +. +58 ♂♂ +- l. + + + +Hydroptila tigurina +Ris, 1894 + + + +D4: +24.05.2010 +. +1 ♀ +- l, +25.08.2010 +. +2 ♂♂ +, +1 ♀ +- l, D5: +15.06.2010 +. +1 ♀ +- l, D6: +19.08.2010 +. +34 ♂♂ +, +209 ♀♀ +- l, D7: +7.07.2010 +. +3 ♀♀ +- l, +18.08.2010 +. +15 ♂♂ +, +13 ♀♀ +- l, +16.09.2010 +. +3 ♀♀ +- l, D8: +11.06.2010 +. +4 ♂♂ +, +16 ♀♀ +- l, +14.07.2010 +. +20 ♂♂ +, +50 ♀♀ +- l, +27.08.2010 +. +1 ♂ +, +11 ♀♀ +- l, +13.09.2010 +. +7 ♂♂ +, +108 ♀♀ +- l, KK: +15.07.2010 +. +2 ♂♂ +, +3 ♀♀ +- l, +17.08.2010 +. +1 ♂ +, +23 ♀♀ +- l. + + + +Hydroptila tineoides +Dalman, 1819 + + + +D3: +29.04.2010 +. +10 ♂♂ +, +9 ♀♀ +- l, KK: +27.04.2010 +. +10 ♂♂ +, +5 ♀♀ +- l. + + + +Hydroptila +sp. + + + +D3: +29.04.2010 +. +13 ♀♀ +- l, +25.05.2010 +. +25 ♀♀ +- l, +23.06.2010 +. +3 ♀♀ +- e, D4: +24.05.2010 +. +19 ♀♀ +- l, +25.08.2010 +. +9 ♀♀ +- l, D5: +26.05.2010 +. +35 ♀♀ +- l, +15.06.2010 +. +1 ♀ +- l, D6: +19.08.2010 +. +30 ♀♀ +- l, D7: +7.07.2010 +. +1 ♀ +- l, +18.08.2010 +. +4 ♀♀ +- l, +16.09.2010 +. +1 ♀ +- l, D8: +11.06.2010 +. +310 ♀♀ +- l, +18.06.2010 +. +1 ♀ +- e, +14.07.2010 +. +32 ♀♀ +- l, +27.08.2010 +. +12 ♀♀ +- l, K3: +27.07.2010 +. +4 ♀♀ +- l, KK: +27.04.2010 +. +1 ♀ +- l, +18.06.2010 +. +1 ♀ +- l, +15.07.2010 +. +157 ♀♀ +- l. + + + +Genus: + +Ithytrichia +Eaton, 1873 + + + + + +Ithytrichia lamellaris +Eaton, 1873 + + + +D3: +23.06.2010 +. +3 ♂♂ +, +3 ♀♀ +- l, D4: +28.06.2010 +. +3 ♂♂ +- l, +25.08.2010 +. +2 ♂♂ +- l, D6: +10.06.2010 +. +1 ♂ +- l, +19.08.2010 +. +4 ♂♂ +, +18 ♀♀ +- l, Dobra-Novigrad: +18.08.2010 +. +1 ♂ +, +1 ♀ +- l. + + + +Genus: + +Orthotrichia +Eaton, 1873 + + + + + +Orthotrichia angustella +McLachlan, 1865 + + + +D3: +11.07.2010 +. +1 ♀ +- l, D4: +25.08.2010 +. +4 ♀♀ +- l, D5: +8.07.2010 +. +1 ♂ +- l, D6: +19.08.2010 +. +1 ♂ +, +3 ♀♀ +- l, D7: +16.09.2010 +. +1 ♂ +- l, D8: +11.06.2010 +. +32 ♂♂ +, +142 ♀♀ +- l, +18.06.2010 +. +1 ♂ +, +2 ♀♀ +- e, +14.07.2010 +. +15 ♂♂ +, +54 ♀♀ +- l, +27.08.2010 +. +4 ♂♂ +, +13 ♀♀ +- l, ZM: +23.08.2010 +. +1 ♀ +- l, KK: +18.06.2010 +. +1 ♀ +- l, +15.07.2010 +. +3 ♂♂ +, +22 ♀♀ +- l. + + + +Genus: + +Oxyethira +Eaton, 1873 + + + + + +Oxyethira tristella +Klapálek, 1895 + + + +D5: +26.05.2010 +. +1 ♂ +, +8 ♀♀ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585AFFB765B8FB20FB4DCD08.xml b/data/8B/0C/87/8B0C87FA585AFFB765B8FB20FB4DCD08.xml new file mode 100644 index 00000000000..5722610024a --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585AFFB765B8FB20FB4DCD08.xml @@ -0,0 +1,290 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +GLOSSOSOMATIDAE Wallengren, 1891 + + + + + + + +Genus: + +Glossosoma +Curtis, 1834 + + + + + +Glossosoma bifidum +McLachlan, 1879 + + + +D8: +14.07.2010 +. +1 ♂ +- l, K2: +24.08.2010 +. +1 ♂ +- l, K3: +29.06.2010 +. +1 ♂ +- l. + + + +Glossosoma discophorum +Klapálek, 1902 + + + +K2: +29.06.2010 +. +1 ♂ +- l. + + + +Genus: + +Agapetus +Curtis, 1834 + + + + + +Agapetus delicatulus +McLachlan, 1884 + + + +D2: +12.06.2010 +. +1 ♂ +, +3 ♀♀ +- l, +30.07.2010 +. +5 ♀♀ +- l, D3: +11.07.2010 +. +1 ♀ +- l, D4: +24.05.2010 +. +1 ♀ +- e, D5: +15.06.2010 +. +14 ♀♀ +- l, +8.07.2010 +. +1 ♀ +- l, D6: +10.06.2010 +. +79 ♀♀ +- l, D7: +9.06.2010 +. +13 ♀♀ +- l, D8: +11.06.2010 +. +5 ♀♀ +- l, K2: +29.06.2010 +. +2 ♀♀ +- l. + + + +Agapetus laniger +Pictet, 1834 + + + +D5: +15.06.2010 +. +1 ♂ +, +10 ♀♀ +- l, D8: +11.06.2010 +. +4 ♂♂ +, +5 ♀♀ +- l, +14.07.2010 +. +1 ♂ +- l, KK: +18.06.2010 +. +6 ♂♂ +, +9 ♀♀ +- l, +15.07.2010 +. +1 ♀ +- l. + + + +Agapetus ochripes +Curtis, 1834 + + + +D1: +12.06.2010 +. +1 ♂ +, +1 ♀ +- l, D2: +12.06.2010 +. +2 ♀♀ +- l, D4: +24.05.2010 +. +1 ♀ +- l, D8: +11.06.2010 +. +1 ♂ +- l, K2: +29.06.2010 +. +4 ♂♂ +, +1 ♀ +- l, K3: +29.06.2010 +. +2 ♀♀ +- l, SR: +27.06.2010 +. +1 ♀ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585BFFB16732F992FD85CAE4.xml b/data/8B/0C/87/8B0C87FA585BFFB16732F992FD85CAE4.xml new file mode 100644 index 00000000000..5343c1c2aac --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585BFFB16732F992FD85CAE4.xml @@ -0,0 +1,241 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Genus: + +Philopotamus +Stephens, 1829 + + + + + + + + +Philopotamus montanus +Donovan, 1813 + + + +K2: +24.08.2010 +. +1 ♂ +- l, K3: +27.05.2010 +. +1 ♂ +- l. + + + +Genus: + +Wormaldia +McLachan, 1865 + + + + + +Wormaldia copiosa +McLachlan, 1868 + + + +K3: +29.06.2010 +. +2 ♂♂ +- l, +29.08.2010 +. +1 ♂ +- l, +29.09.2010 +. +1 ♂ +- l. + + + +Wormaldia occipitalis +Picet, 1834 + + + +D1: +30.05.2010 +. +1 ♂ +- e, D3: +23.06.2010 +. +1 ♂ +- l, +11.07.2010 +. +1 ♂ +- l, D7: +18.08.2010 +. +1 ♂ +- l, K2: +15.11.2009 +. +1 ♂ +- l, K3: +29.08.2010 +. +2 ♂♂ +- e. + + + +Wormaldia subnigra +McLachlan, 1865 + + + +D8: +11.06.2010 +. +1 ♂ +- l, +14.07.2010 +. +1 ♂ +- l. + + + +Wormaldia sp. + + + +D1: +12.06.2010 +. +2 ♀ +- l, D2: +12.06.2010 +. +1 ♀ +- l, D7: +7.07.2010 +. +3 ♀♀ +- l, +18.08.2010 +. +5 ♀♀ +- l, K3: + + +29.08.2010 +. +1 ♀ +- e. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585CFFB065B8FA34FAF9CAE4.xml b/data/8B/0C/87/8B0C87FA585CFFB065B8FA34FAF9CAE4.xml new file mode 100644 index 00000000000..193bc6bff74 --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585CFFB065B8FA34FAF9CAE4.xml @@ -0,0 +1,292 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +POLYCENTROPODIDAE Ulmer, 1903 + + + + + + + +Genus: + +Cyrnus +Stephens, 1836 + + + + + +Cyrnus trimaculatus +Curtis, 1834 + +D8: +11.06.2010 +. +1 ♂ +- l, KK: +18.06.2010 +. +1 ♂ +, +6 ♀♀ +- e, +18.06.2010 +. +13 ♂♂ +- l, +17.08.2010 +. +1 ♂ +, +1 ♀ +- l. + + + +Genus: + +Polycentropus +Curtis, 1835 + + + + + +Polycentropus irroratus +Curtis, 1835 + +D3: +25.05.2010 +. +2 ♂♂ +- l, +23.06.2010 +. +1 ♂ +- l, D4: +24.05.2010 +. +1 ♂ +, +2 ♀♀ +- e, +24.05.2010 +. +5 ♂♂ +- l, +28.06.2010 +. +2 ♂♂ +- e, +28.06.2010 +. +5 ♂♂ +- l, D5: +26.05.2010 +. +2 ♂♂ +- l, +15.06.2010 +. +1 ♂ +- e, +15.06.2010 +. +1 ♂ +- l, +8.07.2010 +. +1 ♂ +- l, +27.08.2010 +. +8 ♂♂ +- l, D6: +19.05.2010 +. +1 ♂ +- l, +10.06.2010 +. +2 ♂♂ +- l, +6.07.2010 +. +1 ♂ +- l, D7: +14.05.2010 +. +1 ♂ +- e, +7.07.2010 +. +2 ♂♂ +- l, D8: +11.06.2010 +. +2 ♂♂ +- l, K3: +29.06.2010 +. +1 ♂ +- l, KK: +18.06.2010 +. +3 ♀♀ +- e, +15.07.2010 +. +1 ♂ +- l. + + + +Genus: + +Plectrocnemia +Stephens, 1836 + + + + + +Plectrocnemia brevis +McLachlan, 1871 + +D1: +22.08.2010 +. +2 ♂♂ +- l, K2: +1 ♂ +- l. + + + +Plectrocnemia conspersa +(Curtis, 1834) + + + +D1: +12.06.2010 +. +1 ♂ +- l, +12.07.2010 +. +17 ♂♂ +- l, D2: +30.07.2010 +. +1 ♂ +- l, K2: +24.08.2010 +. +1 ♂ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585CFFB165B8FEF6FE0BCF85.xml b/data/8B/0C/87/8B0C87FA585CFFB165B8FEF6FE0BCF85.xml new file mode 100644 index 00000000000..a114e379eac --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585CFFB165B8FEF6FE0BCF85.xml @@ -0,0 +1,531 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +HYDROPSYCHIDAE Curtis, 1835 + + + + + + + +Genus: + +Hydropsyche +Pictet, 1834 + + + + + +Hydropsyche contubernalis +McLachlan, 1865 + + + +D6: +10.06.2010 +. +1 ♂ +- l. + + + +Hydropsyche fulvipes +(Curtis, 1834) + + + +D7: +9.06.2010 +. +1 ♂ +- l. + +Hydropsyche incognita +Pitsch, 1993 + + + +D1: +12.06.2010 +. +1 ♂ +- l, D2: +22.08.2010 +. +1 ♂ +- l, D4: +29.04.2010 +. +1 ♂ +- l, +24.05.2010 +. +1 ♂ +- l, D7: +22.08.2010 +. +1 ♂ +- e, +16.09.2010 +. +2 ♂♂ +- l, +26.10.2010 +. +1 ♂ +- l, D8: +27.04.2010 +. +5 ♂♂ +- e, +27.04.2010 +. +21 ♂♂ +- l, +14.05.2010 +. +1 ♂ +- e, +11.06.2010 +. +103 ♂♂ +- l, +18.06.2010 +. +1 ♂ +- e, +14.07.2010 +. +14 ♂♂ +- l, +27.08.2010 +. +17 ♂♂ +- l, K2: +29.06.2010 +. +1 ♂ +- l, K3: +29.06.2010 +. +1 ♂ +- l, KK: +15.07.2010 +. +3 ♂♂ +- l. + +Hydropsyche instabilis +(Curtis, 1834) + + + +D2: +12.06.2010 +. +1 ♂ +- l, D7: +18.08.2010 +. +7 ♂♂ +- l, K1: +24.08.2010 +. +2 ♂♂ +- l, K2: +24.08.2010 +. +1 ♂ +- l, KK: +17.08.2010 +. +1 ♂ +- l. + +Hydropsyche +sp. + + + +D1: +12.06.2010 +. +1 ♀ +- e, +12.06.2010 +. +1 ♀ +- l, +12.07.2010 +. +2 ♀♀ +- l, +22.08.2010 +. +2 ♀♀ +- l, D2: +30.07.2010 +. +4 ♀♀ +- e, +30.07.2010 +. +24 ♀♀ +- l, +22.08.2010 +. +16 ♀♀ +- l, D3: +25.05.2010 +. +19 ♀♀ +- l, +23.06.2010 +. +2 ♀♀ +- e, +23.06.2010 +. +6 ♀♀ +- l, +29.08.2010 +. +1 ♀ +- l, D4: +29.04.2010 +. +1 ♀ +- l, +24.05.2010 +. +3 ♀♀ +- e, +24.05.2010 +. +31 ♀♀ +- l, +28.06.2010 +. +4 ♀♀ +- e, +28.06.2010 +. +41 ♀♀ +- l, D5: +15.06.2010 +. +9 ♀♀ +- e, +15.06.2010 +. +24 ♀♀ +- l, +8.07.2010 +. +25 ♀♀ +- l, +27.08.2010 +. +3 ♀♀ +- l, D6: +26.04.2010 +. +4 ♀♀ +- l, +19.05.2010 +. +14 ♀♀ +- l, +10.06.2010 +. +36 ♀♀ +- l, +6.07.2010 +. +8 ♀♀ +- l, +19.08.2010 +. +1 ♀ +- e, D7: +24.05.2010 +. +2 ♀♀ +- l, +9.06.2010 +. +4 ♀♀ +- l, +7.07.2010 +. +33 ♀♀ +- l, +18.08.2010 +. +10 ♀♀ +- l, +16.09.2010 +. +7 ♀♀ +- l, +26.10.2010 +. +4 ♀♀ +- l, D8: +27.04.2010 +. +20 ♀♀ +- e, +27.04.2010 +. +52 ♀♀ +- l, +14.05.2010 +. +4 ♀♀ +- e, +11.06.2010 +. +269 ♀♀ +- l, +18.06.2010 +. +13 ♀♀ +- e, +14.07.2010 +. +1 ♀ +- l, +27.08.2010 +. +87 ♀♀ +- l, +13.09.2010 +. +6 ♀♀ +- l, K1: +30.06.2010 +. +6 ♀♀ +- l, +31.07.2010 +. +5 ♀♀ +- l, K2: +27.05.2010 +. +15 ♀♀ +- l, +29.06.2010 +. +4 ♀♀ +- l, +31.07.2010 +. +11 ♀♀ +- l, K3: +28.04.2010 +. +18 ♀♀ +- l, +27.05.2010 +. +2 ♀♀ +- l, +29.06.2010 +. +5 ♀♀ +- l, +27.07.2010 +. +16 ♀♀ +- l, +31.08.2010 +. +1 ♀ +- l, KK: +14.05.2010 +. +5 ♀♀ +- l, +18.06.2010 +. +70 ♀♀ +- l, +15.07.2010 +. +4 ♀♀ +- l, +17.08.2010 +. +1 ♀ +- e, +17.08.2010 +. +28 ♀♀ +- l, +21.09.2010 +. +1 ♀ +- l. + +Genus: + +Cheumatopsyche +Wallengren, 1891 + + + + + +Cheumatopsyche lepida, +Pictet, 1834 + + + +D4: +24.05.2010 +. +2 ♂♂ +- l, D5: +8.07.2010 +. +1 ♂ +, +1 ♀ +- l, D6: +10.06.2010 +. +1 ♀ +- l, D8: +11.06.2010 +. +823 ♂♂ +, +279 ♀♀ +- l, +18.06.2010 +. +56 ♂♂ +- e, +14.07.2010 +. +25 ♂♂ +, +57 ♀♀ +- l, +27.08.2010 +. +28 ♂♂ +, +1 ♀ +- l, KK: +18.06.2010 +. +1 ♂ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585DFFB065B8F8BEFCF9CDD8.xml b/data/8B/0C/87/8B0C87FA585DFFB065B8F8BEFCF9CDD8.xml new file mode 100644 index 00000000000..9a4158fe03e --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585DFFB065B8F8BEFCF9CDD8.xml @@ -0,0 +1,139 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +PHRYGANEIDAE Leach, 1815 + + + + + + + +Genus: + +Agrypnia +Curtis, 1835 + + + + + +Agrypnia varia +Fabricius, 1793 + + + +SR: +27.06.2010 +. +2 ♀♀ +- l, +23.08.2010 +. +2 ♂♂ +, +1 ♀ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585DFFB065B8FE6BFD34CCCF.xml b/data/8B/0C/87/8B0C87FA585DFFB065B8FE6BFD34CCCF.xml new file mode 100644 index 00000000000..167a218d1c2 --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585DFFB065B8FE6BFD34CCCF.xml @@ -0,0 +1,582 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +PSYCHOMYIIDAE Walker, 1852 + + + + + + + +Genus: + +Psychomyia +Latreille, 1829 + + + + + +Psychomyia klapaleki +Malicky, 1995 + + + +D3: +23.06.2010 +. +1 ♂ +- l, D4: +24.05.2010 +. +1 ♂ +- l, K1: +30.06.2010 +. +1 ♂ +- l, K3: +29.06.2010 +. +2 ♂♂ +- l, + + +27.07.2010 +. +7 ♂♂ +- l. + +Psychomyia pusilla +Fabricius, 1781 + + + +D3: +25.05.2010 +. +1 ♂ +- l, +23.06.2010 +. +2 ♂♂ +- l, +11.07.2010 +. +1 ♂ +- l, D4: +24.05.2010 +. +2 ♂♂ +- l, + + +28.06.2010 +. +2 ♂♂ +- l, D5: +26.05.2010 +. +4 ♂♂ +- l, +15.06.2010 +. +4 ♂♂ +- l, +8.07.2010 +. +1 ♂ +- l, D6: + + +19.08.2010 +. +10 ♂♂ +- l, D7: +18.08.2010 +. +1 ♂ +- l, +16.09.2010 +. +1 ♂ +- l, D8: +27.04.2010 +. +4 ♂♂ +- l, + + +14.05.2010 +. +10 ♂♂ +- l, +11.06.2010 +. +8 ♂♂ +- l, +14.07.2010 +. +318 ♂♂ +- l, +27.08.2010 +. +43 ♂♂ +- l, + + +13.09.2010 +. +1 ♂ +- l, K1: +30.06.2010 +. +1 ♂ +- l, K2: +29.06.2010 +. +10 ♂♂ +- l, K3: +29.06.2010 +. +2 ♂♂ +- l, + + +27.07.2010 +. +25 ♂♂ +- l, ZM: +25.06.2010 +. +1 ♂ +- e, KK: +27.04.2010 +. +5 ♂♂ +- l, +14.05.2010 +. +2 ♂♂ +- l, + + +18.06.2010 +. +35 ♂♂ +- l, +15.07.2010 +. +172 ♂♂ +- l, +17.08.2010 +. +16 ♂♂ +- l. + +Psychomyia +sp. + + + +D3: +25.05.2010 +. +1 ♀ +- l, +23.06.2010 +. +1 ♀ +- e, +23.06.2010 +. +9 ♀♀ +- l, +11.07.2010 +. +3 ♀♀ +- l, D4: + + +24.05.2010 +. +40 ♀♀ +- l, +26.07.2010 +. +1 ♀ +- l, +25.08.2010 +. +1 ♀ +- l, D5: +26.05.2010 +. +61 ♀♀ +- l, + + +15.06.2010 +. +13 ♀♀ +- l, +8.07.2010 +. +4 ♀♀ +- l, D6: +19.05.2010 +. +1 ♀ +- l, +6.07.2010 +. +2 ♀♀ +- l, +19.08.2010 +. + + +51 ♀♀ +- l, D7: +24.05.2010 +. +29 ♀♀ +- l, +9.06.2010 +. +3 ♀♀ +- l, +7.07.2010 +. +14 ♀♀ +- l, +18.08.2010 +. +16 ♀♀ +- + + +l, +16.09.2010 +. +3 ♀♀ +- l, D8: +14.05.2010 +. +7 ♀♀ +- e, +14.05.2010 +. +850 ♀♀ +- l, +11.06.2010 +. +606 ♀♀ +- l, + + +18.06.2010 +. +2 ♀♀ +- e, +14.07.2010 +. 2339 +♀♀ +- l, +27.08.2010 +. +118 ♀♀ +- l, +13.09.2010 +. +198 ♀♀ +- l, K1: + + +30.06.2010 +. +6 ♀♀ +- l, K2: +29.06.2010 +. +52 ♀♀ +- l, +31.07.2010 +. +1 ♀ +- l, K3: +29.06.2010 +. +27 ♀♀ +- l, + + +27.07.2010 +. +177 ♀♀ +- l, +31.08.2010 +. +1 ♀ +- l, ZM: +22.07.2010 +. +1 ♀ +- l, KK: +27.04.2010 +. +69 ♀♀ +- l, + + +18.06.2010 +. +13 ♀♀ +- e, +18.06.2010 +. +147 ♀♀ +- l, +15.07.2010 +. +916 ♀♀ +- l, +17.08.2010 +. +46 ♀♀ +- l. + +Genus: +Lype McLachlan, 1878 + + + + +Lype phaeopa +Stephens, 1836 + + + +D7: +14.05.2010 +. +1 ♂ +- e. + +Lype reducta +(Hagen, 1868) + + + +D3: +29.04.2010 +. +2 ♂♂ +- l, +25.05.2010 +. +3 ♂♂ +- l, +23.06.2010 +. +1 ♂ +- e, D6: +19.05.2010 +. +1 ♂ +- l. +Lipe +sp. + + +D7: +14.05.2010 +. +1 ♀ +- e, +9.06.2010 +. +1 ♀ +- l. + +Genus: + +Tinodes +McLachlan, 1878 + + + + + +Tinodes braueri +McLachlan, 1878 + + + +D1: +12.06.2010 +. +4 ♂♂ +- e. + +Tinodes dives +Pictet, 1834 + + + +K3: +27.05.2010 +. +1 ♂ +- l. + +Tinodes rostocki +McLachlan, 1878 + + + +D1: +10.06.2010 +. +1 ♂ +- e, K2: +31.07.2010 +. +1 ♂ +- l. + +Tinodes +sp. + + + +D1: +12.06.2010 +. +2 ♀♀ +- e, +29.08.2010 +. +1 ♀ +- e, D3: +25.05.2010 +. +1 ♀ +- l, D7: +16.09.2010 +. +1 ♀ +- l, K2: + + +24.08.2010 +. +1 ♀ +- l, KK: +18.06.2010 +. +2 ♀♀ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585DFFB06732FEECFDFACBB4.xml b/data/8B/0C/87/8B0C87FA585DFFB06732FEECFDFACBB4.xml new file mode 100644 index 00000000000..a57217cedf6 --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585DFFB06732FEECFDFACBB4.xml @@ -0,0 +1,125 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Genus: +Ecnomus McLachlan, 1864 + + + + + + + +Ecnomus tenellus Rambur, 1842 + + + +KK: +17.08.2010 +. +1 ♂ +, +3 ♀♀ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585EFFB26732FEF6FC15CB93.xml b/data/8B/0C/87/8B0C87FA585EFFB26732FEF6FC15CB93.xml new file mode 100644 index 00000000000..f7eaffd20dd --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585EFFB26732FEF6FC15CB93.xml @@ -0,0 +1,691 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Micrasema minimum +McLachlan, 1876 + + + + +D3: +29.04.2010 +. +16 ♀♀ +- l, +25.05.2010 +. +114 ♀♀ +- l, D4: +29.04.2010 +. +7 ♂♂ +, +10 ♀♀ +- l, +24.05.2010 +. +6 ♀♀ +- l, D5: +25.04.2010 +. +12 ♂♂ +, +312 ♀♀ +- l, +26.05.2010 +. +1 ♂ +, +5 ♀♀ +- l, D6: +26.04.2010 +. +7 ♂♂ +, +795 ♀♀ +- l, +19.05.2010 +. +10 ♀♀ +- l, D7: +26.10.2010 +. +8 ♂♂ +, +14 ♀♀ +- l, D8: +27.04.2010 +. +17 ♂♂ +, +212 ♀♀ +- l, K2: +29.06.2010 +. +1 ♀ +- l, K3: +28.04.2010 +. +6 ♂♂ +, +230 ♀♀ +- l, +29.06.2010 +. +1 ♀ +- e, +27.07.2010 +. +1 ♀ +- l, SR: +12.05.2010 +. +4 ♀♀ +- l, +27.06.2010 +. +1 ♀ +- l, KK: +27.04.2010 +. +8 ♂♂ +, +256 ♀♀ +- l. + + + + + +Micrasema sericeum +Klapálek, 1902 + + + +K2: +27.05.2010 +. +1 ♂ +- e. + + + +Micrasema +sp. + + + +K3: +27.05.2010 +. +21 ♀♀ +- l. + + + +Family: +LIMNEPHILIDAE Kolenati, 1848 + + + + +Genus: + +Drusus +, Stephens, 1837 + + + + + +Drusus chrysotus +(Rambur, 1842) + + + +D1: +30.04.2010 +. +1 ♂ +- l. + + + +Drusus croaticus + +Marinković- Gospodnetić, 1971 + + +K1: +30.09.2010 +. +2 ♀♀ +- l, +29.10.2010 +. +1 ♂ +, +2 ♀♀ +- l. + + + +Drusus discolor +(Rambur, 1842) + + + +D1: +30.04.2010 +. +1 ♂ +- l. + + + +Genus: + +Limnephilus +Leach, 1815 + + + + + +Limnephilus auricula +Curtis, 1834 + + + +D2: +23.10.2010 +. +1 ♀ +- e, ZM: +15.09.2010 +. +1 ♂ +- l. + + + +Limnephilus hirsutus +(Pictet, 1864) + + + +ZM: +23.08.2010 +. +1 ♂ +- l. + + + +Limnephilus lunatus +Curtis, 1834 + + + +D4: +24.05.2010 +. +1 ♀ +- l, +23.09.2010 +. +1 ♀ +- l, K3: +23.10.2010 +. +1 ♀ +- l, SR: +22.07.2010 +. +1 ♀ +- l. + + + +Limnephilus rhombicus +(Linnaeus, 1758) + + + +D4: +24.05.2010 +. +1 ♂ +- l, ZM: +25.06.2010 +. +1 ♀ +- e, +25.06.2010 +. +5 ♀♀ +- l, +22.07.2010 +. +1 ♂ +, +2 ♀♀ +- l, SR: +22.07.2010 +. +1 ♀ +- l. + + +Genus: + +Grammotaulius +Retzius, 1873 + + + + +Grammotaulius nigropunctatus +(Retzius, 1873) + + + +K3: +31.08.2010 +. +1 ♂ +- l. + + + +Genus: + +Glyphotaelius +Stephens, 1837 + + + + + +Glyphotaelius pellucidus +(Retzius, 1783) + + + +SR: +15.09.2010 +. +2 ♂♂ +- l. + + + +Genus: + +Anabolia +Stephens, 1837 + + + + + +Anabolia furcata +Brauer, 1857 + + + +D5: +23.09.2010 +. +1 ♂ +- e, D6: +13.10.2010 +. +1 ♂ +- l, D8: +14.10.2010 +. +1 ♂ +- l, KK: +16.10.2010 +. +1 ♂ +- l. + + + +Genus: + +Potamophylax +Wallengren, 1891 + + + + + +Potamophylax latipennis +Curtis, 1834 + + + +D3: +23.09.2010 +. +2 ♀♀ +- l, K1: +27.05.2010 +. +7 ♀♀ +- l, +30.06.2010 +. +5 ♀♀ +- l, +31.07.2010 +. +7 ♀♀ +- l, +24.08.2010 +. +1 ♀ +- e, +24.08.2010 +. +4 ♂♂ +, +23 ♀♀ +- l, K2: +27.05.2010 +. +1 ♂ +- e, +27.05.2010 +. +2 ♂♂ +, +1 ♀ +- l, +31.07.2010 +. +1 ♀ +- l, +24.08.2010 +. +2 ♂♂ +, +1 ♀ +- l, +30.09.2010 +. +1 ♂ +, +8 ♀♀ +- l, +23.10.2010 +. +1 ♂ +- l, K3: +24.01.2010 +. +1 ♂ +- e, +31.08.2010 +. +1 ♀ +- l, +29.09.2010 +. +2 ♂♂ +, +5 ♀♀ +- l, +30.09.2010 +. +4 ♀♀ +- e, +23.10.2010 +. +1 ♀ +- l. + + + +Potamophylax pallidus +(Klapálek, 1899) + + + +D1: +28.09.2010 +. +1 ♀ +- l, +31.10.2010 +. +1 ♀ +- l, D8: +27.08.2010 +. +1 ♂ +- l, ZM: +15.09.2010 +. +1 ♀ +- l, KK: +7.11.2010 +. +1 ♂ +- l. + + + +Genus: + +Halesus +Stephens, 1836 + + + + + +Halesus digitatus +(Schrank, 1781) + + + +K2: +30.09.2010 +. +1 ♂ +- l, K3: +29.09.2010 +. +1 ♂ +- l, +30.09.2010 +. +1 ♂ +- e. + + + +Halesus tesselatus +(Rambur, 1842) + + + +K3: +30.09.2010 +. +1 ♂ +- e. + + + +Halesus +sp. + + + +D2: +15.11.2010 +. +1 ♀ +- l, D3: +22.11.2009 +. +2 ♀♀ +- l, D7: +12.10.2010 +. +1 ♀ +- l, K2: +23.10.2010 +. +1 ♀ +- l, K3: +15.11.2009 +. +1 ♀ +- l. + + + +Genus: + +Stenophylax +Kolenati, 1848 + + + + + +Stenophylax permistus +McLachlan, 1895 + + + +ZM: +12.05.2010 +. +1 ♀ +- l, +15.09.2010 +. +1 ♀ +- l, SR: +24.10.2010 +. +1 ♀ +- l. + + + +Genus: + +Micropterna +Stein, 1874 + + + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585FFF8D65B8FB8FFD79CB18.xml b/data/8B/0C/87/8B0C87FA585FFF8D65B8FB8FFD79CB18.xml new file mode 100644 index 00000000000..978974c613d --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585FFF8D65B8FB8FFD79CB18.xml @@ -0,0 +1,555 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +GOERIDAE Ulmer, 1903 + + + + + + + +Genus: + +Goera +Stephens, 1829 + + + + + +Goera pilosa +Fabricius, 1775 + +D1: +12.07.2010 +. +1 ♀ +- l, D8: +27.04.2010 +. +1 ♀ +- l, +14.05.2010 +. +1 ♀ +- e, +11.06.2010 +. +3 ♀♀ +- l, +14.07.2010 +. +2 ♂♂ +, +8 ♀♀ +- l, +27.08.2010 +. +7 ♂♂ +, +2 ♀♀ +- l, K3: +27.05.2010 +. +1 ♀ +- e, +29.06.2010 +. +1 ♀ +- l, KK: +27.04.2010 +. +1 ♀ +- l, +18.06.2010 +. +2 ♂♂ +- l, +15.07.2010 +. +1 ♂ +- l, +17.08.2010 +. +1 ♀ +- l, +21.09.2010 +. +1 ♀ +- l. + + + +Genus: + +Silo +Curtis.1830 + + + + + +Silo piceus +(Brauer, 1857) + +D1: +12.07.2010 +. +1 ♂ +- l, D2: +12.06.2010 +. +4 ♂♂ +, +2 ♀♀ +- l, +30.07.2010 +. +5 ♀♀ +- l, +29.08.2010 +. +1 ♀ +- e, D3: +25.05.2010 +. +2 ♂♂ +, +3 ♀♀ +- l, D5: +26.05.2010 +. +5 ♂♂ +, +4 ♀♀ +- l, +15.06.2010 +. +1 ♀ +- e, +15.06.2010 +. +1 ♂ +- l, +8.07.2010 +. +1 ♀ +- l, D6: +19.05.2010 +. +1 ♂ +- l, +10.06.2010 +. +1 ♀ +- l, D7: +14.05.2010 +. +1 ♀ +- e, +24.05.2010 +. +31 ♀♀ +- l, +9.06.2010 +. +4 ♀♀ +- l, +7.07.2010 +. +2 ♀♀ +- l, D8: +27.04.2010 +. +1 ♂ +, +1 ♀ +- e, +27.04.2010 +. +79 ♂♂ +, +7 ♀♀ +- l, +14.05.2010 +. +4 ♂♂ +, +3 ♀♀ +- e, +14.05.2010 +. +3 ♂♂ +- l, K1: +30.06.2010 +. +1 ♂ +, +1 ♀ +- l, K2: +27.05.2010 +. +1 ♂ +, +1 ♀ +- l, +30.06.2010 +. +1 ♀ +- e, K3: +27.05.2010 +. +1 ♂ +, +1 ♀ +- e, +27.05.2010 +. +7 ♂♂ +- l, +29.06.2010 +. +1 ♂ +, +1 ♀ +- l, KK: +14.05.2010 +. +6 ♂♂ +, +1 ♀ +- l. + + + +Family: +LEPIDOSTOMATIDAE Ulmer, 1903 + + + + +Genus: + +Lepidostoma +Rambur, 1842 + + + + + +Lepidostoma hirtum +(Fabricius, 1775) + +D2: +30.05.2010 +. +1 ♂ +- l, +22.08.2010 +. +1 ♀ +- l, D3: +25.05.2010 +. +3 ♂♂ +, +10 ♀♀ +- l, +23.06.2010 +. +196 ♀♀ +- l, +11.07.2010 +. +5 ♂♂ +, +102 ♀♀ +- l, D4: +29.04.2010 +. +1 ♀ +- l, +24.05.2010 +. +2 ♀♀ +- e, +24.05.2010 +. +1 ♂ +, +65 ♀♀ +- l, +28.06.2010 +. +1 ♀ +- e, +28.06.2010 +. +18 ♂♂ +, +380 ♀♀ +- l, +26.07.2010 +. +33 ♀♀ +- l, +25.08.2010 +. +69 ♀♀ +- l, +23.09.2010 +. +1 ♀ +- l, D5: +25.04.2010 +. +2 ♀♀ +- l, +26.05.2010 +. +3 ♂♂ +, +685 ♀♀ +- l, +15.06.2010 +. +9 ♀♀ +- e, +15.06.2010 +. +1 ♂ +, +686 ♀♀ +- l, +8.07.2010 +. +15 ♂♂ +, 1003 +♀♀ +- l, +27.08.2010 +. +5 ♀♀ +- l, +25.09.2010 +. +1 ♀ +- l, D6: +26.04.2010 +. +20 ♀♀ +- l, +19.05.2010 +. +2 ♂♂ +, +2 ♀♀ +- l, +10.06.2010 +. +10 ♂♂ +, +441 ♀♀ +- l, +6.07.2010 +. +1 ♂ +, +356 ♀♀ +- l, +19.08.2010 +. +1 ♀ +- e, +19.08.2010 +. +28 ♂♂ +, 1187 +♀♀ +- l, D7: +14.05.2010 +. +2 ♂♂ +, +3 ♀♀ +- e, +24.05.2010 +. +6 ♂ +, +672 ♀♀ +- l, +9.06.2010 +. +6 ♂♂ +, +448 ♀♀ +- l, +7.07.2010 +. +1 ♂ +, +24 ♀♀ +- l, +18.08.2010 +. +2 ♂♂ +, +14 ♀♀ +- l, +16.09.2010 +. +18 ♀♀ +- l, +26.10.2010 +. +1 ♀ +- l, D8: +14.05.2010 +. +1 ♂ +- e, +14.05.2010 +. +1 ♂ +, +2 ♀♀ +- l, +14.07.2010 +. +1 ♂ +- l, +27.08.2010 +. +1 ♂ +, +1 ♀ +- l, K1: +31.07.2010 +. +1 ♀ +- l, K3: +27.07.2010 +. +64 ♀♀ +- l, KK: +18.06.2010 +. +3 ♀♀ +- l, +15.07.2010 +. +1 ♀ +- l, +17.08.2010 +. +1 ♀ +- e, +17.08.2010 +. +7 ♀♀ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA585FFFB26732FE0EFB31CE10.xml b/data/8B/0C/87/8B0C87FA585FFFB26732FE0EFB31CE10.xml new file mode 100644 index 00000000000..60d24e1ef9d --- /dev/null +++ b/data/8B/0C/87/8B0C87FA585FFFB26732FE0EFB31CE10.xml @@ -0,0 +1,303 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Micropterna lateralis +Stephens, 1837 + + + + +K1: +27.05.2010 +. +1 ♂ +, +1 ♀ +- l. + + + + + +Micropterna testacea +(Gemlin, 1879) + + + +ZM: +24.10.2010 +. +1 ♂ +- l. + + + +Genus: + +Allogamus +Schmid, 1955 + + + + + +Allogamus uncatus +(Braur, 1857) + + + +K1: +29.10.2010 +. +2 ♂♂ +, +2 ♀♀ +- l, +25.11.2010 +. +1 ♀ +- e, +25.11.2010 +. +4 ♀♀ +- l. + + + +Genus: + +Chaetopteryx +Stephens + +, 182 + + + + +Chaetopteryx fusca +Brauer, 1857 + + + +D4: +14.11.2009 +. +1 ♀ +- e, K3: +24.01.2010 +. +1 ♂ +- e, +15.11.2010 +. +2 ♂♂ +, +3 ♀♀ +- e, +15.11.2010 +. +2 ♂♂ +, +1 ♀ +- l, ZM: +16.11.2009 +. +2 ♂♂ +- e, +30.12.2009 +. +1 ♂ +, +7 ♀♀ +- l, +17.01.2010 +. +1 ♂ +- l, +24.10.2010 +. +1 ♂ +- l, +6.11.2010 +. +1 ♂ +, +1 ♀ +- e, +6.11.2010 +. +18 ♂♂ +, +5 ♀♀ +- l. + + + +Chaetopteryx gonospina + +Marinković- Gospodnetić, 1966 + + +D1: +21.11.2009 +. +1 ♂ +- l. + + + +Genus: + +Annitella Klapálek +, 1907 + + + + + +Annitella apfelbecki +(Klapálek, 1899) + + + +K1: +15.11.2009 +. +1 ♂ +, +1 ♀ +- e, +15.11.2009 +. +2 ♂♂ +, +1 ♀ +- l, +29.10.2010 +. +6 ♂♂ +, +1♀ +- l, K3: +15.11.2009 +. +1 ♂ +- l, +25.12.2009 +. +1 ♂ +- l, +24.01.2010 +. +3 ♂♂ +- e, +23.10.2010 +. +1 ♂ +- l, +15.11.2010 +. +3 ♂♂ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA5860FF8C65B8F83EFD4AC80A.xml b/data/8B/0C/87/8B0C87FA5860FF8C65B8F83EFD4AC80A.xml new file mode 100644 index 00000000000..77b8288c607 --- /dev/null +++ b/data/8B/0C/87/8B0C87FA5860FF8C65B8F83EFD4AC80A.xml @@ -0,0 +1,161 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +SERICOSTOMATIDAE Stephens, 1836 + + + + + + + +Genus: + +Sericostoma +Latreille 1825 + + + + + +Sericostoma flavicorne +Schneider, 1845 + + + +D1: +12.06.2010 +. +1 ♀ +- l, D3: +25.05.2010 +. +1 ♂ +, +2 ♀♀ +- l, K1: +30.06.2010 +. +1 ♂ +, +1 ♀ +- l, K3: +27.05.2010 +. +1 ♀ +- l, +29.06.2010 +. +1 ♂ +- e, +29.06.2010 +. +1 ♀ +- l. + + +Appendix 2. +List of specimens used in phylogenetic analysis. Specimen ID from sequences obtained in this study are written with bold letters. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA5860FF8D65B8F94DFB8FCDAD.xml b/data/8B/0C/87/8B0C87FA5860FF8D65B8F94DFB8FCDAD.xml new file mode 100644 index 00000000000..2499e583f6c --- /dev/null +++ b/data/8B/0C/87/8B0C87FA5860FF8D65B8F94DFB8FCDAD.xml @@ -0,0 +1,219 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +ODONTOCERIDAE Wallengren, 1891 + + + + + + + +Genus: + +Odontocerum +Leach, 1815 + + + + + +Odontocerum albicorne +(Scopoli, 1769) + +D1: +12.07.2010 +. +1 ♂ +- l, D2: +30.07.2010 +. +1 ♂ +- l, +22.08.2010 +. +1 ♂ +- l, D3: +29.04.2010 +. +1 ♂ +, +1 ♀ +- l, +25.05.2010 +. +3 ♂♂ +, +3 ♀♀ +- l, +23.06.2010 +. +1 ♂ +- e, +23.06.2010 +. +1 ♂ +- l, D4: +24.05.2010 +. +1 ♂ +, +7 ♀♀ +- l, +28.06.2010 +. +1 ♂ +- l, K2: +29.06.2010 +. +3 ♂♂ +- l, +30.06.2010 +. +1 ♀ +- e, K3: +27.05.2010 +. +1 ♂ +, +7 ♀♀ +- e, +27.05.2010 +. +1 ♂ +, +2 ♀♀ +- l, +29.06.2010 +. +1 ♂ +, +21 ♀♀ +- e, +29.06.2010 +. +14 ♂♂ +, +4 ♀♀ +- l, +27.07.2010 +. +5 ♀♀ +- e, +27.07.2010 +. +15 ♂♂ +, +2 ♀♀ +- l, +23.08.2010 +. +1 ♂ +- e, +31.08.2010 +. +1 ♂ +- l. + + + + \ No newline at end of file diff --git a/data/8B/0C/87/8B0C87FA5860FF8D65B8FEB1FA89CC5D.xml b/data/8B/0C/87/8B0C87FA5860FF8D65B8FEB1FA89CC5D.xml new file mode 100644 index 00000000000..4c8b4b9baf3 --- /dev/null +++ b/data/8B/0C/87/8B0C87FA5860FF8D65B8FEB1FA89CC5D.xml @@ -0,0 +1,552 @@ + + + +Ecological and faunistic features of caddisflies (Insecta: Trichoptera) in different types of habitats in the Dinaric karst area (Central Croatia) + + + +Author + +Cerjanec, Darko +Primary School Barilović, Barilović 96, 47252 Barilović and Primary School Netretić, Netretić 1, 47271 Netretić, Croatia (darkocerjanec @ yahoo. com) + + + +Author + +Kučinić, Mladen +Department of Biology (Laboratory for Entomology), Faculty of Science, University of Zagreb, Rooseveltov trg 6, 10 000 Zagreb, Croatia + + + +Author + +Vilenica, Marina +Faculty of Teacher Education, University of Zagreb, Trg Matice hrvatske 12, 44250 Petrinja, Croatia + + + +Author + +Ćukušić, Anđela +Ministry of Economy and Sustainable Development, Vukovarska 78, 10000 Zagreb, Croatia + + + +Author + +Ćuk, Renata +Hrvatske vode, Central Water Management Laboratory, Ulica grada Vukovara 220, 10 000 Zagreb, Croatia + + + +Author + +Ibrahimi, Halil +Department of Biology, Faculty of Mathematical and Natural Sciences, University of Prishtina “ Hasan Prishtina ”, “ Mother Theresa ” p. n., 10000 Prishtina, Republic of Kosovo +halil.ibrahimi@uni-pr.edu + + + +Author + +Vučković, Ivan +Elektroprojekt d. d., Civil and Architectural Engineering Department, Alexandera von Humboldta 4, 10 000 Zagreb, Croatia + + + +Author + +Žalac, Sanja +National Park Plitvice Lakes, Josipa Jovića 19, 53231 Plitvička jezera, Croatia + + + +Author + +Ruk, Damir +Koprivničke vode d. o. o., Public water service company for drinking water supply, sewer drainage and waste water treatment, Mosna 15 a, 48000 Koprivnica, Croatia 1,2 equal authors * Corresponding author: halil. ibrahimi @ uni-pr. edu + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-02 + + +36 + + +6 +39 + + + + +http://dx.doi.org/10.37828/em.2020.36.2 + +journal article +10.37828/em.2020.36.2 +2336-9744 +13232521 + + + + + + +Family: +LEPTOCERIDAE Leach, 1815 + + + + + + + +Genus: +Atripsodes +Billberg, 1820 + + + + +Athripsodes +sp. + + + +D3: +11.07.2010 +. +7 ♀♀ +- l, D5: +27.08.2010 +. +1 ♀ +- l, D7: +7.07.2010 +. +3 ♀♀ +- l, KK: +15.07.2010 +. +1 ♀ +- l. + +Genus: + +Ceraclea +Stephens, 1829 + + + + + +Ceraclea albimacula +(Rambur, 1842) + + + +D6: +6.07.2010 +. +6 ♂♂ +, +9 ♀♀ +- l, +19.08.2010 +. +10 ♀♀ +- e, +19.08.2010 +. +2 ♀♀ +- l, D7: +7.07.2010 +. +2 ♂♂ +, 1 + + +♀ +- l, +18.08.2010 +. +1 ♀ +- l. + +Ceraclea dissimilis +(Stephens, 1836) + + + +D3: +23.06.2010 +. +1 ♂ +- e, +11.07.2010 +. +172 ♂♂ +, +253 ♀♀ +- l, D4: +28.06.2010 +. +62 ♂♂ +, +54 ♀♀ +- l, + + +26.07.2010 +. +1 ♂ +, +9 ♀♀ +- l, +25.08.2010 +. +2 ♂♂ +, +8 ♀♀ +- l, D5: +8.07.2010 +. +4 ♂♂ +, +5 ♀♀ +- l, D6: + + +10.06.2010 +. +102 ♂♂ +, +80 ♀♀ +- l, +6.07.2010 +. +574 ♂♂ +, +468 ♀♀ +- l, +19.08.2010 +. +1 ♀ +- e, +19.08.2010 +. 78 + + +♂♂ +, +41 ♀♀ +- l, D7: +9.06.2010 +. +8 ♂♂ +, +13 ♀♀ +- l, +7.07.2010 +. +78 ♂♂ +, +76 ♀♀ +- l, +18.08.2010 +. +8 ♂♂ +, +1 ♀ + + +- l, D8: +11.06.2010 +. +10 ♂♂ +, +3 ♀♀ +- l, +18.06.2010 +. +1 ♂ +- e, +14.07.2010 +. +11 ♂♂ +, +2 ♀♀ +- l, +27.08.2010 +. 4 + + +♀♀ +- l, K3: +29.06.2010 +. +1 ♂ +- l, KK: +18.06.2010 +. +12 ♂♂ +, +2 ♀♀ +- l, +15.07.2010 +. +31 ♂♂ +, +2 ♀♀ +- l, + + +17.08.2010 +. +20 ♂♂ +, +8 ♀♀ +- l. + +Ceraclea riparia +Albarda, 1874 + + + +D6: +10.06.2010 +. +2 ♂♂ +, +3 ♀♀ +- l, +19.08.2010 +. +10 ♂♂ +, +135 ♀♀ +- l. + +Genus: + +Leptocerus +Leach, 1815 + + + + + +Leptocerus interruptus +Fabricius, 1775 + + + +D3: +11.07.2010 +. +1 ♀ +- l, D6: +11.07.2010 +. +1 ♂ +- l, KK: +18.06.2010 +. +1 ♂ +- l. + +Genus: + +Mystacides +Berthold, 1827 + + + + + +Mystacides azurea +(Linnaeus, 1761) + + + +D4: +24.05.2010 +. +2 ♀♀ +- l, D5: +27.08.2010 +. +4 ♀♀ +- l, D6: +19.05.2010 +. +1 ♂ +- l, +10.06.2010 +. +1 ♂ +, +1 ♀ +- e, + + +6.07.2010 +. +1 ♂ +- l, D7: +9.06.2010 +. +1 ♂ +, +1 ♀ +- l, +7.07.2010 +. +1 ♂ +- l, +18.08.2010 +. +1 ♂ +- l, D8: +14.07.2010 +. + + +1 ♂ +, +1 ♀ +- l, KK: +17.05.2010 +. +5 ♂♂ +, +2 ♀♀ +- e. + +Genus: + +Setodes +Rambur, 1842 + + + + + +Setodes punctatus +Fabricius, 1793 + + + +D6: +6.07.2010 +. +1 ♀ +- l, +19.08.2010 +. +9 ♂♂ +, +22 ♀♀ +- l, D7: +7.07.2010 +. +1 ♂ +- l, D8: +11.06.2010 +. +1 ♂ +- l, + + +14.07.2010 +. +10 ♂♂ +, +14 ♀♀ +- l. + +Setodes bulgaricus +Kumanski, 1967 + + + +D6: +19.08.2010 +. +8 ♂ +, +12 ♀♀ +- l, D8: +14.07.2010 +. +4 ♂ +, +3 ♀♀ +- l, KK: +15.07.2010 +. +3 ♂ +, +2 ♀♀ +- l. + +Genus: +Oecetis (Curtis, 1834) + + + + +Oecetis notata +Rambur, 1842 + + + +D8: +14.07.2010 +. +1 ♂ +- l, +27.08.2010 +. +5 ♂♂ +- l, KK: +17.08.2010 +. +2 ♂♂ +, +9 ♀♀ +- l. + +Oecetis testacea +(Curtis, 1834) + + + +D6: +19.08.2010 +. +6 ♀♀ +- l, D7: +18.08.2010 +. +1 ♀ +- l, SR: +27.06.2010 +. +1 ♀ +- l, KK: +17.08.2010 +. +1 ♀ +- e. + + + + \ No newline at end of file diff --git a/data/99/3D/92/993D9254FFF68C1BD9E5FB30EB3F29ED.xml b/data/99/3D/92/993D9254FFF68C1BD9E5FB30EB3F29ED.xml new file mode 100644 index 00000000000..73b5f5cf164 --- /dev/null +++ b/data/99/3D/92/993D9254FFF68C1BD9E5FB30EB3F29ED.xml @@ -0,0 +1,256 @@ + + + +New species of the genus Pseudamnicola from Kythira Island (Mollusca: Gastropoda: Hydrobiidae) + + + +Author + +Glöer, Peter +Schulstrasse 3, D- 25491 Hetlingen, Germany. E-mail: gloeer @ malaco. de + + + +Author + +Porfyris, Anastasios +Blessa str. 33, 15669 Athens, Greece. E-mail: tasosporfyris @ yahoo. com + + + +Author + +. + + + +Author + +Nhmw + + + +Author + +. + + + +Author + +. + + + +Author + +Sws + + + +Author + +. + + + +Author + +., P. + +text + + +Ecologica Montenegrina + + +2020 + +2019-11-26 + + +38 + + +8 +11 + + + + +http://dx.doi.org/10.37828/em.2020.38.2 + +journal article +300847 +10.37828/em.2020.38.2 +695942ce-62c6-4e7e-af54-96654e8f809f +2336-9744 +13232373 +urn:lsid:zoobank.org:pub:F0A0B89B-3055-45DD-8223-B22209818F05 + + + + + + + +Pseudamnicola mitataensis + +n. sp. + + + + + + +Fig 1 + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +4D312097-3520-44CB-B713-DDFC324B7700 + + + + + +Material examined: + + +Holotype +: + +shell +3.1 mm +high and +2.2 mm +broad ( +ZMH 140797 +) + +. + + +Paratypes +: + +2 specimens +from type locality (in isopropanol, +ZMH 140798 +) + +, +2 specimens +in coll. Glöer, +1 specimen +in coll. Porfyris. + + + +Figures 2-5 +. +2 +: + +Pseudamnicola exilis + +(lectotype, NHMW), +3 +: + +P. +“ +exilis + +” sensu Schütt from Skala (Laconia), +4 +: + +P. mitataensis + +n. sp. +(holotype), +5 +: + +P. mitataensis + +n. sp. +paratype (photographed under ethanol). (2, 3 after +Schütt 1980 +). + + + + + +Type +locality: + +Mitáta +, +Kythira Island +, +Greece +( +36.2450°N +, +22.9963°E +, spring very close to +Mitáta village +) + +. + + + + +Etymology +: Named after the +type +locality. + + + + +Description +: The corneous conical shell has 5-5.5 convex, slightly stepped whorls, separated by a deep suture. The body whorl is prominent and takes 0.75-0.77 of shell height. The aperture is ovate with a sharp peristome. The umbilicus is slit-like to closed. The shell is +2.6-3.1 mm +high and +2.1-2.2 mm +broad. Juveniles are more globular. + + +Differentiating characters +: The new species differs from the +lectotype +of + +Pseudamnicola exilis +, + +in shell height and relative height of the spire. This relation of height of body whorl to shell height is in + +P. magdalenae + +0.83-0.86 vs. +0.75-0.81 in + +P. mitataensis + +n. sp. + + + + +Distribution: +Greece +; only known from the +type +locality. + + + + \ No newline at end of file diff --git a/data/C2/11/87/C21187BFCD562A3BFF79FBC84A21F85C.xml b/data/C2/11/87/C21187BFCD562A3BFF79FBC84A21F85C.xml new file mode 100644 index 00000000000..a01eca1a8a8 --- /dev/null +++ b/data/C2/11/87/C21187BFCD562A3BFF79FBC84A21F85C.xml @@ -0,0 +1,785 @@ + + + +Anarta insolita umay, a new subspecies from Russian Altai and Mongolia, with re-characterization of Anarta insolita uigurica (Hacker, 1998) (Lepidoptera, Noctuidae, Noctuinae) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia & Corresponding author + + + +Author + +Titov, Sergey V. +Department of Biology and Ecology; the Research Centre for Environmental " Monitoring ", Pavlodar State University, Lomova str. 64, KZ- 140008, Pavlodar, Kazakhstan + + + +Author + +Černila, Matjaž +The Slovenian Museum of Natural History, Prešernova 20, SI- 1001, Ljubljana, Slovenia. E-mail: matjazcernila @ yahoo. com + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-21 + + +35 + + +115 +122 + + + + +http://dx.doi.org/10.37828/em.2020.35.8 + +journal article +10.37828/em.2020.35.8 +2336-9744 +13232440 +urn:lsid:zoobank.org:pub:494B0359-595E-4285-B0F0-ED1C1B09CD7D + + + + + + + +Anarta +( +Tricholea +) +insolita umay + +Volynkin, Titov & Černila + +, + +ssp. n. + + + + + + +( +Figs 1–4 +, +9, 10 +, +13, 15 +) + + + + +Type material. + + +Holotype + +( +Figs 1 +, +9 +): male, “ + +04.VI.2010 + +, +Russia +, +Altai Republic +, Kosh- +Agach District +, foot of +Kuraisky Ridge +near +Chuya Steppe +, + +5 km +E of Chagan-Uzun village + +, stony steppe, +50°5'41.82"N +88°25'33.32"E +, + +2130 m + +. Volynkin A. +V +. leg.”, genital slide AV0842 +Volynkin +( +Coll. +ZSM +, ex coll. +CAV +). + + + + + +Paratypes + +: + +RUSSIA + +: +2 males +, same data as for the holotype ( +Coll. +CAV +) + +; + +4 males +, +Russian +fed., +Altai +mtns., +Kosh-Agach distr. +, +Chagan-Uzun +, 10.station, + +2280 m +a.s.l. + +, +050°05'45"N +, +088°25'35"E +, +Černila M. +( +Coll. +MCK +) + +; + +1 male +, +Russian +fed., +Altai +mtns., +Kosh-Agach distr. +, +Ulandryk +r., + +2050m +a.s.l. + +, +049°40'43"N +, +089°04'46"E +, + +21–22. +VI + + + +.2011, +Černila M. +, +Nakonechny A.N. +( +Coll. +MCK +) + +; + +1 male +, + +12.VII.2009 + +, +Altai Republic +, +Kosh-Agach district +, +Chuya +steppe, + +6 km +SE of Chagan-Uzun village + +, steppe. + +1800m + +. N 50º04', E 88º24' +By +light. +Volynkin A. +V + +., + +Černila M. +& +Nakonechnyi A.N. +leg. ( +Coll. +CAV +) + +; + + +MONGOLIA + +: +3 females +, +Bayan-Ölgii aimak +, NE coast of +Tolbo Nuur Lake +, + +2100m + +, + +1.VII.1968 + +, exp. +Kaszab +( +Coll. +HNHM +) + +; + +1 female +, +Bayanchongor +aimak, +Mts. +, +Ih Bogd Uul +, + +1850 m + +, valley of +Pitut river +, +45°00’ N +, +100°13’ E +, + +24- 26.VII.1987 + +, leg. +L. Peregovits +, +M. Hreblay +, & +T + +. + +Stéger +( +Coll. +PGM +) + +; + +1 female +, +Dundgovi aimak +, + +22 km +S of Mandalgovi + +, + +8. +V + + + +.1990, leg. +Fábián +, +Hreblay +, +Peregovits +& +Ronkay +( +Coll. +GRB +) + +; + +1 male +, +Dundgovi aimak +, +Mandalgovi +, leg. +Varga +, genital slide 5936 +Varga +( +Coll. +ZVD +) + +; + +1 male +, +Ömnögovi aimak +, +Naran Bulag +, + +1500m + +, + +14. +V + + + +.1990, leg. +Fábián +, +Hreblay +, +Peregovits +& +Ronkay +, genital slide 9937 +Hacker +( +Coll. +HNHM +) + +; + +1 female +, +Ömnögovi aimak +, +Gurvantos +, + +1300m + +, + +12–14. +V + + + +.1990, leg. +Fábián +, +Hreblay +, +Peregovits +& +Ronkay +, genital slide 9938 +Hacker +( +Coll. +HNHM +) ( + +former +paratypes + +of +A. i. uigurica +) + +; + +1 male +, +1 female +, 30– + +31.05.2011 + +, SW +Mongolia +, +Govi-Altai aimak +, +Mongolian Altai Mts. +(S. slope), +Mogoijn-Gol valley +, h= + +1800 m + +, +45°39’ N +, +93°47’ E +. +Yakovlev +R + +. + +V + +. + +leg., genital slide AV1480 (female) +Volynkin +( +Coll. +CAV +) + +; + +2 males +, 06– + +08.07.2010 + +, SW +Mongolia +, +Govi-Altai aimak +, +Mongolian Altai Mts. +(S slope), +Mogoijn-Gol Valley +, + +1800m + +, +45º39' N +, +93º47' E +, +Yakovlev +R + +. + +V + +. & + +Guskova +E. +V + +. + +leg., genital slide AV0893 +Volynkin +( +Coll. +CAV +) + +; + +1 female +, + +29.05.2011 + +, W +Mongolia +, +Khovd aimak +, near of +Altan-Soembo +, +Uvchugijn-Serven Mt. +, + +1700m + +, +45°39’N +, +93°21’E +. +Yakovlev +R + +. + +V + +. + +leg. ( +Coll. +CAV +) + +; + +1 female +, + +19.06.2005 + +, W +Mongolia +, +Khovd aimak +, +Bodonchijn-Gol river +basin, +Tsagduultai river +valley, + +2000 m + +, +Yakovlev +R + +. + +V + +. + +leg. ( +Coll. +CAV +) + +. + + + + +Figures 1–8. + +Anarta insolita + +sspp.: adults. Depositories of specimens: 1 in ZSM; 2–6 in CAV; 7 in PGM (photo by P. Gyulai); 8 in ZMB. + + + + +Diagnosis +. The new subspecies differs externally from +A. i. uigurica +in its less contrast forewing pattern, paler claviform stigma, slightly narrower and more monotonous reniform stigma, narrower and more interrupted inner blackish brown shade of the subterminal line, and narrower and more diffuse discal spot of hindwing. In comparison to the nominate subspecies ( +Fig. 8 +), +A. i. umay +ssp. n. +has the slightly smaller size and narrower forewing with a less elongate apex, the ochreous brown forewing coloration (sand yellowish in + +A. i. +insolita + +), the conspicuously more contrast forewing pattern with a well-developed subterminal line, the smaller orbicular stigma with a clearly distinguishable fringe (that is indistinct in + +A. i. +insolita + +), the narrower reniform stigma with a clearly distinguishable fringe and a dark grey suffusion in its posterior half (in + +A. i. +insolita + +that is monotonous with an indistinct fringe), and the broader discal spot of hindwing. The male genitalia of +A. i. umay +ssp. n. +are very similar to those of +A. i. uigurica +(illustrated by +Hacker (1998)) +, but in +A. i. umay +ssp. n. +the right saccular process is slightly less elongate, whereas in + +A. i. +insolita + +that is more elongate and reaches the tip of cucullus. The male genitalia of +A. i. umay +ssp. n. +differ clearly from those of +A. i. uigurica +in the narrower uncus, the more elongate and more heavily sclerotized juxta, the narrower right saccular process with a pointed tip (whereas in +A. i. uigurica +the right saccular process is more robust and apically broadened and densely dentate), and the slightly larger cornutus in aedeagus vesica. The female genitalia