From da510e7bfbae0c85bb9bf51c10c50bea22ab05ca Mon Sep 17 00:00:00 2001 From: ggserver Date: Wed, 4 Sep 2024 23:24:19 +0000 Subject: [PATCH] Add updates up until 2024-09-04 23:22:14 --- .../AD/0388AD1CFF918140FF7516E0FCFD9801.xml | 406 +++++++++++++ .../AD/0388AD1CFF96814AFF7514D3FC819F99.xml | 305 ++++++++++ .../33/038A33206419FFC8FF63F98BF7259002.xml | 321 +++++++++++ .../33/038A3320641BFFCEFF63F9CDF0DF9146.xml | 318 +++++++++++ .../33/038A3320641FFFCAFF63F857F73690DA.xml | 447 +++++++++++++++ .../87/039F87EBFFDC9B5410E6F98F08609F78.xml | 100 ++++ .../87/039F87EBFFDC9B5410E6FC6B08759CB8.xml | 102 ++++ .../87/039F87EBFFDF9B5710E6FDCA0ADB9C1E.xml | 152 +++++ .../E8/03A2E801FF9AFFACD6DF5FF6ABD75B92.xml | 496 ++++++++++++++++ .../24/03D12430FFD8BC4BB4CD8614FB54C262.xml | 214 +++++++ .../6A/2C176A0BFFC59C5A3EA8AE1B521A133A.xml | 296 ++++++---- .../E3/4827E337FFFC1449FF32125DFC7722EC.xml | 174 ++++++ .../E3/4827E337FFFC144AFF3215B5FBA22F66.xml | 208 +++++++ .../E3/4827E337FFFE1444FF3210CBFC1825BA.xml | 204 +++++++ .../87/761787C0A000FF917AA3FB5EE2B6FB3E.xml | 539 ++++++++++++++++++ .../87/761787C0A007FF8C7AA3FA3EE576FB12.xml | 512 +++++++++++++++++ 16 files changed, 4686 insertions(+), 108 deletions(-) create mode 100644 data/03/88/AD/0388AD1CFF918140FF7516E0FCFD9801.xml create mode 100644 data/03/88/AD/0388AD1CFF96814AFF7514D3FC819F99.xml create mode 100644 data/03/8A/33/038A33206419FFC8FF63F98BF7259002.xml create mode 100644 data/03/8A/33/038A3320641BFFCEFF63F9CDF0DF9146.xml create mode 100644 data/03/8A/33/038A3320641FFFCAFF63F857F73690DA.xml create mode 100644 data/03/9F/87/039F87EBFFDC9B5410E6F98F08609F78.xml create mode 100644 data/03/9F/87/039F87EBFFDC9B5410E6FC6B08759CB8.xml create mode 100644 data/03/9F/87/039F87EBFFDF9B5710E6FDCA0ADB9C1E.xml create mode 100644 data/03/A2/E8/03A2E801FF9AFFACD6DF5FF6ABD75B92.xml create mode 100644 data/03/D1/24/03D12430FFD8BC4BB4CD8614FB54C262.xml create mode 100644 data/48/27/E3/4827E337FFFC1449FF32125DFC7722EC.xml create mode 100644 data/48/27/E3/4827E337FFFC144AFF3215B5FBA22F66.xml create mode 100644 data/48/27/E3/4827E337FFFE1444FF3210CBFC1825BA.xml create mode 100644 data/76/17/87/761787C0A000FF917AA3FB5EE2B6FB3E.xml create mode 100644 data/76/17/87/761787C0A007FF8C7AA3FA3EE576FB12.xml diff --git a/data/03/88/AD/0388AD1CFF918140FF7516E0FCFD9801.xml b/data/03/88/AD/0388AD1CFF918140FF7516E0FCFD9801.xml new file mode 100644 index 00000000000..60d51158705 --- /dev/null +++ b/data/03/88/AD/0388AD1CFF918140FF7516E0FCFD9801.xml @@ -0,0 +1,406 @@ + + + +New synonyms, lectotypifications and taxonomical notes on the genus Flemingia (Phaseoleae, Papilionoideae, Leguminosae) from Thai-Indochinese floristic region + + + +Author + +Do, Truong Van +Vietnam National Museum of Nature, Vietnam Academy of Science & Technology, 18 th Hoang Quoc Viet Road, Cau Giay, Ha Noi, Vietnam. & CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, P. R. China + + + +Author + +Xu, Bo +CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, P. R. China + + + +Author + +Gao, Xin-Fen +CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, P. R. China + +text + + +Phytotaxa + + +2018 + +2018-05-29 + + +351 + + +1 + + +41 +52 + + + + +http://dx.doi.org/10.11646/phytotaxa.351.1.3 + +journal article +10.11646/phytotaxa.351.1.3 +1179-3163 +13687753 + + + + + + +Flemingia paniculata +Wall. ex Benth. (1852: 245) + +. Type:— +MYANMAR +. Ataran river, +Wall.Cat. 5759 +( +holotype +K- + + + +001122037!, +isotype +BM-000958663!) + + + + + + + +Flemingia sarmentosa +Craib (1927: 69) + + +. Type:— +THAILAND +. Maharat, elev. +360 m +, +15 February 1912 +, +A.F.G. Kerr 2380 +( +holotype +ABD!, +isotype +BM-000958670!) + +syn. nov +. + + + + +Note: +— +Wallich (1831) +originally enumerated + +F. paniculata + +in A Numerical List of Dried Specimens based on the specimen number +Wall.Cat. 5759, +collected from Ataran river, +Myanmar +( +Figure 5 +), but without a description of the species. Thus, + +F. paniculata + +was illegitimate. Later, +Miquel (1852) +not only validated this name with a full description of the species, but also annotated that + +F. paniculata + +is most similar to + +F. strobilifera + +by sharing an unifoliolate leaves and clearly distinguished by inflorescence differences. Nearly one century later, +Craib (1927) +described + +F. sarmentosa + +as a new species on the basis of the specimen +A.F.G. Kerr 2380 +collected from +Thailand +( +Figure 6 +). The author also mentioned that the species is most similar to + +F. paniculata + +by sharing a simple leaf and a racemose inflorescence with flower not enclosed by large folded bracts, but the latter is only distinct from the former by the difference of calyx length. However, our recent examination of protologues and +type +specimens of these two species showed the calyx length of + +F. sarmentosa + +is variable during its flower lifespan and not clearly different from + +F. paniculata +. + +Furthermore, other morphological characters of + +F. sarmentosa + +are mostly identical to those found in + +F. paniculata + +( +Table 2 +). Hence, the former is conspecific with the latter, and is treated here as a new synonym of the latter. + + + +TABLE 2. +Comparison of morphological characters of + +F. paniculata + +and + +F +. sarmentosa + +. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+Characters + + +F. paniculata + +* + + +F. sarmentosa + +** +
