From f345d776d4c8e2dc47c3348518ae3085818fbee5 Mon Sep 17 00:00:00 2001 From: ggserver Date: Thu, 29 Aug 2024 20:19:07 +0000 Subject: [PATCH] Add updates up until 2024-08-29 20:13:01 --- .../7C/0F577CEE9D1759488486B54ECC7B50D4.xml | 1503 ++++ .../11/150611EDA9E75127860257B75456F807.xml | 216 +- .../C9/1B98C9A235665BBBB799E355DDD3409D.xml | 1499 ++++ .../95/4242957258E1580EA53972B9894EA418.xml | 213 +- .../55/436F557EEA2B506C81E385F8FB4C9F0F.xml | 319 +- .../40/4E0D406EFFFA560ABA7CD2ADA7DBC1B2.xml | 6347 +++++++++++++++++ .../57/59CE57F3CA395259813CAC48BE3D0090.xml | 1696 +++++ .../E7/87C2E7EED2375729982F5A8183FFC229.xml | 1757 +++++ .../DF/E662DF396B0B530DBD91D657B5B14F1F.xml | 1397 ++++ .../97/F3BF97FDC1E7589497F898377B0F506B.xml | 357 + 10 files changed, 14941 insertions(+), 363 deletions(-) create mode 100644 data/0F/57/7C/0F577CEE9D1759488486B54ECC7B50D4.xml create mode 100644 data/1B/98/C9/1B98C9A235665BBBB799E355DDD3409D.xml create mode 100644 data/4E/0D/40/4E0D406EFFFA560ABA7CD2ADA7DBC1B2.xml create mode 100644 data/59/CE/57/59CE57F3CA395259813CAC48BE3D0090.xml create mode 100644 data/87/C2/E7/87C2E7EED2375729982F5A8183FFC229.xml create mode 100644 data/E6/62/DF/E662DF396B0B530DBD91D657B5B14F1F.xml create mode 100644 data/F3/BF/97/F3BF97FDC1E7589497F898377B0F506B.xml diff --git a/data/0F/57/7C/0F577CEE9D1759488486B54ECC7B50D4.xml b/data/0F/57/7C/0F577CEE9D1759488486B54ECC7B50D4.xml new file mode 100644 index 00000000000..58ed27f2a7b --- /dev/null +++ b/data/0F/57/7C/0F577CEE9D1759488486B54ECC7B50D4.xml @@ -0,0 +1,1503 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis typica +Walker, 1835 + +stat. rev. + + + + +Figs 2 D +, +3 D +, +17 A – E + + + + + + + +Anacharis typicus + +Walker, 1835: 520 +- +lectotype +( + +NHMUK + +) +♀ +, photographs examined (Fig. +16 A – C +). + + + + + + + + +Diagnosis + + +(n = 10). +Belongs to the + +eucharioides +species group + +. Medium sized species (2.9–3.5, mean +3.2 mm +, similar to + +A. eucharioides + +, + +A. martinae + +and + +A. petiolata + +). Differing from + +A. eucharioides + +and + +A. martinae + +by having a centrally smooth mesoscutellum (Fig. +17 D, E +, centrally carinate in + +A. eucharioides + +and + +A. martinae + +) and a smooth lateromedial area of the pronotum (Fig. +17 B +, rugose to obliquely carinate in + +A. eucharioides + +and + +A. martinae + +). Differs from + +A. petiolata + +mainly by having the hind coxa often distinctly bicoloured, with noticable paling apically (Fig. +17 A +, hind coxa less distinctly bicoloured, though weak paling is notable apically in + +A. petiolata + +). The hind trochanter in + +A. typica + +has a similar pattern of paling as hind coxa or is as pale as in hind femur (hind trochanter similarly dark as the hind coxa in + +A. petiolata + +). Additional to morphological differences, + +A. typica + +is exclusively collected in temperate environments below 700 meters above sea level (whilst + +A. petiolata + +is collected from boreal environments above 1,000 meters above sea level). + + + + + + + +Anacharis typica + +, female ( + +ZFMK +-TIS-2640806 + +) +A +habitus +B +mesosoma lateral +C +face +D +mesosoma dorsal +E +mesosoma posterior view. + + + + + +CO 1 barcode. + + +n = 10. Maximum intraspecific distance: 0.5 %. Minimum distance to closest species ( + +A. eucharioides + +): 5.7 %. CO 1 barcode consensus sequence: + +AATTTTATACTTTATTTTAGGAATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGGACCCCCTCTCAATTAATTATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTCATACCTATTATAGTAGGAGGATTCGGAAATTATTTAGTGCCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCCCGATTAAATAATTTAAGATTTTGATTTTTAATCCCCTCTTT ATTTTTAATAACAATTAATTTATTTATTGACCAAGGAGCAGGAACAGGGTGAACTGTATACCCCCCATTA TCATCACTCACAGGTCATCCATCTATATCGGTAGATTTAGTTATTTATTCATTACATTTAAGTGGAATTT CCTCAATTCTTGGTTCTATTAATTTTATTGTAACCATTTTAAATATACGAATAACTGTTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTTTAACTACAATTTTATTATTATTATCTTTACCAGTACTA GCAGGAGGTTTAACTATATTACTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGAG GGGATCCAATCCTTTATCAACACTTATTT + + + +Type material. + + + +Lectotype +of + +Anacharis typicus +Walker, 1835 + + + +81 61 [on backside of mounting board] +2. +Type +In Coll under typical + +B. M. 1981. Under + +typica + + + +LECTOTYPE + + +LECTOTYPE + +Anacharis typica +Walker + +det. N. D. M. Fergusson, 1981 + + +B. M. +TYPE +HYM 7. 163 + + +[QR code] + +NHMUK + +012858913 + + +[for images, see Fig. +16 A – C +and +https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470199 +] + + + + +Other material examined. + + +DNA barcode vouchers. + +Austria +• +1 ♂ +; +Styria +, +NP Gesäuse +, +Gsengquelle +; + +47.5683 ° N +, +14.5902 ° E + +; ca + +680 m +a. s. l. + +; + +2 Sep. 2015 + +; +Haseke +leg.; + +ZFMK +-TIS-2640691 + + +. + + + +Belgium +• +1 ♀ +; +West Flanders +, +Beernem +, +Centrum +; + +51.1259 ° N +, +3.3202 ° E + +; ca + +10 m +a. s. l. + +; + +8 May 2022 + +; +De Ketelaere +, +Augustijn +leg.; +hand picked +; + +ZFMK +-TIS-2640858 + + +. • + +1 ♀ +; +West Flanders +, +Beernem +, +Gevaerts +; + +51.1411 ° N +, +3.3215 ° E + +; ca + +10 m +a. s. l. + +; + +24 Apr. 2022 + +; +De Ketelaere +, +Augustijn +leg.; +hand picked +; + +ZFMK +-TIS-2640857 + + +. + + + +Germany +• +1 ♀ +; +Hesse +, +Waldeck-Frankenberg +, +National park Kellerwald-Edersee +, +Maierwiesen +; + +51.1555 ° N +, +9.0015 ° E + +; ca + +370 m +a. s. l. + +; + +22 Jun. - 8 Jul. 2021 + +; +GBOL +III leg.; +Malaise trap (Krefeld version) +; + +ZFMK +-TIS-2640806 + + +. • + +3 ♂♂ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Banfe-Haus +“; + +51.167 ° N +, +8.9749 ° E + +; ca + +270 m +a. s. l. + +; + +7–21 Jul. 2022 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640757 + +, + +ZFMK +-TIS-2640758 + +, + +ZFMK +-TIS-2640760 + + +. • + +1 ♀ +; +Mecklenburg-Vorpommern +, +Vorpommern-Rügen +, +Großer Vilm +, +Biosphärenreservat +; + +54.325 ° N +, +13.539 ° E + +; ca + +30 m +a. s. l. + +; + +24 May- 3 Jun. 2016 + +; +Rulik +, +Björn +et al. leg.; +Malaise trap +; + +ZFMK +-TIS-2629503 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Schladern near Windeck +, +Sieg river +, +right river bank +; + +50.8 ° N +, +7.585 ° E + +; ca + +130 m +a. s. l. + +; + +4–11 Jul. 2017 + +; +ZFMK +et al. leg.; +Malaise trap +; + +ZFMK +-TIS-2629276 + + +. + + + +Lithuania +• +1 ♀ +; +Silute distr. +, +Sysa +, +Sysa +, +control plot +; + +55.3127 ° N +, +21.4049 ° E + +; ca 0 m a. s. l.; + +14–25 Jun. 2020 + +; +Petrasiunas +, +Andrius +leg.; +Malaise trap +; + +ZFMK +-TIS-2637717 + + +. + + +Material without DNA barcode. + +Belgium +• +2 ♂♂ +; +Walloon Brabant +, +Ottignies +; + +9–16 Jul. 1983 + +; +Paul Dessart +leg.; +Malaise trap +; +JV_Prel_0074 +( +RBINS +), +JV_Prel_0045 +( +RBINS +) + +. • + +2 ♂♂ +; same collection data as for preceding + +28 May- 4 Jun. 1983 + +; +JV_Prel_0075 +( +RBINS +), +JV_Prel_0076 +( +RBINS +) + +. • + +1 ♂ +; +West +Flanders +, +Harelbeke +, +Gavers +, +Wetland with pools +; + +50.8379 ° N +, +3.3215 ° E + +; ca + +10 m +a. s. l. + +; + +11 Jun. 2022 + +; +Bart Lemey +leg.; +hand caught +; +JV_Prel_0052 +( +RBINS +) + +. + + + +Germany +• +1 ♂ +; +Hesse +, +Werra-Meißner-Kreis +, +Großalmerode +, +Private garden, Siedlerweg +, +semi-abandoned garden with wet spot, ivy hedge and salix +; + +51.2591 ° N +, +9.7871 ° E + +; ca + +380 m +a. s. l. + +; + +12–20 Jul. 2022 + +; +Jonathan Vogel +leg.; +Malaise trap +; + +ZFMK +-TIS-2640704 + + +. • + +1 ♂ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Schladern near Windeck +, +Sieg river +, +right river bank +; + +50.8 ° N +, +7.585 ° E + +; ca + +130 m +a. s. l. + +; + +18–25 Jul. 2017 + +; + +ZFMK + +et al. leg.; +Malaise trap +; + +ZFMK +-HYM-00039677 + + +. • + +2 ♂♂ +; same collection data as for preceding + +1–8 Aug. 2017 + +; + +ZFMK +-HYM-00039674 + +, + +ZFMK +-HYM-00039675 + + +. + + + +Italy +• +1 ♂ +; +Val d’Aoste +, +Boertolaz +, (Villeneuve); ca + +800 m +a. s. l. + +; + +15 Sep. 1978 + +; +L. Martile +leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023180 +( + +NHRS + +) + +. + + + +Sweden +• +1 ♂ +; +Gotland +, +Eksta +sn, +Stora Karlsö +, +calcarous low herb pasture +; + +57.2873 ° N +, +17.9775 ° E + +; ca + +40 m +a. s. l. + +; + +26–29 Aug. 2014 + +; + +Hymenoptera Inventory 2014 + +leg.; +Malaise trap +; MT Loc # 2; + +NHRS + +- +HEVA 000023181 +( + +NHRS + +) + +. • + +1 ♂ +; +Gotska sandön +, +Kapellängen +; + +7 Jul. 1964 + +; +Bror Hanson +leg.; + +NHRS + +- +HEVA 000023182 +( + +NHRS + +) + +. • + +1 ♂ +; +Öland +, +Glömminge +, +Gillsättra +; + +4 Aug. 2004 + +; +Mattias Forshage +leg.; specimen in coll +MF + +. • + +1 ♀ +; +Öland +, +Kastlösa +; + +26 Jun. 1962 + +; +Karl-Johan Hedqvist +leg.; + +NHRS + +- +HEVA 000023198 +( + +NHRS + +) + +. • + +1 ♂ +; +Öland +, +Kastlösa +; + +28 Jun. 1962 + +; +Tor-Erik Leiler +leg.; + +NHRS + +- +HEVA 000023197 +( + +NHRS + +) + +. • + +2 ♂♂ +; +Scania +, +Kristianstads kommun +, +Trunelän +, +Degeberga +, +Grazed meadow at alder stand along stream +; + +55.7746 ° N +, +14.2156 ° E + +; ca + +80 m +a. s. l. + +; + +1–13 Aug. 2019 + +; +Swedish Insect Inventory Programme +(SIIP), +Station Linné +leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023184 +( + +NHRS + +), + +NHRS + +- +HEVA 000023185 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Lomma +; + +10 Jul. 1963 + +; +Hans von Rosen +leg.; + +NHRS + +- +HEVA 000023188 +( + +NHRS + +) + +. • + +1 ♂ +; same collection data as for preceding + +13 Aug. 1963 + +; + +NHRS + +- +HEVA 000023189 +( + +NHRS + +) + +. • + +2 ♀♀ +; same collection data as for preceding + +14 Aug. 1963 + +; + +NHRS + +- +HEVA 000023186 +( + +NHRS + +), + +NHRS + +- +HEVA 000023187 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Saxtorp +; + +5 Jun. 1961 + +; +Karl-Johan Hedqvist +leg.; + +NHRS + +- +HEVA 000023183 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Stenshuvuds NP +, +lush mixed oak forest +; + +55.6603 ° N +, +14.2755 ° E + +; ca + +30 m +a. s. l. + +; + +22 Sep. - 1 Nov. 2004 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023190 +( + +NHRS + +) + +. • + +1 ♀ +, +1 ♂ +; +Småland +; [18 xx]; +Carl Henning Boheman +leg.; female - + +NHRS + +- +HEVA 000023191 +( + +NHRS + +); male - + +NHRS + +- +HEVA 000023192 +( + +NHRS + +) + +. • + +1 ♂ +; +Södermanland +, +Tockenön + +Jul. 1950 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023193 +( + +NHRS + +) + +. • + +1 ♂ +; +Uppland +, +Vallentuna +; + +7 Jun. 1959 + +; +Karl-Johan Hedqvist +leg.; + +NHRS + +- +HEVA 000023195 +( + +NHRS + +) + +. • + +1 ♀ +; same collection data as for preceding + +15 Sep. 1962 + +; + +NHRS + +- +HEVA 000023194 +( + +NHRS + +) + +. • + +1 ♂ +; +Västmanland +, +Köping +; + +18 May 1975 + +; +Walter Siering +leg.; + +NHRS + +- +HEVA 000023196 +( + +NHRS + +) + +. + + + +Switzerland +• +1 ♀ +; +Grisons +, +Pontresina +; unknown leg.; specimen at + +NMBE + + +. + + + + +Biology. + +Summer species, flying mainly from April to September, peak in July. No clear preferences in terms of habitat. + + + +Distribution. + + +Austria +, +Belgium +, +Germany +, +Italy +, +Lithuania +, +Sweden +, +Switzerland +, +United Kingdom +(locus + +typicus + +of + +A. typica + +: southern +England +, near London or +Isle of Wight +). + + +Found in elevations up to +400 m +a. s. l., rarely up to +800 m +a. s. l. + + + + +Remarks. + + +The specimen labelled as +lectotype +is clearly a female, not a male as stated by +Fergusson (1986) +. Despite this incongruence we acknowledge the specimen labelled as +lectotype +by Fergusson as such. + + +The +lectotype +is glued to its ventral side on cardboard, face down, wings also glued to the board. It is overall intact, though the 13 +th +antennal segment is either broken in half and the fragment is lost, or the segment is malformed. The tarsomeres of the right fore leg are missing from second tarsomere onwards. Both wings and legs obscure the lateral mesosoma on both sides. + + +With +2.6 mm +body length, the +lectotype +is a comparably small specimen of this species (average body length +3.2 mm +). Additionally, the +lectotype +is unusual by its overall reddish colouration, which may have been caused by ageing. Otherwise, it is morphologically well-fitting with the specimens we examined. + + +For a comparison of the similar + +A. typica + +and + +A. petiolata + +, see the remarks section of + +A. petiolata + +. + + +One specimen +from +Belgium +( + +JV +_Prel_0076 + +) was similarly coloured as the Bavarian specimens ( + +BC- + + +ZSM + +-HYM-27596 + +-F 10 + +& + +BC- + + +ZSM + +-HYM-27596 + +-F 09 + +, see variation section in description of + +A. martinae + +) of + +A. martinae + +, having the head distinctly darker than the otherwise pale body. + + +In the distribution section we only list those records that we can verify by having seen actual specimens. Additional distribution records can be inferred from sequences from +BOLD +, if they match with our species cluster of + +A. typica + +. They were obtained from specimens originating from +Canada +(e. g. SMTPI 9646-14). The identities of these sequences as + +A. typica + +need to be confirmed by examination of the physical specimens before reliably citing + +A. typica + +for +Canada +. + + + + \ No newline at end of file diff --git a/data/15/06/11/150611EDA9E75127860257B75456F807.xml b/data/15/06/11/150611EDA9E75127860257B75456F807.xml index 3248a5803b3..cab3f7177cf 100644 --- a/data/15/06/11/150611EDA9E75127860257B75456F807.xml +++ b/data/15/06/11/150611EDA9E75127860257B75456F807.xml @@ -1,119 +1,119 @@ - - - -Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species - - -Author + + +Author -Vogel, Jonathan -0000-0002-7102-0231 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Forshage, Mattias -Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden - - -Author + + +Author -Bartsch, Saskia B. -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Ankermann, Anne -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Mayer, Christoph -0000-0001-5104-6621 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -von Falkenhausen, Pia -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Rduch, Vera -0000-0002-6499-2876 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Müller, Björn -0000-0001-6233-5410 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Braun, Christoph -https://orcid.org/0009-0003-1312-5953 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Krammer, Hans-Joachim -https://orcid.org/0009-0008-7012-1752 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Peters, Ralph S. -0000-0001-7784-9203 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany -text - - -Journal of Hymenoptera Research +text + + +Journal of Hymenoptera Research - -2024 - -2024-08-29 + +2024 + +2024-08-29 - -97 + +97 - -621 -698 + +621 +698 -journal article -10.3897/jhr.97.131350 -EA190992-B01B-4F1B-A362-A4549C725580 +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 - + Anacharis minima Vogel, Forshage & Peters @@ -132,29 +132,29 @@ Vogel, Forshage & Peters (n = 1). Belongs to the - + eucharioides species group. Small species ( 2.4 mm ). Similar to - + A. petiolata and - + A. typica by having a centrally smooth mesoscutellum (centrally carinate in - + A. eucharioides , - + A. martinae and - + A. maxima ). The small body size and the narrow coriaceous texture of the malar space that extends only around the dorsal corner of the mandibular base (Fig. @@ -209,13 +209,16 @@ Body black (Fig. - + Anacharis minima sp. nov. , holotype, female ( + ZFMK -- TIS- 2640724) +-TIS-2640724 + +) A lateral habitus B @@ -336,7 +339,7 @@ Unknown n = 1. Maximum intraspecific distance = not applicable. Minimum distance to closest species ( - + A. eucharioides ) = 5.6 %. CO 1 barcode consensus sequence: @@ -348,7 +351,7 @@ n = 1. Maximum intraspecific distance = not applicable. Minimum distance to clos Type material. - + Holotype @@ -365,8 +368,10 @@ n = 1. Maximum intraspecific distance = not applicable. Minimum distance to clos , Malsch , -Hansjakobstraße -, garden; +Hansjakobstraße +, +garden +; 48.8835 ° N , @@ -386,10 +391,11 @@ a. s. l. leg.; Malaise trap ; - -ZFMK - -- TIS- 2640724. + +ZFMK +-TIS-2640724 + +. @@ -410,7 +416,7 @@ was collected in autumn (between October and November) in a garden. Germany (locus - + typicus : Karlsruhe, Malsch). @@ -435,15 +441,15 @@ a. s. l. While - + A. minima is molecularly clearly distinct from other species, the morphology overlaps in many aspects with other species that show a smooth mesoscutellum. It is the name-giving small size that seems to hold the most diagnostic value but there is no way to say for sure which characters are morphologically diagnostic for - + A. minima based on a single specimen. Some specimens, which we currently classify as - + A. typica ( @@ -457,11 +463,11 @@ based on a single specimen. Some specimens, which we currently classify as ) show similarities to the holotype of - + A. minima , but they deviate in size and sculpture to regard them as not conspecific. The morphological diagnosis