of the three subspecies are very similar, but those of +A. i. umay +ssp. n. +have the slightly shorter apophyses anteriores and slightly more heavily sclerotized longitudinal ribs of the posterior section of corpus bursae than those structures of +A. i. uigurica +. Additionally, the anterior section of corpus bursae of the new subspecies bears a narrowly lanceolate, weakly sclerotized signum, which is absent in +A. i. uigurica +. The distal female abdominal segments of +A. i. umay +ssp. n. +( +Fig. 15 +) are narrower than those of +A. i. uigurica +( +Fig. 16 +). Compared to the nominate subspecies (illustrated by +Hacker (1998)) +, the female genitalia of +A. i. umay +ssp. n. +have the slightly less elongate and more weakly sclerotized longitudinal ribs of the posterior section of corpus bursae. + + + + +Description. External morphology of adults +( +Figs 1–4 +). Forewing length +14–17 mm +in males and +16–17 mm +in females. Male antenna ciliate, female antenna filiform. Body ochreous brown with slight admixture of dark brown scales. Forewing moderately broad, triangular. Forewing ground color ochreous brown with slight admixture of dark brown scales. Basal line double, brown but blackish on costa, wavy, interrupted on veins. Antemedial line double, brown but blackish on costa, irregularly wavy. Claviform stigma short, with rounded tip, pale brown, sometimes indistinct. Orbicular stigma round, pale ochreous, fringed with brown scales. Reniform stigma moderately large, with concave outer margin, fringed with brown scales, its anterior half pale ochreous, while posterior one with strong grey suffusion. Postmedial line double, brown but blackish on costa, its inner line irregularly wavy, while outer one irregularly dentate. Subterminal line dark brown, irregularly dentate, its posterior half indistinct between veins, while anterior one fringed with blackish brown shades inwardly. Terminal line thin, blackish brown, interrupted between veins. Outer wing margin slightly wavy, cilia pale ochreous. Hindwing pale ochreous with brown suffusion basally and medially, and brown in outer third. Discal spot large, semilunar. Cilia pale ochreous. +Male genitalia +( +Figs 9, 10 +). Uncus broad, dorso-ventrally flattened, elliptical, with narrow base, densely setose ventrally. Tegumen short, penicular lobe broad, rounded. Juxta elongate and narrow, curved medially, heavily sclerotized. Vinculum short but robust, V-shaped with rounded tip. Valva elongate, moderately broad, with narrow cucullus with rounded tip; corona presented. Costa narrow but heavily sclerotized, with short, broad, rounded and swollen extension directed distally-ventrally. Sacculi large, strongly asymmetrical: left one very short with broad and rounded tip, while right one with long, distally narrowed and apically pointed and weakly dentate, completely covers clasper. Clasper nearly straight with slightly convex outer margin, parallel the ventral margin of valva, distally foot-like broadened. Aedeagus elongate, with large coecum, slightly curved medially and narrowed distally. Vesica with short semiglobular subbasal dorsal diverticulum and elongate, medially curved and distally strongly narrowed distal diverticulum bearing small spine-like apical cornutus; vesica ejaculatorius moderately broad, originates subbasally, directed ventrally. +Female genitalia +( +Fig. 13 +). Ovipositor short, broad, conical; papilla analis trapezoid with rounded corners, densely setose. Apophyses thin, apophyses posteriores ca. twice longer than apophyses anteriores. Ostium bursae moderately broad, with medial concavity ventrally. Ductus bursae short, heavily sclerotised, dorso-ventrally flattened. Posterior section of corpus bursae narrow and elongate, with numerous longitudinal sclerotized ribs. Anterior section of corpus bursae pear-shaped, membranous, with narrowly lanceolate weakly sclerotized signum. Appendix bursae very short and moderately broad, rugose, situated latero-ventrally at junction to ductus bursae. + + + +Figures 9–12. + +Anarta insolita + +sspp.: male genitalia. Depositories of specimens: 9 in ZSM; 10–12 in CAV. + + + + +Figures 13–16. + +Anarta insolita + +sspp.: female genitalia (13, 14) and female distal abdominal segments (15, 16). Specimens are deposited in CAV. + + + +Molecular data +. + +COI 5‘ sequences of +two specimens +of +A. i. umay +ssp. n. +from +Western Mongolia +( +Mogoijn-Gol valley +, +BOLD +vouchers BC +ZSM +Lep +90261 and 90262) were compared with COI 5‘ sequences of +two specimens +of +A. i. uigurica +( +BOLD +vouchers BC +ZSM +Lep +90263 and 90264). +The +COI 5‘ sequences of the two subspecies have no diagnostic differences. +The +658 b. p. length COI 5‘ sequence of the +A. i. umay +ssp. n. +paratype +( +BOLD +voucher BC +ZSM +Lep 90263) is as follows: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTC GAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTAC AGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTG ACTTGTCCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAACAATATAAGTTTTT GACTCTTACCCCCATCTCTAACTCTTTTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAAC AGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCAGTAGATTTA GCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACA ATTATCAATATACGATTAAATAGTTTATCCTTTGATCAAATACCTTTATTTATTTGAGCTGTAGG AATTACCGCATTTTTATTATTATTATCACTTCCTGTATTAGCTGGAGCTATTACTATACTTTTAAC TGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGTGGAGGTGACCCAATTTTATATCAAC ATTTATTT + +. + + + + +Distribution +. The new subspecies is known from the southeastern part of the Russian Altai Mts (Kosh-Agach District: Chuya Steppe), and western and southern +Mongolia +( +Bayan-Ölgii +, +Khovd +, +Govi-Altai +, +Dundgovi +and +Ömnögovi +Aimags). + + + + +Etymology +. In Turkic mythology, Umay is the goddess of fertility and the patroness of children. + + + + \ No newline at end of file diff --git a/data/C6/75/C5/C675C50EFFEEFF8169B00C699D1BFDDB.xml b/data/C6/75/C5/C675C50EFFEEFF8169B00C699D1BFDDB.xml new file mode 100644 index 00000000000..087b51100ce --- /dev/null +++ b/data/C6/75/C5/C675C50EFFEEFF8169B00C699D1BFDDB.xml @@ -0,0 +1,279 @@ + + + +A new species of the genus Tasactes Faust, 1894 (Coleoptera, Curculionidae) from Nepal + + + +Author + +Legalov, Andrei A. +Institute of Systematics and Ecology of Animals, SB RAS, Frunze street 11, Novosibirsk, 630091, Russia. & Altai State University, Lenina 61, Barnaul, 656049, Russia. & Tomsk State University, Lenina Prospekt 36, 634050 Tomsk, Russia. * Corresponding author. E-mail: fossilweevils @ gmail. com + +text + + +Ecologica Montenegrina + + +2021 + +2021-03-22 + + +40 + + +128 +132 + + + + +http://dx.doi.org/10.37828/em.2021.40.11 + +journal article +10.37828/em.2021.40.11 +2336-9744 +urn:lsid:zoobank.org:pub:080822A8-DCAE-4F8E-A81E-3659FBC4227D + + + + + + + +Tasactes dudkoi +Legalov + + +, + +sp +. +nov. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +884A9E45-5AD7-42DB-9928-60CD3E10A98C + + + + + +( +Figs. 1−2 +) + + + + +Type material: + +Holotype +, male ( +ISEA +), +Nepal +, +Solukhumbu Distr. +, +Inkhu Khola River +near +Sibuje +, + +2000−2500 m + +, +27°34.7' N +, +86°46.7' E +, 27− + +28.05.2018 + +, +R +. +Yu. Dudko + +; + +Paratypes +: +1 male +( +ISEA +) + +, + +1 female +( +ISEA +), idem + +; + +1 male +( +ISEA +) + +, + +1 female +( +ISEA +), +Nepal +, +Solukhumbu Distr. +, near +Narkung Pass +, + +2700−3150 m + +, +27°35' N +, +86°45' E +, + +28.05.2018 + +, +R + +.Yu. Dudko; + +1 female +( +ISEA +), E +Nepal +, +Bhojpur Distr. +, + +1.5 km +NE of Salpa Pass + +, + +3350 m + +, +27°26.7' N +, +86°56.1' E +, + +21.05.2018 + +, +R + +.Yu. Dudko. + + + + +Figure 1. + +Tasactes dudkoi + +sp. nov. +, body, dorsally: a - male, holotype, b - female, paratype. Scale bar = 1.0 mm. + + + + +Figure 2. + +Tasactes dudkoi + +sp. nov. +, holotype, aedeagus: a – dorsally, b – laterally, с – apex of aedeagus, dorsally. Scale bar = 1.0 mm. + + + + +Description + + +Male. +Body black, with matted pubescence. Antennae, apex of tibiae and tarsi red-brown. Head subconical. Mandibles small. Rostrum long, 1.1 times as long as pronotum, 3.7-4.0 times as long as wide at apex, 4.4 times as long as wide at midlength, 3.3-3.4 times as long as wide at base, evenly curved, sparsely punctate. Apex of rostrum smooth. Eyes large, not protruding from contour of head, linear, widely separated beneath. Forehead flat, 2.0 times as long as rostrum base width. Antennal scrobes directed ventrally to base of rostrum. Antennae inserted in apical third of rostrum. Scape long, 6.7 times as long as wide in apex, not reaching eye. Funicle 6-segmented. Antennomeres 2-7 subconical. Antennomere 2 1.8 times as long as wide in apex, 0.2 times as long as and 0.6 times as narrow as scape. Antennomere 3 2.0 times as long as wide in apex, equal in length and 0.9 times as narrow as antennomere 2. Antennomeres 4 and 5 subequal. Antennomere 4 0.8 times as long as wide in apex, 0.4 times as long as and 1.1 times as wide as antennomere 3. Antennomere 6 0.6 times as long as wide, equal in length and 1.3 times as wide as antennomere 5. Antennomere 7 0.8 times as long as wide, 1.5 times as long as and 1.2 times as wide as antennomere 6. Antennal club compact, 3.3 times as long as wide, 0.8 times as long as antennomeres 2-7 combined, with subconical tomentose apex. Pronotum campanulate, 1.4 times as long as wide at apex, 0.9 times as long as wide at midlength, 1.0-1.1 times as long at pronotal base. Pronotal disk weakly convex dorsally, densely punctate, with weak carina in middle. Intervals between points smaller than their diameter. Sides rounded, narrowed quite sharp towards base. Maximum width before middle. Base of pronotum 0.8-0.9 times as narrow as base of elytra. Scutellum small, triangular. Elytra suboval, at base 1.6 times as long as wide, at midlength 1.2 times as long as wide, at apical fourth 1.6-1.7 times as long as wide, 1.9-2.0 times as long as pronotum. Humeri weakly convex. Elytral striae distinct. Stria 9 short, fused with stria 10 at level of metacoxae. Interstriae convex, wide, wider than striae, pilose pustules. Prosternum punctate, with weak postocular lobes. Precoxal portion of prosternum distinctly longer than procoxal cavity. Postcoxal portion of prosternum short. Procoxal cavities contiguous. Mesocoxal cavities narrowly separated. Metanepisternum absent. Metaventrite quite long, longer than length of metacoxa, weakly convex, punctate. Abdomen weakly convex ventrally, punctate. Ventrite 2 1.1 times as long as ventrite 1. Ventrite 3 0.7 times as long as ventrite 2. Ventrite 4 0.6 times as long as ventrite 3. Ventrite 5 1.6 times as long as ventrite 4, coarsely punctate. Pygidium almost vertical, impressed in meddle. Procoxae subconical. Mesocoxae spherical, narrowly separated. Metacoxae transverse. Femora slightly thickened, without tooth. Metafemora 5.2 times as long as wide in middle, not extending beyond apex of abdomen. Tibiae weakly curved, with large uncus. Tarsi long. Tarsomeres 1-3 conical, with erect setae ventrally. Tarsomere 5 elongate. Tarsal claws free, divergent. Total body length (without rostrum) +5.5-5.8 mm +. Length of rostrum +1.6-1.9 mm +. + + + +Figure 3. +Habitat of + +Tasactes dudkoi + +sp. nov. + + + +Female +. Rostrum subequal in length to pronotum, 3.8 times as long as wide at apex, 4.2 times as long as wide at midlength, 3.5 times as long as wide at base. Pronotum at apex 1.6 times as long as wide, subequal to wide in middle, at base 1.1 times as long as wide. Elytra at base 1.6 times as long as wide, at midlength 1.3 times as long as wide, at apical one fourth 1.7 times as long as wide, 1.9 times as long as pronotum. Total body length (without rostrum) +5.4-6.2 mm +. Length of rostrum +1.8-1.9 mm +. + + + + +Differential diagnosis +. The new species is similar to +Th +. + +interruptus +Faust, 1894 + +from +Myanmar +but differs from it in the more strongly curved rostrum, punctate pronotum, with rounded sides narrowed more sharply towards base. + + + + +Etymology. +The species is named in honor of Dr. Roman Yu. Dudko ( +Novosibirsk +, +Russia +). + + +Localisation +. Eastern +Nepal +(Solukhumbu and Bhojpur Distr.). + + + + +Remarks +. This species is leaf-litter-dwelling weevil in the mountain forests of +Nepal +( +Fig. 3 +). + + + + \ No newline at end of file diff --git a/data/C7/23/55/C7235500FFD8F50DFF07FEE366DCEA80.xml b/data/C7/23/55/C7235500FFD8F50DFF07FEE366DCEA80.xml new file mode 100644 index 00000000000..a5d4eee32c8 --- /dev/null +++ b/data/C7/23/55/C7235500FFD8F50DFF07FEE366DCEA80.xml @@ -0,0 +1,142 @@ + + + +Two new species of Meyoarabiella Yakovlev, 2008 (Lepidoptera, Cossidae) from Namibia with World Catalogue of the Genus + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-16 + + +38 + + +166 +171 + + + + +http://dx.doi.org/10.37828/em.2020.38.25 + +journal article +10.37828/em.2020.38.25 +2336-9744 +13232081 +urn:lsid:zoobank.org:pub:4A8517A4-C207-4C92-A945-47B57E13086C + + + + + + + +Meyoarabiella naumanni +Yakovlev + +, +sp. nov. + + + + + + +Figs 1−2, 4 +, +6−7 + + + + +Material +. + +Holotype +(male): +Namibia +, +Region Iikaras +, +Klein Ausvista +, +Umg. Aus Region +, + +1471 m + +, +S 26º40′19′′ +/ +E 16º14′53′′ +, + +01.ii.2016 + +, leg. +H. Sulak +, S. +Naumann +& +Elk Ott +( +Museum Witt +, +Genital Präparat Heterocera No. +32.731) + +. +Paratype +( +1 male +), + +same locality (Museum Witt, +Genital Präparat Heterocera No. +37.160) + +. + + + + +Description +. Antenna bipectinate, crest processes long, 3−3.5 times longer than antenna rod diameter. Male fore wing +10−13 mm +in length ( +holotype +– +10 mm +). Fore wing brown, with sputtering of silver-grey scales at root and discally, series of big blurred dark-brown spots postdiscally (partially fused into wide transverse band), thin dark-brown transverse line submarginally, very thin light stripe on border of wing, fringe brown, unicolorous. Hind wing brown, without pattern, very thin light stripe on border of wing, fringe brown, unicolorous. + +Male genitalia. Uncus long, thin, gnathos arms relatively robust, short; gnathos compact, covered with fine spikes; valve narrow, long, outer edge semicircular, costal and abdominal edge almost smooth; transtilla processes short, laminated, apically strongly curved and tapered, apical end strongly serrated (dorsally and abdominally); juxta tiny, with wide leaf-like lateral processes, saccus almost reduced; phallus short, robust, strongly curved in medium third, with needle-like cornutus in vesica. +Female unknown. + + + +Diagnosis +. The new species is characterized by the bright dark coloring, and the transtilla processes apically strongly serrated (dorsally and abdominally). + + + + +Etymology +. The new species is named after the well-known German entomologist Stephan Naumann – specialist in +Saturniidae +, one of the collectors of both new species. + + + + \ No newline at end of file diff --git a/data/C7/23/55/C7235500FFD8F50EFF07FB54641BEFB6.xml b/data/C7/23/55/C7235500FFD8F50EFF07FB54641BEFB6.xml new file mode 100644 index 00000000000..7e13d4df45f --- /dev/null +++ b/data/C7/23/55/C7235500FFD8F50EFF07FB54641BEFB6.xml @@ -0,0 +1,130 @@ + + + +Two new species of Meyoarabiella Yakovlev, 2008 (Lepidoptera, Cossidae) from Namibia with World Catalogue of the Genus + + + +Author + +Yakovlev, Roman V. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-16 + + +38 + + +166 +171 + + + + +http://dx.doi.org/10.37828/em.2020.38.25 + +journal article +10.37828/em.2020.38.25 +2336-9744 +13232081 +urn:lsid:zoobank.org:pub:4A8517A4-C207-4C92-A945-47B57E13086C + + + + + + + +Meyoarabiella vansoni +Yakovlev + +, +sp. nov. + + + + + + +Figs 3, 5 +, +6 +, +8 + + + + +Material +. + +Holotype +(male): +Namibia +, +Region Hardap +, Umg. Mariental +Hardap +Damm +, + +1190 m + +, +S 24º28.869 +/ +E 17º50.364 +, + +31.i.2016 + +, leg. +H. Sulak +, S. +Naumann +& +Elk Ott +( +Museum Witt +, +Genital Präparat Heterocera No. +32.730). + + + + + +Description +. Antenna bipectinate, crest processes long 3−3.5 times longer than antenna rod diameter, Antenna 1.5 times shorter than fore wing in length. Length of fore wing +9 mm +. Fore wing grey with brown portions basally and discally, thin dark-brown transverse line submarginally, very thin brown stripe on border of wing, fringe brown, unicolorous. Hind wing brown, without pattern, very thin brown stripe on border of wing, fringe brown, unicolorous. + +Male genitalia. Uncus relatively short, robust; gnathos arms relatively short, robust; gnathos small, narrow, densely covered with fine spikes; valve short, wide, outer edge rounded, costal edge smooth, abdominal edge oblique, gradually narrowing from base to apex; transtilla processes short, laminated, apices slightly curved, dorsal surface preapically serrated; juxta tiny, with wide leaf-like lateral processes; saccus almost reduced; phallus robust, short, straight, caudal end oblique, vesica without cornuti. +Female unknown. + + + +Diagnosis +. The new species is characterized by the small size and the absence of cornutus in the vesica. + + + + +Etymology +. The new species is named after the well-known South-African entomologist, Dr. Georg Van Son (1898−1967). Dr. Georg Van Son (1898−1967) was a son of the Dutch diplomat Stefan Van Son (1861- 1918) and the Russian countess Natalia Evgrafovna Komarovskaya. After the death of his father in the Civil War, the family emigrated to +the Netherlands +. George became a zoologist and after a 2-year internship in London received an invitation to Pretoria, where he worked without fail in the entomological department of the Transvaal Museum for 42 years. He is the author of many publications on entomology and of the 4- volume Atlas of South African Butterflies. In his free time he was occupied with his hobby - orchids ( +Shergalin 2013 +). + + + + \ No newline at end of file diff --git a/data/C9/7A/B1/C97AB10B4B33FFF662D27399FDC9683E.xml b/data/C9/7A/B1/C97AB10B4B33FFF662D27399FDC9683E.xml new file mode 100644 index 00000000000..25afd5b204f --- /dev/null +++ b/data/C9/7A/B1/C97AB10B4B33FFF662D27399FDC9683E.xml @@ -0,0 +1,311 @@ + + + +Three new hydrobiid species from Thassos Island (Greece) with a re-description of Amnicola charpentieri Roth, 1855 + + + +Author + +Georgiev, Dilian +Department of Ecology and Nature Conservation, Faculty of Biology, Paisii Hilendarski University of Plovdiv, 24 Tsar Assen Str., 4000 Plovdiv, Bulgaria + + + +Author + +Glöer, Peter +Biodiversity Research Laboratory, Schulstrasse 3, D- 25491 Hetlingen, Germany Corresponding author. E-mail: diliangeorgiev @ abv. bg + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-22 + + +35 + + +129 +137 + + + + +http://dx.doi.org/10.37828/em.2020.35.10 + +journal article +10.37828/em.2020.35.10 +2336-9744 +13232490 +urn:lsid:zoobank.org:pub:F63DAA57-8D7A-4EC7-9FA0-602943FED1FB + + + + + + + +Grossuana beroni + +n. sp. + +( +Figs. 2 +, +3 +, +6-8 +) + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +F8C2DAFC-0535-4E8E-A891-6F9ECFFA88AC + + + + + +Material studied: + + + +Holotype +: + +shell height +1.7 mm +, width +1.2 mm +, from type locality (ZMH 140789). + + + + +Paratypes +: + +43 specimens +in ethanol ( +ZMH 140790 +) + +, +5 specimens +in coll. Glöer, +22 specimens +in coll. Georgiev. + + + +Additional localities: (1) +Greece +, +Thassos Island +, spring below +Drakotrypa cave +, +Panagia