BranchletsVillousVillous
LeavesUnifoliolate, ovate-cordateUnifoliolate, ovate and cordated at base
Basal veins55
Lateral veins5–6 pairs6–8 pairs
Petiole1.5–2.3 mm long1.2–2.3 mm long
Inflorescence axilAxillary, sometimes branched, up to one-two the length of leaf bladeAxillary, sometimes branched, up to one-two the length of leaf blade
BractOvate to ovate-lanceolate, ca. 8–10 mm long, and not enclosed the flowerLinear and acute to acuminate at apex, ca. 10 mm long, and not enclosed the flower
FlowerSmall, ca. 10 mm longSmall, ca. 10 mm long
Calyx lobeLanceolate, shorter than corolla, ca. 5–7 mm longLinear-lanceolate, shorter than corolla, ca. 7 mm long
CorollaPurplePurple
Flowering timeJanuary to AprilMarch
+
+ + + +* + +Characters following +Miquel (1852) +, +Sa & Gilbert (2010) +and our own observation of type specimens. + + + +** + +Characters following +Craib (1927) +and our own observation of type specimens. + + + + +FIGURE 5 +. Holotype of + +Flemingia paniculata + +(K-001122037). + + + + +FIGURE 6 +. Holotype of + +Flemingia sarmentosa +(ABD) + +. + + + + +FIGURE 7 +. Lectotype of + +Flemingia sootepensis + +(E-00157794). + + + + +FIGURE 8 +. Syntype of + +Flemingia sootepensis + +(P-00709079). + + + + + + +Flemingia sootepensis + +Craib (1911: 43) + + + +. +Lectotype +( +designated here) +:— +THAILAND +. +Chieng Mai +: +Doi Sootep +, + +16 January 1910 + +, + +A.F.G. Kerr +934 + +(BM-000958671!, +isolectotypes +BM-000958672!, E-00157794!, P-00709078!); + +1 January 1905 + +, + +C.C. Hosseus +309 + +( +syntypes +P-00709079!, +M-0168856 +!). + + + +Note: +—When +Craib (1911) +described this species from Doi Sootep, Chieng Mai, +Thailand +, he cited +two specimens +in the protologue, e.i. +A.F.G. Kerr 934 +at E (E-00157794), BM (BM-000958671, BM-000958672), P (P-00709078) ( +Figure 7 +) and +C.C. Hosseus 309 +at P (P-00709079), M (M-0168856) ( +Figure 8 +), without designating the +holotype +. A search of these +syntypes +at relevant herbaria revealed that the specimen +A.F.G. Kerr +934 at E (E-00157794) has complete branches of open flowers and mature fruits, which match very well with the diagnostic characters of the species mentioned in the protologue, and selected here as the +lectotype +of the species ( +Figure 7 +). The remaining duplicates at BM and P are designated here as the +isolectotype +. + +
+
+
\ No newline at end of file diff --git a/data/03/88/AD/0388AD1CFF96814AFF7514D3FC819F99.xml b/data/03/88/AD/0388AD1CFF96814AFF7514D3FC819F99.xml new file mode 100644 index 00000000000..cd07f02497f --- /dev/null +++ b/data/03/88/AD/0388AD1CFF96814AFF7514D3FC819F99.xml @@ -0,0 +1,305 @@ + + + +New synonyms, lectotypifications and taxonomical notes on the genus Flemingia (Phaseoleae, Papilionoideae, Leguminosae) from Thai-Indochinese floristic region + + + +Author + +Do, Truong Van +Vietnam National Museum of Nature, Vietnam Academy of Science & Technology, 18 th Hoang Quoc Viet Road, Cau Giay, Ha Noi, Vietnam. & CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, P. R. China + + + +Author + +Xu, Bo +CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, P. R. China + + + +Author + +Gao, Xin-Fen +CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration and Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, P. R. China + +text + + +Phytotaxa + + +2018 + +2018-05-29 + + +351 + + +1 + + +41 +52 + + + + +http://dx.doi.org/10.11646/phytotaxa.351.1.3 + +journal article +10.11646/phytotaxa.351.1.3 +1179-3163 +13687753 + + + + + + + + +Flemingia fluminalis +Clarke ex +Prain (1897: 438) + + +. +Lectotype +(designated by +Nguyen 1979 +):— +MYANMAR +. +Kachin +: + + + + +Hukaung valley, +Griffithi 1675 +( +lectotype +K, +isolectotype +P-00709080!) + + + + + + + +Flemingia cavaleriei +( + +H. Lév.) +Lauener (1970: 244) + + + +. +Lectotype +( +designated here) +:— +CHINA +. +Guizhou +: +Pienyang-Lofou +route, + +November 1905 + +, + +P.J. Cavalerie +2579 + +(E-00157784!) + +syn. nov +. + + + + +Basionym: + +Geissaspis cavaleriei +H. Lév. (1913: 533) + +. + + +Note: +—When +Prain (1897) +described this species, he cited five gatherings, e.i. +Clarke 19777 +, +Lister 117 +, +Griffith 1675 +, +Kurz 2525 +, and +King’s collector s.n. +, without designating the +holotype +. Later, +Nguyen (1979) +selected +Griffith +’s collection, +Griffith 1675 +at K (not seen) and P (P-00709080) made from Hukaung valley, +Myanmar +as the +lectotype +of the species ( +Figure 1 +). Therefore, a recently