is in need of extension by studying further material of which the barcode matches that of - + A. minima . diff --git a/data/1B/98/C9/1B98C9A235665BBBB799E355DDD3409D.xml b/data/1B/98/C9/1B98C9A235665BBBB799E355DDD3409D.xml new file mode 100644 index 00000000000..f4576a11302 --- /dev/null +++ b/data/1B/98/C9/1B98C9A235665BBBB799E355DDD3409D.xml @@ -0,0 +1,1499 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis petiolata +( +Zetterstedt, 1838 +) + +stat. rev. + + + + +Figs 2 C +, +15 A – E + + + + + + + +Cynips petiolata + +Zetterstedt, 1838: 409 +- +lectotype +( + +MZLU + +) +♀ +, photographs examined. + + + + + + + + + +Anacharis gracilipes + +Ionescu, 1969: 75 +syn. nov. +(removed from synonymy with + +A. eucharioides + +) - +holotype +( + +MGAB + +) +♀ +, examined. + + + + + + + + +Diagnosis + + +(n = 9). +Belongs to the + +eucharioides + +species group. Medium sized species (3.0–3.4, mean +3.2 mm +, similar to + +A. eucharioides + +, + +A. martinae + +and + +A. typica + +). Differing from + +A. eucharioides + +and + +A. martinae + +by having a centrally smooth mesoscutellum (Fig. +15 D, E +, centrally carinate in + +A. eucharioides + +and + +A. martinae + +) and a smooth lateromedial area of the pronotum (Fig. +15 B +, rugose to obliquely carinate in + +A. eucharioides + +and + +A. martinae + +). Differs from + +A. typica + +mainly by having the hind coxa less distinctly bicoloured, weak paling is notable apically (Fig. +15 A +, distinctly bicoloured with distinct paling in hind coxa in + +A. typica + +). The hind trochanter in + +A. petiolata + +is similarly dark as the hind coxa (similar pattern of paling as hind coxa or pale as hind femur in + +A. typica + +). Additional to morphological differences, based on the limited material at hand, + +A. petiolata + +seems to be exclusively collected in boreal or montane environments from above 1,000 meters above sea level (whilst + +A. typica + +is collected from temperate environments below 700 meters above sea level). + + + + + + + +Anacharis petiolata + +, female ( + +ZFMK +-TIS-2629285 + +) +A +habitus +B +mesosoma lateral +C +face +D +mesosoma dorsal +E +mesosoma posterior view. + + + + + +CO 1 barcode. + + +n = 9. Maximum intraspecific distance: 2.2 %. Minimum distance to closest species ( + +A. eucharioides + +): 3.2 %. CO 1 barcode consensus sequence: + +AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAGTTAGGTACCCCATCTCAATTAATTATAAATGATCAAATTTATAATTCAATTGTAACTGCACATGCA TTTATCATAATTTTCTTTATAGTTATACCTATCATAGTAGGAGGATTTGGAAATTATTTAGTACCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCACGATTAAATAATTTAAGATTTTGATTTGCAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATCGACCAAGGAGCAGGAACAGGATGAACTGTTTATCCTCCATTA TCCTCTCTAACAGGTCACCCATCTATATCAGTAGATTTAGTTATTTATTCATTACATTTAAGTGGAATCT CTTCAATTCTTGGATCAATTAATTTTATTGTTACCATTTTAAATATACGAATAAATTCTATATTTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACTATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGGG GAGACCCAATCCTTTATCAACATTTATTT + + + +Type material. + + + +Lectotype +of + +Cynips petiolata +Zetterstedt, 1838 + + + +LECTO-TYPE + +C. petiola ta +♀ +. + +1982 855 + +LECTOTYPE + +Cynips petiolata +Zett + +det. N. D. M. Fergusson, 1982 + + + +Anacharis eucharoides +(Dal.) + +det. N. D. M. Fergusson, 1982 + + + +MZLU + +00207341 + + + +MZLU + +Type no. 7814: 1 + + +[for images, see +https://www.flickr.com/photos/tags/mzlutype07814 +] + + + +Holotype +of + +Anacharis gracilipes +Ionescu 1969 + + + + + +Anacharis gracilipes + +n. sp. +♀ +Holotip + +26.7. 956 Rarău, +GAL 0340 / 9 + + +Anacharis eucharoides +♀ +( +Dalman, 1823 +) + +JP-V 2012 det + + +HOLOTYPUS +, + +Anacharis gracilipes +Ionescu, 1969 + +, + +MGAB + + + +[Fig. +16 E +] + + + + + + +Lectotype of + +A. typica + +( +A-C +) and holotype of + +A. gracilipes + +( +D, E +) +A +labels, frontal +B +lectotype ventral +C +lectotype dorsal +D +holotype dorsal +E +holotype labels frontal, above and the back, below. + + + + + +Other material examined. + + +DNA barcode vouchers. + +Germany +• +1 ♀ +; +Bavaria +, +Allgäu +, +Oberstdorf +, +Oytal +, +Schochen +, +alpine meadow +; + +47.392 ° N +, +10.37 ° E + +; ca + +1930 m +a. s. l. + +; + +6 Aug. 2014 + +; + +BC- +ZSM +-HYM-24109-D 01 + +( + +ZSM + +) + +. • + +1 ♀ +; same collection data as for preceding; + +4 Sep. 2014 + +; + +BC- +ZSM +-HYM-24073-F 03 + +( + +ZSM + +) + +. • + +1 ♀ +; +Bavaria +, +Allgäu +, +Oberstdorf +, +Schochen +, +south faced ridge +; + +47.394 ° N +, +10.369 ° E + +; ca + +2030 m +a. s. l. + +; + +6 Aug. 2014 + +; + +BC- +ZSM +-HYM-24066-H 09 + +( + +ZSM + +) + +. • + +1 ♀ +, +1 ♂ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4062 ° N +, +11.0095 ° E + +; ca + +1970 m +a. s. l. + +; + +20 Jun. - 5 Jul. 2018 + +; +Doczkal, D. +, +Voith, J. +leg.; +Malaise trap +; female - + +ZFMK +-TIS-2637891 + +; male - + +ZFMK +-TIS-2637890 + + +. • + +2 ♀♀ +, +1 ♂ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4068 ° N +, +11.008 ° E + +; ca + +2010 m +a. s. l. + +; + +20 Jun. - 5 Jul. 2018 + +; +Doczkal, D. +, +Voith, J. +leg.; +Malaise trap +; females - + +ZFMK +-TIS-2628236 + +, + +ZFMK +-TIS-2629285 + +; male - + +ZFMK +-TIS-2628237 + + +. • + +1 ♀ +; same collection data as for preceding; + +2–13 Aug. 2018 + +; + +ZFMK +-TIS-2637893 + + +. + + +Greenland +• + +1 ♀ +, +2 ♂♂ +; SouthWest +Greenland +, +Evighedsfjord +, +Kangiussaq +; + +65.8667 ° N +, - +52.2 ° E + +; ca + +30 m +a. s. l. + +; + +19 Jul. - 20 july 2003 + +; +Kissavik Exp. +, +ZMUC +leg.; female - +zmuc 00023359 +( + +ZMUC + +); males - +zmuc 00023357 +( + +ZMUC + +), +zmuc 00023358 +( + +ZMUC + +) + +. + + +Material without DNA barcode. + +Germany +• +1 ♂ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4053 ° N +, +11.0091 ° E + +; ca + +1980 m +a. s. l. + +; + +18 Jul. - 2 Aug. 2018 + +; +Dieter Doczkal +| +Johannes Voith +leg.; +Malaise trap +; + +ZFMK +-HYM-00039678 + + +. • + +4 ♀♀ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4062 ° N +, +11.0095 ° E + +; ca + +1970 m +a. s. l. + +; + +20 Jun. - 5 Jul. 2018 + +; +Dieter Doczkal +| +Johannes Voith +leg.; +Malaise trap +; + +ZFMK +-HYM-00039679 + +, + +ZFMK +-HYM-00039680 + +, + +ZFMK +-HYM-00039681 + +, + +ZFMK +-HYM-00039682 + + +. • + +1 ♂ +; same collection data as for preceding + +5–18 Jul. 2018 + +; + +ZFMK +-TIS-2642567 + + +. • + +2 ♀♀ +; same collection data as for preceding + +18 Jul. - 2 Aug. 2018 + +; + +ZFMK +-TIS-2642535 + +, + +ZFMK +-TIS-2642547 + + +. • + +1 ♂ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4068 ° N +, +11.008 ° E + +; ca + +2010 m +a. s. l. + +; + +5–18 Jul. 2018 + +; +Dieter Doczkal +| +Johannes Voith +leg.; +Malaise trap +; + +ZFMK +-TIS-2642544 + + +. • + +2 ♂♂ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +Platt +, +mountain +; + +47.4053 ° N +, +11.0091 ° E + +; ca + +1980 m +a. s. l. + +; + +5–18 Jul. 2018 + +; +Dieter Doczkal +| +Johannes Voith +leg.; +Malaise trap +; + +ZFMK +-TIS-2640706 + +, + +ZFMK +-TIS-2640707 + + +. • + +1 ♂ +; same collection data as for preceding + +18 Jul. - 2 Aug. 2018 + +; + +ZFMK +-HYM-00039678 + + +. + + + +Greenland +• +1 ♀ +; +Narssarssuaq +; + +61.1 ° N +, - +45.25 ° E + +; ca 0 m a. s. l.; + +5 Jul. 1983 + +; +Peter Nielsen +leg.; +NHMD 918327 +( + +ZMUC + +) + +. • + +2 ♂♂ +; same collection data as for preceding + +1 Aug. 1983 + +; +NHMD 918299 +( + +ZMUC + +), +NHMD 918313 +( + +ZMUC + +) + +. • + +1 ♀ +; same collection data as for preceding + +13 Aug. 1983 + +; +NHMD 918341 +( + +ZMUC + +) + +. • + +1 ♀ +3 ♂♂ +; SouthWest +Greenland +, +Evighedsfjord +, +Kangiussaq +; + +65.8667 ° N +, - +52.2 ° E + +; ca + +30 m +a. s. l. + +; + +19–20 Jul. 2003 + +; +Kissavik Exp. +, + +ZMUC + +leg.; female - +zmuc 00023359 +( + +ZMUC + +); males - +NHMD 918215 +( + +ZMUC + +), +zmuc 00023357 +( + +ZMUC + +), +zmuc 00023358 +( + +ZMUC + +) + +. • + +1 ♂ +; same collection data as for preceding + +24–25 Jul. 2003 + +; +NHMD 918229 +( + +ZMUC + +) + +. • + +1 ♀ +; SouthWest +Greenland +, +Itivleq +, eastern end; + +66.55 ° N +, - +52.4333 ° E + +; ca 0 m a. s. l.; + +22–23 Jul. 2003 + +; +Kissavik Exp. +, + +ZMUC + +leg.; +NHMD 918285 +( + +ZMUC + +) + +. • + +1 ♀ +; SouthWest +Greenland +, +Kangerdluarssuk +east; + +66.9833 ° N +, - +53.2 ° E + +; ca + +20 m +a. s. l. + +; + +24–25 Jul. 2003 + +; +Kissavik Exp. +, + +ZMUC + +leg.; +NHMD 918271 +( + +ZMUC + +) + +. • + +1 ♀ +, +1 ♂ +; West +Greenland +, +Qarássap munatâ +; + +70.75 ° N +, - +53.62 ° E + +; ca + +710 m +a. s. l. + +; + +18–19 Jul. 1969 + +; +Jens Böcher +leg.; female - +NHMD 918243 +( + +ZMUC + +); male - +NHMD 918257 +( + +ZMUC + +) + +. + + + +Switzerland +• +1 ♀ +; +Neuchâtel +, +Auvernier +; + +16 Aug. 1956 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +2 ♂♂ +; same collection data as for preceding + +26 Aug. 1956 + +; specimens at + +MHNG + + +. • + +1 ♂ +; +Vaud +, +Ferreyres +; + +22 Aug. 1952 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♂ +; +Vaud +, +La Sauge +; + +10 Aug. 1959 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +2 ♂♂ +; same collection data as for preceding + +29 Aug. 1956 + +; specimens at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Lioson + +Sep. 1956 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Marchairuz +; + +21 Jul. 1960 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Sta Catharina +; + +17 Sep. 1955 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. + + + + +Biology. + +Summer species, flying from July to September, peak in July. Seems confined to alpine, arctic or boreal habitats. + + + +Distribution. + + +Finland +(locus + +typicus + +of + +A. petiolata + +: Lapland, Muonio, likely on Finnish side of Muonio River, see remarks), +Germany +(Alps), +Greenland +, +Romania +(locus + +typicus + +of + +A. gracilipes + +: Rarău massif (Eastern Romanian Carpathians) at “ +1,950 m +” altitude according to +Ionescu (1969) +[highest peak according to Wikipedia is at +1651 m +]), +Switzerland +. + + +DNA barcode matches with publicly available sequences from +Canada +(e. g. ABINP 3207-21) and +Norway +(e. g. GWNWG 2160-14). + + +In Central Europe restricted to elevations above +1900 m +a. s. l. but occurring at lower altitudes in arctic and subarctic, boreal landscapes. + + + + +Remarks. + + + +A. petiolata + +( +Zetterstedt, 1838 +, often erroneously cited as Zetterstedt, 1840) was synonymised with + +A. eucharioides + +by +Fergusson (1986) +and was erroneously listed as synonym of + +A. immunis + +in +Mata-Casanova et al. (2018) +. The type locality of + +A. petiolata + +is Muonio, Lapland (in the description: “ Pinetis Lapponiae ad Muonioniska ” ( +Zetterstedt 1838 +)). Muonio is a municipality in present-day +Finland +(belonging to +Russia +at the time of Zetterstedt’s visit), where Zetterstedt visited local entomologist Kolström during his 1821 Lapland journey. The Muoniojoki river, which flows indirectly downstream into the Torne river, marks the border between +Finland +and +Sweden +near the municipality of Muonio and it is unclear whether Zetterstedt crossed it to collect insects from both sides of the river, though he mentions how scary it is to cross the river, making it unlikely that he frequently did so ( +Zetterstedt 1822 +). In conclusion, whether the +lectotype +was collected in modern day +Finland +or +Sweden +is probably impossible to tell and the question itself of minor significance. + + +There are no descriptive labels on the +lectotype +. +Fergusson (1986) +stated that the +lectotype +was held at + +NHRS + +, but it is actually deposited at the + +MZLU + +. The sex of the +lectotype +is difficult to discern, due to the missing antennae and only images available to us. We consider it a male, as the original label shows, though that is in contrast to what +Fergusson (1986) +wrote. Apparently, the specimen was already in a poor condition when Fergusson studied it and he could not reliably identify the sex either. + + +On the primary type of + +A. gracilipes + +: +Mata-Casanova et al. (2018) +cites a +lectotype +of + +A. gracilipes + +as primary type. However, Ionescu specifically mentions a +holotype +in his publication, though without giving unambiguous details about the actual specimen ( +Ionescu 1969 +). The ICZN states in 73.1. 2., that “ If the taxon was established before 2000 evidence derived from outside the work itself may be taken into account [Art. 72.4.1.1] to help identify the specimen. ” The loaned specimen from + +MGAB + +with the Museum ID “ GAL 340 / 9 ” bears the word “ holotip ” on its label, along with information on locality and time that match the description of the type series. The specimen thereby constitutes the +holotype +. + + + +The +holotype +was kept in a vial with ethanol, already damaged, lacking head and wings, legs incomplete. We mounted the specimen on a white pointed card with Shellac Gel glue on the right side of its mesosoma after asking permission from +MGAB +. All coxae are present, fore trochanters and femora present, trochanter and femora of right hind leg mounted separately along with a tibia. The specimen was about +2.8 mm +in body length (measurements on +holotype +combined with proportions from photograph in +Ionescu, 1969 +) and that falls into the average body size of most + + +Anacharis + + +species. + + + +A. petiolata + +is morphologically very similar to + +A. typica + +. The morphological differences are rather subtle differences in colouration and morphological diagnoses for both species are rather weak. Still, we differentiate between the two species based on the distinct difference in CO 1 barcode sequences as well as a difference in habitat +type +/ distribution. All known specimens of + +A. petiolata + +were collected in alpine or boreal environments, specimens of + +A. typica + +were collected in temperate environments below 700 meters above sea level. + + + + + \ No newline at end of file diff --git a/data/42/42/95/4242957258E1580EA53972B9894EA418.xml b/data/42/42/95/4242957258E1580EA53972B9894EA418.xml index a1ed067319f..47c6bf94040 100644 --- a/data/42/42/95/4242957258E1580EA53972B9894EA418.xml +++ b/data/42/42/95/4242957258E1580EA53972B9894EA418.xml @@ -1,119 +1,119 @@ - - - -Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species - - -Author + + +Author -Vogel, Jonathan -0000-0002-7102-0231 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Forshage, Mattias -Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden - - -Author + + +Author -Bartsch, Saskia B. -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Ankermann, Anne -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Mayer, Christoph -0000-0001-5104-6621 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -von Falkenhausen, Pia -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Rduch, Vera -0000-0002-6499-2876 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Müller, Björn -0000-0001-6233-5410 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Braun, Christoph -https://orcid.org/0009-0003-1312-5953 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Krammer, Hans-Joachim -https://orcid.org/0009-0008-7012-1752 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Peters, Ralph S. -0000-0001-7784-9203 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany -text - - -Journal of Hymenoptera Research +text + + +Journal of Hymenoptera Research - -2024 - -2024-08-29 + +2024 + +2024-08-29 - -97 + +97 - -621 -698 + +621 +698 -journal article -10.3897/jhr.97.131350 -EA190992-B01B-4F1B-A362-A4549C725580 +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 - + Anacharis norvegica Mata-Casanova & Pujade-Villar, 2018 @@ -126,47 +126,47 @@ (n = 1). Belongs to the - + A. immunis species group. Similar to - + A. ensifer in generally having a largely sculptured mesoscutellum (largely smooth in - + A. immunis ). Different to - + A. ensifer by having its mesoscutellum covered with reticulate-foveate sculpture resulting in smaller foveae (larger foveae in - + A. ensifer ). The circumscutellar carina is less distinct and not flanged upwards posteriorly (usually distinctly flanged upwards, appearing in lateral view like a posterodorsal tooth in - + A. ensifer and - + A. immunis ). The dorsal margin of the mesopleural line is diffused by rugose sculpture of mesopleuron in its anterior half (dorsally well-defined mesopleural line in its anterior half in - + A. ensifer and - + A. immunis ). Wrinkles on mesoscutum, especially in anteromedian area, strong, making the anteroadmedian signa distinct (less to no wrinkles and thereby less notable anteroadmedian signa in - + A. ensifer and - + A. immunis ). @@ -178,17 +178,19 @@ and Material without DNA barcode. - + Sweden • 1 ♀ ; -Torne -lappmark, -Kiruna +Torne lappmark , -Abisko Nationalpark -, dry sparse alpine downy birch forest; +Kiruna +, +Abisko Nationalpark +, +dry sparse alpine downy birch forest +; 68.3539 ° N , @@ -204,11 +206,8 @@ a. s. l. 21 Jul. - 7 Aug. 2003 ; -Swedish Malaise Trap -Project -( -Swedish Museum of Natural History -) leg.; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; Malaise