village +N40 44 06.3 +E24 44 02.2 +, + +124 m +a.s.l. + +( +ZMH 140792 +: +35 specimens +, +6 specimens +coll. +Glöer +) and (2) +Greece +, +Thassos Island +, +North Aegean +, a big spring in the yard of the church of +Rachoni village +, +N40 45 29.6 +E24 38 17.3 +, + +107 m +a.s.l. + +( +ZMH 140791 +: +5 specimens +, +4 specimens +in coll. +Glöer +) + +. + + +Type locality: + +Greece +, +Thassos Island +, +North Aegean +, a spring (water source) south of +Skala Potamia +near the round road of the island, +N40 41 01.1 +E24 46 16.7 +, + +115 m +a.s.l. + +( +Fig. 1 +) + +. + + + + +Etymology: +Named in honor of Prof. Petar Beron (National Natural History Museum - +Sofia +) who paid attention on this island and inspired D. Georgiev in its young age by his books. + + + + +Description: +Shell: The corneous, small shell is ovate with a prominent body whorl. The 4-4.5 whorls are convex with a weak suture, with smooth surface and fine growth lines. The aperture is rounded ovate with a sharp periostome thickened at the columella. The umbilicus is closed ( +Fig. 2 +). The operculum is dark red. Animal: The animal is mostly dirty whitish or gray colored. The mantle is white or gray with a black wide stripe in its middle. The snout and tentacles are whitish or gray. Small patches of black pigment are visible around eyes and at the base of the snout. Penis: The penis is nearly regularly broad with a long tapered penis-tip and a bilobed outgrowth in the middle part on the left side. There is a dark spot near the penis-tip. + + +Differentiating features: + +Grossuana beroni + +n. sp. +is most similar to + +Grossuana marginata +(Westerlund, 1881) + +from which it differs by more regularly growing whorls, sharper and thinner periostome and lighter soft body pigmentation. The new species is also similar to + +Grossuana sidironerensis +Glöer, Reuselaars & Papavasileiou, 2018 + +described from the area of Drama at the mainland of +Greece +( +Glöer et al., 2018 +) but the last species has a penis with shorter tip, black colored mantle, and its whorls are fast growing (as in + +G. marginata + +). + + + + +Distribution: +Known only from few springs on Thassos Island: a spring (water source) south of Skala Potamia near the round road of the island ( +type +locality), spring below Drakotrypa cave, Panagia village, and a big spring in the yard of the church of Rachoni village. + + + +Figures 3-5 +. +3 +: Type locality of + +Grossuana beroni + +n. sp. +, water source south of Skala Potamia near the round road of the island. +4 +: Type locality of + +Grossuana thasia + +n. sp. +, a spring south of Kinira near the round road of the island. +5 +: Type locality of + +Bythinella rachonica + +n. sp. + + + + +Figures 6-10. +The + +Grossuana +spp. +6 + +-7 +: + +G. beroni + +n. sp. +(paratypes), +8 +: penis of + +G. beroni + +n. sp. +9 +: + +G. thasia + +n. sp (holotype), +10 +: penis of + +G. thasia + +n. sp. + + + +Habitat: +Karst spring in a mixed broad leaf forest (mainly + +Platanus orientalis + +and + +Quercus +spp. + +). Found on moss, dry leaves, sand and stones. + + + + \ No newline at end of file diff --git a/data/C9/7A/B1/C97AB10B4B34FFF462D276F8FABF6C29.xml b/data/C9/7A/B1/C97AB10B4B34FFF462D276F8FABF6C29.xml new file mode 100644 index 00000000000..0d340323b23 --- /dev/null +++ b/data/C9/7A/B1/C97AB10B4B34FFF462D276F8FABF6C29.xml @@ -0,0 +1,193 @@ + + + +Three new hydrobiid species from Thassos Island (Greece) with a re-description of Amnicola charpentieri Roth, 1855 + + + +Author + +Georgiev, Dilian +Department of Ecology and Nature Conservation, Faculty of Biology, Paisii Hilendarski University of Plovdiv, 24 Tsar Assen Str., 4000 Plovdiv, Bulgaria + + + +Author + +Glöer, Peter +Biodiversity Research Laboratory, Schulstrasse 3, D- 25491 Hetlingen, Germany Corresponding author. E-mail: diliangeorgiev @ abv. bg + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-22 + + +35 + + +129 +137 + + + + +http://dx.doi.org/10.37828/em.2020.35.10 + +journal article +10.37828/em.2020.35.10 +2336-9744 +13232490 +urn:lsid:zoobank.org:pub:F63DAA57-8D7A-4EC7-9FA0-602943FED1FB + + + + + + + +Bythinella reischuetzi +Glöer & Georgiev + +n. sp. + +( +Figs. 2 +, +18-21 +) + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +5FFCFB24-AF6F-4625-9A57-70520A01B94D + + + + + +Materials studied: + + + + +Holotype + +: shell height +2.5 mm +, shell width +1.7 mm +, +ZSM +Mol +20202395, coll. +Roth. + + + + + +Paratypes + +: numerous (> 150) specimens, +ZSM +Mol + +20012100 + +, coll. +Roth. + + + +Type locality +: +Greece +, Párnis (Mountain) in Parnitha National Park. + + + + +Etymology: +Named after Peter L. Reischütz (Vienna), outstanding expert on Hydrobiids of the Balkans, who already pointed out in 2008 (p. 35) that the + +Bythinella +spp. + +of the Peleponnese is much more diverse than believed at that time. + + + + +Figs 18-21 +. + +Bythinella reischuetzi + +n. sp. +18 +: holotype, +19 +: original label, +20 +: paratype, +21 +: apical view. + + + + +Description +: The ovate shell is thick-walled with 4-4.5 slightly convex whorls, separated by a clear suture. The first whorl lies in a plane and is not visible from frontal view. The aperture is ovate with a slight angle at the top. The peristome is thickened at the columella. The umbilicus is closed. The shell is +2.5 mm +high and +1.7 mm +broad. + + +Differentiating characters +: The species differs from all other + +Bythinella +spp. + +of +Greece +by the first whorl which lies in a plane. Thus the compressed shell shape is characteristic of this species. + + + + +Distribution +: Only known from +type +locality. + + + + +Remark +: In this region another + +Bythinella +sp. + +occurred (see +Fig. 15 +), distinct from + +B. reischuetzi + +n. sp. +Unfortunately we do not know the exact locations because these have not been mentioned at the labels. + + + + \ No newline at end of file diff --git a/data/C9/7A/B1/C97AB10B4B35FFF662D2710EFDC96F96.xml b/data/C9/7A/B1/C97AB10B4B35FFF662D2710EFDC96F96.xml new file mode 100644 index 00000000000..b03b11a90ef --- /dev/null +++ b/data/C9/7A/B1/C97AB10B4B35FFF662D2710EFDC96F96.xml @@ -0,0 +1,270 @@ + + + +Three new hydrobiid species from Thassos Island (Greece) with a re-description of Amnicola charpentieri Roth, 1855 + + + +Author + +Georgiev, Dilian +Department of Ecology and Nature Conservation, Faculty of Biology, Paisii Hilendarski University of Plovdiv, 24 Tsar Assen Str., 4000 Plovdiv, Bulgaria + + + +Author + +Glöer, Peter +Biodiversity Research Laboratory, Schulstrasse 3, D- 25491 Hetlingen, Germany Corresponding author. E-mail: diliangeorgiev @ abv. bg + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-22 + + +35 + + +129 +137 + + + + +http://dx.doi.org/10.37828/em.2020.35.10 + +journal article +10.37828/em.2020.35.10 +2336-9744 +13232490 +urn:lsid:zoobank.org:pub:F63DAA57-8D7A-4EC7-9FA0-602943FED1FB + + + + + + + +Grossuana thasia + +n. sp. + +( +Figs. 2 +, +4 +, +9-10 +) + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +019E5D1D-E033-4913-896D-4C779ACA9198 + + + + + +Material studied: + + + + +Holotype +: + +shell height +1.7 mm +, width +1.1 mm +, from type locality ( +ZMH 140793 +). + + + + + +Paratypes +: + +5 specimens +in ethanol ( +ZMH 140794 +) + +, +5 specimens +in coll. Glöer, +11 specimens +in coll. Georgiev. + + +Type locality: + +Greece +, +Thassos Island +, +North Aegean +, a spring (water source) south of +Kinira +near the round road of the island, +N40 38 07.5 +E24 45 52.2 +, + +144 m +a.s.l. + +( +Fig. 3 +) + +. + + + + +Etymology: +Named after Thassos Island on which the species lives. + + + + +Description: +Shell: The corneous shell is elongate ovate with a prolonged body whorl ( +Fig. 2 +). The apex is rounded and often eroded. The 4-4.5 whorls are slightly convex with a weak suture, with rough irregular growth lines. The aperture is ovate slightly angled at the top with a sharp periostome thickened at the columella. The umbilicus is closed. The operculum is dark red. Animal: The animal is mostly black colored. The mantle is black with a thin white border. The snout and tentacles are black with white or grayish tips. Penis: The penis is nearly regularly broad with a long tapered penis-tip. There is a dark spot at the near the penis-tip. + + +Differentiating features: +The new species is most similar to + +Grossuana angeltsekovi +Glöer & Georgiev, 2009 + +which is known to be widely distributed in +Bulgaria +and North +Greece +( +Georgiev 2013 +, +Georgiev et al., 2015 +, Falniowski et al. 2015, +Glöer et al., 2018 +). From this species + +Grossuana thasia + +n. sp. +differs by its more elongated and slender shell with flatter whorls, which have rough surface with irregular growth lines, and by its more rounded, often eroded apex. The whorls of the shell of the new species are 4-4.5 while in + +G. angeltsekovi + +they are 5-5.5 and the later is larger (height of the +holotype += +2.1 mm +). In addition + +G. thasia + +has a well visible bifurcated penis lobe, while in + +G. angeltsekovi + +it is very small and hardly visible ( +Glöer & Georgiev, 2009 +). + + + +Grossuana thasia + +n. sp. +is similar by its shell morphology to + +Grossuana stenaensis +Glöer, Reuselaars & Papavasileiou, 2018 + +described from the nearby mainland of +Greece +( +Glöer et al., 2018 +) but this species has a penis with broader base and shorter and thicker tip. + + +Previously all + +Grossuana + +of Thassos were assigned to + +G. hohenackeri +(Küster, 1853) ( +Reischütz, 1983 +) + +. It was later re-described and split into two species: + +Radomaniola tritonum +(Bourguignat, 1852) + +and + +Grossuana tembii +Boeters, Glöer & Falniowski (2018) + +( +Boeters et al., 2018 +). + +G. thasia + +n. sp. +differs from + +G. tembii + +by its higher whorl number ( +3.25-3.5 in + +G. tembii + +) and longer penis tip. + + + + +Distribution: +Known only from the +type +locality. + + +Habitat: +Karst spring in a mixed broad leaf forest (mainly + +Platanus orientalis + +and + +Quercus +spp. + +). Found on moss, dry leaves, sand and stones. + + + + \ No newline at end of file diff --git a/data/C9/7A/B1/C97AB10B4B35FFF762D276B7FE9A687A.xml b/data/C9/7A/B1/C97AB10B4B35FFF762D276B7FE9A687A.xml new file mode 100644 index 00000000000..66148ea369d --- /dev/null +++ b/data/C9/7A/B1/C97AB10B4B35FFF762D276B7FE9A687A.xml @@ -0,0 +1,128 @@ + + + +Three new hydrobiid species from Thassos Island (Greece) with a re-description of Amnicola charpentieri Roth, 1855 + + + +Author + +Georgiev, Dilian +Department of Ecology and Nature Conservation, Faculty of Biology, Paisii Hilendarski University of Plovdiv, 24 Tsar Assen Str., 4000 Plovdiv, Bulgaria + + + +Author + +Glöer, Peter +Biodiversity Research Laboratory, Schulstrasse 3, D- 25491 Hetlingen, Germany Corresponding author. E-mail: diliangeorgiev @ abv. bg + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-22 + + +35 + + +129 +137 + + + + +http://dx.doi.org/10.37828/em.2020.35.10 + +journal article +10.37828/em.2020.35.10 +2336-9744 +13232490 +urn:lsid:zoobank.org:pub:F63DAA57-8D7A-4EC7-9FA0-602943FED1FB + + + + + + + +Bythinella charpentieri +Roth, 1855 + + +( +Figs. 1 +, +2 +, +9-15 +) + + + + + + + +Type +locality + +: +Hymettos +, east of +Athens +, +Attika + +. + + + +There +are four samples ( +Kephesos +, +Attika +, 2x +Hymettos +) marked as +Syntypes +in +ZSM + +. + +Only +one sample contained a specimen which corresponds to the original description. +Thus +we designate this species as the +lectotype +( +ZSM + +20012106 + +) + +. + + +Re-description +: The ovate-cylindrical shell has 4.5-5 regularly growing convex whorls with a deep suture. The aperture is ovate with a round angle at the top. The aperture height takes +1 +/ +3 +of shell height. The peristome is sharp, somewhat reflexed at the columella. The umbilicus is closed. The shell is +3.3 mm +high and +1.8 mm +broad. + + + + \ No newline at end of file diff --git a/data/C9/7A/B1/C97AB10B4B37FFF562D27527FE956DDC.xml b/data/C9/7A/B1/C97AB10B4B37FFF562D27527FE956DDC.xml new file mode 100644 index 00000000000..8faa3d5aaab --- /dev/null +++ b/data/C9/7A/B1/C97AB10B4B37FFF562D27527FE956DDC.xml @@ -0,0 +1,227 @@ + + + +Three new hydrobiid species from Thassos Island (Greece) with a re-description of Amnicola charpentieri Roth, 1855 + + + +Author + +Georgiev, Dilian +Department of Ecology and Nature Conservation, Faculty of Biology, Paisii Hilendarski University of Plovdiv, 24 Tsar Assen Str., 4000 Plovdiv, Bulgaria + + + +Author + +Glöer, Peter +Biodiversity Research Laboratory, Schulstrasse 3, D- 25491 Hetlingen, Germany Corresponding author. E-mail: diliangeorgiev @ abv. bg + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-22 + + +35 + + +129 +137 + + + + +http://dx.doi.org/10.37828/em.2020.35.10 + +journal article +10.37828/em.2020.35.10 +2336-9744 +13232490 +urn:lsid:zoobank.org:pub:F63DAA57-8D7A-4EC7-9FA0-602943FED1FB + + + + + + + +Bythinella rachonica + +n. sp. + +( +Figs. 2 +, +22-25 +) + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +DD058BE9-160A-4CA0-8ECB-7F5E642420DC + + + + + +Materials studied: + + + + +Holotype +: + +shell height +3.1 mm +, width +1.75 mm +, from type locality ( +ZMH 140795 +). + + + + + +Paratypes +: + +3 specimens +in ethanol ( +ZMH 140796 +) + +, +1 specimen +in coll. Glöer. + + +Type locality: + +Greece +, +Thassos Island +, +North Aegean +, a big spring in the yard of the church of +Rachoni village +, +N40 45 29.6 +E24 38 17.3 +, + +107 m +a.s.l. + +( +Fig. 4 +) + +. + + + + +Etymology: +Named after village of Rachoni where the new species was found. + + + + +Description: +Shell ivory, cylindrical with 4.5 whorls, separated by a deep suture. Surface silky and finely striated. Apex obtuse, umbilicus closed. Aperture oval, with a sharp peristome, angled at the top. Shell height +2.9-3.1 mm +, width +1.8 mm +. Penial appendix twice longer than the penis, tubular gland medium-sized, with 5 half loops, tapering from distal to proximal part ( +Fig. 5 +). + + +Differentiating features: +From this region no + +Bythinella +spp. + +are known ( +Glöer & Hirschfelder 2020 +, +Glöer & Reuselaars 2020a +, b, c), except from the neighbouring Samothrake Island, from where Reischütz described + +Bythinella charpentieri cabirius +P.L. Reischütz 1988 + +(considered as a separate species by +Glöer & + + +Georgiev 2012), which is a small and slim species ( +2.5-2.7 mm +high and +1.2-1.3 mm +broad) ( +Glöer & Georgiev 2012 +) and in this way different from + +Bythinella rachonica + +n. sp. + + + + +Figures 22-25. + +Bythinella rachonica + +n. sp. +, +22 +: shell, +23 +: penis in situ, +24 +: penis with penial appendix, +25 +: tubular gland. + + + + +Distribution: +Known only from the +type +locality. The spring at the Agora of Limenas was checked but no living snails were found. Some empty, eroded shells of a + +Bythinella +species + +were found by D. Georgiev in sand deposits in a spring below Panagia village ( +N40 43 56.8 +E24 44 26.6 +, +49 m +a.s.l.) but it is not clear if they belong to + +Bythinella rachonica + +n. sp. + + +Habitat: +Found in a spring (captured under the church of Rachoni, with a concrete bed) on stones and submerged mosses. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10F91EFF47F84B.xml b/data/DF/75/00/DF750049FFC6F352FF10F91EFF47F84B.xml new file mode 100644 index 00000000000..a382702542c --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10F91EFF47F84B.xml @@ -0,0 +1,95 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +8. + +Batocnema africanus +(Distant, 1899) + +( +Figs. 13-14 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [25] + +– +1 ex. +; [27C] – +1 ex. +; [30A] – +3 exs. +; [30F] – +1 ex. +; [30G] – +8 exs. +; [30D] – +4 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10F9E1FE1FF911.xml b/data/DF/75/00/DF750049FFC6F352FF10F9E1FE1FF911.xml new file mode 100644 index 00000000000..699bf923fc8 --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10F9E1FE1FF911.xml @@ -0,0 +1,117 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +7. + +Pseudoclanis postica +(Walker, 1856) + +( +Figs. 10-12 +) + + + + +Material examined: + +Gorongosa National Park +: [6] – +1 ex. +; + + +Chimanimani National Reserve + +: [17] + +– +1 ex. +; + + +Maputo +Special Reserve + +: [27A] + +– +1 ex. +; [27B] – +1 ex. +; [30A] – +6 exs. +; [30C] – +4 exs. +; [30F] – +16 exs. +; [30G] – +9 exs. +; + + +Mt Mabu + +: [31] + +– +2 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10FA89FDEAFA3D.xml b/data/DF/75/00/DF750049FFC6F352FF10FA89FDEAFA3D.xml new file mode 100644 index 00000000000..398912de5a4 --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10FA89FDEAFA3D.xml @@ -0,0 +1,84 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +6. + +Andriasa contraria contraria +Walker, 1856 + +( +Fig. 9 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [30C] – +1 ex. + + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10FC42FE84FB90.xml b/data/DF/75/00/DF750049FFC6F352FF10FC42FE84FB90.xml new file mode 100644 index 00000000000..e75283eb6fb --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10FC42FE84FB90.xml @@ -0,0 +1,95 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +4. + +Polyptychus grayii +(Walker, 1856) + +( +Figs. 5-6 +) + + + + +Material examined: + +Gorongosa National Park +: [4E] – +1 ex. +; [4L] – +1 ex. +; [4N] – +1 ex. +; + + +Maputo +Special Reserve + +: [27C] + +– +1 ex. +; [28] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10FCEAFD58FC5D.xml b/data/DF/75/00/DF750049FFC6F352FF10FCEAFD58FC5D.xml new file mode 100644 index 00000000000..93ce460afd5 --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10FCEAFD58FC5D.xml @@ -0,0 +1,79 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +3. + +Polyptychus jansei +Clark 1936 + +( +Fig. 4 +) + + + + +Material examined: + +Chimanimani National Reserve +: [19] – +3 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10FE1CFDCEFD04.xml b/data/DF/75/00/DF750049FFC6F352FF10FE1CFDCEFD04.xml new file mode 100644 index 00000000000..1f570e8d9eb --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10FE1CFDCEFD04.xml @@ -0,0 +1,107 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +2. + +Polyptychus coryndoni +Rothschild + +& +Jordan +, 1903 ( +Figs. 2-3 +) + + + + +Material examined: + +Gorongosa National Park +: [6] – +1 ex. +: [7B] – +1 ex. +; + + +Coutada +12 + +: [13] + +– +1 ex. +; + + +Chimanimani National Reserve + +: [22] + +– +2 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC6F352FF10FF2CFCC8FE16.xml b/data/DF/75/00/DF750049FFC6F352FF10FF2CFCC8FE16.xml new file mode 100644 index 00000000000..2866a27ed2d --- /dev/null +++ b/data/DF/75/00/DF750049FFC6F352FF10FF2CFCC8FE16.xml @@ -0,0 +1,93 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +1. + +Polyptychus andosa amaniensis +Carcasson, 1968 + +( +Fig. 1 +) + + + + +Material examined: + +Mt Namuli +: [33] – +1 ex. + + +New country record for +Mozambique +. + + +The sole Mozambican record of this species was previously based on +de Encarnação (2014) +, which is a misidentification of a specimen of + +Neopolyptychus compar + +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10F9C3FC37F977.xml b/data/DF/75/00/DF750049FFC8F35CFF10F9C3FC37F977.xml new file mode 100644 index 00000000000..51ccbced324 --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10F9C3FC37F977.xml @@ -0,0 +1,83 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +32. + +Atemnora