additional designation of the specimen +Clarke 19777C +(CAL-0000012301) by + +Gavade +et al. +(2016) + +as the +lectotype +of + +F. fluminalis + +is superfluous due to a valid +lectotype +. + + + + +From a view of the morphological characters, + +F. fluminalis + +is most similar to + +F. chappar +Buchanan-Hamilton ex Bentham (1852: 244) + +and + +F. strobilifera +(Linnaeus) +Aiton (1812: 350) + +by sharing a thyrse inflorescence with flowers enclosed by large folded bracts, but it clearly differs from these two species by the diagnostic characters of leaves (a lanceolate leaflet blade with very short petiole vs. orbicular-cordate with much longer petiole). +Nguyen (1979) +considered + +F. fluminalis + +was insufficient distinct as a separate species and regarded it as a new variety, + +F. strobilifera +var. +fluminalis +(Clarke ex Prain) Nguyen Van Thuan (1979: 143) + +. This treatment was lately adopted by Van der Measen +et al. +(1985), but not supported by +Wei (1991) +, +Sa & Gilbert (2010) +, and + +Gavade +et al. +(2016) + +. Indeed, it may be easily distinguished from + +F. strobilifera + +by having a narrowly oblong to lanceolate leaflet blade with a very short or sessile petiole and acute at base (vs. an ovate to broadly elliptic leaflet blade with a much longer petiole and rounded or slightly cordate at base) and inflorescence not branched (vs. sometime branched). Hence, we here accept + +F. fluminalis + +as a separate species. + + +Léveillé (1913) +originally described + +Geissaspis cavaleriei + +on the basis of +two specimens +collected by +P.J. Cavalerie +( +P.J. Cavalerie 2579 +& +2269 +) from +Guizhou +, +China +, but the author did not indicate the +holotype +of the species. Later, +Lauener (1970) +transfered it to the genus + +Flemingia + +without designating the +lectotype +as well. Therefore, a designation of the +lectotype +is necessary here. Notably, this species was not mentioned in the recent treatments of the genus + +Flemingia + +for the Indo-Chinese floristic region ( +Nguyen 1979 +, +Wei 1991 +, +Sa & Gilbert 2010 +). A search of these +two specimens +at relevant herbaria revealed that +P.J. Cavalerie 2622 +at E (E-00157786) (not “2269” as +Léveillé (1913) +and +Lauener (1970)) +has digitately 3-foliolate leaves and a long petiole, which do not match with the protologue. Whilst +P.J. Cavalerie 2579 +at E (E-00157784) possesses simple leaves with a lanceolate leaf blade and very short petiole, and flowers enclosed by large bracts, which matches very well with the protologue, and selected here as the +lectotype +of the species ( +Figure 2 +). Furthermore, these diagnostics characters are mostly identical to those of + +F. fluminalis + +that previously described by Clarke (1897) from +Myanmar +and distributes throughout the Indo-Chinese region. Therefore, + +F. cavaleriei + +is proposed here as a new synonym of the latter. + + + + \ No newline at end of file diff --git a/data/03/8A/33/038A33206419FFC8FF63F98BF7259002.xml b/data/03/8A/33/038A33206419FFC8FF63F98BF7259002.xml new file mode 100644 index 00000000000..33f6b137598 --- /dev/null +++ b/data/03/8A/33/038A33206419FFC8FF63F98BF7259002.xml @@ -0,0 +1,321 @@ + + + +New species of Eugenia (Myrtaceae) from São Paulo state, Brazil + + + +Author + +Mazine, Fiorella F. +Departamento de Ciências Ambientais, Universidade Federal de São Carlos - campus Sorocaba, Rod. João Leme dos Santos, km 110, 18052 - 780, Sorocaba, SP, Brazil. + + + +Author + +Meireles, Leonardo Dias +Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, USP Leste, Av. Arlindo Béttio, 1000, 03828 - 000, São Paulo, SP, Brazil. + + + +Author + +Sobral, Marcos +Departamento de Ciências Naturais, Universidade Federal de São João del-Rei, Praça Dom Helvécio, 74, 36301 - 160, São João del-Rei, MG, Brazil. + + + +Author + +Valdemarin, Karinne Sampaio +Programa de Pós-Graduação em Recursos Florestais, Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Caixa Postal 9, 13418 - 900, Piracicaba, SP, Brazil. + +text + + +Phytotaxa + + +2017 + +2017-02-20 + + +296 + + +3 + + +265 +273 + + + + +http://dx.doi.org/10.11646/phytotaxa.296.3.5 + +journal article +10.11646/phytotaxa.296.3.5 +1179-3163 + + + + + +2. + +Eugenia pithecocephala +Sobral & Mazine + +, + +sp. nov. + + + + + + +Type: +— + +Brazil +. +São Paulo +: mun. +Peruíbe +, +Estação Ecológica Jureia-Itatins +, +Guarauzinho +, +Restinga +da +praia do Arpoador +, + +22 June 1994 + +, + +M. R. F. Melo +, +I. Cordeiro +, +R. J. Oliveira +& +M. Barros +1072 + +( +holotype +: SORO!; +isotypes +: BHCB!, +SP +!, UB!). +Figure 2 + +. + + +This species is related to + +Eugenia grandissima +Sobral, Mazine & E.A.D.Melo + +( + +Sobral +et al. +2016: 63–67 + +), distinguished by the smaller leaves (petioles +9–11 mm +long and blades 22.0–24.5 × +8.8–10.5 cm +vs. +petioles +15–25 mm +long and blades 45.0–55.0 × 11.0–18.0 cm) and the costate fruits ( +vs. +smooth) with five seeds ( +vs. +seven). + + +Tree ca. + +5 m +. + +Plant covered with simple brownish trichomes. Twigs terete, sometimes markedly longitudinally striate, densely covered with simple brownish trichomes, the internodes 50–65 × +9–11 mm +. Leaves with petioles terete, 9–11 × +4 mm +, densely pilose as the twigs; blades elliptic-lanceolate, 22–24.5 x +8.8–10.5 cm +, 2.3–2.5 times longer than wide, concolorous when dry, adaxially with simple brownish trichomes mostly along the midvein, scattered along the surface and somewhat denser over the lateral veins and margin, abaxially uniformly covered with trichomes to +1 mm +; glandular dots scarcely visible on both sides and more evident through light, slightly impressed adaxially, slightly prominent abaxially, 6–10/mm², of unequal sizes, the larger ones to +0.1 mm +diam.; apex acute; base obtuse; midvein impressed adaxially and strongly raised abaxially; lateral veins 15–17 at each side, visible on both sides and raised abaxially, leaving the midvein at angles of 45–60 degrees; marginal veins two, the inner one +3–4 mm +, the outer ca. +1 mm +from the margin, the margin itself slightly revolute. Inflorescences axillary, racemiform, apparently with to 6 flowers, the axis ca. 17 × +3 mm +(in fruit collection), densely covered with red-brown simple trichomes; bracts, flower buds unknown. Pedicels terete (in fruit collection), 3–5 × +2–3 mm +, pilose as the axes; bracteoles rounded (observed in one fruit only), 3 × +5 mm +, the apex rounded, densely pilose externally, more sparsely internally, probably deciduous at some point; calyx lobes four, rounded, 4–5 × +6–7 mm +(observed in fruit collection), covered with trichomes externally, more densely on the base. Fruits oblong, 43–50 × +23–30 mm +, strongly costate, densely pilose, with about five seeds to 13–14 × +9–13 mm +, with dark brown testa when dry; embryos not examined. + + + + +Distribution, habitat, and phenology: +— + +Eugenia pithecocephala + +is presently known only from the +type +material, collected in “restinga arbustivo arborea” of the Jureia-Itatins Ecological Station, specifically in the municipality of Peruíbe. Flowers were not collected; fruits were collected in June. + + +Conservation: +—The locality of Jureia-Itatins Ecological Station has an area of +792 km +², with about 7,500 botanical collections ( +CRIA 2016 +), resulting in an average of 9.5 collections/km², which can be considered as a good sampling effort. The existence of only one collection of + +Eugenia pithecocephala + +is an indicative of its rarity, principally considering the high amount of collections per square kilometers of the site. This locality lies in a protected area that does not allow sustainable uses, just scientific activities. The rarity of this species could be confirmed by the area of occupancy (AOO; see +IUCN 2016 +) estimated via Geocat ( + +Bachman +et al. +2011 + +) is +4 km +² (criterion B2 of +IUCN 2016 +). Moreover, it is known from only one locality, where the habitat quality is declining due the anthropic pressure (criterion a(i) and b(iii) of IUCN).We suggest including + +Eugenia pithecocephala + +under the Critically Endangered (CR) category of IUCN Red List for the present. + + + +FIGURE 2. + +Eugenia pithecocephala +Sobral & Mazine + +—unmounted holotype deposited at SORO (scale 5 cm). + + + +Affinities: +—This species is apparently related to the recently described + +Eugenia grandissima +Sobral, Mazine & E.A.D.Melo + +( + +Sobral +et al. +2016: 63 + +), differing by the characters given in the diagnosis (specially the smaller leaves and costate fruits). + +Eugenia grandissima + +grows in rainforests and forest edges in the eastern portion of +Minas Gerais state +, while + +E. pithecocephala + +is from +resting +vegetation of +São Paulo state +. Considering the large leaves, + +Eugenia pithecocephala + +is also apparently related to the southeastern Brazilian + +Eugenia umbrosa +O. +Berg (1857 + +–1859: 582), differing by the pilose leaves (glabrous in + +E. umbrosa + +) and the strongly costate fruits (smooth in + +E. umbrosa + +).According to the phylogenetic scheme proposed by + +Mazine +et al. +(2014) + +, + +Eugenia pithecocephala + +(as + +E. grandissima + +and + +E. umbrosa +— + +the latter sampled in that analysis) should be circumscribed in “ + +Eugenia + +clade 9” ( + +Eugenia +sect. +Umbellatae +O.Berg + +). + + + + +Etymology: +—The epithet +“pithecocephala +” means “monkey head”, alluding the vernacular name referred (in Portuguese) in the label of the +type +collection, “cabeça-de-mico”. + + + + \ No newline at end of file diff --git a/data/03/8A/33/038A3320641BFFCEFF63F9CDF0DF9146.xml b/data/03/8A/33/038A3320641BFFCEFF63F9CDF0DF9146.xml new file mode 100644 index 00000000000..ba8f8670613 --- /dev/null +++ b/data/03/8A/33/038A3320641BFFCEFF63F9CDF0DF9146.xml @@ -0,0 +1,318 @@ + + + +New species of Eugenia (Myrtaceae) from São Paulo state, Brazil + + + +Author + +Mazine, Fiorella F. +Departamento de Ciências Ambientais, Universidade Federal de São Carlos - campus Sorocaba, Rod. João Leme dos Santos, km 110, 18052 - 780, Sorocaba, SP, Brazil. + + + +Author + +Meireles, Leonardo Dias +Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, USP Leste, Av. Arlindo Béttio, 1000, 03828 - 000, São Paulo, SP, Brazil. + + + +Author + +Sobral, Marcos +Departamento de Ciências Naturais, Universidade Federal de São João del-Rei, Praça Dom Helvécio, 74, 36301 - 160, São João del-Rei, MG, Brazil. + + + +Author + +Valdemarin, Karinne Sampaio +Programa de Pós-Graduação em Recursos Florestais, Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Caixa Postal 9, 13418 - 900, Piracicaba, SP, Brazil. + +text + + +Phytotaxa + + +2017 + +2017-02-20 + + +296 + + +3 + + +265 +273 + + + + +http://dx.doi.org/10.11646/phytotaxa.296.3.5 + +journal article +10.11646/phytotaxa.296.3.5 +1179-3163 + + + + + +1. + +Eugenia binata +Mazine & Sobral + +, + +sp. nov. + + + + + + +Type: +— + +BRAZIL +. +São Paulo +: mun. +Ilhabela +, +Parque Estadual da Serra do Mar +, estrada para +Castelhanos +, trilha +da Água Branca +, próximo das parcelas 22 e 24, + +29 June 2000 + +, + +J.B. Baitello +, +F.T. Rocha +& +O. T. Aguiar +1769 + +( +holotype +: +BHCB +!; +isotypes +BHCB!, SPSFphoto!). +Figure 1 + +. + + +This species is related to + +Eugenia lomeroensis +Villarroel & Gomes-Bezerra + +( + +Villarroel +et al. +2014: 316–320 + +), being distinguished by the larger leaf blades (petioles +6–7 mm +long and blades 7.5–10.4 × +3–4.1 cm +vs. +petioles +1–2 mm +long and blades 1.5–2.6(–3) × +0.4–0.7 cm +), larger flower buds ( +3–4 mm +diam. +vs. +1–2 mm +diam.) and ovary densely pubescent ( +vs. +glabrous). + + +Tree (height unregistered). Plants glabrous except for the flowers with ovaries densely beset with simple white trichomes to +0.1 mm +. Twigs terete, sometimes moderately longitudinally striate, gray or light brown when dry, the internodes 30–50 × +1–2 mm +. Leaves with petioles markedly canaliculate adaxially, 6–7 × +0.8–1 mm +, usually with visible glands; blades elliptic to narrowly elliptic, 7.5–10.4 × +3–4.1 cm +, 2.3–2.8 times longer than wide, drying dull green, very slightly or not at all discolorous, glabrous; glandular dots visible and raised on both sides, 4–6/mm², of unequal sizes, the larger ones to +0.1 mm +diam.; apex acuminate in +6–8 mm +; base cuneate; midvein finely impressed adaxially and raised abaxially; lateral veins 15–18 at each side, minutely raised on both sides, a little more so abaxially, leaving the midvein at angles of about 60 degrees; secondary lateral veins of a smaller gauge and scarcely visible; marginal veins two, the inner one +3.5–4.5 mm +, the outer one +0.5–1.5 mm +from the margin, the margin itself revolute and finely undulate. Inflorescences axillary or ramiflorous, racemiform, consistently biflorous, the axis 2–3 × +0.4–0.8 mm +; bracts elliptic, 11.2 × +0.5 mm +, glabrous, persisting; pedicels terete, 2–3 × +0.4–0.5 mm +, glabrous; bracteoles elliptic, 0.9–1 × +0.7 mm +, the apex rounded, glabrous, probably persisting at anthesis; flower buds obovate, 4.5–5 × +3–4 mm +, ovary with scattered trichomes; calyx lobes four, in two unequal pairs, the outer ones hemispheric, 1–1.4 × +2–2.3 mm +, the inner ones widely ovate, to 2 × +2.5–2.8 mm +, sometimes with scattered trichomes but usually glabrous and with cilia to +0.1 mm +; petals four, rounded, ca. +4 mm +in diam., glabrous; stamens not counted, filaments +2.5–3 mm +long in bud, the anthers globose, +0.5–0.6 mm +in diam., with one connective gland; staminal ring circular to +1.7 mm +in diam.; calyx tube to +0.5 mm +deep; style to +3 mm +, the stigma punctiform; ovary with two locules and 4–5 ovules per locule. Fruits unknown. + + + + +Distribution, habitat, and phenology: +— + +Eugenia binata + +is presently known only from the +type +material, collected at Serra do Mar State Park, in the municipality Ilhabela, where it grows in coastal Atlantic forests. Fruits were not collected; young flowers were collected in June. + + + +FIGURE 1. + +Eugenia binata +Mazine & Sobral. + +a +. Holotype deposited at BHCB (scale 5 cm). +b +. Detail of inflorescences (scale 1 cm). + + + +Conservation: +—The Serra do Mar State Park, a mosaic of coastal Atlantic forests remnants, includes the Ilhabela municipality. It has an area of +347.5 km +² ( +IBGE 2016 +) with about 5,000 botanical collections ( +CRIA 2016 +), resulting in an average of 14.4 collections/km², which classifies it as having a good sampling effort. The existence of only the +type +collection of + +Eugenia binata + +is an indicative of its rarity, particularly when considering the high amount of collections per square kilometers at the locality. Although this locality lies in a protected area, it allows sustainable uses, specifically tourist activity, which is difficult to analyse as a