trap ; @@ -242,7 +241,7 @@ series collected in July and August, as was the specimen studied here. Probably Norway (locus - + typicus : Oppdal), @@ -263,7 +262,7 @@ series). Despite not having had a fresh specimen at hand for sequencing, we regard this species as different from - + A. ensifer due to the clear differences in sculpture of the mesoscutum, mesoscutellum and mesopleuron. diff --git a/data/43/6F/55/436F557EEA2B506C81E385F8FB4C9F0F.xml b/data/43/6F/55/436F557EEA2B506C81E385F8FB4C9F0F.xml index 08fa44d5349..6dbd780b807 100644 --- a/data/43/6F/55/436F557EEA2B506C81E385F8FB4C9F0F.xml +++ b/data/43/6F/55/436F557EEA2B506C81E385F8FB4C9F0F.xml @@ -1,119 +1,119 @@ - - - -Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species - - -Author + + +Author -Vogel, Jonathan -0000-0002-7102-0231 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Forshage, Mattias -Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden - - -Author + + +Author -Bartsch, Saskia B. -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Ankermann, Anne -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Mayer, Christoph -0000-0001-5104-6621 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -von Falkenhausen, Pia -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Rduch, Vera -0000-0002-6499-2876 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Müller, Björn -0000-0001-6233-5410 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Braun, Christoph -https://orcid.org/0009-0003-1312-5953 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Krammer, Hans-Joachim -https://orcid.org/0009-0008-7012-1752 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany - - -Author + + +Author -Peters, Ralph S. -0000-0001-7784-9203 -Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany -text - - -Journal of Hymenoptera Research +text + + +Journal of Hymenoptera Research - -2024 - -2024-08-29 + +2024 + +2024-08-29 - -97 + +97 - -621 -698 + +621 +698 -journal article -10.3897/jhr.97.131350 -EA190992-B01B-4F1B-A362-A4549C725580 +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 - + Anacharis maxima Vogel, Forshage & Peters @@ -136,31 +136,31 @@ Vogel, Forshage & Peters (n = 6, all males). Belongs to the - + eucharioides species group. Large species (3.5–4.0, mean 3.8 mm , unique in Northwestern European fauna). Similar to - + A. eucharioides by having the lateromedial area of the pronotum smooth to rugose (Fig. 13 B , smooth in - + A. minima , - + A. petiolata and - + A. typica , longitudinal carinae in - + A. martinae ). Differing from all other Northwestern European species by its large size (other species usually not larger than @@ -172,15 +172,15 @@ and right, LOL: metacoxa ratio usually> 0.225, if around 0.225, then head frontal height: mesoscutellum length ratio> 1.9 in other Northwestern European species). In the Western Palaearctic fauna, - + A. maxima is most similar to - + A. parapsidalis , mainly due to its size. - + Anacharis parapsidalis was not reported from Northwestern Europe but from @@ -190,33 +190,33 @@ and ( Mata-Casanova et al. 2018 ). - + Anacharis maxima differs from - + A. parapsidalis in its mesoscutellar sculpture (Fig. 13 D , mesoscutellum reticulate-carinate all over mesoscutellum in - + A. parapsidalis ), the lateromedial area of the pronotum is smooth to rugose (Fig. 13 B , reticulate-carinate in - + A. parapsidalis ), the mesopleural line not reaching the posteroventral hypocoxal furrow (Fig. 13 B ) (reaching it in - + A. parapsidalis ) and the presence of punctures on the metasomal tergites (absent in - + A. parapsidalis ). @@ -226,13 +226,16 @@ in its mesoscutellar sculpture (Fig. - + Anacharis maxima sp. nov. , holotype, male ( + ZFMK -- TIS- 2640744) +-TIS-2640744 + +) A lateral habitus B @@ -413,7 +416,7 @@ Unknown. n = 7. Maximum intraspecific distance: 0 %. Minimum distance to closest species ( - + A. eucharioides ): 3.9 %. CO 1 barcode consensus sequence: @@ -425,7 +428,7 @@ n = 7. Maximum intraspecific distance: 0 %. Minimum distance to closest species Type material. - + Holotype @@ -442,8 +445,10 @@ n = 7. Maximum intraspecific distance: 0 %. Minimum distance to closest species , Hausen , -Eisgraben -, basalt depot at forest margin; +Eisgraben +, +basalt depot at forest margin +; 50.5026 ° N , @@ -463,14 +468,15 @@ a. s. l. leg.; Malaise trap ; - -ZFMK - -- TIS- 2640744. + +ZFMK +-TIS-2640744 + +. - + Paratypes @@ -480,54 +486,59 @@ leg.; Germany • 5 ♂♂ -; -Same -collection data as for holotype; - -ZFMK - -- TIS- 2640739, - -ZFMK - -- TIS- 2640740 ( +; Same collection data as for holotype; + +ZFMK +-TIS-2640739 + +, + +ZFMK +-TIS-2640740 + +( ZSM ), - -ZFMK - -- TIS- 2640741 ( + +ZFMK +-TIS-2640741 + +( SMNS ), - -ZFMK - -- TIS- 2640742 ( + +ZFMK +-TIS-2640742 + +( NHMUK ), - -ZFMK - -- TIS- 2640743 ( + +ZFMK +-TIS-2640743 + +( NHRS ) . • - + 1 ♂ ; Rhineland-Palatinate , Vulkaneifel , -Jünkerath -, private garden, wet meadow, right next to ditch; +Jünkerath +, +private garden, wet meadow, right next to ditch +; 50.3343 ° N , @@ -547,10 +558,10 @@ a. s. l. leg.; Malaise trap ; - -ZFMK - -- TIS- 2640676 + +ZFMK +-TIS-2640676 + . @@ -561,11 +572,17 @@ leg.; Without DNA barcode. - + Sweden • 1 ♂ -; Uppland, Norrtälje, Singö; +; +Uppland +, +Norrtälje +, +Singö +; 15 Jul. 1962 @@ -623,7 +640,7 @@ leg.; specimen at Germany (locus - + typicus : @@ -652,36 +669,36 @@ a. s. l. Remarks. - + A. maxima is not frequently collected, though with six specimens caught from one collection event at one site, it seems like it can be locally relatively abundant. The diagnosis against - + A. parapsidalis is based on comparisons with the SEM images and the redescription ( Mata-Casanova et al. 2018 ) as no specimen of - + A. parapsidalis was available to us. The morphometric analysis revealed only little overlap of - + A. maxima with the other species within the - + eucharioides species group (Fig. 8 C left). The lda extractor provided two ratios, which – separately – can almost and – in combination – fully separate - + A. maxima from the remaining species (Fig. @@ -689,15 +706,15 @@ from the remaining species (Fig. , Fig. 8 C right). We included these ratios into the diagnosis of - + A. maxima . For this species, the morphometric analyses proved helpful in finding diagnostic characters. Note that this was not the case in - + A. eucharioides , and only partially in - + A. martinae (see above), highlighting both the morphometric variability and overall similarity of the diff --git a/data/4E/0D/40/4E0D406EFFFA560ABA7CD2ADA7DBC1B2.xml b/data/4E/0D/40/4E0D406EFFFA560ABA7CD2ADA7DBC1B2.xml new file mode 100644 index 00000000000..50e5839b7bd --- /dev/null +++ b/data/4E/0D/40/4E0D406EFFFA560ABA7CD2ADA7DBC1B2.xml @@ -0,0 +1,6347 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis eucharioides +(Dalman, 1818) + + + + + +Figs 2 G +, +3 F +, +10 A – E + + + + + + + +Cynips eucharioides +Dalman, 1818: 78 + + +- +type +lost. + + + + + + +Anacharis tinctus + +Walker, 1835: 520 +- +lectotype +( + +NHMUK + +) +♀ +, synonymised in Fergusson (1968), photographs examined. + + + + + + + + + +Megapelmus spheciformis +Hartig, 1840: 202 + + +(removed from synonymy with + +A. typica + +) - +lectotype +( + +ZSM + +) +♂ +, first synonymised in +Reinhard (1860) +, examined. + + + + + + +Anacharis fergussoni + +Mata-Casanova & Pujade-Villar, 2018: 16 +syn. nov. +- +holotype +( + +CNC + +) +♀ +, photographs examined. + + + + + + + + + +Anacharis eucharoides + +auct., common misspelling. + + + + + + +Diagnosis + + +(n = 290). +Most common species within the + +eucharioides + +species group. Medium sized body (2.7–3.4, mean +3.1 mm +, similar to + +A. typica + +, + +A. petiolata + +& + +A. martinae + +). Differing from + +A. typica + +and + +A. petiolata + +by having a mesoscutellum with a median carina present, which is typically interrupted centrally by reticulation (largely smooth and even in + +A. petiolata + +and + +A. typica + +) (Fig. +10 D +). Differing from + +A. martinae + +by having the lateromedial area of the pronotum smooth to rugose (Fig. +10 B +, with longitudinal carinae that are a continuation of the ventral carinae in + +A. martinae + +). Unique in usually having the mesoscutum glabrous to more sparsely pubescent than the rest of the mesoscutum (Fig. +10 D +, more evenly pubescent in all other species). The male genitalia of + +A. eucharioides + +(Fig. +3 F +) are unique in not being significantly widened basally or medially, i. e. being more parallel-sided (basally or medially widened in all other species Fig. +3 C – E +). + + + + +CO 1 barcode. + + +n = 289. Maximum intraspecific distance = 2.5 %. Minimum distance to closest species ( + +A. petiolata + +) = 2.9 %. CO 1 barcode consensus sequence: + +AATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTTATACCTATTATAGTTGGAGGATTTGGGAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGAGCAGGAACAGGATGAACTGTTTACCCTCCATTA TCCTCCCTAACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAACTTCTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACGATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGAG GAGACCCTATTCTTTATCAACATTTATTT + + + +Type material. + + + +Lectotype +of + +Anacharis tinctus +Walker, 1835 + +, designated by +Fergusson (1986) + + +81 86 [on backside of mounting board] +Type + +B. M. 1981. Under + +tincta + + +LECTO-TYPE + +LECTOTYPE + +Anacharis +tincta +Walker + +det. N. D. M. Fergusson, 1981 + + +B. M. +TYPE +HYM 7.162 + + +[QR code] + +NHMUK + +012858912 + + +[for images, see +https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470209 +] + + + +Lectotype +of + +Megapelmus spheciformis +Hartig, 1840 + +, designated by +Weld (1952) + + +Weld 1931 + + +Megapelmus spheciformis + +[handwritten, probably by Hartig himself] + + +LECTOTYPE +of + +MEGAPELMUS +spheciformis + +det. N. D. M. Fergusson, 1982 + + + +Anacharis eucharoides +Dal. + +det. N. D. M. Fergusson, 1982 + + + +Anacharis eucharioides +(Dalman, 1818) + +♂ +Det. Jonathan Vogel 2024 + + + +Holotype +of + +Anacharis fergussoni +Mata-Casanova & Pujade-Villar, 2018 + + + + + +Germany +• +1 ♀ +; +Rhineland Palatinate +, +Mainz-Bingen +, +Ingelheim am Rhein +, +orchard +; + +1–30 Sep. 1968 + +; +I. Sreffan +leg.; +Malaise trap + +. + + +[for images, see +https://www.cnc.agr.gc.ca/taxonomy/Specimen.php?id=3274133 +] + + + + +Other material examined. + + +DNA barcode voucher + +s. +Belgium +• +1 ♀ +; +East Flanders +, +Assenede +, +Isabellepolder +, +Agricultural land with Partridge mix +; + +51.266 ° N +, +3.71 ° E + +; ca 0 m a. s. l.; + +12–19 Jun. 2019 + +; UGent leg.; +yellow pan trap +; + +ZFMK +-TIS-2640673 + + +. • + +2 ♂♂ +; +West +Flanders +, +Ypres +, +De Triangel +, +Urban park (bushes) +; + +50.8418 ° N +, +2.8838 ° E + +; ca + +20 m +a. s. l. + +; + +30 Apr. - 14 May 2022 + +; +Verheyde +, +Fons +leg.; +Malaise trap +; + +ZFMK +-TIS-2640843 + +, + +ZFMK +-TIS-2640844 + + +. • + +3 ♀♀ +, +9 ♂♂ +; same collection data as for preceding + +14–28 May 2022 + +; females - + +ZFMK +-TIS-2640845 + +, + +ZFMK +-TIS-2640846 + +, + +ZFMK +-TIS-2640847 + +, + +ZFMK +-TIS-2640859 + +, + +ZFMK +-TIS-2640860 + +, + +ZFMK +-TIS-2640861 + +; males - + +ZFMK +-TIS-2640848 + +, + +ZFMK +-TIS-2640849 + +, + +ZFMK +-TIS-2640850 + +, + +ZFMK +-TIS-2640851 + +, + +ZFMK +-TIS-2640852 + +, + +ZFMK +-TIS-2640853 + +, + +ZFMK +-TIS-2640854 + +, + +ZFMK +-TIS-2640855 + +, + +ZFMK +-TIS-2640856 + +, + +ZFMK +-TIS-2640862 + +, + +ZFMK +-TIS-2640863 + + +. • + +1 ♂ +; same collection data as for preceding + +2–23 Jul. 2022 + +; + +ZFMK +-TIS-2640868 + + +. • + +3 ♀♀ +, +2 ♂♂ +; +West +Flanders +, +Ypres +, +De Triangel +, +Urban park (pool vegetation) +; + +50.8427 ° N +, +2.884 ° E + +; ca + +20 m +a. s. l. + +; + +14–28 May 2022 + +; +Verheyde +, +Fons +leg.; +Malaise trap +; females - + +ZFMK +-TIS-2640859 + +, + +ZFMK +-TIS-2640860 + +, + +ZFMK +-TIS-2640861 + +; males - + +ZFMK +-TIS-2640862 + +, + +ZFMK +-TIS-2640863 + + +. + + + +Germany +• +1 ♂ +; +Baden-Württemberg +, +Biberach +, +Altheim +; + +48.1399 ° N +, +9.4491 ° E + +; ca + +540 m +a. s. l. + +; + +6–19 Aug. 2013 + +; +Schmalfuß, H. +leg.; +Malaise trap +; + +ZFMK +-TIS-2629512 + + +. • + +2 ♀♀ +, +8 ♂♂ +; +Baden-Württemberg +, +Karlsruhe +, +Malsch +, +Hansjakobstraße +, +garden +; + +48.8835 ° N +, +8.3197 ° E + +; ca + +120 m +a. s. l. + +; + +26 Apr. - 10 May 2020 + +; +Dieter Doczkal +leg.; +Malaise trap +; females - + +ZFMK +-TIS-2640753 + +, + +ZFMK +-TIS-2640754 + +; males - + +ZFMK +-TIS-2640745 + +, + +ZFMK +-TIS-2640746 + +, + +ZFMK +-TIS-2640747 + +, + +ZFMK +-TIS-2640748 + +, + +ZFMK +-TIS-2640749 + +, + +ZFMK +-TIS-2640750 + +, + +ZFMK +-TIS-2640751 + +, + +ZFMK +-TIS-2640752 + + +. • + +1 ♂ +; same collection data as for preceding + +25 Oct. - 8 Nov. 2020 + +; + +ZFMK +-TIS-2640726 + + +. • + +11 ♀♀ +, +1 ♂ +; +Baden-Württemberg +, +Stuttgart +, +Espan +; + +49.6167 ° N +, +9.2667 ° E + +; ca + +280 m +a. s. l. + +; + +28 Jul. - 28 Aug. 2014 + +; +Woog, F. +leg.; females - + +ZFMK +-TIS-2640775 + +, + +ZFMK +-TIS-2640776 + +, + +ZFMK +-TIS-2640777 + +, + +ZFMK +-TIS-2640778 + +, + +ZFMK +-TIS-2640779 + +, + +ZFMK +-TIS-2640780 + +, + +ZFMK +-TIS-2640781 + +, + +ZFMK +-TIS-2640782 + +, + +ZFMK +-TIS-2640783 + +, + +ZFMK +-TIS-2640784 + +, + +ZFMK +-TIS-2640785 + +; male - + +ZFMK +-TIS-2640786 + + +. • + +1 ♀ +, +10 ♂♂ +; +Baden-Württemberg +, +Tübingen +, +Hirschau +, +Oberes Tal +, +orchard +; + +48.505 ° N +, +8.993 ° E + +; ca + +390 m +a. s. l. + +; + +29 Apr. - 13 May 2014 + +; +Kothe, T. +, +Engelhardt, M. +, +Bartsch, D. +leg.; +Malaise trap +; female - + +ZFMK +-TIS-2629263 + +; males - + +ZFMK +-TIS-2629200 + +, + +ZFMK +-TIS-2629201 + +, + +ZFMK +-TIS-2629202 + +, + +ZFMK +-TIS-2629203 + +, + +ZFMK +-TIS-2629204 + +, + +ZFMK +-TIS-2629218 + +, + +ZFMK +-TIS-2629540 + +, + +ZFMK +-TIS-2629541 + +, + +ZFMK +-TIS-2629542 + +, + +ZFMK +-TIS-2640774 + + +. • + +1 ♂ +; +Baden-Württemberg +, +Tübingen +, +Hirschau +, +Oberes Tal +, +orchard +; + +48.505 ° N +, +8.9935 ° E + +; ca + +370 m +a. s. l. + +; + +23 May- 6 Jun. 2014 + +; +Kothe, T. +, +Engelhardt, M. +, +Bartsch, D. +leg.; +Malaise trap +; + +ZFMK +-TIS-2628235 + + +. • + +3 ♀♀ +; +Baden-Württemberg +, +Tübingen +, +Hirschau +, +Wiesenweingärten +; + +48.5043 ° N +, +8.9956 ° E + +; ca + +380 m +a. s. l. + +; + +17–31 Jul. 2014 + +; +Kothe, T. +, +Engeldhardt, M. +, +König, C. +leg.; +Malaise trap +; + +ZFMK +-TIS-2629238 + +, + +ZFMK +-TIS-2629267 + +, + +ZFMK +-TIS-2629268 + + +. • + +1 ♀ +; +Baden-Württemberg +, +Tübingen +, +Steinenberg +; + +48.5306 ° N +, +9.0312 ° E + +; ca + +470 m +a. s. l. + +; + +31 Jul. - 14 Aug. 2014 + +; +Kothe, T. +, +Engeldhardt, M. +, +König, C. +leg.; +Malaise trap +; + +ZFMK +-TIS-2629237 + + +. • + +4 ♀♀ +; +Baden-Württemberg +, +Tübingen +, +Steinenberg +; + +48.5313 ° N +, +9.03 ° E + +; ca + +490 m +a. s. l. + +; + +4–17 Jul. 2014 + +; +Kothe, T. +, +Engelhardt, M. +, +König, Ch. +leg.; + +ZFMK +-TIS-2629504 + +, + +ZFMK +-TIS-2629505 + +, + +ZFMK +-TIS-2629506 + +, + +ZFMK +-TIS-2629507 + + +. • + +1 ♀ +, +1 ♂ +; +Baden-Württemberg +, +Tübingen +, +Steinenbergturm +; + +48.531 ° N +, +9.03 ° E + +; ca + +490 m +a. s. l. + +; + +14–29 Aug. 2014 + +; +Kothe, T. +, +Engeldhardt, M. +, +König, C. +leg.; +Malaise trap +; female - + +ZFMK +-TIS-2629236 + +; male - + +ZFMK +-TIS-2629219 + + +. • + +1 ♂ +; +Baden-Württemberg +, +Tübingen +, +Wurmlingen +, +Gengental +, +orchard +; + +48.5131 ° N +, +8.9923 ° E + +; ca + +370 m +a. s. l. + +; + +13–23 May 2014 + +; +Kothe, T. +, +Engeldhardt, M. +, +König, C. +leg.; +Malaise trap +; + +ZFMK +-TIS-2640681 + + +. • + +1 ♀ +, +1 ♂ +; +Bavaria +, +Main-Spessart +, +Lohr +, +Nat. res. Romberg +, +pasture woodland +; + +49.9864 ° N +, +9.5896 ° E + +; ca + +190 m +a. s. l. + +; + +9 Jun. - 6 Jul. 2018 + +; +Dieter Doczkal +leg.; +Malaise trap +; female - + +ZFMK +-TIS-2640717 + +; male - + +ZFMK +-TIS-2640716 + + +. • + +1 ♂ +; +Bavaria +, +Rhön-Grabfeld +, +Fladungen +, +Nat. res. Schwarzes Moor +, +Karpatenbirkenwald +; + +50.5117 ° N +, +10.071 ° E + +; ca + +780 m +a. s. l. + +; + +26 Jun. - 18 Jul. 2017 + +; +Dieter Doczkal +leg.; +Malaise trap +; + +ZFMK +-TIS-2629538 + + +. • + +2 ♀♀ +; +Hesse +, +Gießen +, +Nat. res. Holzwäldchen bei Gleiberg +; + +50.605 ° N +, +8.6316 ° E + +; ca + +190 m +a. s. l. + +; + +14 Jun. 2021 + +; +GBOL +III leg.; +sweep net +; + +ZFMK +-TIS-2629494 + +, + +ZFMK +-TIS-2629495 + + +. • + +1 ♀ +; +Hesse +, +Kassel +, +Nat. res., „ Fuldaschleuse Wolfsanger “ +, +meadow along Fulda river with Salix and Phragmites +; + +51.329 ° N +, +9.5565 ° E + +; ca + +130 m +a. s. l. + +; + +13–27 Oct. 2020 + +; + +GBOL +III + +leg.; +sweep net +; +Loc. +1; + +ZFMK +-TIS-2628230 + + +. • + +3 ♀♀ +; +Hesse +, +Rheingau-Taunus +, +Lorch am Rhein +, +above Nollig castle +; + +50.0491 ° N +, +7.7978 ° E + +; ca + +240 m +a. s. l. + +; + +27 May- 7 Jun. 2013 + +; +Niehuis +, +Oliver +leg.; +Malaise trap +; MF 1; + +ZFMK +-TIS-2629498 + +, + +ZFMK +-TIS-2629499 + +, + +ZFMK +-TIS-2629500 + + +. • + +1 ♀ +, +1 ♂ +; same collection data as for preceding + +17–25 Jun. 2015 + +; MF 4; female - + +ZFMK +-TIS-2629248 + +; male - + +ZFMK +-TIS-2629214 + + +. • + +8 ♂♂ +; same collection data as for preceding + +15–21 Jul. 2013 + +; MF 1; + +ZFMK +-TIS-2629227 + +, + +ZFMK +-TIS-2629240 + +, + +ZFMK +-TIS-2629241 + +, + +ZFMK +-TIS-2629521 + +, + +ZFMK +-TIS-2629522 + +, + +ZFMK +-TIS-2629523 + +, + +ZFMK +-TIS-2629524 + +, + +ZFMK +-TIS-2629525 + + +. • + +20 ♂♂ +; same collection data as for preceding + +21–27 Jul. 2013 + +; + +ZFMK +-TIS-2629225 + +, + +ZFMK +-TIS-2629226 + +, + +ZFMK +-TIS-2629553 + +, + +ZFMK +-TIS-2629554 + +, + +ZFMK +-TIS-2629555 + +, + +ZFMK +-TIS-2629556 + +, + +ZFMK +-TIS-2629557 + +, + +ZFMK +-TIS-2629558 + +, + +ZFMK +-TIS-2629559 + +, + +ZFMK +-TIS-2629560 + +, + +ZFMK +-TIS-2629576 + +, + +ZFMK +-TIS-2629577 + +, + +ZFMK +-TIS-2640820 + +, + +ZFMK +-TIS-2640821 + +, + +ZFMK +-TIS-2640822 + +, + +ZFMK +-TIS-2640823 + +, + +ZFMK +-TIS-2640824 + +, + +ZFMK +-TIS-2640825 + +, + +ZFMK +-TIS-2640826 + +, + +ZFMK +-TIS-2640827 + + +. • + +1 ♀ +; +Hesse +, +Rheingau-Taunus +, +Lorch am Rhein +, +above Nollig castle +; + +50.0495 ° N +, +7.7966 ° E + +; ca + +250 m +a. s. l. + +; + +12–17 Jun. 2015 + +; +Niehuis +, +Oliver +leg.; +Malaise trap +; MF 3; + +ZFMK +-TIS-2629252 + + +. • + +3 ♂♂ +; same collection data as for preceding + +17–25 Jun. 2015 + +; + +ZFMK +-TIS-2628232 + +, + +ZFMK +-TIS-2629212 + +, + +ZFMK +-TIS-2629213 + + +. • + +1 ♀ +; +Hesse +, +Rheingau-Taunus +, +Lorch am Rhein +, +above Nollig castle +; + +50.0498 ° N +, +7.7974 ° E + +; ca + +260 m +a. s. l. + +; + +27 May- 7 Jun. 2013 + +; +Niehuis +, +Oliver +leg.; +Malaise trap +; MF 2; + +ZFMK +-TIS-2629266 + + +. • + +2 ♀♀ +; same collection data as for preceding + +7–15 Jun. 2013 + +; + +ZFMK +-TIS-2628233 + +, + +ZFMK +-TIS-2629250 + + +. • + +5 ♀♀ +; same collection data as for preceding + +15–23 Jun. 2013 + +; + +ZFMK +-TIS-2629269 + +, + +ZFMK +-TIS-2629270 + +, + +ZFMK +-TIS-2629271 + +, + +ZFMK +-TIS-2629501 + +, + +ZFMK +-TIS-2629502 + + +. • + +7 ♂♂ +; same collection data as for preceding + +15–21 Jul. 2013 + +; + +ZFMK +-TIS-2629513 + +, + +ZFMK +-TIS-2629515 + +, + +ZFMK +-TIS-2629550 + +, + +ZFMK +-TIS-2629551 + +, + +ZFMK +-TIS-2629552 + +, + +ZFMK +-TIS-2640710 + +, + +ZFMK +-TIS-2640711 + + +. • + +12 ♂♂ +; same collection data as for preceding + +21–27 Jul. 2013 + +; + +ZFMK +-TIS-2629243 + +, + +ZFMK +-TIS-2629244 + +, + +ZFMK +-TIS-2629245 + +, + +ZFMK +-TIS-2629246 + +, + +ZFMK +-TIS-2629496 + +, + +ZFMK +-TIS-2629497 + +, + +ZFMK +-TIS-2629527 + +, + +ZFMK +-TIS-2629528 + +, + +ZFMK +-TIS-2629529 + +, + +ZFMK +-TIS-2629530 + +, + +ZFMK +-TIS-2629531 + +, + +ZFMK +-TIS-2629532 + + +. • + +1 ♀ +, +1 ♂ +; +Hesse +, +Waldeck-Frankenberg +, +National park Kellerwald-Edersee +, +Banfehaus +, +old floodplain of the Banfe +; + +51.167 ° N +, +8.9749 ° E + +; ca + +270 m +a. s. l. + +; + +22 Jul. - 5 Aug. 2021 + +; + +GBOL +III + +leg.; +Malaise trap (Krefeld version) +; female - + +ZFMK +-TIS-2640790 + +; male - + +ZFMK +-TIS-2640792 + + +. • + +2 ♀♀ +; +Hesse +, +Waldeck-Frankenberg +, +National park Kellerwald-Edersee +, +Maierwiesen +; + +51.1555 ° N +, +9.0015 ° E + +; ca + +370 m +a. s. l. + +; + +22 Jun. - 8 Jul. 2021 + +; +GBOL +III leg.; +Malaise trap +( +Krefeld +version); + +ZFMK +-TIS-2640807 + +, + +ZFMK +-TIS-2640808 + + +. • + +9 ♀♀ +, +1 ♂ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee, „ Banfe-Haus “ +; + +51.167 ° N +, +8.9749 ° E + +; ca + +270 m +a. s. l. + +; + +7–21 Jul. 2022 + +; +GBOL +III leg.; +Malaise trap +; females - + +ZFMK +-TIS-2640761 + +, + +ZFMK +-TIS-2640762 + +, + +ZFMK +-TIS-2640763 + +, + +ZFMK +-TIS-2640764 + +, + +ZFMK +-TIS-2640765 + +, + +ZFMK +-TIS-2640766 + +, + +ZFMK +-TIS-2640767 + +, + +ZFMK +-TIS-2640768 + +, + +ZFMK +-TIS-2640769 + +; male - + +ZFMK +-TIS-2640755 + + +. • + +1 ♀ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Kleiner Mehlberg +“; + +51.2105 ° N +, +9.042 ° E + +; ca + +360 m +a. s. l. + +; + +30 Sep. - 14 Oct. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640610 + + +. • + +1 ♂ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Maierwiesen +“; + +51.1555 ° N +, +9.0015 ° E + +; ca + +370 m +a. s. l. + +; + +8–22 Jul. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640732 + + +. • + +1 ♀ +; +Lower Saxony +, +Lüchow-Dannenberg +, +Pevestorf +, +Deichvorland & Deich +; + +53.0636 ° N +, +11.4742 ° E + +; ca + +20 m +a. s. l. + +; + +6–10 Aug. 2013 + +; +Krogmann +, +Lars +leg.; +Malaise trap +; + +ZFMK +-TIS-2629251 + + +. • + +1 ♀ +, +3 ♂♂ +; +North Rhine-Westphalia +, +Bonn +, +Garden of Museum Koenig +, Various habitats; + +50.7215 ° N +, +7.1137 ° E + +; ca + +70 m +a. s. l. + +; + +4 Jul. 2022 + +; +Schwingeler +, +Josefine +, +Jonathan Vogel +leg.; +sweep net +; female - + +ZFMK +-TIS-2640738 + +; males - + +ZFMK +-TIS-2640735 + +, + +ZFMK +-TIS-2640736 + +, + +ZFMK +-TIS-2640737 + + +. • + +2 ♀♀ +; +North Rhine-Westphalia +, +Bonn +, +Museum Koenig +, +garden +; + +50.7214 ° N +, +7.1139 ° E + +; ca + +70 m +a. s. l. + +; + +4 Oct. 2022 + +; +Salden +, +Tobias +leg.; +sweep net +; + +ZFMK +-TIS-2635303 + +, + +ZFMK +-TIS-2635304 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Borken +, +Borken +, +spinach field with flower strip +; + +51.8078 ° N +, +6.8324 ° E + +; ca + +60 m +a. s. l. + +; + +2–9 Aug. 2016 + +; +Schwarz +et al. leg.; +Malaise trap +; + +ZFMK +-TIS-2629284 + + +. • + +1 ♂ +; +North Rhine-Westphalia +, +Delbrück +, +Delbrück +, +Nat. res. „ Steinhorster Becken “ +; + +51.8217 ° N +, +8.542 ° E + +; ca + +90 m +a. s. l. + +; + +22 Jul. - 5 Aug. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640677 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Paderborn +, +Delbrück +, +Nat. res. „ Erdgarten-Lauerwiesen “ +, +alder carr surrounded by wet meadows, ponds, muddy, geese +; + +51.7989 ° N +, +8.6582 ° E + +; ca + +110 m +a. s. l. + +; + +31 Aug. - 14 Sep. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640674 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Paderborn +, +Delbrück +, +Nat. res. „ Steinhorster Becken “ +; + +51.82 ° N +, +8.5409 ° E + +; ca + +90 m +a. s. l. + +; + +19 Aug. - 2 Sep. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640692 + + +. • + +1 ♀ +, +1 ♂ +; same collection data as for preceding + +2–16 Sep. 2021 + +; female - + +ZFMK +-TIS-2640715 + +; male - + +ZFMK +-TIS-2640714 + + +. • + +1 ♀ +, +4 ♂♂ +; same collection data as for preceding + +16–30 Sep. 2021 + +; female - + +ZFMK +-TIS-2640803 + +; males - + +ZFMK +-TIS-2640799 + +, + +ZFMK +-TIS-2640800 + +, + +ZFMK +-TIS-2640801 + +, + +ZFMK +-TIS-2640802 + + +. • + +9 ♂♂ +; same collection data as for preceding + +30 Sep. - 14 Oct. 2021 + +; + +ZFMK +-TIS-2640810 + +, + +ZFMK +-TIS-2640811 + +, + +ZFMK +-TIS-2640812 + +, + +ZFMK +-TIS-2640813 + +, + +ZFMK +-TIS-2640814 + +, + +ZFMK +-TIS-2640815 + +, + +ZFMK +-TIS-2640816 + +, + +ZFMK +-TIS-2640817 + +, + +ZFMK +-TIS-2640818 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Paderborn +, +Delbrück +, +Nat. res. „ Steinhorster Becken “ +; + +51.8252 ° N +, +8.5359 ° E + +; ca + +90 m +a. s. l. + +; + +19 Aug. - 2 Sep. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640693 + + +. • + +6 ♂♂ +; same collection data as for preceding + +2–16 Sep. 2021 + +; + +ZFMK +-TIS-2640793 + +, + +ZFMK +-TIS-2640794 + +, + +ZFMK +-TIS-2640795 + +, + +ZFMK +-TIS-2640796 + +, + +ZFMK +-TIS-2640797 + +, + +ZFMK +-TIS-2640798 + + +. • + +4 ♂♂ +; same collection data as for preceding + +16–30 Sep. 2021 + +; + +ZFMK +-TIS-2640727 + +, + +ZFMK +-TIS-2640728 + +, + +ZFMK +-TIS-2640729 + +, + +ZFMK +-TIS-2640730 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Oberdrees +, +Buschfeld +; + +50.6371 ° N +, +6.9157 ° E + +; ca + +160 m +a. s. l. + +; + +28 May- 6 Jun. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640679 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Schladern near Windeck +, +Sieg river +, +right river bank +; + +50.8 ° N +, +7.585 ° E + +; ca + +130 m +a. s. l. + +; + +30 May- 6 Jun. 2017 + +; + +ZFMK + +et al. leg.; +Malaise trap +; + +ZFMK +-TIS-2628234 + + +. • + +1 ♀ +; same collection data as for preceding + +6–13 Jun. 2017 + +; + +ZFMK +-TIS-2629239 + + +. • + +1 ♀ +; same collection data as for preceding + +13–20 Jun. 2017 + +; + +ZFMK +-TIS-2629262 + + +. • + +4 ♀♀ +; same collection data as for preceding + +20–27 Jun. 2017 + +; + +ZFMK +-TIS-2629279 + +, + +ZFMK +-TIS-2629280 + +, + +ZFMK +-TIS-2629281 + +, + +ZFMK +-TIS-2629282 + + +. • + +2 ♀♀ +; same collection data as for preceding + +27 Jun. - 4 Jul. 2017 + +; + +ZFMK +-TIS-2629260 + +, + +ZFMK +-TIS-2629261 + + +. • + +3 ♀♀ +; same collection data as for preceding + +4–11 Jul. 2017 + +; + +ZFMK +-TIS-2629264 + +, + +ZFMK +-TIS-2629275 + +, + +ZFMK +-TIS-2629277 + + +. • + +10 ♀♀ +, +23 ♂♂ +; same collection data as for preceding + +18–25 Jul. 2017 + +; females - + +ZFMK +-TIS-2629290 + +, + +ZFMK +-TIS-2629292 + +, + +ZFMK +-TIS-2629487 + +, + +ZFMK +-TIS-2629488 + +, + +ZFMK +-TIS-2629489 + +, + +ZFMK +-TIS-2629490 + +, + +ZFMK +-TIS-2629508 + +, + +ZFMK +-TIS-2629561 + +, + +ZFMK +-TIS-2629562 + +, + +ZFMK +-TIS-2629563 + +; males - + +ZFMK +-TIS-2629217 + +, + +ZFMK +-TIS-2629247 + +, + +ZFMK +-TIS-2629265 + +, + +ZFMK +-TIS-2629286 + +, + +ZFMK +-TIS-2629287 + +, + +ZFMK +-TIS-2629288 + +, + +ZFMK +-TIS-2629291 + +, + +ZFMK +-TIS-2629293 + +, + +ZFMK +-TIS-2629294 + +, + +ZFMK +-TIS-2629486 + +, + +ZFMK +-TIS-2629492 + +, + +ZFMK +-TIS-2629510 + +, + +ZFMK +-TIS-2629511 + +, + +ZFMK +-TIS-2629518 + +, + +ZFMK +-TIS-2629519 + +, + +ZFMK +-TIS-2629520 + +, + +ZFMK +-TIS-2629564 + +, + +ZFMK +-TIS-2629565 + +, + +ZFMK +-TIS-2629566 + +, + +ZFMK +-TIS-2629567 + +, + +ZFMK +-TIS-2629569 + +, + +ZFMK +-TIS-2629570 + +, + +ZFMK +-TIS-2629571 + + +. • + +7 ♀♀ +, +19 ♂♂ +; same collection data as for preceding + +1–8 Aug. 2017 + +; females - + +ZFMK +-TIS-2629253 + +, + +ZFMK +-TIS-2629254 + +, + +ZFMK +-TIS-2629255 + +, + +ZFMK +-TIS-2629256 + +, + +ZFMK +-TIS-2629257 + +, + +ZFMK +-TIS-2629258 + +, + +ZFMK +-TIS-2629259 + +; males - + +ZFMK +-TIS-2629215 + +, + +ZFMK +-TIS-2629224 + +, + +ZFMK +-TIS-2629228 + +, + +ZFMK +-TIS-2629231 + +, + +ZFMK +-TIS-2629232 + +, + +ZFMK +-TIS-2629233 + +, + +ZFMK +-TIS-2629234 + +, + +ZFMK +-TIS-2629235 + +, + +ZFMK +-TIS-2629543 + +, + +ZFMK +-TIS-2629544 + +, + +ZFMK +-TIS-2629545 + +, + +ZFMK +-TIS-2629546 + +, + +ZFMK +-TIS-2629547 + +, + +ZFMK +-TIS-2629548 + +, + +ZFMK +-TIS-2629549 + +, + +ZFMK +-TIS-2629572 + +, + +ZFMK +-TIS-2629573 + +, + +ZFMK +-TIS-2629574 + +, + +ZFMK +-TIS-2629575 + + +. • + +2 ♂♂ +; same collection data as for preceding + +15–30 Aug. 2017 + +; + +ZFMK +-TIS-2629220 + +, + +ZFMK +-TIS-2640675 + + +. • + +1 ♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +; + +50.4679 ° N +, +7.2223 ° E + +; ca + +330 m +a. s. l. + +; + +12–27 Jul. 2022 + +; +Jaume-Schinkel +, +Santiago +leg.; +Gressit Malaise trap +; + +ZFMK +-TIS-2640672 + + +. • + +1 ♀ +, +1 ♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +dry grassland +; + +50.4647 ° N +, +7.2222 ° E + +; ca + +320 m +a. s. l. + +; + +14–20 Jul. 2017 + +; + +ZFMK + +et al. leg.; +Malaise trap +; MF 5; female - + +ZFMK +-TIS-2629509 + +; male - + +ZFMK +-TIS-2629516 + + +. • + +1 ♀ +; +Rhineland-Palatinate +, +Alzey-Worms +, +Wine fields north of Monsheim +, +shrub islands between wine fields, mostly poplars +; + +49.6406 ° N +, +8.2137 ° E + +; ca + +150 m +a. s. l. + +; + +5–24 Aug. 2021 + +; +Gilgenbach +, +Carolin +leg.; +Malaise trap +; + +ZFMK +-TIS-2640678 + + +. • + +1 ♂ +; +Rhineland-Palatinate +, +Cochem +, +Nat. res. Brauselay +; + +50.1421 ° N +, +7.1881 ° E + +; ca + +120 m +a. s. l. + +; + +29 May 2020 + +; DINA leg.; +Malaise trap +; + +ZFMK +-TIS-2629216 + +( +EVK +) + +. • + +1 ♀ +; +Saarland +, +Neunkirchen +, +Schiffweiler +, +Landsweiler-Reden +, +Höfertal +; + +50.0767 ° N +, +7.3283 ° E + +; ca + +370 m +a. s. l. + +; + +18 Jun. 2022 + +; + +AK +Diptera + +leg.; +sweep net +; + +ZFMK +-TIS-2640838 + + +. • + +1 ♂ +; +Saarland +, +Saarpfalz +, +Gersheim +; + +49.31 ° N +, +8.1683 ° E + +; ca + +140 m +a. s. l. + +; + +19 Jun. 2022 + +; + +AK +Diptera + +leg.; +sweep net +; + +ZFMK +-TIS-2640839 + + +. • + +2 ♂♂ +; +Schleswig-Holstein +, +Nordfriesland +, +Nat. res. Luetjenholmer Heidedünen +; + +54.6963 ° N +, +9.0643 ° E + +; ca 0 m a. s. l.; + +29 May 2020 + +; DINA leg.; +Malaise trap +; + +ZFMK +-TIS-2629229 + +( +EVK +), + +ZFMK +-TIS-2629230 + +( +EVK +) + +. + + + +Lithuania +• +1 ♀ +; +Silute distr. +, +Sysa +, +Sysa +, +control plot +; + +55.3127 ° N +, +21.4049 ° E + +; ca 0 m a. s. l.; + +15–25 Jul. 2020 + +; +Petrasiunas +, +Andrius +leg.; +Malaise trap +; + +ZFMK +-TIS-2637713 + + +. + + + +The Netherlands +• +1 ♂ +; +Noord-Holland +, +Amsterdam +, +Vondelpark +; + +52.3581 ° N +, +4.8681 ° E + +; ca 0 m a. s. l.; + +3–12 Jun. 2019 + +; +Taxon Expeditions Team +leg.; +Malaise trap +; + +ZFMK +-TIS-2640687 + + +. • + +2 ♀♀ +, +1 ♂ +; same collection data as for preceding + +12–15 Jun. 2019 + +; females - + +ZFMK +-TIS-2640718 + +, + +ZFMK +-TIS-2640719 + +; male - + +ZFMK +-TIS-2640720 + + +. • + +1 ♂ +; same collection data as for preceding + +21–25 Jun. 2019 + +; + +ZFMK +-TIS-2640689 + + +. • + +1 ♀ +; same collection data as for preceding + +19–27 Jul. 2019 + + +. • + +2 ♀♀ +, +1 ♂ +; same collection data as for preceding + +7 Aug. 2019 + +; females - + +ZFMK +-TIS-2640721 + +, + +ZFMK +-TIS-2640722 + +; male - + +ZFMK +-TIS-2640723 + + +. • + +2 ♂♂ +; +Noord-Holland +, +Amsterdam +, +Vondelpark +, +Urban park +; + +52.356 ° N +, +4.861 ° E + +; ca 0 m a. s. l.; + +19–27 Jul. 2019 + +; +Taxon Expeditions +( +M. Schilthuizen +) leg.; +Malaise trap +; + +ZFMK +-TIS-2640841 + +, + +ZFMK +-TIS-2640842 + + +. • + +1 ♀ +; same collection data as for preceding 2019; + +ZFMK +-TIS-2640840 + + +. + + + +Norway +• +1 ♂ +; +Rogaland Ytre +, +Finnøy +, +Nordre Vignes +; + +59.1679 ° N +, +5.7883 ° E + +; ca + +10 m +a. s. l. + +; + +22 Sep. - 1 Nov. 2020 + +; +Tengesdal +, +Gaute +leg.; +Malaise trap +; + +ZFMK +-TIS-2640680 + + +. + + +Material without DNA barcode. + +Belgium +• +1 ♂ +; +Walloon Brabant +, +Ottignies +; + +3–10 Sep. 1983 + +; +Paul Dessart +leg.; +Malaise trap +; +JV_Prel_0057 +( +RBINS +) + +. • + +1 ♀ +, +1 ♂ +; +Walloon Region +, +Luik +, +Wanze +, +Antheit +( +Corphalie +); + +50.5363 ° N +, +5.2515 ° E + +; ca + +110 m +a. s. l. + +; + +14–28 Jul. 1989 + +; +R. Detry +leg.; +Malaise trap +; + +ZFMK +-HYM-00039669 + +, +JV_Prel_0044 +( +RBINS +) + +. • + +1 ♂ +; same collection data as for preceding + +28 Jul. - 11 Aug. 1989 + +; +JV_Prel_0054 +( +RBINS +) + +. • + +1 ♀ +, +1 ♂ +; +West Flanders +, +Oostkamp +, +Private garden +; + +51.168 ° N +, +3.276 ° E + +; ca 0 m a. s. l.; + +16–30 Aug. 2020 + +; +Arnout Zwaenepoel +leg.; +Malaise trap +; female - + +ZFMK +-TIS-2640697 + +; male - + +ZFMK +-TIS-2640696 + + +. • + +1 ♂ +; +West +Flanders +, +Snellegem +, +Vloethembos +; + +9 Jun. 1983 + +; +P. Grootaert +leg.; +hand caught +; +JV_Prel_0059 +( +RBINS +) + +. • + +1 ♀ +; +West +Flanders +, +Ypres +, +De Triangel +, +Urban park (bushes) +; + +50.8418 ° N +, +2.8838 ° E + +; ca + +20 m +a. s. l. + +; + +28 May- 18 Jun. 2022 + +; +Fons Verheyde +leg.; +Malaise trap +; +JV_Prel_0058 +( +RBINS +) + +. • + +1 ♀ +; same collection data as for preceding + +20 Aug. - 3 Sep. 2022 + +; +JV_Prel_0053 +( +RBINS +) + +. • + +1 ♀ +; same collection data as for preceding + +17 Sep. - 1 Oct. 2022 + +; +JV_Prel_0055 +( +RBINS +) + +. • + +15 ♀♀ +, +8 ♂♂ +; +West Flanders +, +Ypres +, +De Triangel +, +Urban park (pool vegetation) +; + +50.8427 ° N +, +2.884 ° E + +; ca + +20 m +a. s. l. + +; + +6–20 Aug. 2022 + +; +Fons Verheyde +leg.; +Malaise trap +; females - +JV_Prel_0111 +( +RBINS +), +JV_Prel_0112 +( +RBINS +), +JV_Prel_0113 +( +RBINS +), +JV_Prel_0114 +( +RBINS +), +JV_Prel_0115 +( +RBINS +), +JV_Prel_0116 +( +RBINS +), +JV_Prel_0117 +( +RBINS +), +JV_Prel_0118 +( +RBINS +), +JV_Prel_0119 +( +RBINS +), +JV_Prel_0120 +( +RBINS +), +JV_Prel_0121 +( +RBINS +), +JV_Prel_0122 +( +RBINS +), +JV_Prel_0123 +( +RBINS +), +JV_Prel_0124 +( +RBINS +), +JV_Prel_0125 +( +RBINS +); males - +JV_Prel_0103 +( +RBINS +, +JV_Prel_0104 +( +RBINS +), +JV_Prel_0105 +( +RBINS +), +JV_Prel_0106 +( +RBINS +), +JV_Prel_0107 +( +RBINS +), +JV_Prel_0108 +( +RBINS +), +JV_Prel_0109 +( +RBINS +), +JV_Prel_0110 +( +RBINS +) + +. • + +8 ♀♀ +, +10 ♂♂ +; same collection data as for preceding + +20 Aug. - 3 Sep. 2022 + +; females - +JV_Prel_0095 +( +RBINS +), +JV_Prel_0096 +( +RBINS +), +JV_Prel_0097 +( +RBINS +), +JV_Prel_0098 +( +RBINS +), +JV_Prel_0099 +( +RBINS +), +JV_Prel_0100 +( +RBINS +), +JV_Prel_0101 +( +RBINS +), +JV_Prel_0102 +( +RBINS +); males - +JV_Prel_0085 +( +RBINS +), +JV_Prel_0086 +( +RBINS +), +JV_Prel_0087 +( +RBINS +), +JV_Prel_0088 +( +RBINS +), +JV_Prel_0089 +( +RBINS +), +JV_Prel_0090 +( +RBINS +), +JV_Prel_0091 +( +RBINS +), +JV_Prel_0092 +( +RBINS +), +JV_Prel_0093 +( +RBINS +), +JV_Prel_0094 +( +RBINS +) + +. • + +5 ♀♀ +, +9 ♂♂ +; same collection data as for preceding + +3–17 Sep. 2022 + +; females - +JV_Prel_0068 +( +RBINS +), +JV_Prel_0069 +( +RBINS +), +JV_Prel_0070 +( +RBINS +), +JV_Prel_0071 +( +RBINS +), +JV_Prel_0072 +( +RBINS +); males - +JV_Prel_0061 +( +RBINS +), +JV_Prel_0062 +( +RBINS +), +JV_Prel_0063 +( +RBINS +), +JV_Prel_0064 +( +RBINS +), +JV_Prel_0065 +( +RBINS +), +JV_Prel_0066 +( +RBINS +), +JV_Prel_0067 +( +RBINS +), + +ZFMK +-HYM-00039673 + +, + +ZFMK +-HYM-00039672 + + +. + + + +Denmark +• +4 ♂♂ +; +Southern Jutland +, +Rømø +; + +24 Sep. 2000 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023146 +( + +NHRS + +), + +NHRS + +- +HEVA 000023147 +( + +NHRS + +), + +NHRS + +- +HEVA 000023148 +( + +NHRS + +), + +NHRS + +- +HEVA 000023149 +( + +NHRS + +) + +. • + +1 ♀ +; +Western Jutland +, +Baldersbaek +, +plantation +; + +12 Jul. 1993 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023150 +( + +NHRS + +) + +. + + + +Germany +• +1 ♀ +; +Baden-Württemberg +, +Karlsruhe +, +Malsch +, +Luderbusch +, +south faced slope +; + +48.9131 ° N +, +8.3325 ° E + +; ca + +120 m +a. s. l. + +; + +26 Jul. - 2 Aug. 2020 + +; +Dieter Doczkal +| +K. Grabow +leg.; +Malaise trap +; + +ZFMK +-TIS-2640695 + + +. • + +1 ♂ +; +Bavaria +, +Allgäu +, +Balderschwang +, +Leiterberg +; + +47.4858 ° N +, +10.0899 ° E + +; ca + +1290 m +a. s. l. + +; + +4–21 Sep. 2017 + +; +Dieter Doczkal +| +Johannes Voith +leg.; +Malaise trap +; + +ZFMK +-TIS-2640708 + + +. • + +1 ♀ +; +Berlin +, +Berlin +, +Chausseestraße +109, +ruderal area +; + +29 Jun. - 5 Jul. 2009 + +; +A. Wiesener +| +V. Richter +| +F. Koch +leg.; MfN URI: 57384 a ( +ZHMB +) + +. • + +1 ♀ +; +Hesse +, +Gießen +, +Botanical garden +; + +50.5859 ° N +, +8.678 ° E + +; ca + +170 m +a. s. l. + +; + +18 Jun. 2021 + +; +GBOL +III leg.; +sweep net +; + +ZFMK +-TIS-2629491 + + +. • + +1 ♂ +; +Hesse +, +Rheingau-Taunus +, +Lorch am Rhein +, +oberhalb der Burg Nollig +; + +50.0491 ° N +, +7.7978 ° E + +; ca + +240 m +a. s. l. + +; + +21–27 Jul. 2013 + +; +Oliver Niehuis +leg.; +Malaise trap +; + +ZFMK +-TIS-2629579 + + +. • + +1 ♂ +; +Hesse +, +Rheingau-Taunus +, +Lorch am Rhein +, +oberhalb der Burg Nollig +; + +50.0498 ° N +, +7.7974 ° E + +; ca + +260 m +a. s. l. + +; + +15–21 Jul. 2013 + +; +Oliver Niehuis +leg.; +Malaise trap +; + +ZFMK +-TIS-2629514 + + +. • + +2 ♂♂ +; same collection data as for preceding + +21–27 Jul. 2013 + +; + +ZFMK +-TIS-2629242 + +, + +ZFMK +-TIS-2629526 + + +. • + +5 ♂♂ +; +Hesse +, +Werra-Meißner-Kreis +, +Großalmerode +, +Private garden, Siedlerweg +, +semi-abandoned garden with wet spot, ivy hedge and salix +; + +51.2591 ° N +, +9.7871 ° E + +; ca + +380 m +a. s. l. + +; + +12–20 Jul. 2022 + +; +Jonathan Vogel +leg.; +Malaise trap +; + +ZFMK +-TIS-2640700 + +, + +ZFMK +-TIS-2640701 + +, + +ZFMK +-TIS-2640702 + +, + +ZFMK +-TIS-2640703 + +, + +ZFMK +-TIS-2640705 + + +. • + +2 ♀♀ +; +North Rhine-Westphalia +, +Bonn +, + +ZFMK +garden + +, +lawn and bushes +; + +50.7218 ° N +, +7.1132 ° E + +; ca + +70 m +a. s. l. + +; + +30 Aug. 2022 + +; + +AG +Hymenoptera + +leg.; +sweep net +; + +ZFMK +-TIS-2640698 + +, + +ZFMK +-TIS-2640699 + + +. • + +1 ♀ +; same collection data as for preceding + +1 Sep. 2022 + +; + +ZFMK +-HYM-00039670 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Alfter +, +Mirbachstrasse +; + +50.7307 ° N +, +7.0142 ° E + +; ca + +90 m +a. s. l. + +; + +22 Jul. 2021 + +; +GBOL +III leg.; +sweep net +; + +ZFMK +-TIS-2629298 + + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Schladern near Windeck +, +Sieg river +, +right river bank +; + +50.8 ° N +, +7.585 ° E + +; ca + +130 m +a. s. l. + +; + +20–27 Jun. 2017 + +; + +ZFMK + +et al. leg.; +Malaise trap +; + +ZFMK +-TIS-2629283 + + +. • + +1 ♀ +, +2 ♂♂ +; same collection data as for preceding + +18–25 Jul. 2017 + +; female - + +ZFMK +-TIS-2629289 + +; males - + +ZFMK +-TIS-2629485 + +, + +ZFMK +-TIS-2629568 + + +. • + +2 ♂♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +slope of volcanic mountain, mixed broad-leaved forest +; + +50.4679 ° N +, +7.2223 ° E + +; ca + +330 m +a. s. l. + +; + +12–27 Jul. 2022 + +; +Santiago Jaume Schinkel +leg.; +Gressitt Malaise trap +; + +ZFMK +-HYM-00039687 + +, + +ZFMK +-HYM-00039688 + + +. • + +1 ♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +upper part of volcanic mountain, next to oak tree +; + +50.4672 ° N +, +7.2212 ° E + +; ca + +310 m +a. s. l. + +; + +12–27 Jul. 2022 + +; +Santiago Jaume Schinkel +leg.; +Gressitt Malaise trap +; + +ZFMK +-HYM-00039671 + + +. • + +1 ♂ +; +Saxony +, +Leipzig +, +surroundings of Naunhof +; + +28 Jul. 1957 + +; +Michalk +leg.; +JV_Prel_0046 +( + +SDEI + +) + +. + + + +The Netherlands +• +1 ♀ +; +Gelderland +, +Beek-Ubbergen +, +Goudenregenstraat +, +garden +; + +51.8268 ° N +, +5.9332 ° E + +; ca + +10 m +a. s. l. + +; + +1 Oct. 2023 + +; +Jochem Kühnen +leg.; +hand caught +; + +ZFMK +-HYM-00039657 + + +. • + +1 ♂ +; +Gelderland +, +Nijmegen +, +Gelderse poort +; + +10 May 2022 + +; +R. Lexmond +leg.; +Malaise trap +; +JV_Prel_0043 +( +RBINS +) + +. • + +1 ♀ +, +7 ♂♂ +; same collection data as for preceding + +20 Jul. 2022 + +; female - +JV_Prel_0077 +( +RBINS +); males - +JV_Prel_0078 +( +RBINS +), +JV_Prel_0079 +( +RBINS +), +JV_Prel_0080 +( +RBINS +), +JV_Prel_0081 +( +RBINS +), +JV_Prel_0082 +( +RBINS +), +JV_Prel_0083 +( +RBINS +), +JV_Prel_0084 +( +RBINS +) + +. • + +1 ♀ +; same collection data as for preceding + +23 Aug. 2022 + +; +JV_Prel_0060 +( +RBINS +) + +. + + + +Portugal +• +1 ♂ +; +Madeira +, +Funchal +, +Curral das Romeiros +; ca + +550 m +a. s. l. + +; + +8 Feb. 1991 + +; +Martti Koponen +leg.; specimen in coll. +Koponen. + + + + +Sweden +• +1 ♂ +; +Dalarna +, +Rättvik +, +Glostjärn +; + +20 May- 30 Jun. 1977 + +; +Tord Tjeder +leg.; + +NHRS + +- +HEVA 000023151 +( + +NHRS + +) + +. • + +1 ♀ +; +Hälsingland +, +Älgesjön +; + +62.16 ° N +, +16.212 ° E + +; ca + +300 m +a. s. l. + +; + +17 May- 15 Jun. 2002 + +; +Erik Sahlin +leg.; +window trap +; Tömn 1, specimen in coll MF + +. • + +1 ♂ +; +Närke +; + +10 Aug. 1953 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023153 +( + +NHRS + +) + +. • + +1 ♂ +; +Närke +, +Oset +; + +8 Aug. 1941 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023152 +( + +NHRS + +) + +. • + +1 ♂ +; +Öland +, +Kastlösa +; + +26 Jun. 1962 + +; +Karl-Johan Hedqvist +leg.; + +NHRS + +- +HEVA 000023175 +( + +NHRS + +) + +. • + +1 ♀ +; +Öland +, +Mörbylånga kommun +, +Skogsby +, +Ecological research station, lawn in garden with sandy soil +; + +56.6283 ° N +, +16.4918 ° E + +; ca + +30 m +a. s. l. + +; + +29 Aug. - 11 Sep. 2008 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023174 +( + +NHRS + +) + +. • + +1 ♂ +; +Östergötland +, +S: t Anna +, +Svensmarö +, +Sanningholmen +; + +7 Aug. 1976 + +; +Gustaf Wängsjö +leg.; + +NHRS + +- +HEVA 000023176 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Kristianstads kommun +, +Trunelän +, +Degeberga +, +Grazed meadow at alder stand along stream +; + +55.7746 ° N +, +14.2156 ° E + +; ca + +80 m +a. s. l. + +; + +1–13 Aug. 2019 + +; +Swedish Insect Inventory Programme +( +SIIP +), +Station Linné +leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023155 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Malmö kommun +, +Klagshamn +, +Limhamns kalkbrott +, +Limestone quarry +; + +55.5694 ° N +, +12.9267 ° E + +; ca - + +50 m +a. s. l. + +; + +4–12 Jun. 2018 + +; +Swedish Insect Inventory Programme +( +SIIP +), +Station Linné +leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023154 +( + +NHRS + +) + +. • + +2 ♂♂ +; +Södermanland +, +Trosa kommun +, +Hunga södergård +1, +agricultural backyard, heavily eutrophicated, in tall grass near stable manure pile +; + +58.9207 ° N +, +17.5212 ° E + +; ca + +20 m +a. s. l. + +; + +16 May- 13 Jun. 2004 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023156 +( + +NHRS + +), + +NHRS + +- +HEVA 000023157 +( + +NHRS + +) + +. • + +4 ♀♀ +, +3 ♂♂ +; same collection data as for preceding + +9–19 Aug. 2004 + +; females - + +NHRS + +- +HEVA 000023158 +( + +NHRS + +), + +NHRS + +- +HEVA 000023160 +( + +NHRS + +), + +NHRS + +- +HEVA 000023161 +( + +NHRS + +), + +NHRS + +- +HEVA 000023164 +( + +NHRS + +); males - + +NHRS + +- +HEVA 000023159 +( + +NHRS + +), + +NHRS + +- +HEVA 000023162 +( + +NHRS + +), + +NHRS + +- +HEVA 000023163 +( + +NHRS + +) + +. • + +1 ♂ +; +Södermanland +, +Väsbyön +; + +11 Aug. 1950 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023165 +( + +NHRS + +) + +. • + +1 ♀ +; +Uppland +, +Almunge +, +Harparbol +; + +20 Jun. 1948 + +; +Olov Lundblad +leg.; + +NHRS + +- +HEVA 000023169 +( + +NHRS + +) + +. • + +1 ♀ +, +1 ♂ +; +Uppland +, +Älvkarleby +, +Båtfors +, +flood-regiment oldgrowth birch edge of pine forest +; + +60.4607 ° N +, +17.3178 ° E + +; ca + +40 m +a. s. l. + +; + +14 Jun. - 4 Jul. 2005 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; female - + +NHRS + +- +HEVA 000023167 +( + +NHRS + +); male - + +NHRS + +- +HEVA 000023166 +( + +NHRS + +) + +. • + +1 ♂ +; +Uppland +, +Håbo kommun +, +Biskops-Arnö +, +elm grove +; + +59.6721 ° N +, +17.5009 ° E + +; ca + +10 m +a. s. l. + +; + +27 Aug. - 10 Sep. 2004 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023168 +( + +NHRS + +) + +. • + +1 ♀ +; +Uppland +, +Uppsala +, +Vårdsätra skog +, +forest +; + +7–28 Oct. 2002 + +; +Fredrik Ronquist +leg.; +Malaise trap +; specimen in coll MF + +. • + +2 ♂♂ +; +Västerbotten +, +Hällnäs +; + +22 Aug. 1961 + +; +Karl-Johan Hedqvist +leg.; + +NHRS + +- +HEVA 000023170 +( + +NHRS + +), + +NHRS + +- +HEVA 000023171 +( + +NHRS + +) + +. • + +1 ♀ +; +Västergötland +, +South of Alingsås +; + +29 Jul. 1998 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023172 +( + +NHRS + +) + +. • + +1 ♀ +; +Västmanland +, +Sala kommun +, +Västerfärnebo +, +Nötmyran +( +Östermyran +), +birch stand in moist haymaking meadow +; + +59.942 ° N +, +16.3095 ° E + +; ca + +70 m +a. s. l. + +; + +18 Aug. - 1 Sep. 2003 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023173 +( + +NHRS + +) + +. + + + +Switzerland +• +1 ♀ +; +Neuchâtel +, +Montmollin +; + +1 Aug. 1966 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +2 ♂♂ +; same collection data as for preceding + +3 Aug. 1957 + +; specimens at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +17 Aug. 1962 + +; specimen at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +19 Aug. 1957 + +; specimen at + +MHNG + + +. • + +2 ♂♂ +; same collection data as for preceding + +31 Aug. 1956 + +; specimens at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +29 Sep. 1956 + +; specimen at + +MHNG + + +. • + +1 ♀ +; +St. Gallen +, +Pfäfers +; + +9 Sep. 1992 + +; +F. Amiet +leg.; specimen at + +NMBE + + +. • + +1 ♀ +; +Valais +, +Visperterminen +; ca + +1550 m +a. s. l. + +; + +4 Aug. 1996 + +; +Gerhard Bächli +| +Bernhard Merz +leg.; specimen at + +NMBE + + +. • + +1 ♂ +; +Vaud +, +Ferreyres +; + +8 Sep. 1964 + +; +Jacques de Beaumont +leg.; specimens at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Lausanne +, +Vidy +; + +9 Sep. 1948 + +; +Jacques Aubert +leg.; specimens at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Lutry +; + +18 Jun. 1954 + +; +Jacques Aubert +leg.; specimens at + +MHNG + + +. • + +1 ♂ +; +Vaud +, +Rougemont +; ca + +1000 m +a. s. l. + +; + +14 Jun. 1963 + +; +Claude Besuchet +leg.; specimens at + +MHNG + + +. + + + + +Biology. + +Summer species, flying mainly from May to October, peak in July. Collected in all kinds of habitats: deciduous and coniferous forests, gardens, parks and orchards, agricultural fields, pastures and meadows, ruderal land, ponds and marshes + + + +Distribution. + + +Verified by morphological examination: +Belgium +, +Denmark +, +Germany +(locus + +typicus + +of + +A. spheciformis + +; locus + +typicus + +of + +A. fergussoni + +: Ingelheim am Rhein), +Lithuania +, +The Netherlands +, +Norway +, +Portugal +, +Sweden +(locus + +typicus + +of + +A. eucharioides + +: Västergötland), +Switzerland +, +United Kingdom +(locus + +typicus + +of + +A. tincta + +: unclear, either near London, +Isle of Wight +or Machynlleth (North Wales )). + + +CO 1 barcode sequence matches: +Belarus +(e. g. GMBMQ 746-17) and +Canada +(e. g. BBHYJ 932-10). + + +Lowland species, usually occurring in elevations below +500 m +a. s. l., rarely collected in higher altitudes, most specimens between +0–100 m +a. s. l. + + + + +Remarks. + + + +A. eucharioides + +is both the most commonly collected and the most morphologically heterogeneous species within the genus + +Anacharis + +. Specimens often exhibit slight metallic sheen on their mesoscutum and head that is more notable in ethanol-stored specimens but sometimes retains on dried specimens. + + +The type of + +A. eucharioides + +is reportedly lost ( +Fergusson 1986 +, +Mata-Casanova et al. 2018 +), which we confirm herein by having searched the collection of the + +NHRS + +in addition to previous efforts at other possible depositories ( + +NHMUK + +, + +MZLU + +). In the current situation with several new species, we disagree with Fergusson’s statement, that “ … there is no confusion about the identity of this species ” and that “ a +neotype +is not required ” ( +Fergusson 1986 +) and rather stress the necessity to designate a +neotype +from the broader type locality at Västergötland. However, as we were not able to acquire a fresh specimen suitable for DNA sequencing from the type locality, we withhold taking action until a more suitable occasion. + + +The +lectotype +of + +A. tincta + +is glued to its ventral side on cardboard, face down, the wings also glued to the board. It is overall intact, except the terminal four segments of the left antenna, which are detached from the rest to the specimen but still present on the cardboard. Also, the left fore tarsomeres are detached, the second tarsomere is missing, the rest is glued on the card. Both wings and legs obscure the lateral mesosoma on both sides. We here confirm the synonymy with + +A. eucharioides + +. + + +The +lectotype +of + +A. spheciformis +(Hartig, 1840) + +was designated by +Weld (1952) +, who reported the +syntype +series to consist of +12 specimens +. Interestingly, +Fergusson (1986) +reports only +one specimen +under the name + +A. spheciformis + +from the Hartig collection, meaning that +11 syntypes +might be lost. Fergusson additionally states the sex of the +lectotype +to be female, while the specimen is clearly a male. The species was treated as a synonym of + +A. typica + +by +Dalla-Torre and Kieffer (1910) +and +Weld (1952) +, as established by +Reinhard (1860) +, but the +lectotype +has a clearly sculptured mesoscutellum, which makes it distinct from + +A. typica + +. We agree with the latest treatments of + +A. spheciformis + +as synonym of + +A. eucharioides + +( +Fergusson 1986 +; +Mata-Casanova et al. 2018 +) but as we consider + +A. typica + +a valid species, we formally move it from synonymy with + +A. typica + +to + +A. eucharioides + +. + + + +A. fergussoni + +is diagnosed against + +A. parapsidalis + +and + +A. melanoneura + +in +Mata-Casanova et al. (2018) +. The reason why it is not considered similar to + +A. eucharioides + +by the authors is likely due to the distinction they make based on the parascutal sulcus (present in + +A. fergussoni + +, absent in + +A. eucharioides + +), as used in their key (couplet 3). As we found this character to be very variable within + +A. eucharioides + +, this is not sufficient for discrimination. The character states used to diagnose + +A. fergussoni + +against + +A. parapsidalis + +and + +A. melanoneura + +given by +Mata-Casanova et al. (2018) +match with the re-description of + +A. eucharioides + +by +Mata-Casanova et al. (2018) +and our observations. The morphometric values given for + +A. fergussoni + +fall into the range of + +A. eucharioides + +as diagnosed herein (Table +2 +), except the head width: length and the petiole length: metacoxa length which exhibit unusual high values in the description of + +A. fergussoni + +. However, the former is only 0.1 off of the range of + +A. eucharioides + +, and might well fall into the error range, and the latter (relative petiole length) seems erroneous in the description (“ about 2.0 times as long as metacoxa ” +Mata-Casanova et al. 2018 +), as we measure a value of 1.4 on the images of the +holotype +, which falls well into the range of what we measured for + +A. eucharioides + +and is even close to the mean (1.0–1.7, mean 1.5). In terms of qualitative characters, the centrally sparsely pubescent to glabrous median lobe of the mesoscutum, the well-foveated notauli, the median carina of the mesoscutellum that is medially morphing into reticulate sculpture and the smooth to rugose lateromedial area of pronotum are typical for + +A. eucharioides + +. Based on this re-evaluation of possible morphometric differences and the similarity in qualitative characters between the specimens examined herein and the +holotype +of + +A. fergussoni + +we synonymise + +A. fergussoni + +with + +A. eucharioides + +. + + + + + + +Comparison of morphometric values between +A + +A. fergussoni + +in the description of +Mata-Casanova et al. (2018) +, +B +measurements taken from images of the holotype of + +A. fergussoni + +, +C + +A. eucharioides + +in the redescription of +Mata-Casanova et al. (2018) +, and +D +our measured values for + +A. eucharioides + +(n = 58). + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