westermannii +(Boisduval, 1875) + +( +Fig. 45 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; +Coutada 12 +: [14] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10FA89FE32F9DE.xml b/data/DF/75/00/DF750049FFC8F35CFF10FA89FE32F9DE.xml new file mode 100644 index 00000000000..2e1cc53a622 --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10FA89FE32F9DE.xml @@ -0,0 +1,97 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +31. + +Odontosida pusillus +(Felder & Felder, 1874) + +( +Figs. 55-58 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [26] + +– +1 ex. +; [30A] – +23 exs. +; [30B] – +11 exs. +; [30D] – +2 exs. +; [30F] – +1 ex. +; [30G] – +7 exs. +; [30H] – +4 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10FB7FFD69FAE4.xml b/data/DF/75/00/DF750049FFC8F35CFF10FB7FFD69FAE4.xml new file mode 100644 index 00000000000..3fa74c6d3cc --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10FB7FFD69FAE4.xml @@ -0,0 +1,112 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +30. + +Sphingonaepiopsis nana +(Walker, 1856) + +( +Figs. 47-50 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +1 ex. +; [4Q] – +1 ex. +; + + +Coutada +12 + +: [12] + +– +1 ex. +; + + +Maputo +Special Reserve + +: [30C] + +– +1 ex. +; [26] – +1 ex. +; + + +Mt Mabu + +: [31] + +– +4 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10FC42FDCEFBB1.xml b/data/DF/75/00/DF750049FFC8F35CFF10FC42FDCEFBB1.xml new file mode 100644 index 00000000000..adfec6d610e --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10FC42FDCEFBB1.xml @@ -0,0 +1,94 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +29. + +Sphingonaepiopsis ansorgei +(Rothschild, 1894) + +( +Figs. 51-52 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [28] – +1 ex. + +; + +[30C] – +1 ex. + + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10FD56FB4AFC5D.xml b/data/DF/75/00/DF750049FFC8F35CFF10FD56FB4AFC5D.xml new file mode 100644 index 00000000000..049a7af70b6 --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10FD56FB4AFC5D.xml @@ -0,0 +1,137 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +28. + +Cephonodes virescens +(Wallengren, 1858) + +( +Fig. 44 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; + + +Coutada +12 + +: [13] + +– +1 ex. +; [14] – +1 ex. +; + + +Cheringoma Plateau + +: [15] + +– +2 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +1 ex. +; [18] – +1 ex. +; [19] – +2 exs. +; + + +Quirimbas National Park +: + +[23] + +– +5 exs. +; + + +Maputo +Special Reserve + +: [27A] + +– +3 exs. +; [30A] – +4 exs. +; [30B] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10FE3AFEC0FD49.xml b/data/DF/75/00/DF750049FFC8F35CFF10FE3AFEC0FD49.xml new file mode 100644 index 00000000000..187eb6f2b39 --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10FE3AFEC0FD49.xml @@ -0,0 +1,90 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +27. + +Xanthopan morganii morganii +(Walker, 1856) + +( +Figs. 42-43 +) + + + + +Material examined: + +Gorongosa National Park +: [4A] – +1 ex. +; [4K] – +1 ex. +; [6] – +2 exs. + + + + + +Macroglossinae + + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC8F35CFF10FEEFFC70FE75.xml b/data/DF/75/00/DF750049FFC8F35CFF10FEEFFC70FE75.xml new file mode 100644 index 00000000000..7e1da787906 --- /dev/null +++ b/data/DF/75/00/DF750049FFC8F35CFF10FEEFFC70FE75.xml @@ -0,0 +1,103 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +26. + +Oligographa juniperi +(Boisduval, 1847) + +( +Figs. 36-37 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [25] + +– +20 exs. +; [26] – +3 exs. +; [27C] – +1 ex. +; [28] – +14 exs. +; [30A] – +17 exs. +; [30B] – +22 exs. +; [30D] – +11 exs. +; [30F] – +8 exs. +; [30G] – +13 exs. +; [30I] – +7 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10F95AFC97F8A9.xml b/data/DF/75/00/DF750049FFC9F35DFF10F95AFC97F8A9.xml new file mode 100644 index 00000000000..13ad557bb54 --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10F95AFC97F8A9.xml @@ -0,0 +1,130 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +24. + +Pantophaea favillacea +(Walker, 1866) + +( +Figs. 33-34 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +3 exs. +; [4E] – +1 ex. +; [4K] – +6 exs. +; [4M] – +1 ex. +; [4N] – +1 ex. +; + + +Maputo +Special Reserve + +: [30E] + +– +2 exs. +; + + +Coutada +12 + +: [12] + +– +1 ex. +; [13] – +1 ex. +; [14] – +1 ex. +; + + +Cheringoma Plateau + +: [15] + +– +1 ex. +; + + +Quirimbas National Park + +: [23] + +– +1 ex. +; + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10F9E1FD1AF955.xml b/data/DF/75/00/DF750049FFC9F35DFF10F9E1FD1AF955.xml new file mode 100644 index 00000000000..a0fb30d90bc --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10F9E1FD1AF955.xml @@ -0,0 +1,79 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +23. + +Poliana wintgensi +(Strand 1910) + +( +Fig. 32 +) + + + + +Material examined: + +Gorongosa National Park +: [4K] – +2 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10FA89FD23FA3D.xml b/data/DF/75/00/DF750049FFC9F35DFF10FA89FD23FA3D.xml new file mode 100644 index 00000000000..21dfeb56110 --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10FA89FD23FA3D.xml @@ -0,0 +1,79 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +22b. + +Macropoliana natalensis pinheyi +Eitschberger & Melichar, 2016 + +( +Fig. 40 +) + + + + +Material examined: + +Chimanimani National Reserve +: [17] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10FB7FFF21FAE4.xml b/data/DF/75/00/DF750049FFC9F35DFF10FB7FFF21FAE4.xml new file mode 100644 index 00000000000..3640ca59f67 --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10FB7FFF21FAE4.xml @@ -0,0 +1,95 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +22a. + +Macropoliana natalensis natalensis +(Butler, 1875) + +( +Figs 38-39 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [26] + +– +1 ex. +; [27A] – +2 exs. +; [27C] – +2 exs. +; [29] – +1 ex. +; [30B] – +5 exs. +; [30G] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10FC42FBC2FBB1.xml b/data/DF/75/00/DF750049FFC9F35DFF10FC42FBC2FBB1.xml new file mode 100644 index 00000000000..e9d87650440 --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10FC42FBC2FBB1.xml @@ -0,0 +1,119 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +21. + +Coelonia fulvinotata fulvinotata +(Butler, 1875) + +( +Fig. 41 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +2 exs. +; [4K] – +2 exs. +; +Coutada 12 +: [12] – +2 exs. +; [14] – +1 ex. +; + + + + +Chimanimani National Reserve +: [17] – +7 exs. +; [18] – +3 exs. +; [19] – +1 ex. +; [20A] – +1 ex. +; [22] – +4 exs. +; + + +Quirimbas National Park +: [23] – +1 ex. +; + + +Maputo +Special Reserve + +: [30A] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10FD56FE73FC5D.xml b/data/DF/75/00/DF750049FFC9F35DFF10FD56FE73FC5D.xml new file mode 100644 index 00000000000..e35d2bc8189 --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10FD56FE73FC5D.xml @@ -0,0 +1,116 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +20. + +Agrius convolvuli +(Linnaeus, 1758) + +( +Figs. 30-31 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; [4B] – +14 exs. +; [4K] – +1 ex. +; [4N] – +1 ex. +; [4P] – +3 exs. +; [7B] – +3 exs. +; + + +Cheringoma Plateau + +: [15] + +– +3 exs. +; [16] – +1 ex. +; + + +Maputo +Special Reserve + +: [25] + +– +1 ex. +; [28] – +3 exs. +; [30B] – +2 exs. +; [30C] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10FE3AFA93FD49.xml b/data/DF/75/00/DF750049FFC9F35DFF10FE3AFA93FD49.xml new file mode 100644 index 00000000000..ea2aaace861 --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10FE3AFA93FD49.xml @@ -0,0 +1,119 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +19. + +Acherontia atropos +(Linnaeus, 1758) + +( +Figs. 28-29 +) + + + + +Material examined: + +Gorongosa National Park +: [3] – +1 ex. +; [4F] – +1 ex. +(caterpillar on + +Stachytarpheta urticifolia +Sims + +); [4O] – +1 ex. +; [6] – +1 ex. +; [9] – +1 ex. +; [10] – +1 ex. + + + + + + +Maputo +Special Reserve + +: [27B] + +– +1 ex. +; [28] – +1 ex. +; [30B +] +– +1 ex. +; [30C +] +– +1 ex. +; [30G] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFC9F35DFF10FF2CFEBFFE75.xml b/data/DF/75/00/DF750049FFC9F35DFF10FF2CFEBFFE75.xml new file mode 100644 index 00000000000..6f686d5bdcd --- /dev/null +++ b/data/DF/75/00/DF750049FFC9F35DFF10FF2CFEBFFE75.xml @@ -0,0 +1,107 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +18. + +Platysphinx piabilis +(Distant, 1897) + +( +Fig. 25 +) + + + + +Material examined: + +Gorongosa National Park +: [4E] – +4 exs. +; [4L] – +1 ex. +; [4P] – +1 ex. +; [5A] – +1 ex. +; [8] – +1 ex. +; + + +Chimanimani National Reserve + +: [18] + +– +1 ex. +; [19] – +2 exs. +; [22] – +1 ex. + + + + + +Sphinginae + + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFCBF35FFF10F987FC86F932.xml b/data/DF/75/00/DF750049FFCBF35FFF10F987FC86F932.xml new file mode 100644 index 00000000000..ae4b822fadb --- /dev/null +++ b/data/DF/75/00/DF750049FFCBF35FFF10F987FC86F932.xml @@ -0,0 +1,89 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +16. + +Lophostethus dumolinii +(Angas, 1849) + +( +Figs. 26-27 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [30A] – +1 ex. + +; + +[30B] – +1 ex. + + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFCBF35FFF10FA2EFB04F99A.xml b/data/DF/75/00/DF750049FFCBF35FFF10FA2EFB04F99A.xml new file mode 100644 index 00000000000..63999cd5e90 --- /dev/null +++ b/data/DF/75/00/DF750049FFCBF35FFF10FA2EFB04F99A.xml @@ -0,0 +1,90 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +15. + +Leucophlebia rosulenta +Rothschild + +& +Jordan +, 1916 ( +Fig. 21 +) + + + + +Material examined: + +Chimanimani National Reserve +: [22] – +1 ex. +; + + +Quirimbas National Park + +: [23] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFCBF35FFF10FB13FACCFA41.xml b/data/DF/75/00/DF750049FFCBF35FFF10FB13FACCFA41.xml new file mode 100644 index 00000000000..4a148bd4bdb --- /dev/null +++ b/data/DF/75/00/DF750049FFCBF35FFF10FB13FACCFA41.xml @@ -0,0 +1,115 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +14. + +Neoclanis basalis +(Walker, 1866) + +( +Figs. 23-24 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; [4E] – +4 exs. +; [4P] – +4 exs. +; [8] – +1 ex. +; + + +Coutada +12 + +: [13] + +– +1 ex. +; [14] – +2 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +4 exs. +; + + +Quirimbas National Park + +: [23] + +– +3 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFCBF35FFF10FBF8FBFAFB0F.xml b/data/DF/75/00/DF750049FFCBF35FFF10FBF8FBFAFB0F.xml new file mode 100644 index 00000000000..6a123265fd3 --- /dev/null +++ b/data/DF/75/00/DF750049FFCBF35FFF10FBF8FBFAFB0F.xml @@ -0,0 +1,120 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +13. + +Afroclanis neavi +(Hampson, 1910) + +( +Fig. 20 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +3 exs. +; [2B] – +8 exs. +; [2C] – +1 ex. +; [2D] – +2 exs. +; [2E] – +1 ex. +; [2F] – +4 exs. +; [2H] – +1 ex. +; [2I] – +1 ex. +; [5A] – +5 exs. +; [8] – +5 exs. +; +Coutada 12 +: [13] – +1 ex. +; [14] – +1 ex. +; + + + + +Cheringoma Plateau +: [15] – +1 ex. +; + + +Chimanimani National Reserve + +: [18] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFCBF35FFF10FD93FEAFFCE2.xml b/data/DF/75/00/DF750049FFCBF35FFF10FD93FEAFFCE2.xml new file mode 100644 index 00000000000..c80afa13d82 --- /dev/null +++ b/data/DF/75/00/DF750049FFCBF35FFF10FD93FEAFFCE2.xml @@ -0,0 +1,115 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +11. + +Rufoclanis numosae numosae +(Wallengren, 1860) + +( +Figs. 17-18 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +7 exs. +; [4K] – +1 ex. +; [4N] – +2 exs. +; + + +Coutada +12 + +: [13] + +– +1 ex. +; + + +Maputo +Special Reserve + +: [28] + +– +1 ex. +; [30A] – +2 exs. +; [30B] – +1 ex. +; [30E] – +2 exs. +; [30F] – +16 exs. +; [30G] – +4 exs. +; [30I] – +3 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10F93CFB2FF84B.xml b/data/DF/75/00/DF750049FFD2F346FF10F93CFB2FF84B.xml new file mode 100644 index 00000000000..1f8ad95c479 --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10F93CFB2FF84B.xml @@ -0,0 +1,122 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +41. + +Nephele comma +Hopffer, 1857 + +( +Figs. 70-71 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +4 exs. +; [4C] – +1 ex. +; [4E] – +2 exs. +; [4L] – +1 ex. +; [4P] – +1 ex. +; [5B] – +2 exs. +; [7B] – +3 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +14 exs. +; [18] – +10 exs. +; [19] – +1 ex. +; [20A] – +24 exs. +; + + +Maputo +Special Reserve + +: [25] + +– +1 ex. +; [27A] – +4 exs. +; [30B] – +3 exs. +; [30G] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FA2EFEB3F977.xml b/data/DF/75/00/DF750049FFD2F346FF10FA2EFEB3F977.xml new file mode 100644 index 00000000000..d4794615a4f --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FA2EFEB3F977.xml @@ -0,0 +1,128 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +40. + +Nephele bipartita +Butler, 1878 + +( +Figs. 64-65 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; [4B] – +2 exs. +; [4E] – +2 exs. +; [4P] – +1 ex. +; [5B] – +1 ex. +; + + + + +Cheringoma Plateau +: [16] – +3 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +2 exs. +; [18] – +1 ex. +; [21] – +3 exs. +; + + +Maputo +Special Reserve + +: [30A] + +– +1 ex. +; [30B] – +1 ex. +; [30E] – +1 ex. +; [30F] – +3 exs. +; [30G] – +1 ex. +; [30I] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FB32FAFEFA41.xml b/data/DF/75/00/DF750049FFD2F346FF10FB32FAFEFA41.xml new file mode 100644 index 00000000000..6280e5090a5 --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FB32FAFEFA41.xml @@ -0,0 +1,127 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +39. + +Nephele argentifera +(Walker, 1856) + +( +Figs. 59-60 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +1 ex. +; [4K] – +1 ex. +; [4N] – +1 ex. +; [7B] – +1 ex. +; + + +Chimanimani National Reserve + +: [19] + +– +1 ex. +; + + +Quirimbas National Park + +: [23] + +– +1 ex. +; + + +Maputo +Special Reserve + +: [26] + +– +1 ex. +; [27A] – +1 ex. +; [27B] – +5 exs. +; [27C] – +5 exs. +; [28] – +4 exs. +; [30A] – +15 exs. +; [30B] – +2 exs. +; [30F] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FC05FDCEFB6D.xml b/data/DF/75/00/DF750049FFD2F346FF10FC05FDCEFB6D.xml new file mode 100644 index 00000000000..dae4ee98855 --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FC05FDCEFB6D.xml @@ -0,0 +1,86 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +38. + +Nephele aequivalens +(Walker, 1856) + +( +Figs. 66-67 +) + + + + +Material examined: + +Chimanimani National Reserve +: [17] – +6 exs. +; [20A] – +5 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FCCBFEAFFC19.xml b/data/DF/75/00/DF750049FFD2F346FF10FCCBFEAFFC19.xml new file mode 100644 index 00000000000..5711ed00485 --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FCCBFEAFFC19.xml @@ -0,0 +1,98 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +37. + +Nephele accentifera +(Palisot de Beauvois, 1821) + +( +Fig. 62 +) + + + + +Material examined: + +Gorongosa National Park +: [4K] – +1 ex. +; + + +Cheringoma Plateau + +: [15] + +– +1 ex. +; + + +Maputo +Special Reserve + +: [30A] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FDDFFCA6FD26.xml b/data/DF/75/00/DF750049FFD2F346FF10FDDFFCA6FD26.xml new file mode 100644 index 00000000000..330a666142c --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FDDFFCA6FD26.xml @@ -0,0 +1,115 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +36. + +Daphnis nerii +(Linnaeus, 1758) + +( +Fig. 61 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +2 exs. +; [4C] – +1 ex. +; [7B] – +3 exs. +; +Coutada 12 +: [13] – +1 ex. +; + + + + +Chimanimani National Reserve +: [20A] – +1 ex. +; + + +Maputo +Special Reserve + +: [27C] + +– +1 ex. +; [28] – +2 exs. +; [30A] – +4 exs. +; [30B] – +4 exs. +; [30F] – +1 ex. +; [30I] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FE85FBF4FDD2.xml b/data/DF/75/00/DF750049FFD2F346FF10FE85FBF4FDD2.xml new file mode 100644 index 00000000000..12188315441 --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FE85FBF4FDD2.xml @@ -0,0 +1,111 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +35. + +Leucostrophus alterhirundo +d'Abrera, 1987 + +( +Fig. 54 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +2 exs. +; [4C] – +2 exs. +; [4E] – +1 ex. +; [4I] – +4 exs. +; [4K] – +1 ex. +; + + +Coutada +12 + +: [12] + +– +4 exs. +; [14] – +1 ex. +; + + +Maputo +Special Reserve + +: [30A] + +– +1 ex. +; [33] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD2F346FF10FF2CFB6CFE9F.xml b/data/DF/75/00/DF750049FFD2F346FF10FF2CFB6CFE9F.xml new file mode 100644 index 00000000000..1f2d5bcf66d --- /dev/null +++ b/data/DF/75/00/DF750049FFD2F346FF10FF2CFB6CFE9F.xml @@ -0,0 +1,87 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +34. + +Macroglossum trochilus +(Hübner, 1823) + +( +Fig. 53 +) + + + + +Material examined: + +Gorongosa National Park +: [4N] – +2 exs. +; [7A] – +1 ex. +; +Coutada 12 +: [12] – +1 ex. +; [13] – +5 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10F91EFDCEF806.xml b/data/DF/75/00/DF750049FFD5F341FF10F91EFDCEF806.xml new file mode 100644 index 00000000000..2845951674a --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10F91EFDCEF806.xml @@ -0,0 +1,99 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +57. + +Temnora sardanus hirsutus +Darge, 2004 + +( +Fig. 84 +) + + + + +Material examined: + +Gorongosa National Park +: [7B] – +3 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +2 exs. +; [18] – +1 ex. +; [19] – +1 ex. +; [22] – +4 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10F9A5FBCEF911.xml b/data/DF/75/00/DF750049FFD5F341FF10F9A5FBCEF911.xml new file mode 100644 index 00000000000..a6fd890bdb7 --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10F9A5FBCEF911.xml @@ -0,0 +1,85 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +56. + +Temnora roberstoni +Carcasson, 1968 + +( +Fig. 81 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; [4K] – +1 ex. +; +Coutada 12 +: [12] – +5 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10FA6AFC15F9F8.xml b/data/DF/75/00/DF750049FFD5F341FF10FA6AFC15F9F8.xml new file mode 100644 index 00000000000..dd979e04051 --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10FA6AFC15F9F8.xml @@ -0,0 +1,106 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +55. + +Temnora pseudopylas pseudopylas +(Rothschild, 1894) + +( +Figs. 94-95 +) + + + + +Material examined: + +Gorongosa National Park +: [5A] – +1 ex. +; [6] – +11 exs. +; [7A] – +5 exs. +; [7B] – +3 exs. +; + + +Coutada +12 + +: [12] + +– +1 ex. +; + + +Chimanimani National Reserve + +: [18] + +– +3 exs. +; [19] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10FB32FDC1FA86.xml b/data/DF/75/00/DF750049FFD5F341FF10FB32FDC1FA86.xml new file mode 100644 index 00000000000..83f6cd4cf5e --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10FB32FDC1FA86.xml @@ -0,0 +1,81 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +54. + +Temnora pylades stevensoni +Clark, 1926 + +( +Figs. 92-93 +) + + + + +Material examined: + +Mt Namuli +: [33] – +2 exs. +; [34] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10FBF8FB38FB6D.xml b/data/DF/75/00/DF750049FFD5F341FF10FBF8FB38FB6D.xml new file mode 100644 index 00000000000..a9163929fbd --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10FBF8FB38FB6D.xml @@ -0,0 +1,105 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +53. + +Temnora natalis +(Walker, 1856) + +( +Figs. 76-77 +) + + + + +Material examined: + +Gorongosa National Park +: [4E] – +3 exs. +; [4N] – +1 ex. +; [4Q] – +1 ex. +; + + +Maputo +Special Reserve + +: [25] + +– +1 ex. +; [27C] – +1 ex. +; [30A] – +4 exs. +; [30B] – +6 exs. +; [30F] – +2 exs. +; [30G] – +1 ex. +; [30H] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10FCEAFDCEFC3A.xml b/data/DF/75/00/DF750049FFD5F341FF10FCEAFDCEFC3A.xml new file mode 100644 index 00000000000..dc737bbf5ca --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10FCEAFDCEFC3A.xml @@ -0,0 +1,108 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +52. + +Temnora murina +(Walker, 1856) + +( +Figs. 85-87 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [25] + +– +5 exs. +; [27A] – +5 exs. +; [27B] – +1 ex. +; [27C] – +19 exs. +; [30A] – +1 ex. +; [30B] – +1 ex. +; [30D] – +4 exs. +; [30F] – +8 exs. +; [30G] – +7 exs. +; [30I] – +1 ex. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10FDDFFBA4FD04.xml b/data/DF/75/00/DF750049FFD5F341FF10FDDFFBA4FD04.xml new file mode 100644 index 00000000000..6836993852f --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10FDDFFBA4FD04.xml @@ -0,0 +1,108 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +51. + +Temnora marginata marginata +(Walker, 1856) + +( +Figs. 88-89 +) + + + + +Material examined: + +Coutada 12 +: [13] – +3 exs. +; + + +Chimanimani National Reserve + +: [19] + +– +2 exs. +; [22] – +4 exs. +; + + +Maputo +Special Reserve + +: [29] + +– +1 ex. +; [30A] – +1 ex. +; [30C] – +1 ex. +; [30G] – +1 ex. +; [30H] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD5F341FF10FEC1FDCEFDD2.xml b/data/DF/75/00/DF750049FFD5F341FF10FEC1FDCEFDD2.xml new file mode 100644 index 00000000000..0280ef8b766 --- /dev/null +++ b/data/DF/75/00/DF750049FFD5F341FF10FEC1FDCEFDD2.xml @@ -0,0 +1,102 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +50. + +Temnora inornatum +(Rothschild, 1894) + +( +Fig. 82-83 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [25] + +– +1 ex. +; [27A] – +1 ex. +; [28] – +1 ex. +; [30A] – +4 exs. +; [30B] – +1 ex. +; [30D] – +1 ex. +; [30F] – +3 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD6F342FF10F9C3FDCEF933.xml b/data/DF/75/00/DF750049FFD6F342FF10F9C3FDCEF933.xml new file mode 100644 index 00000000000..d97076ea643 --- /dev/null +++ b/data/DF/75/00/DF750049FFD6F342FF10F9C3FDCEF933.xml @@ -0,0 +1,84 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +48. + +Temnora fuscata subrubra +Darge, 2011 + +( +Fig. 79 +) + + + + +Material examined: + +Gorongosa National Park +: [7B] – +2 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD6F342FF10FA89FAD0F9DE.xml b/data/DF/75/00/DF750049FFD6F342FF10FA89FAD0F9DE.xml new file mode 100644 index 00000000000..f787545be2b --- /dev/null +++ b/data/DF/75/00/DF750049FFD6F342FF10FA89FAD0F9DE.xml @@ -0,0 +1,118 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +47. + +Temnora fumosa fumosa +(Walker, 1856) + +( +Figs. 74-75 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +1 ex. +; + + +Coutada +12 + +: [12] + +– +1 ex. +; + + +Maputo +Special Reserve + +: [27A] + +– +1 ex. +; [27C] – +1 ex. +; [28] – +2 exs. +; [30B] – +6 exs. +; [30A] – +2 exs. +; [30F] – +1 ex. +; + + +Mt Namuli + +: [34] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD6F342FF10FB9CFDCEFAE4.xml b/data/DF/75/00/DF750049FFD6F342FF10FB9CFDCEFAE4.xml new file mode 100644 index 00000000000..72ec5798f7f --- /dev/null +++ b/data/DF/75/00/DF750049FFD6F342FF10FB9CFDCEFAE4.xml @@ -0,0 +1,93 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +46. + +Temnora elegans polia +Rothschild, 1904 + +( +Fig. 78 +) + + + + +Material examined: + +Coutada 12 +: [14] – +1 ex. +; + + +Chimanimani National Reserve + +: [18] + +– +1 ex. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD6F342FF10FD56FDCEFC5D.xml b/data/DF/75/00/DF750049FFD6F342FF10FD56FDCEFC5D.xml new file mode 100644 index 00000000000..a01e459cc87 --- /dev/null +++ b/data/DF/75/00/DF750049FFD6F342FF10FD56FDCEFC5D.xml @@ -0,0 +1,86 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +44. + +Nephele oenopion continentis +Rothschild + +& +Jordan +, 1903 ( +Fig. 69 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +1 ex. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD6F342FF10FE1CFAB1FD49.xml b/data/DF/75/00/DF750049FFD6F342FF10FE1CFAB1FD49.xml new file mode 100644 index 00000000000..5352367674f --- /dev/null +++ b/data/DF/75/00/DF750049FFD6F342FF10FE1CFAB1FD49.xml @@ -0,0 +1,112 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +43. + +Nephele peneus +(Cramer, 1776) + +( +Fig. 63 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +2 exs. +; [4K] – +1 ex. +; + + +Chimanimani National Reserve + +: [20A] + +– +2 exs. +; + + + + + + +Maputo +Special Reserve + +: [27B] + +– +2 exs. +; [27C] – +1 ex. +; [30A] – +2 exs. +; [30D] – +1 ex. +; [30I] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD6F342FF10FF2CFF7DFE16.xml b/data/DF/75/00/DF750049FFD6F342FF10FF2CFF7DFE16.xml new file mode 100644 index 00000000000..8806d826b5d --- /dev/null +++ b/data/DF/75/00/DF750049FFD6F342FF10FF2CFF7DFE16.xml @@ -0,0 +1,144 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +42. + +Nephele funebris +(Fabricius, 1793) + +( +Figs. 72-73 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +1 ex. +; [4K] – +2 exs. +; [6] – +1 ex. +; [7B] – +1 ex. +; + + +Coutada +12: + +[12] + +– +4 exs. +; [13] – +10 exs. +; [14] – +4 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +12 exs. +; [18] – +4 exs. +; [19] – +6 exs. +; [20A] – +15 exs. +; [22] – +5 exs. +; + + +Maputo +Special Reserve + +: [27A] + +– +2 exs. +; [27B] – +3 exs. +; [27C] – +2 exs. +; [28] – +2 exs. +; [30A] – +65 exs. +; [30B] – +9 exs. +; [30C] – 2 exs; [30D] – +10 exs. +; [30F] – +5 exs. +; [30G] – +3 exs. +; [30I] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10F8FFFCBCF84B.xml b/data/DF/75/00/DF750049FFD8F34CFF10F8FFFCBCF84B.xml new file mode 100644 index 00000000000..b63a723df4d --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10F8FFFCBCF84B.xml @@ -0,0 +1,89 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +73. + +Theretra orpheus orpheus +(Herrich-Schäffer, 1854) + +( +Fig. 114 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [27B] – +1 ex. + +; + +[30B] – +2 exs. + + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10F987FAD1F932.xml b/data/DF/75/00/DF750049FFD8F34CFF10F987FAD1F932.xml new file mode 100644 index 00000000000..a92cf19c285 --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10F987FAD1F932.xml @@ -0,0 +1,90 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +72. + +Theretra mothironi +Haxaire & Melichar, 2012 + +( +Fig. 117 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +2 exs. +; [4E] – +1 ex. +; + + +Chimanimani National Reserve + +: [19] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FA6AFD1CF99A.xml b/data/DF/75/00/DF750049FFD8F34CFF10FA6AFD1CF99A.xml new file mode 100644 index 00000000000..413e822ff2e --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FA6AFD1CF99A.xml @@ -0,0 +1,116 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +71. + +Theretra monteironis +(Butler, 1882) + +( +Figs. 115-116 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +1 ex. +; [4E] – +4 exs. +; [4P] – +1 ex. +; + + +Chimanimani National Reserve + +: [18] + +– +1 ex. +; [19] – +3 exs. +; + + +Maputo +Special Reserve + +: [28] + +– +5 exs. +; [30A] – +14 exs. +; [30B] – +3 exs. +; [30D] – +1 ex. +; [30F] – +1 ex. +; [30G] – +1 ex. +; [30H] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FB32FDF5FA86.xml b/data/DF/75/00/DF750049FFD8F34CFF10FB32FDF5FA86.xml new file mode 100644 index 00000000000..2f9e5191b47 --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FB32FDF5FA86.xml @@ -0,0 +1,79 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +70. + +Theretra dominikae +Melichar & Řezáč, [2014] + +( +Fig. 118 +) + + + + +Material examined: + +Quirimbas National Park +: [23] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FBF8FA1AFB6D.xml b/data/DF/75/00/DF750049FFD8F34CFF10FBF8FA1AFB6D.xml new file mode 100644 index 00000000000..3c6738a228c --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FBF8FA1AFB6D.xml @@ -0,0 +1,105 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +69. + +Theretra capensis +(Linnaeus, 1764) + +( +Figs. 119-120 +) + + + + +Material examined: + +Chimanimani National Reserve +: [18] – +2 exs. +; + + +Maputo +Special Reserve + +: [27A] + +– +3 exs. +; [27C] – +6 exs. +; [28] – +6 exs. +; [30A] – +31 exs. +; [30B] – +7 exs. +; [30D] – +6 exs. +; [30F] – +15 exs. +; [30G] – +3 exs. +; [30I] – +4 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FCCBFD7DFC3A.xml b/data/DF/75/00/DF750049FFD8F34CFF10FCCBFD7DFC3A.xml new file mode 100644 index 00000000000..3d0f513d433 --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FCCBFD7DFC3A.xml @@ -0,0 +1,119 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +68. + +Hippotion roseipennis +(Butler, 1882) + +( +Figs. 111-113 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +2 exs. +; [4E] – +2 exs. +; [4B] – +1 ex. +; [4N] – +3 exs. +; [5A] – +1 ex. +; [8] – +1 ex. +; + + + + + + +Maputo +Special Reserve + +: [27B] + +– +5 exs. +; [27C] – +1 ex. +; [28] – +6 exs. +; [30A] – +8 exs. +; [30B] – +1 ex. +; [30C] – +6 exs. +; [30D] – +1 ex. +; [30F] – +3 exs. +; [30I] – +3 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FDB1FD48FD26.xml b/data/DF/75/00/DF750049FFD8F34CFF10FDB1FD48FD26.xml new file mode 100644 index 00000000000..0b01b67aa92 --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FDB1FD48FD26.xml @@ -0,0 +1,99 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +67. + +Hippotion rosae rosae +(Butler, 1882) + +( +Figs. 109-110 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +1 ex. +; [4D] – +1 ex. +; + + +Maputo +Special Reserve + +: [27C] + +– +1 ex. +; [28] – +3 exs. +; [30A] – +3 exs. +; [30B] – +1 ex. +; [30G] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FE66FD12FDEC.xml b/data/DF/75/00/DF750049FFD8F34CFF10FE66FD12FDEC.xml new file mode 100644 index 00000000000..2cf71a3e3ab --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FE66FD12FDEC.xml @@ -0,0 +1,99 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +66. + +Hippotion osiris +(Dalman, 1823) + +( +Figs. 107-108 +) + + + + +Material examined: + +Gorongosa National Park +: [4H] – +1 ex. +; [6] – +1 ex. +; + + +Maputo +Special Reserve + +: [25] + +– +1 ex. +; [28] – +1 ex. +; [30B] – +1 ex. +; [30C] – +1 ex. +; [30I] – +3 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFD8F34CFF10FF2CFE06FEB9.xml b/data/DF/75/00/DF750049FFD8F34CFF10FF2CFE06FEB9.xml new file mode 100644 index 00000000000..120f5a1e9f7 --- /dev/null +++ b/data/DF/75/00/DF750049FFD8F34CFF10FF2CFE06FEB9.xml @@ -0,0 +1,100 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +65. + +Hippotion gracilis +(Butler, 1875) + +( +Figs. 105-106 +) + + + + +Material examined: + +Gorongosa National Park +: [4E] – +1 ex. +; [7B] – +3 exs. +; + + +Coutada +12 + +: [13] + +– +1 ex. +; + + +Chimanimani National Reserve + +: [18] + +– +2 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10F91EFDCEF806.xml b/data/DF/75/00/DF750049FFDAF34EFF10F91EFDCEF806.xml new file mode 100644 index 00000000000..06644070d22 --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10F91EFDCEF806.xml @@ -0,0 +1,100 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +64. + +Hippotion eson +(Cramer, 1779) + +( +Figs. 103-104 +) + + + + +Material examined: + +Gorongosa National Park +: [6] – +7 exs. +; + + +Maputo +Special Reserve + +: [30C] + +– +1 ex. +; [30F] – +1 ex. +; [30H] – +1 ex. +; [27B] – +2 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FA00FD6EF911.xml b/data/DF/75/00/DF750049FFDAF34EFF10FA00FD6EF911.xml new file mode 100644 index 00000000000..8df8b4d23ee --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FA00FD6EF911.xml @@ -0,0 +1,138 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +63. + +Hippotion celerio +(Linnaeus, 1758) + +( +Figs. 101-102 +) + + + + +Material examined: + +Gorongosa National Park +: [4B] – +10 exs. +; [4J] – +2 exs. +; [4N] – +3 exs. +; [4P] – +1 ex. +; [5A] – +1 ex. +; [6] – +9 exs. +; [7B] – +6 exs. +; + + +Coutada +12 + +: [13] + +– +1 ex. +; + + +Chimanimani National Reserve + +: [17] + +– +2 exs. +; [19] – +1 ex. +; [22] – +1 ex. +; + + +Maputo +Special Reserve + +: [27A] + +– +2 exs. +; [27B] – +4 exs. +; [27C] – +2 exs. +; [28] – +9 exs. +; [30A] – +4 exs. +; [30B] – +3 exs. +; [30D] – +1 ex. +; [30G] – +4 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FB13FEB4FA63.xml b/data/DF/75/00/DF750049FFDAF34EFF10FB13FEB4FA63.xml new file mode 100644 index 00000000000..d456ab55317 --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FB13FEB4FA63.xml @@ -0,0 +1,109 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +62. + +Hippotion balsaminae +(Walker, 1856) + +( +Figs. 99-100 +) + + + + +Material examined: + +Gorongosa National Park +: [4E] – +1 ex. +; [4B] – +1 ex. +; [6] – +1 ex. +; +Cheringoma Plateau +: [16] – +1 ex. +; + + + + +Chimanimani National Reserve +: [22] – +1 ex. +; + + +Maputo +Special Reserve + +: [27B] + +– +1 ex. +; [30C] – +3 exs. +; [30F] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FBF8FDCEFB0F.xml b/data/DF/75/00/DF750049FFDAF34EFF10FBF8FDCEFB0F.xml new file mode 100644 index 00000000000..ac6e930c954 --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FBF8FDCEFB0F.xml @@ -0,0 +1,94 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +61. + +Hyles livornica +(Esper, 1780) + +( +Figs. 97-98 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [27B] + +– +1 ex. +; [28] – +1 ex. +; [30A] – +2 exs. + + +New country record for +Mozambique +. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FD08FB95FC3A.xml b/data/DF/75/00/DF750049FFDAF34EFF10FD08FB95FC3A.xml new file mode 100644 index 00000000000..7fb64cd252b --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FD08FB95FC3A.xml @@ -0,0 +1,173 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +60. + +Euchloron megaera megaera +(Linnaeus, 1758) + +( +Figs. 123-125 +) + + + + +Material examined: + +Gorongosa National Park +: [2A] – +3 exs. +; [4K] – +3 exs. +; [4N] – +4 exs. +; [7A] – +2 exs. +; [7B] – +2 exs. +; [20] – +6 exs. +; + + +Coutada +12 + +: [12] + +– +2 exs. +; + + +Cheringoma Plateau + +: [15] + +– +2 exs. +; [16] – +2 exs. +; + + +Chimanimani National Reserve + +: [17] + +– +1 ex. +; [18] – +1 ex. +; [19] – +1 ex. +; [22] – +2 exs. +; + + +Quirimbas National Park + +: [23] + +– +1 ex. +; + + + + + + +Maputo +Special Reserve + +: [24B] + +– +1 ex. +; [27A] – +1 ex. +; [27B] – +4 exs. +; [28] – +1 ex. +; [30A] – +8 exs. +; [30B] – +1 ex. +; [30C] – +2 exs. +; [30D] – +2 exs. +; [30F] – +2 exs. +; + + +Mt Mabu + +: [32] + +– +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FDFDFF5EFD6B.xml b/data/DF/75/00/DF750049FFDAF34EFF10FDFDFF5EFD6B.xml new file mode 100644 index 00000000000..f13d8dbd448 --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FDFDFF5EFD6B.xml @@ -0,0 +1,93 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +59. + +Basiothia medea +(Fabricius, 1781) + +( +Fig. 96 +) + + + + +Material examined: + +Gorongosa National Park +: [4K] – +1 ex. +; [7B] – +2 exs. +; + + +Maputo +Special Reserve + +: [25] + +– +2 exs. +; [28] – +2 exs. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FE85FDFAFE30.xml b/data/DF/75/00/DF750049FFDAF34EFF10FE85FDFAFE30.xml new file mode 100644 index 00000000000..d49e2806f7d --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FE85FDFAFE30.xml @@ -0,0 +1,79 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +58b. + +Temnora zantus curvilimes +Hering, 1927 + +( +Fig. 91 +) + + + + +Material examined: + +Gorongosa National Park +: [1] – +1 ex. + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDAF34EFF10FF2CFDEAFE9F.xml b/data/DF/75/00/DF750049FFDAF34EFF10FF2CFDEAFE9F.xml new file mode 100644 index 00000000000..9bf18decb77 --- /dev/null +++ b/data/DF/75/00/DF750049FFDAF34EFF10FF2CFDEAFE9F.xml @@ -0,0 +1,84 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +58a. + +Temnora zantus zantus +(Herrich-Schäffer, 1854) + +( +Fig. 90 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [27B] – +1 ex. + + + + + \ No newline at end of file diff --git a/data/DF/75/00/DF750049FFDEF34AFF10F88BFE32F7D9.xml b/data/DF/75/00/DF750049FFDEF34AFF10F88BFE32F7D9.xml new file mode 100644 index 00000000000..2516631a725 --- /dev/null +++ b/data/DF/75/00/DF750049FFDEF34AFF10F88BFE32F7D9.xml @@ -0,0 +1,97 @@ + + + +A contribution to the knowledge of the Sphingidae fauna of Mozambique + + + +Author + +Bąkowski, Marek +Department of Systematic Zoology, Adam Mickiewicz University, Collegium Biologicum, Uniwersytetu Poznańskiego 6, Poznań 61 - 614, Poland +bakowski@amu.edu.pl + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + + + +Author + +Takano, Hitoshi +The African Natural History Research Trust (ANHRT), Street Court Leominster-Kingsland, HR 6 9 QA, United Kingdom Corresponding author - bakowski @ amu. edu. pl + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-10 + + +35 + + +45 +77 + + + + +http://dx.doi.org/10.37828/em.2020.35.5 + +journal article +10.37828/em.2020.35.5 +2336-9744 +13232145 + + + + + +74. + +Centroctena imitans +(Butler, 1882) + +( +Figs 121-122 +) + + + + +Material examined: + + + +Maputo +Special Reserve + +: [27B] + +– +1 ex. +; [28] – +1 ex. +; [30A] – +16 exs. +; [30B] – +5 exs. +; [30D] – +2 exs. +; [30F] – +4 exs. +; [30G] – +3 exs. + + + + \ No newline at end of file diff --git a/data/E0/21/72/E021721EFF85D446BB8BF8E83BF2A961.xml b/data/E0/21/72/E021721EFF85D446BB8BF8E83BF2A961.xml new file mode 100644 index 00000000000..6c888b820d2 --- /dev/null +++ b/data/E0/21/72/E021721EFF85D446BB8BF8E83BF2A961.xml @@ -0,0 +1,303 @@ + + + +Revision of the genus Palaeugoa Durante, 2012, with descriptions of seven new species (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia * Corresponding author + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +53 +77 + + + + +http://dx.doi.org/10.37828/em.2020.36.5 + +journal article +10.37828/em.2020.36.5 +2336-9744 +13232583 +urn:lsid:zoobank.org:pub:DCEA508B-BE69-45C9-977D-211F36B04EFD + + + + + + +Palaeugoa megala +Volynkin & László + +, + +sp. nov. + + + + + + +( +Figs 15, 16 +, +41, 42 +) + + + + +Type material. + + +Holotype + +( +Figs 15 +, +41 +): male, “ +Rwanda +, Nyungwe, 12.X.[19]74, +B. Turlin +[leg.], + +2000m + +”, gen. slide No.: +ZSM +Arct. 2019-217 (prepared by Volynkin) ( +ZSM +). + + + + +Figures 28–31. + +Palaeugoa spurrelli + +, male genitalia. Depositories of the specimens: 28 and 29 in NHMUK (©); 30 and 31 in ANHRT. + + + + +Figures 32–35. + +Palaeugoa +spp. + +, male genitalia. Specimens are deposited in ANHRT. + + + + +Figures 36–40. + +Palaeugoa +spp. + +, male genitalia. Depositories of the specimens: 36–39 in ANHRT; 40 in MWM/ZSM. + + + + +Figures 41–43. + +Palaeugoa +spp. + +, male genitalia. Depositories of the specimens: 41 and 42 in ZSM; 43 in ANHRT. + + + + + +Paratypes +. +RWANDA + +: +1 male +, +Nyungwe +, + +2000m + +, 23.IV.