risk for the habitat. The rarity of + +Eugenia binata + +could be confirmed by the area of occupancy (AOO; see +IUCN 2016 +) estimated via Geocat ( + +Bachman +et al. +2011 + +) is +4 km +² (criterion B2 of +IUCN 2016 +). Moreover, its known from just one locality and the habitat quality is declining due the anthropic pressure (criterion a(i) and b(iii) of IUCN). We suggest including + +Eugenia binata + +under the Critically Endangered (CR) category of IUCN Red List for the present. + + +Affinities: +—Apparently related to + +Eugenia lomeroensis +Villarroel & Gomes-Bezerra + +(for description see + +Villarroel +et al. +2014 + +), from which it is distinguished by the characters given in the diagnosis (specially the longer petioles and the hypanthium densely pubescent) and the habit (tree +vs. +shrub). + + + + +Etymology: +—The epithet +“binata +” means “twinned”, alluding the paired flowers of this species. + + +Taxonomic notes: +—In a new ongoing phylogenetic analysis of + +Eugenia + +(Mazine +et al. in prep. +), + +Eugenia binata + +has been sampled and appeared as sister to “ + +Eugenia + +clade 8” ( + +Eugenia +sect. +Racemosae +O. Berg + +). Those authors preferred not to include this species in that clade, once it has flowers in pairs, being the only species with this flower arrangement that was sampled in that analysis. They suggest that it may consist a different clade, with a few species sharing this arrangement with flowers in pairs, very peculiar in + +Eugenia + +, as + +E. lomeroensis +Villarroel & Gomes-Bezerra + +, for example. They mention that a broader sampling, in this case would be necessary. + + + + \ No newline at end of file diff --git a/data/03/8A/33/038A3320641FFFCAFF63F857F73690DA.xml b/data/03/8A/33/038A3320641FFFCAFF63F857F73690DA.xml new file mode 100644 index 00000000000..a3d7ebec988 --- /dev/null +++ b/data/03/8A/33/038A3320641FFFCAFF63F857F73690DA.xml @@ -0,0 +1,447 @@ + + + +New species of Eugenia (Myrtaceae) from São Paulo state, Brazil + + + +Author + +Mazine, Fiorella F. +Departamento de Ciências Ambientais, Universidade Federal de São Carlos - campus Sorocaba, Rod. João Leme dos Santos, km 110, 18052 - 780, Sorocaba, SP, Brazil. + + + +Author + +Meireles, Leonardo Dias +Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, USP Leste, Av. Arlindo Béttio, 1000, 03828 - 000, São Paulo, SP, Brazil. + + + +Author + +Sobral, Marcos +Departamento de Ciências Naturais, Universidade Federal de São João del-Rei, Praça Dom Helvécio, 74, 36301 - 160, São João del-Rei, MG, Brazil. + + + +Author + +Valdemarin, Karinne Sampaio +Programa de Pós-Graduação em Recursos Florestais, Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Caixa Postal 9, 13418 - 900, Piracicaba, SP, Brazil. + +text + + +Phytotaxa + + +2017 + +2017-02-20 + + +296 + + +3 + + +265 +273 + + + + +http://dx.doi.org/10.11646/phytotaxa.296.3.5 + +journal article +10.11646/phytotaxa.296.3.5 +1179-3163 + + + + + +3. + +Eugenia sulcatifolia +L.D. Meireles & Mazine + +, + +sp. nov. + + + + + + +Type: +— + +Brazil +. +São Paulo +: mun. +Ubatuba +, fazenda +Capricórnio +, trilha parcela F, +Parque Estadual da Serra do Mar +, núcleo +Picinguaba +, +23°22’52”S +, +45°04’45”W +, + +105 m + +, + +03 January 2006 + +[erroneously referred as +2009 in +the collection label], + +J.A.M.A. Gomes +& +C.B. Virillo +649 + +( +holotype +: +UEC +!; +isotypes +: IAC!, +RB +!, SORO!). +Figure 3 + +. + + +This species is related to + +Eugenia umbrosa +O. +Berg (1857 + +–1859: 656) from which it can be distinguished by the broader leaf blades ( +8.1–16.8 cm +vs. +4.8–5.0 cm), obovate bracteoles ( +vs. +ovate bracteoles) and slightly costate ovary ( +vs. +smooth). + + +Tree to + +5 m +. + +Plants glabrous except for the leaves, sometimes with simple red-brown trichomes, the flowers (pedicels and ovaries) and fruits covered with simple and ochraceous or red-brown trichomes to +0.5 mm +. Twigs terete to moderately aplaned, gray when dry, the internodes 50–160 × +2.5–5.1 mm +. Leaves with petioles terete to slightly canaliculate adaxially, 8–15 × +2–4.1 mm +, rugose; blades widely elliptic to oblong-elliptic, 16–33 × +8.1–16.8 cm +, 1.8–1.9 times longer than wide, drying dull green, slightly concolorous, glabrous or sometimes with red-brown simple trichomes arise the midveins and laterals veins, bullate when fresh, rugose when dry; glandular dots occasionally somewhat raised on both sides and evident through light, 6–8/mm², of unequal sizes, the larger ones to +0.1 mm +diam.; apex acuminate to cuspidate; base widely attenuate to obovate, sometimes cordate; midvein plane adaxially, strongly raised abaxially; lateral veins 13–21 at each side, plane adaxially, raised abaxially, leaving the midvein at angles of 70–75 degrees; marginal veins two, the inner one +2.8–7.3 mm +, the outer one +0.9–1.3 mm +from the margin, the margin itself plane to slighted revolute. Inflorescences terminal, axillary