Entities measuredHead dorsal width: lengthHead frontal width: heightMalar sulcus length: eye heightEye-to-eyee dist.: eye heightmesoscutum width: lengthmesoscutellum _ l mesoscutum _ lRadial cell length: widthPetiole length: metacoxa length
+A + +A. fergussoni + +in description ( +Mata-Casanova et al. 2018 +) +2.41.30.71.11.20.62.72
+B + +A. fergussoni + +holotype, measured herein +-1.20.61.01.20.8-1.4
+C + +A. eucharioides + +in redescription ( +Mata-Casanova et al. 2018 +) +21.30.611.20.82.6> 1
+D + +A. eucharioides + +range, measured herein +1.8–2.31.0–1.30.6–0.81.0–1.11.0–1.20.6–0.82.4–3.31.0–1.7
+ + +We want to note that images of the +holotype +, kindly provided to kindly provided to us by the team at + +CNC + +, do not correspond to all the SEM images in +Mata-Casanova et al. (2018 +, Fig. +4 A – C +). Fig. +4 A +clearly shows the +holotype +before the right wings were removed, as does fig. 4 B though the image is vertically flipped, but fig. 4 C shows a different antennal position and must be a different specimen. + + +Here, we demonstrate that, given the morphometric variability within + +A. eucharioides + +and the whole + +eucharioides + +species group, morphometric characters / analyses cannot reliably separate this species from the others (Fig. +8 A +). Our diagnosis rather relies on qualitative characters and species delimitation has been crucially informed by the results from analysis of molecular sequence data, which show a distinct cluster / putative species with small intraspecific variability based on almost +300 specimens +from various localities. Without this reverse taxonomy approach included, finding and defining species limits within the + +eucharioides + +species group, and especially of + +A. eucharioides + +would have been difficult if not impossible. + + +Additional distribution records are listed in +Mata-Casanova et al. (2018) +for +Andorra +, +France +, +Romania +, +Spain +, +Slovakia +and +Hungary +. Since our circumscription of + +A. eucharioides + +is narrower than that of +Mata-Casanova et al. (2018) +, we cannot confirm the presence of the species in these countries (specimens listed as + +A. eucharioides + +could also belong to + +A. typica + +or + +A. petiolata + +) but it is likely present in these regions, too. + + + + \ No newline at end of file diff --git a/data/59/CE/57/59CE57F3CA395259813CAC48BE3D0090.xml b/data/59/CE/57/59CE57F3CA395259813CAC48BE3D0090.xml new file mode 100644 index 00000000000..2c32f5794de --- /dev/null +++ b/data/59/CE/57/59CE57F3CA395259813CAC48BE3D0090.xml @@ -0,0 +1,1696 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis immunis +Walker, 1835 + + + + + +Figs 2 B +, +3 B +, +11 A – E + + + + + + + +Anacharis immunis + +Walker, 1835: 521 +- +lectotype +( + +NHMUK + +) +♂ +, syn. by Fergusson (1968), photographs examined. + + + + + + + + + +Anacharis staegeri +Dahlbom, 1842: 4 + + +- +lectotype +( + +MZLU + +) +♀ +, syn. by Dalla Torre (1893), photographs examined. + + + + + + +Synapsis aquisgranensis +Förster, 1869: 361 + + +- +Holotype +( + +ZMHB + +) +♂ +, syn. by +Kierych (1984) +, not examined. + + + + + +Diagnosis + + +(n = 14). +Belongs to the + +immunis + +species group. + +Anacharis immunis + +can be distinguished from + +A. ensifer + +and + +A. norvegica + +by having a largely smooth and even dorsal surface of the mesoscutellum, especially centrally (reticulate-foveate in + +A. ensifer + +and + +A. norvegica + +) (Fig. +11 D +). The fore and mid coxae are usually as dark as the hind coxa (usually distinctly paler than the hind coxa in + +A. ensifer + +). + + + + +CO 1 barcode. + + +n = 14. Maximum intraspecific distance = 0.2 %. Minimum distance to closest species ( + +A. ensifer + +) = 7.8 %. CO 1 barcode consensus sequence: + +AATTTTATACTTTATTATAGGAATCTGATCAGCAATATTAGGATCAAGACTTAGTATAATTATCCGAAT AGAATTAGGGACTCCATCACAATTAATTAGAAATGAACAAATTTACAATTCAATTGTAACCGCACATGCA TTTATCATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGATTTGGAAATTACCTAATCCCATTAA TACTTTTATCTCCAGATATAGCTTTTCCACGATTAAATAATATAAGATTTTGATTTTTAATTCCCTCTTT AGCTTTAATATCTTCTAGTTTATTTATTGATCAAGGGGCAGGAACAGGATGAACAATTTACCCTCCTTTA TCTTCATTAACAGGACACTCAGGAATTGCAGTAGATATAACAATCTACTCCCTTCATTTAAGAGGAATTT CTTCAATTTTAGGATCAATTAATTTTATCAGAACAATTTTAAACATACGAATTAATAAAGTATCAATAGA TAAAATTACTCTATTTAGATGATCAATCTTTTTAACTACAATTTTATTACTTCTATCATTACCTGTGCTT GCAGGAGGAATTACTATACTTTTATTTGACCGAAACTTAAACACCTCCTTTTTCGACCCCATAGGGGGAG GAGACCCAATCTTATATCAACATTTATTT + + + +Type material. + + + +Lectotype +of + +A. immunis +Walker, 1835 + + +: + +Type + + +immunis +, Walk. + +[handwritten, probably by Walker himself] + + +In coll under + +immunis + + + +LECTOTYPE + + +B. M. +TYPE +HYM 7. 160 + + +LECTOTYPE +of + +A. immunis +Walker + +det. N. D. M. Fergusson, 1981 + + +[QR code] +NHMUK +010640455 + + +[for images, see +https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10638963 +] + + + +Lectotype +of + +A. staegeri +Dahlbom, 1842 + + +: + + +♀ + + + +LECTOTYPE + + +LECTOTYPE +of + +Anacharis staegeri +Dahlm + +det. N. D. M. Fergusson, 1983 + + +1983 366 + + +MZLU + +00215544 + + + +MZLU + +Type no. 6511: 1 + + +[for images, see +https://www.flickr.com/photos/tags/mzlutype06511 +] + + + + +Other material examined. + + +DNA barcode vouchers. + +Germany +• +1 ♀ +; +Baden-Württemberg +, +Karlsruhe +, +Malsch +, +Hansjakobstraße +, +garden +; + +48.8835 ° N +, +8.3197 ° E + +; ca + +120 m +a. s. l. + +; + +25 Oct. - 8 Nov. 2020 + +; +Dieter Doczkal +leg.; +Malaise trap +; + +ZFMK +-TIS-2640725 + + +. • + +1 ♀ +; +Bavaria +, +Allgäu +, +Balderschwang +, +Leiterberg +; + +47.4858 ° N +, +10.0899 ° E + +; ca + +1290 m +a. s. l. + +; + +4–21 Sep. 2017 + +; +Doczkal +, +Dieter +, +Voith, J. +leg.; +Malaise trap +; + +ZFMK +-TIS-2640709 + + +. • + +1 ♀ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4068 ° N +, +11.008 ° E + +; ca + +2010 m +a. s. l. + +; + +20 Jun. - 5 Jul. 2018 + +; +Doczkal, D. +, +Voith, J. +leg.; +Malaise trap +; + +ZFMK +-TIS-2628218 + + +. • + +6 ♂♂ +; +Bavaria +, +Rhön-Grabfeld +, +Fladungen +, +Nat. res. Schwarzes Moor +, +Karpatenbirkenwald +; + +50.5117 ° N +, +10.071 ° E + +; ca + +780 m +a. s. l. + +; + +26 Jun. - 18 Jul. 2017 + +; +Dieter Doczkal +leg.; +Malaise trap +; + +ZFMK +-TIS-2629533 + +, + +ZFMK +-TIS-2629534 + +, + +ZFMK +-TIS-2629535 + +, + +ZFMK +-TIS-2629536 + +, + +ZFMK +-TIS-2629537 + +, + +ZFMK +-TIS-2629539 + + +. • + +2 ♂♂ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Banfe-Haus +“; + +51.167 ° N +, +8.9749 ° E + +; ca + +270 m +a. s. l. + +; + +7–21 Jul. 2022 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640756 + +, + +ZFMK +-TIS-2640759 + + +. • + +3 ♂♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +upper part of volcanic mountain, next to oak tree +; + +50.4672 ° N +, +7.2212 ° E + +; ca + +310 m +a. s. l. + +; + +12–27 Jul. 2022 + +; +Jaume-Schinkel +, +Santiago +leg.; +Gressit Malaise trap +; + +ZFMK +-TIS-2640771 + +, + +ZFMK +-TIS-2640772 + +, + +ZFMK +-TIS-2640773 + + +. + + +Material without DNA barcode. + +Belgium +• +1 ♂ +; +Walloon Brabant +, +Ottignies +; + +9–16 Jul. 1983 + +; +Paul Dessart +leg.; +Malaise trap +; +JV_Prel_0073 +( +RBINS +) + +. • + +1 ♀ +; same collection data as for preceding + +24 Sep. - 1 Oct. 1983 + +; +JV_Prel_0051 +( +RBINS +) + +. • + +1 ♀ +; +Walloon Region +, +Luik +, +Wanze +, +Antheit +(Corphalie); + +50.5363 ° N +, +5.2515 ° E + +; ca + +110 m +a. s. l. + +; + +16–30 May 1989 + +; +R. Detry +leg.; +Blue pan trap +; +JV_Prel_0056 +( +RBINS +) + +. + + + +Denmark +• +1 ♂ +; +Eastern Jutland +, +Fugslev +; + +56.2667 ° N +, +10.7167 ° E + +; ca + +20 m +a. s. l. + +; 1999; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023102 +( + +NHRS + +) + +. • + +4 ♂♂ +; +Eastern Jutland +, +Hjelm +; + +3–5 Aug. 1992 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023104 +( + +NHRS + +), + +NHRS + +- +HEVA 000023104 +( + +NHRS + +), + +NHRS + +- +HEVA 000023104 +( + +NHRS + +), + +NHRS + +- +HEVA 000023105 +( + +NHRS + +) + +. • + +1 ♂ +; +Eastern Jutland +, +Rugård +, +Sønderskov +; + +56.2667 ° N +, +10.8167 ° E + +; ca + +30 m +a. s. l. + +; + +20 Jul. 1996 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023103 +( + +NHRS + +) + +. • + +1 ♀ +, +1 ♂ +; +Northwestern Jutland +, +Torup +, +klitplantage +; + +56.9667 ° N +, +8.4 ° E + +; ca + +20 m +a. s. l. + +; + +27 Jul. 1989 + +; +Torkhild Munk +leg.; female - + +NHRS + +- +HEVA 000023106 +( + +NHRS + +); male - + +NHRS + +- +HEVA 000023101 +( + +NHRS + +) + +. + + + +Germany +• +1 ♀ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4053 ° N +, +11.0091 ° E + +; ca + +1980 m +a. s. l. + +; + +2–13 Aug. 2018 + +; +Dieter Doczkal +| +Johannes Voith +leg.; +Malaise trap +; + +ZFMK +-HYM-00039683 + + +. • + +3 ♂♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +slope of volcanic mountain, mixed broad-leaved forest +; + +50.4679 ° N +, +7.2223 ° E + +; ca + +330 m +a. s. l. + +; + +12–27 Jul. 2022 + +; +Santiago Jaume Schinkel +leg.; +Gressitt Malaise trap +; + +ZFMK +-HYM-00039684 + +, + +ZFMK +-HYM-00039685 + +, + +ZFMK +-HYM-00039686 + + +. • + +18 ♂♂ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +upper part of volcanic mountain, next to oak tree +; + +50.4672 ° N +, +7.2212 ° E + +; ca + +310 m +a. s. l. + +; + +12–27 Jul. 2022 + +; +Santiago Jaume Schinkel +leg.; +Gressitt Malaise trap +; + +ZFMK +-HYM-00039689 + +, + +ZFMK +-HYM-00039690 + +, + +ZFMK +-HYM-00039691 + +, + +ZFMK +-HYM-00039692 + +, + +ZFMK +-HYM-00039693 + +, + +ZFMK +-HYM-00039694 + +, + +ZFMK +-HYM-00039695 + +, + +ZFMK +-HYM-00039696 + +, + +ZFMK +-HYM-00039697 + +, + +ZFMK +-HYM-00039698 + +, + +ZFMK +-HYM-00039699 + +, + +ZFMK +-HYM-00039700 + +, + +ZFMK +-HYM-00039701 + +, + +ZFMK +-HYM-00039702 + +, + +ZFMK +-HYM-00039703 + +, + +ZFMK +-HYM-00039704 + +, + +ZFMK +-HYM-00039705 + + +. + + + +Sweden +• +1 ♀ +; +Närke +, +Örebro +, +Adolfsberg +; + +19 Sep. 1953 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023107 +( + +NHRS + +) + +. • + +1 ♀ +; +Öland +, +Ekerums strand +, +dry meadow with mixed trees +; + +31 Jul. 1977 + +; +Sven Johansson +leg.; + +NHRS + +- +HEVA 000023115 +( + +NHRS + +) + +. • + +1 ♂ +; +Östergötland +, +S: t Anna +, +Svensmarö +, +Sanningsholmen +; + +11 Aug. 1976 + +; +Gustav Wängsjö +leg.; + +NHRS + +- +HEVA 000023117 +( + +NHRS + +) + +. • + +1 ♂ +; +Östergötland +, +Tjärholm +; + +5 Jul. 1976 + +; +Gustav Wängsjö +leg.; + +NHRS + +- +HEVA 000023116 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Kristianstads kommun +, +Trunelän +, +Degeberga +, +Grazed meadow at alder stand along stream +; + +55.7746 ° N +, +14.2156 ° E + +; ca + +80 m +a. s. l. + +; + +16–26 Sep. 2018 + +; +Swedish Insect Inventory Programme +( +SIIP +), +Station Linné +leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023109 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Kristianstads kommun +, +Trunelän +, +Degeberga +, +Grazed meadow at alder stand along stream +; + +55.7746 ° N +, +14.2156 ° E + +; ca + +80 m +a. s. l. + +; + +31 May- 9 Jun. 2019 + +; +Swedish Insect Inventory Programme +( +SIIP +), +Station Linné +leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023108 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Kvistofta +; + +1 Aug. 1949 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023110 +( + +NHRS + +) + +. • + +1 ♀ +; +Småland +, +Bäckebo +, +Grytsjön +, +moist haymaking meadow at birch-spruce forest edge +; + +56.9314 ° N +, +16.0855 ° E + +; ca + +80 m +a. s. l. + +; + +12 Jul. - 18 Aug. 2005 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; + +NHRS + +- +HEVA 000023113 +( + +NHRS + +) + +. • + +2 ♀♀ +; +Småland +; [19 +th +cent.]; +Carl Henning Boheman +leg.; + +NHRS + +- +HEVA 000023111 +( + +NHRS + +), + +NHRS + +- +HEVA 000023112 +( + +NHRS + +) + +. • + +1 ♀ +; +Södermanland +, +Åva +; + +20 Sep. 1953 + +; +Tor-Erik Leiler +leg.; + +NHRS + +- +HEVA 000023114 +( + +NHRS + +) + +. + + + +Switzerland +• +1 ♂ +; +Neuchâtel +, +Auvernier +; + +1 Aug. 1953 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +10 Aug. 1957 + +; specimen at + +MHNG + + +. • + +1 ♀ +; same collection data as for preceding + +15 Aug. 1956 + +; specimen at + +MHNG + + +. • + +1 ♀ +; same collection data as for preceding + +25 Aug. 1966 + +; specimen at + +MHNG + + +. • + +1 ♂ +; +Neuchâtel +, +La Tourne +; + +26 Aug. 1960 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♂ +; +Neuchâtel +, +Montmollin +; + +14 Aug. 1957 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Valais +, +Mayens de Sion + +Aug. 1957 + +; +Jean-Louis Nicod +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Jorat +; + +29 Jun. 1960 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Vidy +; + +28 Sep. 1953 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. + + + + +Biology. + + +Summer species, flying mainly from July to September, peak in July. No clear habitat preference but in +Sweden +and +Denmark +often collected in open sandy pine forest. + + + + +Distribution. + + +Verified by morphological examination: +Belgium +, +Denmark +, +Germany +(locus + +typicus + +of + +A. aquisgranensis + +: Aachen and + +Megapelmus rufiventris +Hartig, 1841 + +), +Sweden +(locus + +typicus + +of + +A. staegeri + +), +Switzerland +, +United Kingdom +(locus + +typicus + +of + +A. immunis + +: near London). + +No DNA barcode matches with publicly available sequences from other countries. + +Mainly collected in lowlands below +400 m +a. s. l., occasionally found in higher altitudes at +700–900 m +a. s. l. and rarely even higher. + + + + +Remarks. + + + +Anacharis aquisgranensis + +was described by Förster (1869) because of its +holotype +having the mesoscutum fused with the mesoscutellum. He even erected the monotypic genus + +Synapsis + +(later replaced by + +Prosynapsis +Dalla Torre & Kieffer, 1910 + +, due to homonymy) based on that state. +Kierych (1984) +considered the fusion as an aberrant state and synonymised + +Prosynapsis + +under + +Anacharis + +and + +A. aquisgranensis + +under + +A. immunis + +. We have not seen such a character state, but it seems rather aberrant if real, and we see no reason to question Kierych’s judgment until further. + + +The distribution records of + +A. immunis + +reported by +Mata-Casanova et al. (2018) +require re-evaluation as + +A. immunis +sensu +Mata-Casanova et al. (2018) + +also includes + +A. ensifer + +(see remarks there). + + + + \ No newline at end of file diff --git a/data/87/C2/E7/87C2E7EED2375729982F5A8183FFC229.xml b/data/87/C2/E7/87C2E7EED2375729982F5A8183FFC229.xml new file mode 100644 index 00000000000..35a8038acbc --- /dev/null +++ b/data/87/C2/E7/87C2E7EED2375729982F5A8183FFC229.xml @@ -0,0 +1,1757 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis ensifer +Walker, 1835 + +stat. rev. + + + + +Figs 2 A +, +3 A +, +9 A – E + + + + + + + +Anacharis ensifer + +Walker, 1835: 522 +- +lectotype +( + +NHMUK + +) +♀ +, photographs examined. + + + + + + + + + +Megapelmus rufiventris +Hartig, 1841: 358 + + +(removed from synonymy with + +A. immunis + +) - +lectotype +( + +ZSM + +) +♀ +, photographs examined. + + + + + +Diagnosis + + +(n = 13). +Belongs to the + +immunis + +species group. Similar to + +A. norvegica + +in generally having a largely sculptured mesoscutellum (largely smooth in + +A. immunis + +) (Fig. +9 D +). Different from + +A. norvegica + +by having its mesoscutellum covered with reticulate-foveate sculpture resulting in larger foveae (smaller foveae on mesoscutellum in + +A. norvegica + +) (Fig. +9 D +). The circumscutellar carina is distinct and usually flanged upwards and appears in lateral view like a posterodorsal tooth (circumscutellar carina not flanged and less distinct in + +A. norvegica + +, not appearing like a tooth) (Fig. +9 B +). The mesopleural line is dorsally well-defined in its anterior half (dorsal margin in anterior half diffused by rugose sculpture of mesopleuron in + +A. norvegica + +) (Fig. +9 B +). The mesoscutum lacks, or has just a few, wrinkles and has no distinct anteroadmedian signa (in + +A. norvegica + +, wrinkles on mesoscutum strong, amplifying the visibility of anteroadmedian signa) (Fig. +9 D +). + + + + +CO 1 barcode. + + +n = 12. Maximum intraspecific distance = 0.5 %. Minimum distance to closest species ( + +A. immunis + +) = 7.8 %. CO 1 barcode consensus sequence: + +AATTTTATACTTTATTTTAGGAATCTGGTCAGCAATATTAGGATCAAGACTTAGTATAATTATTCGAAT AGAATTAGGCACCCCATCTCAATTAATCAGAAATGACCAAATTTACAATTCAATTGTAACAGCTCATGCA TTTATTATAATTTTTTTTATAGTTATACCTATTATAGTCGGAGGATTTGGAAATTACCTAATTCCATTAA TACTCCTATCCCCAGATATAGCTTTCCCACGATTAAATAATATAAGATTTTGATTTCTAATCCCCTCTTT AATTTTAATAGCTTCAAGATTATTTATTGATCAAGGAGCAGGAACCGGATGAACAGTATATCCCCCTTTA TCTTCATTAACAGGTCACTCAGGGATTGCAGTAGACATAACAATTTACTCTCTTCATTTAAGAGGAATTT CTTCAATTTTAGGCTCAATTAATTTTATTAGAACAATTTTAAATATACGAATCAATAAAGTATCAATAGA TAAAATTACCCTATTTACATGATCAATTTTTTTAACTACAATTCTATTACTTTTATCATTACCCGTCCTA GCAGGAGGGATCACTATACTTTTATTTGACCGAAACTTAAATACCTCCTTTTTCGATCCCATAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT + + + +Type material. + + + +Lectotype +of + +Anacharis ensifer +Walker, 1835 + +, designated by +Fergusson (1986) + + +F Walker Coll. 81–86 +LECTO-TYPE + +B. M. 1981. Under + +A. ensifer + + + +LECTOTYPE +of + +A. ensifer +Walker + +det. N. D. M. Fergusson, 1981 + + +B. M. +TYPE +HYM 7. 