[19]77, +B. Turlin +[leg.], gen. slide +No. +: +ZSM + + +Arct. +183/2017 (prepared by +Volynkin +) ( +ZSM +) + +; + +1 male +, +Nyungwe NP +, + +2000m + +, +Kamiranzowu Swamp +, +2°29’S +, +29°08’E +, + +6.VIII.2008 + +, leg. +J. & W. De Prins +, +De Prins Coll. +BMNH +(E) + + +2014-125, gen. slide No.: +NHMUK010315267 +(prepared by +Volynkin +) + +( +NHMUK +). + + + + +Diagnosis +. The forewing length of the new species is +11.5–12 mm +in males. + +Palaeugoa megala + +can easily be distinguished from all other species of the + +P. spurrelli + +species-group by its considerably larger size. The male genital capsule of the new species is most similar to that of + +P. smithi + +due to the presence of a medial saccular process, but differs from it clearly by the broader uncus, the shorter, densely spinulose and detached transtillar processes (in + +P. smithi + +those are longer, fused into one smooth-surfaced plate with a deep medio-distal depression), the membranous anellus (which is weakly spinulose in + +P. smithi + +) and the presence of a large medio-ventral process of juxta (absent in + +P. smithi + +). In addition, the new species has somewhat wider vinculum, convex costal margin of valva (straight in + +P. smithi + +), a well-developed costal process (absent in + +P. smithi + +), broader cucullus compared to those of + +P. smithi + +. The medial saccular process of + +P. megala + +is considerably longer, somewhat thicker, narrower at base and erected medially, whereas that is shorter and narrower in + +P. smithi + +having a markedly broader basal section erected distally. The distal saccular process of the new species is somewhat more robust, more curved dorsally compared to that of + +P. smithi + +. The aedeagus of + +P. megala + +is conspicuously larger than that of + +P. smithi + +, it is straight, equally wide in its full length with a very short coecum, whereas that of + +P. smithi + +is slightly arched medially and gradually tapered distally, having a well-developed coecum. The vesica of + +P. megala + +is markedly broader than that of + +P. smithi + +, having two elongate, adversely projected lateral diverticula bearing robust cornuti apically, whereas that of + +P. smithi + +has a single, shorter diverticulum directed distally, bearing apical cornuti. + +Female is unknown. + + + +Distribution +. The species is known from +Rwanda +only, the +type +specimens were collected in the high elevation rainforest of the Nyungwe Forest. + + + + +Etymology +. ‘Megalo’ is a Latin transliteration of the Greek word ‘μεγάλο’ meaning ‘large’. The specific epithet refers to the size of the new species which is the largest in the species-group. + + + + \ No newline at end of file diff --git a/data/E0/21/72/E021721EFF8BD441BB8BF8A43B1EA926.xml b/data/E0/21/72/E021721EFF8BD441BB8BF8A43B1EA926.xml new file mode 100644 index 00000000000..e3ab8f42dcf --- /dev/null +++ b/data/E0/21/72/E021721EFF8BD441BB8BF8A43B1EA926.xml @@ -0,0 +1,332 @@ + + + +Revision of the genus Palaeugoa Durante, 2012, with descriptions of seven new species (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia * Corresponding author + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +53 +77 + + + + +http://dx.doi.org/10.37828/em.2020.36.5 + +journal article +10.37828/em.2020.36.5 +2336-9744 +13232583 +urn:lsid:zoobank.org:pub:DCEA508B-BE69-45C9-977D-211F36B04EFD + + + + + + +Palaeugoa secunda +Volynkin, 2017 + + + + + + +( +Figs 5, 6 +, +33–35 +, +52 +) + + + + + +Palaeugoa secunda + +Volynkin, 2017 + + +, +Zootaxa +4353 (2): 385, figs 1, 2, 5, 7 ( +Type +locality: “ +Sierra Leone +, + +180 m + +, +Western Area + +Peninsula Forest Reserve +, N + +08°20'57''; W13°10'42''”). + + + + +Figures 1–8. + +Palaeugoa +spp. + +, adults. Depositories of the specimens: 1 in NHMUK (©); 2–6 in ANHRT; 7 in MWM/ZSM; 8 in MFN + + + + +Figures 9–19. + +Palaeugoa +spp. + +, adults. Depositories of the specimens: 9–14, 17–19 in ANHRT; 15 and 16 in ZSM. + + + + +Figures 20–27. + +Palaeugoa +spp. + +, adults. Depositories of the specimens: 21, 21, 26 and 27 in ANHRT; 22 and 23 in MFN; 24 and 25 in NHMUK (©). + + + + +Type material examined. + + +Holotype + +( +Figs 5 +, +33 +): male, “ +Sierra Leone +, + +180m + +, +Western Area +Peninsula Forest Reserve +, 6.X.15, N08°20'57", W13°10'42" +Light Trap +R +. +Goff +coll. leg. +Smith +, +R +& Takano, H”; “ +ANHRT +:2017.18.1”; “African Natural History Research Trust +ANHRT +:2018.18”; “IMAGED”; “ANHRTUK 00073622”; gen. slide +No. +: AV2926 ( +ANHRT +). + + + + + +Paratypes + +. + +SIERRA LEONE + +: +1 male +, +1 female +, with same data as the holotype, unique numbers: ANHRTUK 00073623, 00073624, gen. slide No.: AV2928 (female) + +; +5 males +, same site, +24.x.2015 +, unique numbers: ANHRTUK 00073625–00073629, gen. slide No.: AV2927; + +3 males +, +1 female +, same site, + +21.ix.2015 + +, unique numbers: ANHRTUK 00073630–00073633, gen. slide Nos.: AV3010, AV3011, AV3012 (males), AV5991 (female) ( +ANHRT +) + +. + + +Additional material examined +. + + +SIERRA LEONE + +: +1 male +, +1 female +, +Western Area +Peninsula Forest Reserve +, + +180m + +, + +21.ix.2015 + +, N08°20'57", W13°10'42", +Light Trap +, +R +. +Goff +coll. leg. +Smith +, +R + +. & + +Takano, H. +, +ANHRT + +:2018.19 ( +ANHRT +). + + + + +Diagnosis +. The forewing length is +7.5–8.5 mm +in males and +10 mm +in females. + +Palaeugoa secunda + +is very similar externally to + +P. spurrelli + +and + +P. moa + +. Some male specimens of + +P. secunda + +have slightly broader forewing than that of the other two congeners, but the reliable identification requires examination of the genital structures. The male genital capsule of + +P. secunda + +differs from that of + +P. spurrelli + +by the conspicuously narrower and more elongate transtillar process lacking an inner triangular protrusion, the slightly longer juxta with shallower basal depression. In addition, the valva of + +P. secunda + +bears a conspicuously shorter medial dorsal process, and a much smaller, narrow-triangular costal process, which is elongate crest-like in + +P. spurrelli + +. The female genitalia of + +P. secunda + +are very similar to those of + +P. spurrelli + +, but distinguishable by the somewhat smaller papillae anales, the slightly stronger dentation of the postvaginal area of the 7 +th +sternite, and the noticeably longer antevaginal plate which has a shallower medial depression at the ostium bursae. The corpus bursae of + +P. secunda + +has a slightly shorter area of spinulose scobination medially and a somewhat broader appendix bursae bearing more robust spinulose scobination compared to those of + +P. spurelli + +. The differences between + +P. secunda + +and + +P. moa + +are discussed in the diagnosis of + +P. moa + +. + + + + +Distribution +. The species is known only from the western coast of +Sierra Leone +, its +type +series was collected in the lowland forest of the +Western Area +Peninsula ( +Volynkin 2017 +). + + + + \ No newline at end of file diff --git a/data/E0/21/72/E021721EFF8BD44DBB8BFB823B59AB86.xml b/data/E0/21/72/E021721EFF8BD44DBB8BFB823B59AB86.xml new file mode 100644 index 00000000000..77fe701d339 --- /dev/null +++ b/data/E0/21/72/E021721EFF8BD44DBB8BFB823B59AB86.xml @@ -0,0 +1,186 @@ + + + +Revision of the genus Palaeugoa Durante, 2012, with descriptions of seven new species (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia * Corresponding author + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +53 +77 + + + + +http://dx.doi.org/10.37828/em.2020.36.5 + +journal article +10.37828/em.2020.36.5 +2336-9744 +13232583 +urn:lsid:zoobank.org:pub:DCEA508B-BE69-45C9-977D-211F36B04EFD + + + + + + +Palaeugoa moa +Volynkin & László + +, + +sp. nov. + + + + + + +( +Figs 4 +, +32 +) + + + + +Type material. + + +Holotype + +( +Figs 4 +, +32 +): male, “ +Sierra Leone +, + +120m + +, +Tiwai Island +, +Moa River, N +07°33’00”, W11°21’09”, + +17–22.vi.2016 + +, +Light Trap +, leg. +Takano +, Miles & Goff, +ANHRT +:2017.18” / “ANHRTUK 00026223”, gen. slide +No. +: AV5019 ( +ANHRT +). + + + + + +Diagnosis +. The forewing length is +8 mm +in the male +holotype +. The new species is externally indistinguishable from + +P. spurrelli + +, + +P. secunda + +and + +P. camerunensis + +. The male genital capsule of + +P. moa + +is most similar to that of + +P. secunda + +, but differs from it by the conspicuously broader base of the transtillar process, the considerably longer medial process of the juxta, and the larger costal process. The aedeagus of the new species differs from that of + +P. secunda + +by its more elongate proximal section. The vesica configurations of the two species are very similar, but the main chamber of the vesica is slightly narro wer in + +P. moa + +than in + +P. secunda + +. In comparison to that of + +P. spurrelli + +, the genital capsule of + +P. moa + +has a conspicuously more elongate and distally narrower transtillar process lacking an inner triangular protrusion and a shorter but more prominent costal process. The vesica of the new species differs from that of + +P. spurrelli + +by its larger and longer medial diverticulum. + +Female is unknown. + + + +Distribution +. The new species is known only from a primary lowland forest in the Tiwai Island of the +Moa River +in +Sierra Leone +. + + + + +Etymology +. The specific epithet refers to the +type +locality by the +Moa River. + + + + \ No newline at end of file diff --git a/data/E0/21/72/E021721EFF99D45EBB8BFAAE3EFDAC80.xml b/data/E0/21/72/E021721EFF99D45EBB8BFAAE3EFDAC80.xml new file mode 100644 index 00000000000..a9485a4f4dc --- /dev/null +++ b/data/E0/21/72/E021721EFF99D45EBB8BFAAE3EFDAC80.xml @@ -0,0 +1,212 @@ + + + +Revision of the genus Palaeugoa Durante, 2012, with descriptions of seven new species (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia * Corresponding author + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +53 +77 + + + + +http://dx.doi.org/10.37828/em.2020.36.5 + +journal article +10.37828/em.2020.36.5 +2336-9744 +13232583 +urn:lsid:zoobank.org:pub:DCEA508B-BE69-45C9-977D-211F36B04EFD + + + + + + +Palaeugoa ngoko +Volynkin & László + +, + +sp. nov. + + + + + + +( +Figs 25 +, +50 +) + + + + +Type material. + + +Holotype + +( +Figs 25 +, +50 +): male, [ +CAMEROON +] “1494, +Bitje +, +Ja River +, +Cameroons +, + +2000 ft. + +, + +Oct.–Nov. 1919 + +” / “1915-113.” / QR- code label with a unique number “ +NHMUK010918063 +”, gen. slide No.: +NHMUK010315725 +(prepared by Volynkin) ( +NHMUK +). + + + + + +Diagnosis +. The forewing length is +9 mm +in the male +holotype +. + +Palaeugoa ngoko + +is reminiscent externally of + +P. peregrina + +, but differs by its smaller size and less intense brownish suffusion on the forewing. The male genital capsule of + +P. ngoko + +differs from that of + +P. peregrina + +by the conspicuously smaller spines on the ventral part of the anellus, the somewhat narrower valva with gently arcuate costal margin (which is strongly angled medially in + +P. peregrina + +), the broader cucullus, the much shorter, broadly triangular medial process of sacculus lacking setae (which is longer and broader, slightly curved, finger-like and densely setose in + +P. peregrina + +) and the conspicuously narrower and longer distal saccular process. In comparison with those characters of + +P. aristophanousi + +, the genital capsule of + +P. ngoko + +has smaller spines on the ventral surface of the anellus, slightly more elongate valva with somewhat less arched costal margin, broader cucullus lacking setae ventrally, basally broader but much shorter medial saccular process and somewhat broader and longer distal saccular process. The aedeagus of + +P. ngoko + +is most similar to that of + +P. aristophanousi + +, but in + +P. ngoko + +the ventral distal crest is absent, and the dorsal distal crest is conspicuously broader and longer. The vesica of the new species differs markedly from that of both related species by the ventral diverticulum bearing a cluster of three long and robust cornuti (whereas in + +P. peregrina + +and + +P. aristophanousi + +the ventral diverticulum is armed with a cluster of numerous short and fine spinules), in addition, the presence of a cluster of seven, long and robust cornuti which character is absent in + +P. peregrina + +and + +P. aristophanousi + +. Further differences between the vesica configuration of + +P. ngoko + +and + +P. aristophanousi + +are the larger and heavily scobinated subbasal ventral diverticulum (which is smaller and granulated in + +P. aristophanousi + +), the membranous dorsal diverticulum (heavily scobinated and granulated in + +P. aristophanousi + +) and the smaller and less intensely granulated distal diverticulum of the new species. + + + + +Distribution +. The new species is known by its single +holotype +collected in the historic locality of Bitje in South +Cameroon +. + + + + +Etymology +. Ngoko is another name of the Dja River. The new species was presumably collected near the shores of the river. + + + + \ No newline at end of file diff --git a/data/E0/21/72/E021721EFF99D45FBB8BFF773D79A998.xml b/data/E0/21/72/E021721EFF99D45FBB8BFF773D79A998.xml new file mode 100644 index 00000000000..c86505cb1f1 --- /dev/null +++ b/data/E0/21/72/E021721EFF99D45FBB8BFF773D79A998.xml @@ -0,0 +1,262 @@ + + + +Revision of the genus Palaeugoa Durante, 2012, with descriptions of seven new species (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia * Corresponding author + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +53 +77 + + + + +http://dx.doi.org/10.37828/em.2020.36.5 + +journal article +10.37828/em.2020.36.5 +2336-9744 +13232583 +urn:lsid:zoobank.org:pub:DCEA508B-BE69-45C9-977D-211F36B04EFD + + + + + + +Palaeugoa aristophanousi +Volynkin & László + +, + +sp. nov. + + + + + + +( +Figs 26, 27 +, +48, 49 +) + + + + +Type material. + + +Holotype + +( +Figs 26 +, +48 +): male, “ +GABON +, + +430m + +, Mikongo (Rougier), +Monts de Cristal +( +Secondary Forest +), +0°29'47"N +, +11°10'42"E +, + +28.vii.–12.viii.2019 + +, +LepiLED Light Trap +, Albert, J-L., Aristophanous, M., Bie Mba, J., Dérozier, +V +., +Moretto, P. +leg., +ANHRT +:2019.17” / “ANHRTUK 00107454”, gen. slide No.: AV5971 ( +ANHRT +). + + + + + +Paratypes + +. + +GABON + +: +3 males +, with the same data as the holotype, +collecting method Actinic Light Trap +, unique numbers: ANHRTUK 00162682, 00162741 and 00167930 + +; + +2 males +, +Nyonie +( +Lowland Forest +), + +10m + +, +0°2'22"S +, +9°20'25"E +, + +23–28.viii.2019 + +, +MV + + +Light Trap +, +Albert +, J-L., +Aristophanous, M. +, +Bie Mba +, J., +Dérozier +, +V +., +Moretto, P. +leg., +ANHRT + +: + +2019.17, unique numbers: ANHRTUK 00152561, 00152562, gen. slide +Nos. +: AV5972, +LGNA1209 +( +ANHRT +) + +. + + + + +Diagnosis +. The length of the forewing is +8–9 mm +in males. + +Palaeugoa aristophanousi + +can be distinguished from + +P. peregrina + +and + +P. ngoko + +by its rather greyish forewing colouration and the conspicuously darker, pale greyish brown hindwing whereas the forewings are rather brownish-reddish, the hindwings are creamy yellowish in + +P. peregrina + +and + +P. ngoko + +. Additionally, the new species differs from + +P. peregrina + +by its markedly smaller size and the less elongate forewing. The male genital capsule of the new species differs from that of + +P. peregrina + +by the shorter spines on the ventral part of anellus, the gently arched costal margin of the valva (which is strongly angled in + +P. peregrina + +) the narrower cucullus with heavily setose ventral margin (which is membranous in + +P. peregrina + +); the conspicuously narrower and slightly longer distal saccular process and the much shorter, triangular and non-setose medial saccular process which is longer and broader, slightly curved, finger-like and densely setose in + +P. peregrina + +. The aedeagus of the new species differs from that of + +P. peregrina + +by the narrower dorsal distal crest lacking a spinulose dilated distal plate. The vesica structure of + +P. aristophanousi + +is similar to that of + +P. peregrina + +, but differs by the presence of the subbasal ventral diverticulum, the more elongate medial diverticulum, and the conspicuously smaller cluster of cornuti on the ventral diverticulum. The comparison with male genitalia of + +P. ngoko + +is provided under the diagnosis of the latter species. + + + + +Distribution +. The new species is hitherto known only from +Gabon +, nevertheless, it is presumably more widespread in the central-western African lowland rainforests. + + + + +Etymology +. The new species is dedicated to Mr Marios Aristophanous distinguished entomologist, one of the collectors of the +type +series. + + + + \ No newline at end of file diff --git a/data/E0/21/72/E021721EFF9ED458BB8BFD843C32AA79.xml b/data/E0/21/72/E021721EFF9ED458BB8BFD843C32AA79.xml new file mode 100644 index 00000000000..5b96b185cb3 --- /dev/null +++ b/data/E0/21/72/E021721EFF9ED458BB8BFD843C32AA79.xml @@ -0,0 +1,253 @@ + + + +Revision of the genus Palaeugoa Durante, 2012, with descriptions of seven new species (Lepidoptera: Erebidae: Arctiinae: Lithosiini) + + + +Author + +Volynkin, Anton V. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk & Altai State University, Lenina Avenue 61, RF- 656049, Barnaul, Russia * Corresponding author + + + +Author + +László, Gyula M. +The African Natural History Research Trust (ANHRT), Street Court Leominster, Kingsland, HR 6 9 QA, United Kingdom. E-mails: monstruncusarctia @ gmail. com, gyulalaszlo @ anhrt. org. uk + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-13 + + +36 + + +53 +77 + + + + +http://dx.doi.org/10.37828/em.2020.36.5 + +journal article +10.37828/em.2020.36.5 +2336-9744 +13232583 +urn:lsid:zoobank.org:pub:DCEA508B-BE69-45C9-977D-211F36B04EFD + + + + + + +Palaeugoa asafis +Volynkin & László + +, + +sp. nov. + + + + + + +( +Figs 20, 21 +, +44, 45 +) + + + + +Type material. + + +Holotype + +( +Figs 20 +, +44 +): male, “ +CAMEROON +, + +612m + +, +Central Region +, +Nkoteng +, +On Sanaga River +, +Nkoteng Forest +, +04°33'34.2"N +, +11°59'37.6"E +, + +24–28.x.2018 + +, Cold Cathode +UV +Light Trap, Safian, Sz., Simonics, +G. Leg. +ANHRT +:2018.36” / “ANHRTUK 00060252”, gen. slide No.: AV5128 ( +ANHRT +). + + + + + +Paratype + +: male, with the same data as the holotype, unique number: ANHRTUK 00060253, gen. slide No.: AV5134 ( +ANHRT +) + +. + + + + +Diagnosis +. The forewing length is +8 mm +in males. + +Palaeugoa asafis + +can be distinguished from + +P. takanoi + +by its creamy head and thorax (which are pale yellow in + +P. takanoi + +), the monochromatic forewing ground colour (in + +P. takanoi + +the forewing costa, terminal area and ciliae are bright yellow), the reddish brown and more diffuse suffusion between the veins (in + +P. takanoi + +the suffusion is blackish and much more intense), and the paler hindwing with a slight brownish suffusion medially (which is strongly and evenly suffused with dark grey scales in + +P. takanoi + +). The male genital capsule of + +P. asafis + +differs from that of + +P. takanoi + +by the evenly narrow uncus (which is medially broadened in + +P. takanoi + +), the presence of two clusters of small denticles on anellus (in + +P. takanoi + +the anellus lacks sclerotized structures) and the shorter juxta without a protrusion whereas the juxta is longer, bearing a short conical apical protrusion in + +P. takanoi + +. The valva of the new species is broader and somewhat shorter with the costal margin having a large rounded medio-dorsal protrusion, whereas that of + +P. takanoi + +is narrower with slightly convex costal margin, in addition the cucullus of + +P. asafis + +is apically pointed without spinules whereas that is narrowly rounded bearing a cluster of small spinules in + +P. takanoi + +. The new species has much longer, basally narrower and more curved costal process compared to that of the related species and shorter and broader, lobe-like transtillar processes directed distally, bearing numerous long and robust cornuti along its outer margin whereas that is finger-like, shortly dentate, and directed dorsally in + +P. takanoi + +. The medial saccular process is slightly S-curved and apically pointed in + +P. asafis + +, whereas that is evenly arched and rounded apically in + +P. takanoi + +, in addition, the distal saccular process is considerably shorter and somewhat narrower in the new species than in its congener. The aedeagus of the two related species are similarly straight tubular with well-developed coecum, but that of + +P. asafis + +is somewhat smaller than that of + +P. takanoi + +if compared to the size of the genital capsule. The vesica of + +P. asafis + +is markedly narrower than that of + +P. takanoi + +, bearing one dorsal granulated diverticulum subbasally (there are two subbasal diverticula in + +P. takanoi + +), the medio-ventral diverticulum is conspicuously narrower than that of + +P. takanoi + +, and the distal chamber of the vesica is much smaller than that of + +P. takanoi + +armed with a narrow cornuti field consisting of a cluster of smaller spines, whereas the analogous cornuti field is more extensive, consisting of more robust spines in + +P. takanoi +. + + +Female is unknown. + + + +Distribution +. The +type +specimens of the new species were collected in a dryer lowland rainforest in central +Cameroon +. + + + + +Etymology +. ‘Asafis’ is a Latin transliteration of the Greek word ‘ασαφής’ meaning ‘indistinct’. The specific epithet refers to the species’ indistinct pattern. + + + + \ No newline at end of file diff --git a/data/E6/0B/87/E60B87CDFFE0E434B5C3FE2BFCF6FE55.xml b/data/E6/0B/87/E60B87CDFFE0E434B5C3FE2BFCF6FE55.xml new file mode 100644 index 00000000000..11955caffcc --- /dev/null +++ b/data/E6/0B/87/E60B87CDFFE0E434B5C3FE2BFCF6FE55.xml @@ -0,0 +1,76 @@ + + + +Thamoma, a new genus for Miltochrista vetusta Piepers & Snellen, 1904 from Java (Lepidoptera, Erebidae, Arctiinae) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-23 + + +35 + + +138 +143 + + + + +http://dx.doi.org/10.37828/em.2020.35.11 + +journal article +10.37828/em.2020.35.11 +2336-9744 +13232536 +urn:lsid:zoobank.org:pub:CA0F304E-E50D-4101-9E00-99FDC80A5347 + + + + + +Genus + +Thamoma +Volynkin + +, + +gen. nov. + + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +4F825941-7F77-4C9B-86FC-DC89B972A910 + + + + + +Type +species: + +Miltochrista vetusta +Piepers & Snellen, 1904 + +. + + + + \ No newline at end of file diff --git a/data/E6/0B/87/E60B87CDFFE4E430B5C3FD92FB7BFAAA.xml b/data/E6/0B/87/E60B87CDFFE4E430B5C3FD92FB7BFAAA.xml new file mode 100644 index 00000000000..692cce9847f --- /dev/null +++ b/data/E6/0B/87/E60B87CDFFE4E430B5C3FD92FB7BFAAA.xml @@ -0,0 +1,276 @@ + + + +Thamoma, a new genus for Miltochrista vetusta Piepers & Snellen, 1904 from Java (Lepidoptera, Erebidae, Arctiinae) + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + +text + + +Ecologica Montenegrina + + +2020 + +2020-10-23 + + +35 + + +138 +143 + + + + +http://dx.doi.org/10.37828/em.2020.35.11 + +journal article +10.37828/em.2020.35.11 +2336-9744 +13232536 +urn:lsid:zoobank.org:pub:CA0F304E-E50D-4101-9E00-99FDC80A5347 + + + + + + +Thamoma vetusta +( +Piepers & Snellen, 1904 +) + +, + +comb. nov. + + + + + + +( +Figs 1, 2 +, +9 +, +14 +) + + + + +Type material examined. + + +Lectotype + +(designated herein) ( +Figs 1 +, +9 +): male, “Java occ., Preanger, + +1800m + +, 1887.3 +♂ +” / “orig. desalb” / blue label “ +TYPE +” / “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / red label “ +SYNTYPE + +vetusta +Snellen + +” / “Cat. № 1” / QR- code label with unique number “ +RMNH +. +INS 1148699 +”, genital slide +RMNH +. +INS 1148699 +Volynkin +( +Coll. +RMNH +). + + + + + +Paralectotypes + +: +1 female +, “Java occ., +Berg Gedeh +, + +4000 ft. + +, 1887 +♀ +” / “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / “Cat. № 6” / QR- code label with unique numbers “ +RMNH +. +INS 1148700 + +”, + +genital slide +RMNH +. +INS 1148700 + + +Volynkin + +; + +1 female +, same data, “Cat. № 8” + +; + +1 female +, “Java occ., +Preanger +, + +1800m + +, 1887.3 +♀ +” / “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / “Cat. № 2” + +; + +1 female +, “Java occ., +Preanger +, + +15–1800m + +, 1885 +♀ +” / “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / “Cat. № 3” + +; + +1 male +, “Java occ., Preanger, 1886” / “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / “Cat. № 4” + +; + +1 male +, “W Java, Preanger, 5000 vt., 1894 +♀ +/ “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / “Cat. № 5” + +; + +1 female +, “Java occ., Gedeh, + +1400m + +, 1887.3” / “Museum Leiden + +M. vetusta +Det. + +: +Sn. +” / “Cat. № 7” ( +Coll. +RMNH +) + +. + + +Additional material examined +. + +1 male +, +W Java +, +Preanger +, 5000 vt., 1894 (Coll. +RMNH +) + +. + + + + +Diagnosis +. See the diagnosis for the genus. + + + + +Distribution +. The species is known from western Java Island only ( +Piepers & Snellen 1904 +). + + + + \ No newline at end of file diff --git a/data/EA/38/87/EA3887ECFF98451AFF2A15166C7AB21E.xml b/data/EA/38/87/EA3887ECFF98451AFF2A15166C7AB21E.xml new file mode 100644 index 00000000000..3af10905c62 --- /dev/null +++ b/data/EA/38/87/EA3887ECFF98451AFF2A15166C7AB21E.xml @@ -0,0 +1,391 @@ + + + +A new species of the genus Microcleonus Faust, 1904 (Coleoptera: Curculionidae) from Tuva + + + +Author + +Legalov, Andrei A. + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-08 + + +36 + + +40 +45 + + + + +http://dx.doi.org/10.37828/em.2020.36.3 + +journal article +10.37828/em.2020.36.3 +2336-9744 +13232026 +urn:lsid:zoobank.org:pub:B823F035-A5D2-40CC-87D6-86F137579DB7 + + + + + + +Microcleonus meregallii +Legalov + +, +sp. nov. + + + +https://zoobank.org/ + +urn:lsid:zoobank.org:act: +13A68AF4-3B11-4180-BAD8-96BC7BDFB49C + + + + + +( +Figs. 1 +, +2 +) + + + + +Type material +: + +Holotype +, male ( +ISEA +), +RUSSIA +, +Tuva +, env. +Erzin +, + +1100-1200 m + +, + +14-15.VIII.1989 + +, +D. Logunov + +. + +Paratypes +: +1 male +( +ISEA +), idem + +; + +2 females +( +ISEA +), env. +Kyzyl +, + + +20-25. +VI +.1989 + + +, +D. Logunov + +; + +1 male +( +ISEA +), env. +Kyzyl +, + + +11. +V +.1990 + + +, +V +. +Zinchenko + +; + +1 female +( +ISEA +), + +5 km +E of Khol-Oozhu + +, +Valley of Aryacaooy-Chen River +, + +1300m + +, + +15-16.VII.1993 + +, +D. Logunov + +; + +2 females +( +ISEA +), +Tandinsky District +, env. +Uspenka +, +Berezovka +, + + +14. +VI +.1976 + + +, +A. Cherepanov + +; + +1 female +( +ISEA +), +Kaa-Khemsky District +, 1964 + +; + +1 female +, ( +ISEA +) +Tuva +, +Akademika Obrucheva Mts. +, + +15 km +N of Kyzyl + +, +Malyi Shivilig River +, + +650-850 m + +, steppe, + + +24. +VI +.2001 + + +, +R +. & +A. Dudko +, +I. Ljubechansky + +; + +1 female +, ( +ISEA +) +Mongun-Tayginsky District +, +Kargy River +, + +1700m + +, + + +15. +VI +.1989 + + +, +D. Logunov + +. + + + + +Description +. + + +Body black, covered with densely yellowish-gray scales. Scales suboval, apically bifid, absent on head, wide longitudinal stripes on pronotal disc, base of 3 +rd- +7 +th +elytral interstriae, oblique spots behind middle of elytra. Antennae, tarsi and apices of tibiae, or tibiae completely red-brown. + + + +Figure 1. + +Microcleonus +spp. + +, dorsal view: a – + +M +. +meregallii + +sp. nov. +, holotype, male, b – + +M +. +meregallii + +sp. nov. +, paratype, female, c – + +M +. +panderi + +, neotype, male, Zabaikalskii Krai. Scale bar: 1.0 mm. + + + + +Figure 2 +. + +Microcleonus +spp. + +, aedeagus: a – + +M +. +meregallii + +sp. nov. +, holotype, dorsal view, b – + +M +. +panderi + +, neotype, dorsal view, c – + +M +. +meregallii + +sp. nov. +, holotype, lateral view, d – + +M +. +meregallii + +sp. nov. +, paratype, lateral view, e – + +M +. +panderi + +, neotype, lateral view. Scale bar: 0.5 mm. + + + +Male: Rostrum almost straight, without middle carina or with weak one, sparsely punctate in basal and middle thirds, finely punctate at apex, 1.9 times as long as wide at apex, 1.7-1.8 times as long as wide in middle, 1.4-1.6 times as long as wide at base, 0.6-0.7 times as long as pronotum. Antennal scrobes lateral, directed to base of rostrum, not reaching eyes. Forehead subequal in width to width of rostrum base, flattened, punctate. Eyes large, about 0.4 times as short as wide, transversely oval, not protruding from contour of head. Temples very short. Antennae inserted before apex of rostrum. Scapus long, about 2.8 times as long as wide at apex, not reaching eyes. Antennomeres 2 and 3 conical. Antennomere 2 subequal in length and wide, 0.3 times as long as and equal in width to scape. Antennomere 3 subequal in length and width, 0.6 times as long as and as narrow as antennomere 2. Antennomeres 4-7 wide-subconical. Antennomere 4 about 0.6 times as long as wide, shorter and distinctly wider than antennomere 3. Antennomere 5 almost two times wider than long, distinctly shorter and slightly narrower than antennomere 4. Antennomere 6 about 1.6 times wider than long, longer and slightly wider than antennomere 5. Antennomere 7 almost two times wider than long, slightly shorter and distinctly wider than antennomere 6. Antennomere 8 about 0.6 times as long as wide, distinctly longer and wider than antennomere 7. Club compact, 2.3 times as long as wide in middle, about 0.6 times shorter than antennomeres 2-8 combined. Pronotum 1.3 times as long as wide at apex, 0.9 times as long as wide in middle, 0.9 times as long as wide at base. Greatest width before middle and at base. Disk coarsely punctuate, without distinct tubercles, with deep middle groove. Base of pronotum convex to elytra. Scutellum absent. Elytra oval, 2.0 times as long as wide at base, 1.5 times as long as wide in middle, 2.7 times as long as wide at apex, 2.3 times as long as pronotum. Humeri smoothed. Greatest width in middle. Interstriae wide, flat, finely punctate. Base of interstriae 3 and 5 granulate. Striae deep. Prosternum with postocular lobe. Procoxal cavities rounded and contiguous. Precoxal portion of prosternum slightly shorter than postcoxal portion. Mesocoxal cavities separated. Metaventrite about 1.3-1.5 times shorter than length of metacoxal cavity. Metanepisterna about 4.3 times as long as wide in middle. Abdomen weakly convex. Ventrites 1, 3-5 with black spot before middle of apical edge and small spots on sides. Ventrites 1 and 2 quite long, subequal in length, fused, with slight depression in middle. Suture between ventrites 1 and 2 angularly curved to metaventrite. Ventrite 1 1.4-1.5 times as long as metacoxal cavity. Ventrite 2 with four small black spots. Ventrites 3 and 4 quite short. Ventrite 3 about two times shorter than ventrite 2. Ventrite 4 equal in length or slightly shorter than ventrite 3. Ventrite 5 long, 1.6-2.4 times as long as ventrite 4. Pygidium covered by elytra. Legs long. Femora not widened. Tibiae with decumbent long setae on inner edge, apical comb of small denticles and large uncus. Pro- and mesotibiae almost straight. Metatibiae weakly biconcave on inner margin. Tarsi long. Tarsomeres 1-3 with reduced pulvilli on lower surface. Tarsomeres 1 and 2 long-conical, flattened. Tarsomere 2 shorter than tarsomere 1. Tarsomere 3 bilobed. Tarsomere 5 elongated, slightly longer than tarsomeres 2 and 3 combined. Claws long and free. Aedeagus slightly curved ( +Fig. 1 +c-d). Length of body: +6.6-10.3 mm +. Length of rostrum: 1.0- +1.7 mm +. + + +Female: Rostrum about 1.6 times as long as wide at apex and in middle, 1.5 times as long as wide at base, 0.6 times as long as pronotum. Pronotum 1.4 times as long as wide at apex, equal to width in middle, almost 0.9 times as long as wide at base. Elytra 1.9 times as long as wide at base, 1.4 times as long as wide in middle, 2.6 times as long as wide at apex, 2.1 times as long as pronotum. Ventrites 1 and 2 flattened in middle. Metaventrite about two times shorter than length of metacoxal cavity. Ventrite 1 1.4 times as long as metacoxal cavity. Ventrite 2 subequal in length to ventrite 1. Ventrite 3 2.3-2.8 times shorter than ventrite 2. Ventrite 4 equal in length to ventrite 3. Ventrite 5 1.6-1.7 times as long as ventrite 4. Length of body: +9.2- 10.3 mm +. Length of rostrum: +1.8-1.9 mm +. + + + + +Differential diagnosis +. The new species is similar to + +M +. +panderi + +from Eastern Siberia and +Mongolia +but differs in the coarsely punctuate pronotum, without distinct tubercles, with deep middle groove, and slightly curved aedeagus. + + + + +Etymology +. The species is named in honor of Dr. Massimo Meregalli (University of Torino). + + + + +Distribution +. Southern Siberia: +Tuva +( +Fig. 3 +octagon). + + + + \ No newline at end of file diff --git a/data/EA/38/87/EA3887ECFF9A451AFF2A11666EC4B7F2.xml b/data/EA/38/87/EA3887ECFF9A451AFF2A11666EC4B7F2.xml new file mode 100644 index 00000000000..3b062b0ccc6 --- /dev/null +++ b/data/EA/38/87/EA3887ECFF9A451AFF2A11666EC4B7F2.xml @@ -0,0 +1,75 @@ + + + +A new species of the genus Microcleonus Faust, 1904 (Coleoptera: Curculionidae) from Tuva + + + +Author + +Legalov, Andrei A. + +text + + +Ecologica Montenegrina + + +2020 + +2020-11-08 + + +36 + + +40 +45 + + + + +http://dx.doi.org/10.37828/em.2020.36.3 + +journal article +10.37828/em.2020.36.3 +2336-9744 +13232026 +urn:lsid:zoobank.org:pub:B823F035-A5D2-40CC-87D6-86F137579DB7 + + + + + + +Microcleonus panderi +( +Fischer von Waldheim, 1835 +) + + + + + + +Remarks +. The type of this species is not present in the collections of the Zoological Museum of +Moscow +University and Zoological Institute of the Russian Academy of Sciences. +Neotype +is designated here. It is the specimen – male (ISEA) with labels “SE Zabaical’e, Onon River, +5 km +of Verkhnii Tsasuchei vill, steppe, thickets of elm, 29- +30.6.1995 +, O. Berezina, O. Kosterin”, “ +Neotype +, + +Cleonus panderi +Fischer von Waldheim, 1835 + +, A. Legalov des.” + + + + \ No newline at end of file diff --git a/data/F0/16/FA/F016FA47FFBBFF875FAAFED8F0ECF874.xml b/data/F0/16/FA/F016FA47FFBBFF875FAAFED8F0ECF874.xml new file mode 100644 index 00000000000..b045037e90a --- /dev/null +++ b/data/F0/16/FA/F016FA47FFBBFF875FAAFED8F0ECF874.xml @@ -0,0 +1,425 @@ + + + +First record of Theretra alecto (Linnaeus, 1758) from Kazakhstan, with notes on the bionomics of the species (Lepidoptera, Macroheterocera, Sphingidae, Macroglossinae, Macroglossini) + + + +Author + +Titov, Sergey V. +Department of Biology and Ecology; the Research Centre for Environmental " Monitoring ", Toraighyrov University, Lomova str. 64, KZ- 140008, Pavlodar, Kazakhstan. E-mail: sandipta @ yandex. kz + + + +Author + +Volynkin, Anton V. +Altai State University, Lenina Avenue, 61, RF- 656049, Barnaul, Russia. E-mail: monstruncusarctia @ gmail. com & National Research Tomsk State University, Lenina Avenue, 36, RF- 634050, Tomsk, Russia + + + +Author + +Rakhimov, Ruslan D. +Department of Entomology, Institute of Zoology, al-Farabi str. 050060, Almaty, Kazakhstan * Corresponding author + + + +Author + +Belyalov, Oleg V. + + + +Author + +. + + + +Author + +. + + + +Author + +. + +text + + +Ecologica Montenegrina + + +2020 + +2020-12-03 + + +38 + + +79 +83 + + + + +http://dx.doi.org/10.37828/em.2020.38.10 + +journal article +10.37828/em.2020.38.10 +2336-9744 +13232305 + + + + + + +Theretra alecto +(Linnaeus, 1758) + + + + + + +( +Figs 1–7 +) + + + +Sphinx alecto +Linnaeus, 1758 + +, +Systema Naturae (Edn 10) +1 +: 492 ( +Type +locality: +India +). + + + + +Material examined. + +1 male +, +1 female +, +ex pupa + +18.IX.2019 +, +12.VIII.2017 + +, SE +Kazakhstan +, +Almaty +city, +43°14'54.00"N +76°51'33.00"E +, + +790m + +, leg. +R +. +Rakhimov +, eggs collected on + +01.VIII.2019 + +from cultivated grape vine (coll. +STP +) + +; + +1 male +, SE +Kazakhstan +, +Almaty +city, Aygerim-2 community, +43.271282°N +076.836360°E +, + + +746m + + + + +., collection of larva from cultivated grape vine: + +12.IX.2019 + +, pupation: + +14.09.2019 + +, imago hatching: + +09.I.2020 + +, leg. +S. Kolov +(coll. +OBA +) + +; + +1 male +, SE +Kazakhstan +, +Almaty region +, +Alatau +vill., (IYAF-Institute of +Nuclear Physics +), +43°21'7.95"N +77°8'50.34"E +, + + +790 m + + + + +., collection of larva from cultivated grape vine: + +21.VIII.2019 + +, pupation: + +28.VIII.2019 + +, imago hatching: + +09.IX.2019 + +, leg. +D. Zakharov +(coll. +DZA +) + +. + + +Photographic material examined +. + +1 female +, photo taken on + +21.VIII.2017 + +, SE +Kazakhstan +, +Almaty region +, +Yntymak +vill., +43°24'40.00"N +, +76°58'22.00"E +, + +740m + +, on the ground, in the afternoon (photo by +K. Popkov +) + +; + +1 female +, photo taken on + +14.VII.2019 + +, SE +Kazakhstan +, suburb of +Almaty +city, +Pervomayskiye Dachi +cottage settlement, northern part, +43°23'28.00"N +76°54'32.00"E +, + +710m + +, on the wall of the cottage in the evening (photo by +O. Belyalov +) + +; + +1 male +, photo taken on + +08.VIII.2018 + +, S +Kazakhstan +, +Turkestan region +, +Shymkent +city, +42°18'21.99"N +69°38'23.99"E +, + +550m + +, on the wall of the building, in the afternoon (photo by +Q. Amirekul +) + +. + + +Bionomics and distribution + + +All specimens were found in populated areas ( +Fig. 7 +). Imagoes were found in day and night time sitting on the ground, vegetation or walls of houses ( +Figs 2, 3 +). +One female +specimen was observed flying and lying eggs one at a time on the underside of leaves of cultivated grape vine ( + +Vitis vinifera + +) at dusk (21:00–21: +30 p. +m.). Imagoes of + +Th. alecto + +are on wing in July and August, eggs lying was observed in August, larvae feed on + +Vitis vinifera + +in August and September. + + + +The species is known from +Italy, Romania +, +Bulgaria +, North Macedonia, +Greece, Turkey, Cyprus +, +Armenia +, Georgia, +Russia +(Daghestan +Republic +), Azerbaijan, +Iran, Turkmenistan, Uzbekistan, Kyrgyzstan +, +Kazakhstan +(present study), +Afghanistan, Lebanon, Israel, Jordan, Egypt, Pakistan, China, Nepal, India, Sri Lanka, Taiwan, Japan +and +Indonesia +( + +Krpač +et al. +2019 + +; +Zolotuhin +& +Yevdoshenko +2019; +Pittaway +2020). In +Kazakhstan +( +Fig. 8 +), + +Th. alecto + +was found in the northern foothills of Transili Alatau Range ( +Almaty Region +, northern part of the +Tien Shan mountain +massif) at altitudes ranging from + +710 to 790 m + + +, + +and in the northeastern foothills of Karzhantau Range ( +Turkestan Region +, western part of the +Tien Shan mountain +massif) at altitude of + + +550m + +. + + + + +The nearest known localities of + +Th. alecto + +in Central Asia are in +Uzbekistan +(Tashkent) ( +Gehlen 1941 +) and +Kyrgyzstan +( +Bishkek +) ( +Korb 2018 +). The new founds ( +Fig. 8 +) in +Almaty +city are the northernmost in Central Asia and increase the known range of the species in the region by +183 km +to the north-east. We have no data if the populations of + +Th. alecto + +in +Kazakhstan +are autochthonous or the species is present in the country only as a summer migrant. Clarification of this question requires further studies. + + + + \ No newline at end of file