161 + + +[QR-code] +NHMUK +010640456 + + +[for images, see +https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10638964 +] + + + +Lectotype +of + +Anacharis rufiventris +Hartig, 1841 + +, designated by +Fergusson (1986) + + +LECTO-TYPE + + +Megapelmus + +n. sp. +? [handwritten, probably by Hartig himself] + + + +rufiventris + +. [handwritten, probably by Hartig himself] + + +LECTOTYPE +of + +Megapelmus rufiventris +Hartig + +det. N. D. M. Fergusson 1982 + + + +Anacharis immunis + +det. N. D. M. Fergusson 1982 + + + + +Other material examined. + + +DNA barcode vouchers. + +Belgium +• +1 ♀ +; +West Flanders +, +Ypres +, +De Triangel +, +Urban park (bushes) +; + +50.8418 ° N +, +2.8838 ° E + +; ca + +20 m +a. s. l. + +; + +2–23 Jul. 2022 + +; +Verheyde +, +Fons +leg.; +Malaise trap +; + +ZFMK +-TIS-2640867 + + +. + + + +Norway +• +2 ♂♂ +; +Rogaland Ytre +, +Sola +, +Indraberget +; + +58.9124 ° N +, +5.6628 ° E + +; ca + +20 m +a. s. l. + +; + +24 Aug. - 6 Sep. 2020 + +; +Leendertse +, +Arjen +leg.; +Malaise trap +; + +ZFMK +-TIS-2629222 + +, + +ZFMK +-TIS-2629223 + + +. • + +1 ♂ +; same collection data as for preceding; + +20 Sep. - 5 Oct. 2020 + +; + +ZFMK +-TIS-2629221 + + +. • + +1 ♀ +, +3 ♂♂ +; +Rogaland Ytre +, +Stavanger +, +Byhaugen +; + +58.9731 ° N +, +5.6988 ° E + +; ca + +50 m +a. s. l. + +; + +6–29 Aug. 2020 + +; +Birkeland +, +Jarl +leg.; +Malaise trap +; female - + +ZFMK +-TIS-2629272 + +; males - + +ZFMK +-TIS-2629209 + +, + +ZFMK +-TIS-2629210 + +, + +ZFMK +-TIS-2629211 + + +. • + +1 ♀ +; same collection data as for preceding; + +25 Sep. - 31 Oct. 2020 + +; + +ZFMK +-TIS-2629249 + + +. • + +3 ♂♂ +; +Rogaland Ytre +, +Time +, +Mossige +; + +58.69 ° N +, +5.7239 ° E + +; ca + +60 m +a. s. l. + +; + +17 Sep. - 11 Oct. 2020 + +; +Mjøs +, +Alf Tore +leg.; +Malaise trap +; + +ZFMK +-TIS-2629206 + +, + +ZFMK +-TIS-2629207 + +, + +ZFMK +-TIS-2629208 + + +. + + +Material without DNA barcode. + +Belgium +• +3 ♂♂ +; +Walloon Brabant +, +Ottignies +; + +16–23 Jul. 1983 + +; +Paul Dessart +leg.; +Malaise trap +; +JV_Prel_0047 +( +RBINS +), +JV_Prel_0048 +( +RBINS +), +JV_Prel_0049 +( +RBINS +) + +. • + +1 ♀ +; +West Flanders +, +Ypres +, +De Triangel +, +Urban park (pool vegetation) +; + +50.8427 ° N +, +2.884 ° E + +; ca + +20 m +a. s. l. + +; + +18 Jun. - 2 Jul. 2022 + +; +Fons Verheyde +leg.; +Malaise trap +; + +ZFMK +-TIS-2640864 + + +. + + + +Denmark +• +1 ♂ +; +Eastern Jutland +, +Alminde hule +, + +20 km +S of Vejle + +; + +30 May 1982 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023120 +( + +NHRS + +) + +. • + +1 ♂ +; +Eastern Jutland +, +Klattrup +, + +10 km +S of Velje + +, +Bygade +, +on compost heap +; + +28–29 Jul. 1982 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023118 +( + +NHRS + +) + +. • + +1 ♀ +; +Eastern Jutland +, +Nørreskov +, + +10 km +E of Kording + +; + +31 Jul. 1984 + +; +Torkhild Munk +leg.; + +NHRS + +- +HEVA 000023119 +( + +NHRS + +) + +. + + + +Germany +• +2 ♀♀ +; +Bavaria +, near +Schwandorf +; + +49.3042 ° N +, +12.1184 ° E + +; ca + +360 m +a. s. l. + +; +Ernst Klimsa +leg.; specimen in coll +MF + +. • + +1 ♂ +; +Brandenburg +, +Potsdam-Mittelmark +, +Kleinmachnow +; + +22 Jun. 1925 + +; +S. Bollow +leg.; +JV_Prel_0042 +( + +SDEI + +) + +. • + +1 ♀ +; +North Rhine-Westphalia +, +Rhein-Sieg-Kreis +, +Schladern near Windeck +, +Sieg river +, +right river bank +; + +50.8 ° N +, +7.585 ° E + +; ca + +130 m +a. s. l. + +; + +4–11 Jul. 2017 + +; + +ZFMK + +et al. leg.; +Malaise trap +; + +ZFMK +-TIS-2629278 + + +. + + + +The Netherlands +• +1 ♀ +; +Gelderland +, +Nijmegen +, +Gelderse poort +; + +23 Aug. 2022 + +; +R. Lexmond +leg.; +Malaise trap +; +JV_Prel_0050 +( +RBINS +) + +. + + + +Norway +• +2 ♀♀ +; +Akershus +, +Baerum +, +Ostøya +; + +10 Jun. - 1 Jul. 1984 + +; +Fred Midtgaard +leg.; + +NHRS + +- +HEVA 000023124 +( + +NHRS + +), + +NHRS + +- +HEVA 000023125 +( + +NHRS + +) + +. • + +1 ♀ +; +Norvegia +alpina (“ +Nv alp +”); [1832]; +Carl Henning Boheman +leg.; + +NHRS + +- +HEVA 000023123 +( + +NHRS + +) + +. • + +2 ♀♀ +; +Rogaland Ytre +, +Stavanger +, +Byhaugen +; + +58.9731 ° N +, +5.6988 ° E + +; ca + +50 m +a. s. l. + +; + +6–29 Aug. 2020 + +; +Jarl Birkeland +leg.; +Malaise trap +; + +ZFMK +-TIS-2629273 + +, + +ZFMK +-TIS-2629274 + + +. • + +1 ♂ +; same collection data as for preceding + +25 Sep. - 31 Oct. 2020 + +; + +ZFMK +-TIS-2629205 + + +. + + + +Sweden +• +1 ♀ +; +Gotska sandön +, +Lilla lövskogen +; + +6 Aug. 1952 + +; +Anton Jansson +leg.; + +NHRS + +- +HEVA 000023126 +( + +NHRS + +) + +. • + +3 ♂♂ +; +Öland +, +Ås +, +Ottenbylund +, +glade in deciduous grove +; + +56.2194 ° N +, +16.4224 ° E + +; ca + +10 m +a. s. l. + +; + +24 Jul. - 1 Aug. 2003 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023139 +( + +NHRS + +), + +NHRS + +- +HEVA 000023140 +( + +NHRS + +), + +NHRS + +- +HEVA 000023141 +( + +NHRS + +) + +. • + +1 ♂ +; +Öland +, +Kastlösa +; + +26 Jun. 1952 + +; +Karl-Johan Hedqvist +leg.; + +NHRS + +- +HEVA 000023138 +( + +NHRS + +) + +. • + +1 ♂ +; +Öland +, +Torslunda +, +Gamla skogsby +, +Diversitetsängen +, +rich transitional meadow with shrubs near nemoral forest +; + +56.6167 ° N +, +16.5076 ° E + +; ca + +40 m +a. s. l. + +; + +17 Jul. - 7 Aug. 2003 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023142 +( + +NHRS + +) + +. • + +2 ♂♂ +; +Östergötland +, +Omberg +, +Stocklycke +, +meadow in Tilia-dominated forest +; + +58.3075 ° N +, +14.631 ° E + +; ca + +130 m +a. s. l. + +; + +22 Jul. - 5 Aug. 2003 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023143 +( + +NHRS + +), + +NHRS + +- +HEVA 000023144 +( + +NHRS + +) + +. • + +3 ♀♀ +, +1 ♂ +; +Småland +; [18 xx]; +Carl Henning Boheman +leg.; females - + +NHRS + +- +HEVA 000023127 +( + +NHRS + +), + +NHRS + +- +HEVA 000023128 +( + +NHRS + +), + +NHRS + +- +HEVA 000023129 +( + +NHRS + +); male - + +NHRS + +- +HEVA 000023130 +( + +NHRS + +) + +. • + +1 ♀ +, +1 ♂ +; +Södermanland +, +Ludgo +s: n, +Tovetorp fieldstation +; + +58.9478 ° N +, +17.1485 ° E + +; ca + +50 m +a. s. l. + +; + +6 Aug. 2012 + +; +Mattias Forshage +leg.; +sweep net +; female - + +NHRS + +- +HEVA 000023131 +( + +NHRS + +); male - + +NHRS + +- +HEVA 000023132 +( + +NHRS + +) + +. • + +1 ♀ +; +Södermanland +, +Trosa kommun +, +Hunga södergård +1, +agricultural backyard, heavily eutrophicated, in tall grass near stable manure pile +; + +58.9207 ° N +, +17.5212 ° E + +; ca + +20 m +a. s. l. + +; + +9–19 Aug. 2004 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023133 +( + +NHRS + +) + +. • + +1 ♀ +; +Uppland +, +Håbo kommun +, +Biskops-Arnö +, +northern beach, elm grove +; + +59.6721 ° N +, +17.5009 ° E + +; ca + +10 m +a. s. l. + +; + +20 May- 20 Jun. 2005 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023136 +( + +NHRS + +) + +. • + +1 ♀ +; +Uppland +, +Uppsala kommun +, +Ekdalen +, +herb-rich open oak forest +; + +59.9715 ° N +, +18.355 ° E + +; ca + +40 m +a. s. l. + +; + +21 Jul. - 4 Aug. 2003 + +; +Swedish Malaise Trap Project +(Swedish Museum of Natural History) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023135 +( + +NHRS + +) + +. • + +1 ♀ +; same collection data as for preceding + +23 Aug. - 6 Sep. 2004 + +; + +NHRS + +- +HEVA 000023134 +( + +NHRS + +) + +. • + +1 ♂ +; +Uppland +, +Vallentuna +, +forest +; + +19 Jul. 1959 + +; +Karl-Johan Hedqvist +leg.; +sweep net +; + +NHRS + +- +HEVA 000023137 +( + +NHRS + +) + +. + + + +Switzerland +• +1 ♀ +; +Genève +, +La Louton +; + +12 Aug. 1960 + +; +André Comellini +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Neuchâtel +, +Auvernier +; + +2 Aug. 1960 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; same collection data as for preceding + +5 Aug. 1959 + +; specimen at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +8 Aug. 1957 + +; specimen at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +18 Aug. 1986 + +; specimen at + +MHNG + + +. • + +1 ♀ +; same collection data as for preceding + +26 Aug. 1956 + +; specimen at + +MHNG + + +. • + +1 ♀ +; same collection data as for preceding + +28 Aug. 1956 + +; specimen at + +MHNG + + +. • + +1 ♂ +; same collection data as for preceding + +31 Aug. 1956 + +; specimen at + +MHNG + + +. • + +1 ♂ +; +Vaud +, +Bussigny +; + +26 Jul. 1958 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. • + +1 ♂ +; +Vaud +, +Lutry + +Aug. 1956 + +; +Jacques Aubert +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; +Vaud +, +Pampigny +; + +19 Jun. 1960 + +; +Jacques de Beaumont +leg.; specimen at + +MHNG + + +. + + + + +Biology. + +Summer species, flying mainly from May to October, peak in August. Collected mainly in deciduous forest and in open nemoral habitats. + + + +Distribution. + + +Verified by morphological examination: +Belgium +, +Denmark +, +Germany +, +The Netherlands +, +Norway +, +Sweden +, +Switzerland +, +United Kingdom +(locus + +typicus + +: +England +, near London or Windsor forest). + +No DNA barcode matches with publicly available sequences from other countries. + +Lowland species, occurring in elevations below +400 m +a. s. l. + + + + +Remarks. + + +We remove + +A. ensifer + +from the synonymy with + +A. immunis + +that was established by +Fergusson (1986) +. + + +Walker’s original name + +Anacharis ensifer + +was changed into + +A. ensifera + +by +Reinhard (1860) +. While +Thomson (1862) +maintained + +‘ +ensifer + +’, most authors from +Cameron (1890) +on followed Reinhard’s emendation. However, + +‘ +ensifer + +’ can be a noun as well as an adjective (and Walker’s intentions are not clear in the description), but Reinhard’s emendation for gender agreement purposes makes sense only if it is an adjective. § 31.2. +2 in +the zoological code ( +ICZN +1999) clearly states that in such ambiguous cases it is to be treated as a noun, thus the original spelling is retained and the gender ending remains unchanged. + + +Almost all specimens of + +A. ensifer + +show an intermediate stage of sculpturing of the mesoscutellum between + +A. immunis + +(largely smooth) and + +A. norvegica +Mata-Casanova & Pujade-Villar, 2018 + +(finely foveate on both dorsal and posterior surface of the mesoscutellum), with the exception of + + +ZFMK + +-TIS-2629272 + +, which has a largely smooth mesoscutellum like in + +A. immunis + +but clusters within + +A. ensifer + +by its CO 1 barcode sequence. + + + +Anacharis ensifer + +falls within the diagnosis of + +A. immunis + +in +Mata-Casanova et al. (2018) +and thus the two host records and all distributional data given therein must be re-evaluated considering the existence of two species behind + +A. immunis +sensu +Mata-Casanova et al. (2018) + +. + + +Works prior to +Fergusson (1986) +describe + +A. ensifer + +largely based on colouration, but always state a smooth mesoscutellum (e. g. +Reinhard 1860 +& +von Dalla-Torre and Kieffer 1910 +), which is not in line with our findings. Historical literature records therefore require critical evaluation, too. + + + + \ No newline at end of file diff --git a/data/E6/62/DF/E662DF396B0B530DBD91D657B5B14F1F.xml b/data/E6/62/DF/E662DF396B0B530DBD91D657B5B14F1F.xml new file mode 100644 index 00000000000..993dc8b70ad --- /dev/null +++ b/data/E6/62/DF/E662DF396B0B530DBD91D657B5B14F1F.xml @@ -0,0 +1,1397 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis martinae +Vogel, Forshage & Peters + +sp. nov. + + + + +Figs 2 F +, +3 C +, +12 A – E + + + + +Diagnosis + + +(n = 18). +Belongs to the + +eucharioides + +species group. Medium sized species (2.6–3.3, mean +2.9 mm +, similar to + +A. eucharioides + +, + +A. petiolata + +and + +A. typica + +). Different from + +A. petiolata + +and + +A. typica + +in having a centrally carinate mesoscutellum (Fig. +12 D +, centrally smooth in + +A. petiolata + +and + +A. typica + +). Different from + +A. eucharioides + +by having oblique carinae on the lateromedial area of the pronotum (Fig. +12 B +). This character is shared with + +A. belizini + +, which is an Indomalayan species described from +Thailand +. + +Anacharis martinae + +differs from + +A. belizini + +by having a larger glabrous area on the clypeus medioventrally (largely pubescent in + +A. belizini + +) (Fig. +12 C +) and a brown to dark-brown metasoma (black in + +A. belizini + +) (Fig. +12 A +). +WIPs +: The band pattern of the fore wings reaching along about half the length of the non-sclerotised vein M (Fig. +2 C +, reaching along at least 2 / 3 the length of the non-sclerotised vein M in all other species, including those of the + +immunis + +species group). The apical spot of the hind wing fills almost the entire apical area (Fig. +2 C +, filling about half the apical area in other species of the + +eucharioides + +species group). + + + + + + + +Anacharis martinae + +sp. nov. +, holotype, female ( + +ZFMK +-TIS-2640787 + +) +A +lateral habitus +B +mesosoma lateral +C +face frontal +D +mesoscutum and mesoscutellum dorsal +E +mesosoma posterior view. + + + + + +Description. + + + +Both sexes. +Size +. + +Body: +♀ +2.6–3.2 (3.2) mm, +♂ +2.3–2.9 mm +. Antennae: +♀ +1.7–2.3 (2.1) mm, +♂ +2–2.3 mm +. Fore wing: 2.1–2.8 (2.5) mm + + + +Colour +. + +Body black to reddish-brown (Fig. +12 A +); base of scape usually (Fig. +12 A, C +), head always (Fig. +12 A, C +), base of mandibles usually (Fig. +12 C +), mesosoma usually (Fig. +12 A, B, D, E +), coxa to a varying degree (Fig. +12 A +), hind-trochanter usually basally, and petiole usually black (Fig. +12 A +); scape usally apically (Fig. +12 C +), rest of antennae (Fig. +12 A +), tegulae (Fig. +12 B, D +) and metasoma brown (Fig. +12 A +); mandibles & palps (Fig. +12 C +) and rest of legs (Fig. +12 A +) testaceous. + + + +Head +. + +Roundish-trapezoid in frontal view, genae gently kinked, in an angle <90 ° to the vertical axis of the face (Fig. +12 C +); lower face with thick silvery hairs, densely punctured (Fig. +12 C +); clypeal margin bilobed, somewhat flanged upwards, clypeus otherwise convex, medioventrally smooth, otherwise punctate (Fig. +12 C +); malar area with coriaceous texture, reaching from ventral eye margin along entire stretch of mandibular base (Fig. +18 B +), anteroventral corner of mandibular base sometimes smooth; genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin; upper face with somewhat thinner setae, punctured, with usually shallow median dent; space between toruli sometimes transversally striolate, intertorular distance: torulus to eye distance 1.4–2.0 (1.9); eyes with scattered setae, extent varying (Fig. +12 C +); POL: OOL: LOL: OD 2.4–2.8 (2.6): 1.2–2.1 (1.3): 1–1.4 (1.2): 1, POL: petiole length 0.45–0.75 (0.59); vertex pubescent between lateral ocellus and compound eye, small glabrous area anterior of median ocellus reaching until median dent of upper face; head in dorsal view 1.9–2.5 (2.3) times wider than long, laterally longer than medially; vertex and occiput sometimes with shallow and smooth median furrow, occiput with transverse striae (Fig. +12 D +), interrupted medially by furrow if present. + + + +Antennae +. + +♀ +formula: + +1.9–2.3 (2.1): 1: 2.1–2.8 (2.5): 1.6–2.1 (2.0): 1.4–2 (1.8): 1.3–1.9 (1.8): 1.3–1.7 (1.6): 1.3–1.6 (1.6): 1.3–1.7 (1.5): 1.3–1.6 (1.4): 1.1–1.5 (1.4): 1.1–1.5 (1.4): 2.1–2.5 (2.3) + +♂ +formula: + +1.6–2.7: 1: 2 – 2.9: 1.6 – 2.5: 1.4 – 2.3: 1.3 – 2: 1.3 – 1.9: 1.3 – 2.1: 1.3 – 2: 1.3 – 2: 1.1 – 2: 1.1 – 2: 1.3 – 2 + + +Mesosoma +. + +Mesosoma 1.3–1.4 (1.4) times longer than high (Fig. +12 B +); pronotal plate variable in sculpture, usually smooth with some few radial carinae; pronotum laterally setose, with longitudinal carinae along entire stretch reaching the posterior margin (Fig. +12 B +), sometimes somewhat branching; mesopleuron without coriaceous texture, rugulose anteroventrally, setose anteroventrally and along ventral margin, otherwise glabrous (Fig. +12 B +); mesopleural line merging with posteroventral hypocoxal furrow, ventral margin somewhat continuous, dorsally marked by influent striae (Fig. +12 B +); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit, posterodorsally smooth and shiny; axillulae well delimited (Fig. +12 B +), inside setose and longitudinally striate; mesoscutum 1.0–1.2 (1.1) times wider than long and 1.3–1.5 (1.4) times longer than the mesoscutellum (Fig. +12 D +); notauli distinct, sometimes deep, with weak or strong transversal carination inside that is less dense than in + +A. eucharioides + +, usually surrounded by weak to strong wrinkles (Fig. +12 D +); median lobe of mesoscutum setose, gradually weakening towards posterior end (Fig. +12 D +), lateral lobes denser setose along outer margins than along inner margins; mesoscutellar foveae sometimes each delimited by a circumfoveal carina (Fig. +12 D +), which is sometimes not fusing with median carina; median carina sometimes extending over entire dorsal surface of mesoscutellum (Fig. +12 D +), sometimes interrupted, rarely completely absent, usually accompanied by lateral carinae that are less distinct but are not prone to disappear among general reticulate inside (as in + +A. eucharioides + +); posterior surface of mesoscutellum medially broadly raised (Fig. +12 E +), evenly setose, with one, two or more (sub-) median longitudinal carinae (Fig. +12 E +), rarely branching, laterally smooth to reticulate; dorsal axillular area laterally rugose to striate (Fig. +12 D – E +); sculpture of propodeum variable; nuchal collar usually with a narrow tooth dorsomedially (Figs +6 C +, +12 E +). + + + +Wings +. + +Marginal cell of fore wing 2.5–2.8 (2.6) times longer than wide (Fig. +2 C +). +WIPs +(Fig. +2 C +): Purple band pattern of fore wing reaching along about half the length of vein M. Apical spot of hind wing large, filling almost entire apical area. + + + +Metasoma +. + +0.9–1.2 (1.2) times longer than rest of body (Fig. +12 A +); gaster 2.1–2.4 (2.4) times longer than petiole (Fig. +12 A +); petiole 1.0–1.6 (1.4) times longer than hind coxa (Fig. +12 A +); metasomal tergite 2 (T 2) with 0–4 (2) lateral setae on each side, with irregular punctures, T 3-4 with narrow bands of punctures, dorsally usually interrupted, T 5 with broad band of punctures, decreasing in width on T 6-7, T 7 with few setae along the band and more setae in posterior half than in the anterior half. + + + +Male genitalia +. + +Parameral plate submedially widened, basoventral margin rounded, without tooth. + + +Males. +Flagellomeres dorsoventrally bicoloured yellow-dark brown, gaster shorter than in females. T +7 in +males almost entirely punctured except medially, long setae across surface, except on smooth area. + + + + +Variation. + + +The specimens from the Bavarian Forest National Park ( + +BC- + + +ZSM + +-HYM-27596 + +-F 10 + +& + +BC- + + +ZSM + +-HYM-27596 + +-F 09 + +) are in colouration similar to the +holotype +(Fig. +12 +), but more distinct, i. e. the head is distinctly darker than the rest of the body. They are also smaller than the average. + + +ZFMK + +-TIS-2640713 + +has a strong sculpture on its pronotal plate, whilst other specimens are rather smooth and of weaker sculpture. + + +ZFMK + +-TIS-2640791 + +has a completely smooth dorsal surface of the meso-scutellum but fits otherwise well within the species morphologically. + + + + +CO 1 barcode. + + +n = 18. Maximum intraspecific distance = 2.3 %. Minimum distance to closest species ( + +A. eucharioides + +) = 7.9 %. CO 1 barcode consensus sequence: + +AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTATCTGGTTCCTCTAA TACTAATTTCTCCTGATATAGCCTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCATCCCT ATTTTTAATAACAATAAATTTATTTATTGATCAAGGAGCTGGTACAGGATGAACTGTATACCCTCCACTA TCCTCCTTAACGGGTCATCCATCAATATCAGTAGATTTAGTTATTTATTCTCTTCATTTAAGAGGAATTT CTTCAATTCTTGGTTCAATTAATTTTATTGTAACAATTTTAAATATACGAATAAACTCAATAACAATAGA TAAAATTTCATTATTCATTTGATCTATTTTTTTAACAACTATTTTACTATTATTATCATTACCTGTATTA GCTGGAGGTTTAACAATATTACTTTTTGATCGAAACTTAAATACATCATTTTTTGATCCTACAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT + + + +Type material. + + + + + +Holotype + +. + +Germany +• +♀ +; +Hesse +, +Waldeck-Frankenberg +, +National park Kellerwald-Edersee +, +Banfehaus +, +old floodplain of the Banfe +; + +51.167 ° N +, +8.9749 ° E + +; ca + +270 m +a. s. l. + +; + +22 Jul. - 5 Aug. 2021 + +; +GBOL +III leg.; +Malaise trap (Krefeld version) +; + +ZFMK +-TIS-2640787 + +. + + + + + + +Paratypes + +. + +Germany +• +2 ♂♂ +; same collection data as for holotype; + +ZFMK +-TIS-2640788 + +, + +ZFMK +-TIS-2640791 + + +. • + +1 ♂ +; +Bavaria +, +Bavarian Forest National Park +; + +48.937 ° N +, +13.42 ° E + +; ca + +830 m +a. s. l. + +; + +1 Jun. 2013 + +; + +BC- + +ZSM +-HYM-27764 + +-H 01 + +( + +ZSM + +) + +. • + +1 ♀ +, +1 ♂ +; +Bavaria +, +Bavarian Forest National Park +; + +49.099 ° N +, +13.233 ° E + +; ca + +710 m +a. s. l. + +; + +1 Jun. 2013 + +; female - + +BC- + +ZSM +-HYM-27596 + +-F 10 + +( + +ZSM + +); male - + +BC- + +ZSM +-HYM-27596 + +-F 09 + +( + +ZSM + +) + +. • + +1 ♂ +; +Bavaria +, +Garmisch-Partenkirchen +, +Zugspitze +, +mountain +; + +47.4062 ° N +, +11.0095 ° E + +; ca + +1970 m +a. s. l. + +; + +20 Jun. - 5 Jul. 2018 + +; +Doczkal, D. +, +Voith, J. +leg.; +Malaise trap +; + +ZFMK +-TIS-2637892 + +( + +NHMUK + +) + +. • + +1 ♂ +; +Hesse +, +Gießen +, +Hohberg +, +Großen-Buseck +; + +50.6196 ° N +, +8.7844 ° E + +; ca + +300 m +a. s. l. + +; + +17 Jun. 2021 + +; +GBOL +III leg.; +sweep net +; + +ZFMK +-TIS-2629493 + + +. • + +1 ♂ +; +Hesse +, +Rheingau-Taunus +, +Lorch am Rhein +, +above Nollig castle +; + +50.0495 ° N +, +7.7966 ° E + +; ca + +250 m +a. s. l. + +; + +17–25 Jun. 2015 + +; +Niehuis +, +Oliver +leg.; +Malaise trap +; MF 3; + +ZFMK +-TIS-2628231 + + +. • + +1 ♀ +, +2 ♂♂ +; +Hesse +, +Waldeck-Frankenberg +, +National park Kellerwald-Edersee +, +Maierwiesen +; + +51.1555 ° N +, +9.0015 ° E + +; ca + +370 m +a. s. l. + +; + +22 Jun. - 8 Jul. 2021 + +; +GBOL +III leg.; +Malaise trap (Krefeld version) +; female - + +ZFMK +-TIS-2640809 + +( + +NHRS + +); males - + +ZFMK +-TIS-2640804 + +, + +ZFMK +-TIS-2640805 + +( + +NHRS + +) + +. • + +1 ♀ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Banfe-Haus +“; + +51.167 ° N +, +8.9749 ° E + +; ca + +270 m +a. s. l. + +; + +7–21 Jul. 2022 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640770 + + +. • + +1 ♀ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Große Küche +“; + +51.1564 ° N +, +8.9879 ° E + +; ca + +320 m +a. s. l. + +; + +19 Aug. - 2 Sep. 2021 + +; +GBOL +III leg.; +Malaise trap +; + +ZFMK +-TIS-2640690 + +( + +NHMUK + +) + +. • + +1 ♀ +, +2 ♂♂ +; +Hesse +, +Waldeck-Frankenberg +, +NP Kellerwald-Edersee +, „ +Maierwiesen +“; + +51.1555 ° N +, +9.0015 ° E + +; ca + +370 m +a. s. l. + +; + +8–22 Jul. 2021 + +; +GBOL +III leg.; +Malaise trap +; female - + +ZFMK +-TIS-2640734 + +( +SMNS +); males - + +ZFMK +-TIS-2640731 + +, + +ZFMK +-TIS-2640733 + +( +SMNS +) + +. • + +1 ♀ +; +Rhineland-Palatinate +, +Ahrweiler +, +Niederzissen +, +Bausenberg +, +upper part of volcanic mountain, next to oak tree +; + +50.4672 ° N +, +7.2212 ° E + +; ca + +310 m +a. s. l. + +; + +26 May- 12 Jun. 2022 + +; +Jaume-Schinkel +, +Santiago +leg.; +Gressit Malaise trap +; + +ZFMK +-TIS-2640713 + + +. + + + + +Other material examined. + + +Without DNA barcode. + +Belgium +• +1 ♀ +; +Walloon Region +, +Namur +, +Nismes +; + +50.0744 ° N +, +4.5556 ° E + +; ca + +220 m +a. s. l. + +; + +10 Jul. 2022 + +; +W. Declercq +leg.; +Light trap +; + + +ZFMK + +-HYM-00039668 + +( +RBINS +) + +. • + +1 ♀ +; +Walloon Region +, +Tellin +, +Ri d’Howisse +; + +50.1113 ° N +, +5.2531 ° E + +; ca + +260 m +a. s. l. + +; + +18 Jul. 2022 + +; +W. Declercq +leg.; +Light trap +; + + +ZFMK + +-HYM-00039667 + +( +RBINS +) + +. + + + +France +• +1 ♂ +; Bitche; + +7 Aug. 1979 + +; +Henk J. Vlug +leg.; +sweep net +; specimen in coll MF + +. + + + +Sweden +• +1 ♂ +; +Hälsingland +, +Skog +sn, +Noran +; + +5 Aug. 1949 + +; +Olov Lundblad +leg.; + +NHRS + +- +HEVA 000023178 +( + +NHRS + +) + +. • + +1 ♂ +; +Scania +, +Ystad +kommun, +Sandhammaren +, +Järahusen +, oak shrub forest on coastal sand dunes; + +55.4038 ° N +, +14.1999 ° E + +; ca + +10 m +a. s. l. + +; + +22 May- 15 Jul. 2005 + +; +Swedish Malaise Trap +Project +( +Swedish Museum of Natural History +) leg.; +Malaise trap +; + +NHRS + +- +HEVA 000023179 +( + +NHRS + +) + +. + + + +Switzerland +• +1 ♂ +; +Neuchâtel +, +Auvernier +; + +8 Aug. 1957 + +; + + +Jacques +de Beaumont + + +leg.; specimen at + +MHNG + + +. • + +1 ♀ +; same collection data as for preceding + +15 Aug. 1956 + +; specimen at + +MHNG + + +. + + + + +Biology. + +Summer species, flying mainly from June to September, peak in July. No clear preferences in terms of habitat. + + + +Distribution. + + +Belgium +, +France +, +Germany +(locus + +typicus + +: Kellerwald-Edersee National Park, Banfehaus), +Sweden +, +Switzerland +. + +No DNA barcode matches with publicly available sequences from other countries. + +Mainly collected in lowlands below +400 m +a. s. l., occasionally found in higher altitudes at +700–900 m +a. s. l. and rarely even higher. + + + + +Etymology. + +Named after the first author’s wife, Martina Vogel. + + + +Remarks. + + +In the molecular analysis, + +A. martinae + +is split into two clades by ASAP. The gap between the two clusters is 2.3 % and cannot be attributed to poor quality sequences. As ASAP is the only analysis to split this cluster by that gap and we cannot find morphological evidence for a split into two species, we regard this result as an oversplit. + + +The diagnosis against + +A. belizini + +is based on the description and the accompanying SEM images of the +holotype +in +Mata-Casanova et al. (2018) +. There, + +A. belizini + +is described as having a smooth occiput. In the SEM images, however, we can see occipital striolation or striation, which would match with the diagnosis of the + +eucharioides + +species group. In +Mata-Casanova et al. (2018) +, + +A. belizini + +is said to be most similar to + +A. antennata + +, while we think that + +A. antennata + +is much closer morphologically to + +A. petiolata + +/ + +typica + +based on the SEM images provided, showing the interrupted mesopleural line, the smooth mesoscutellum and the smooth to rugose lateromedial area of the pronotum. + + +On the SEM images of + +A. belizini + +, the pronotal plate is significantly laterally projecting in dorsal view (Fig. +3 +. C. in +Mata-Casanova et al. (2018) +vs. Fig. +12 D +). This is not the case in + +A. martinae + +, and shape of the pronotal plate could be another diagnostic feature to separate + +A. belizini + +and + +A. martinae + +. Additionally, the parascutal sulcus seems very strongly impressed and carinate in + +A. belizini + +, much more so than in any of our specimens of + +A. martinae + +(Fig. +12 B +). As we discussed in the treatment of + +A. eucharioides + +, the parascutal sulcus is very variable and cannot be used as a diagnostic character. If such extremes as present in + +A. belizini + +are consistent or not is currently impossible to evaluate because there is only a single specimen (the +holotype +) known for + +A. belizini + +. + + +The morphometric analysis (Fig. +8 B +) revealed overlap with the remaining species of the + +eucharioides + +species group. However, the morphospace overlaps only partially, which allows us to make statements of inclusive and exclusive ranges in the two ratios extracted as separating species best. The intertorular distance: torulus to eye distance (Fig. +8 B +, right) ranges from 1.4 to 2.0, but no other species than + +A. martinae + +has a ratio of higher than 1.7, making> 1.7 to 2.0 the exclusive + +A. martinae + +range. For POL: petiole length, a ratio of> 0.7 is exclusive for + +A. martinae + +, but any ratio below could be other species. While we included the ratios in the description of the species, we refrained from including them in the diagnosis. This partial separation between + +A. martinae + +and the remaining species in the morphometric analyses again highlights the morphometric variability of the species in + +Anacharis + +(see also remarks on + +A. eucharioides + +) but also points towards the potential power of morphometric analyses which will prove helpful in delimitation of another species ( + +A. maxima + +, see below). + + + + \ No newline at end of file diff --git a/data/F3/BF/97/F3BF97FDC1E7589497F898377B0F506B.xml b/data/F3/BF/97/F3BF97FDC1E7589497F898377B0F506B.xml new file mode 100644 index 00000000000..424cc91ec71 --- /dev/null +++ b/data/F3/BF/97/F3BF97FDC1E7589497F898377B0F506B.xml @@ -0,0 +1,357 @@ + + + +Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species + + + +Author + +Vogel, Jonathan +0000-0002-7102-0231 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Forshage, Mattias +Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden + + + +Author + +Bartsch, Saskia B. +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Ankermann, Anne +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Mayer, Christoph +0000-0001-5104-6621 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +von Falkenhausen, Pia +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Rduch, Vera +0000-0002-6499-2876 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Müller, Björn +0000-0001-6233-5410 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Braun, Christoph +https://orcid.org/0009-0003-1312-5953 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Krammer, Hans-Joachim +https://orcid.org/0009-0008-7012-1752 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + + + +Author + +Peters, Ralph S. +0000-0001-7784-9203 +Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany + +text + + +Journal of Hymenoptera Research + + +2024 + +2024-08-29 + + +97 + + +621 +698 + + + +journal article +10.3897/jhr.97.131350 +EA190992-B01B-4F1B-A362-A4549C725580 + + + + + +Anacharis +Dalman, 1823 + + + + + + + + +Anacharis +Dalman, 1823 + + +- +Type +species: + +Cynips eucharioides +Dalman, 1818 + +. + + + + + + +Megapelmus +Hartig, 1840 + + +- +Type +species: + +Megapelmus spheciformis +Hartig, 1840 + +(= + +Anacharis eucharioides +(Dalman, 1818 )) + +. + + + + + + +Synapsis +Förster, 1869 + + +- +Type +species: + +Synapsis aquisgranensis +Förster, 1869 + +(= + +Anacharis immunis +Walker, 1835 + +), homonymous with beetle genus + +Synapsis +Bates, 1868 + +. + + + + + + +Prosynapsis +Dalla Torre & Kieffer, 1910 + + +- +Type +species: + +Prosynapsis aquisgranensis +(Förster, 1869) + +(= + +Anacharis immunis +Walker, 1835 + +) - replacement name for + +Synapsis +Förster, 1869 + +, due to the aforementioned homonymy. + + + + + +Diagnosis. + + +The genus + +Anacharis + +is characterised by an elongate, smooth petiole (sometimes with some vague longitudinal striae, but never sculptured as in + +Aegilips +Walker, 1835 + +and + +Xyalaspis +Hartig, 1843 + +). The mesoscutellum does not overhang the propodeum (as sometimes in + +Aegilips + +and always in + +Xyalaspis + +). The mesoscutellum is posteriorly rounded, never extended apically (usually pointed in + +Aegilips + +, pointed or extended into a spine in + +Xyalaspis + +). The mesoscutellum always possesses a posterior carina that separates the mesoscutellum into a dorsal and posterior surface (circumscutellar carina absent, indistinct or present in + +Aegilips + +and + +Xyalaspis + +). The circumscutellar carina is sometimes posteriorly flanged upwards, appearing tooth-like in lateral view (never flanged upwards in + +Aegilips + +and + +Xyalaspis + +, if carina is present). The mesopleural line is exhibited as a rugose and / or striate furrow, often extending from the anterior to close to the posterior margin of the mesopleuron (mesopleural sculpture in + +Aegilips + +and + +Xyalaspis + +not concentrated in any sort of furrow but equally spread out along anterior margin, sometimes reduced to the anterior half of mesopleuron or totally absent). The metasoma is apically pointed, especially in females (metasoma apically ending more abruptly in + +Aegilips + +and + +Xyalaspis + +). The occiput is either smooth, striolate, or striate (smooth in + +Aegilips + +and + +Xyalaspis + +). The upper face has a usually shallow to sometimes more distinct median dent (Fig. +4 C +, usually absent in + +Aegilips + +and + +Xyalaspis + +Fig. +4 D +). + + + + +Etymology and grammatical gender. + + +Derived from Greek “ Ana (ἀνά, up, back, against, above, across, throughout, again, counter) ” and “ charis (Χάρις, grace, beauty, favour, loveliness) ”. Dalman describes + +Anacharis + +as looking similar to eucharitids ( +Dalman 1823 +) and arguably wanted to emphasise them as at least a “ counterbeauty ” to the eucharitids. + + +The grammatical gender of + +Anacharis + +is female (as used in +Westwood 1833 +and discussed in +Reinhard 1860 +). + + + + +Remarks. + + +The most recent diagnoses of the genus are presented in +van Noort et al. (2015) +and +Mata-Casanova et al. (2016) +. The differential diagnosis presented here is a complemented version of the previous diagnoses. It aims to characterise the genus in the Western Palaearctic fauna by differentiating it against + +Aegilips + +and + +Xyalaspis + +, which are the only other anacharitine genera known from the Western Palaearctic. The added characters have not been evaluated as to their diagnostic value for the anacharitine fauna outside the Western Palaearctic. + + + + \ No newline at end of file