or occasionally ramiflorous, umbelliform, apparently with 3–5 flowers, the axis +1–3.5 mm +long, glabrous to puberulous, with rufescent simple trichomes; bracts ovate to triangulate, 1.2–1.3 × +0.9–1.7 mm +, glabrous or covered with red-brown trichomes to +0.5 mm +, deciduous; pedicels terete, plane to slightly canaliculate, 5.8–9.4 × +0.7–0.9 mm +in flower and 4.7–22.9 × +1.3–2.6 mm +in fruit, covered with red-brown or ochraceous simple trichomes to +0.5 mm +; bracteoles obovate to triangulate, 1.5–4.6 × +1–3.1 mm +, the apex acuminate, concave, slightly costate, punctate, persisting at anthesis; flower buds globose, costate 6.8–8.8 × +5–6.5 mm +, ovary uniformly covered by simple red-brown trichomes to +0.5 mm +; calyx lobes four, in two unequal pairs, widely ovate, punctate and concave, the outer ones 5.5–5.8 × +6.7–8.1 mm +, the inner ones 2.1–2.8 × +2.3–3.9 mm +, uniformly covered by simple red-brown simple trichomes to +0.5 mm +as the ovary; petals four, elliptic, densely punctate, 11.2– 12.1 × +9.7–11.1 mm +, glabrous, the globe of petals visible in the same plane or above the calyx lobes; stamens ca. 150, filaments +6.2–17.7 mm +, the anthers elliptic, 1.1–1.5 × 0.7–1.0 mm, eglandular; staminal ring circular, +4.9–5.4 mm +in diam. and +1.4–1.5 mm +in width, glabrous; style +15–16 mm +, glabrous, the stigma slightly capitate and papillose; ovary with two locules and 6–9 centrally attached ovules per locule. Fruits ellipsoid to globose, +23.6–37.7 mm +diam., slightly costate, densely covered with ochraceous or red-brown trichomes to +0.5 mm +, with one to three globose seeds to 15.8 × +9.3 mm +, the testa not adhered to the endocarp, the embryo with cotyledons strongly coalescent, without a visible hypocotyl. + + + + +Distribution, habitat, and phenology: +— + +Eugenia sulcatifolia + +is a small tree from coastal lowland rainforest of the northern portion of Brazilian state of +São Paulo +, in the “Núcleo Picinguaba” of the State Park of Serra do Mar, in the municipality of Ubatuba. It was collected along the margins of Indaiá River in the Fazenda Capricórnio, and in Cachoeira da Canela at Trilha do Corisco, between 100 to 200 meters elev. Flowers were collected in January; fruits were collected between March and September. + + + +FIGURE 3. + +Eugenia sulcatifolia +L.D. Meireles & Mazine. + +a +. Holotype deposited at UEC. +b +. Detail of fruit from the paratype deposited at UEC (scale 2 cm). + + + +Conservation: +—The “Núcleo Picinguaba” of the State Park of Serra do Mar is located in the municipality of Ubatuba, from which are known all the collections of the species. It has an area of +724 km +² with ca. 6,500 botanical collections ( +CRIA 2016 +), resulting in an average of 8.9 collections/km², which can be considered a good sampling effort.Although these localities lie in a protected area, it allows sustainable uses, specifically tourist activities. + +Eugenia sulcatifolia + +is known from seven collections in three populations. The area of occupancy (AOO; see +IUCN 2016 +) estimated via Geocat ( + +Bachman +et al. +2011 + +) is +12 km +² (criterion B2 of +IUCN 2016 +) and the declining of habitat quality due the anthropic pressure (criterion a(i) and b(iii) of IUCN) suggested the inclusion of + +Eugenia pithecocephala + +under the Endangered (EN) category of IUCN Red List for the present. + + +Affinities: +—This species is apparently related to + +Eugenia umbrosa +O. +Berg (1857 + +–1859: 582), because of the glabrous twigs, rugose leaves, and persistent bracteoles at anthesis. They are set apart through the characters cited in the diagnosis. As referred above, + +Eugenia umbrosa + +has been sampled in the phylogeny of + +Eugenia + +proposed by + +Mazine +et al. +(2014) + +, being circumscribed in “ + +Eugenia + +clade 9” ( + +Eugenia +sect. +Umbellatae + +). We also believe + +Eugenia sulcatifolia + +is part of this same large clade. + + + + +Etymology: +—The epithet +“sulcatifolia +” is allusive to the deeply sulcate veins of the leaves. + + + + +Paratypes +: + +— +BRAZIL +. +São Paulo +: mun. +Ubatuba +, +Fazenda Capricórnio +, próximo ao +rio Indaiá +( +Parque Estadual da Serra do Mar +, +Núcleo Picinguaba +), +Floresta Ombrófila Densa Submontana +, + +23 +o +22’52”S + +, + +45 +o +04’45”W + +, + +105 m + +, + +06 March 2006 + +, + +J.A.M.A Gomes +& +C.B.Virillo +651 + +(IAC!) + +; + +Floresta Ombrófila Densa +de terras baixas, + +25 September 2006 + +, + +E. Ramos +, +R.B. Torres +& S. +Santos +s.n + +. (IAC 48262!, +UEC 178176 +!) + +; +04 January 2007 +, +E. Ramos, H. R. Gonçalves & S. Santos 167, 168 +(IAC!, HUFSJ); + +Subindo +a +Serra do Mar +, rumo a +Taubaté +, interior +da Mata +, + +29 July 1983 + +, + +J.R. Pirani +& O. +Yano +807 + +(SPF!, SP) + +; + +Picinguaba +, +Mata +Atlântica de Encosta, Trilha +do +Corisco +, + +23 +o +18’40” S + +, + +44 +o +48’44”W + +, + +150 m + +, + +19 September 1996 + +, + +M. +Sanchez +& +F. Pedroni +712 + +( +UEC +!, SP!) + +. + + + + \ No newline at end of file diff --git a/data/03/9F/87/039F87EBFFDC9B5410E6F98F08609F78.xml b/data/03/9F/87/039F87EBFFDC9B5410E6F98F08609F78.xml new file mode 100644 index 00000000000..a643c402c22 --- /dev/null +++ b/data/03/9F/87/039F87EBFFDC9B5410E6F98F08609F78.xml @@ -0,0 +1,100 @@ + + + +New names of fossil Berberidaceae + + + +Author + +Doweld, Alexander B. + +text + + +Phytotaxa + + +2018 + +2018-05-29 + + +351 + + +1 + + +72 +80 + + + + +http://dx.doi.org/10.11646/phytotaxa.351.1.6 + +journal article +10.11646/phytotaxa.351.1.6 +1179-3163 +13687822 + + + + + + +Alloberberis obliqua +(MacGinitie) Doweld + +, + +comb. nov. + + + + + + + +≡ + + +Mahonia obliqua +MacGinitie (1953: 111 + + +, pl. 26, fig. 5). + + + + + +Type +:—[fossil leaves] Florissant, +Colorado +, +USA +( +holotype +, 3617, Museum of Paleontology, University of +California +, Berkeley, +USA +). + + +Occurrence +:—Oligocene; North America ( +USA +). + +IFPNI + +: +1B2519F4-5DDC-93E3-99BE-ABD0E4D43515 +. + + + + \ No newline at end of file diff --git a/data/03/9F/87/039F87EBFFDC9B5410E6FC6B08759CB8.xml b/data/03/9F/87/039F87EBFFDC9B5410E6FC6B08759CB8.xml new file mode 100644 index 00000000000..f44d15314ee --- /dev/null +++ b/data/03/9F/87/039F87EBFFDC9B5410E6FC6B08759CB8.xml @@ -0,0 +1,102 @@ + + + +New names of fossil Berberidaceae + + + +Author + +Doweld, Alexander B. + +text + + +Phytotaxa + + +2018 + +2018-05-29 + + +351 + + +1 + + +72 +80 + + + + +http://dx.doi.org/10.11646/phytotaxa.351.1.6 + +journal article +10.11646/phytotaxa.351.1.6 +1179-3163 +13687822 + + + + + + +Alloberberis lobodonta +(Becker) Doweld + +, + +comb. nov. + + + + + + + +≡ + + +Mahonia lobodonta +Becker (1959: 35 + + +, fig. 1). + + + + + +Type +:—[fossil leaves] Ruby Basin, +Montana +, +USA +( +holotype +, +UMMP +No. 39566, Museum of Palaeontology, University of +Michigan +, Ann Arbor, +USA +). + + +Occurrence +:—Oligocene; North America ( +USA +). + +IFPNI + +:— +DC2EBBE5-2AB4-6819-5A83-395A43C61D63 +. + + + + \ No newline at end of file diff --git a/data/03/9F/87/039F87EBFFDF9B5710E6FDCA0ADB9C1E.xml b/data/03/9F/87/039F87EBFFDF9B5710E6FDCA0ADB9C1E.xml new file mode 100644 index 00000000000..14dd2961882 --- /dev/null +++ b/data/03/9F/87/039F87EBFFDF9B5710E6FDCA0ADB9C1E.xml @@ -0,0 +1,152 @@ + + + +New names of fossil Berberidaceae + + + +Author + +Doweld, Alexander B. + +text + + +Phytotaxa + + +2018 + +2018-05-29 + + +351 + + +1 + + +72 +80 + + + + +http://dx.doi.org/10.11646/phytotaxa.351.1.6 + +journal article +10.11646/phytotaxa.351.1.6 +1179-3163 +13687822 + + + + + + +Alloberberis axelrodii +Doweld + +, + +sp. nov. + + + + + + + +≡ + + +Mahonia sinuata +Axelrod (1985: 193) + + +, +nom. inval +. (Art. 40.1 of the ICN). + + + + + +Type +:—[fossil leaves] +2 miles +west of Fenwick ranch and about +7 miles +south of Rockville, Malheur Co., +Oregon +, +USA +( +holotype +, 17314, Museum of Palaeontology, University of +Michigan +, Ann Arbor, +USA +—illustrated by +Arnold 1936 +: pl. 2, figs. 3–4). + + + + +Description +:—Leaves with lanceolate to ovate leaflets having pinnate venation and obliquely cuneate bases; leaflets have 2–4 widely spaced, broad sinuses separated by lobes with sharp spines (after +Axelrod 1985 +). + + +Occurrence +:—Miocene; North America ( +USA +). + + +Eponymy +:—In honour of D. I. Axelrod (1910—1998), eminent American palaeobotanist. + + +IFPNI +:— +72DD25B8-5D3C-5B5F-AE85-6ED1335375C3 +. + + +Notes +:—The fossil-species + +Mahonia sinuata +Axelrod (1985: 193) + +was not validly published since the +type +was not designated (Art. 40.1 of the ICN). +Axelrod (1985) +related it to extant + +Mahonia eutriphylla +Fedde (1901: 91) + +, a part of the formerly + +Mahonia +section +Horridae + +, recently segregated into a separate genus + +Alloberberis + +. Therefore, a new name is proposed for + +M. sinuata + +. + + + + \ No newline at end of file diff --git a/data/03/A2/E8/03A2E801FF9AFFACD6DF5FF6ABD75B92.xml b/data/03/A2/E8/03A2E801FF9AFFACD6DF5FF6ABD75B92.xml new file mode 100644 index 00000000000..9e9a2b087d2 --- /dev/null +++ b/data/03/A2/E8/03A2E801FF9AFFACD6DF5FF6ABD75B92.xml @@ -0,0 +1,496 @@ + + + +Corydalis hualongshanensis, a new species of Corydalis sect. Fumarioides (Papaveraceae) from Shaanxi, China + + + +Author + +Wang, Dong +School of Life Sciences, Central China Normal University; Key Laboratory for Geographical Process Analysis & Simulation, Wuhan 430079, Hubei Province, P. R. China +395351998@qq.com + + + +Author + +Xu, Xiaodong +School of Life Sciences, Central China Normal University; Key Laboratory for Geographical Process Analysis & Simulation, Wuhan 430079, Hubei Province, P. R. China + + + +Author + +Liu, Ping +Hualongshan National Nature Reserve, Ankang 725000, Shaanxi Province, P. R. China + +text + + +Phytotaxa + + +2017 + +2017-05-23 + + +307 + + +2 + + +153 +158 + + + + +http://dx.doi.org/10.11646/phytotaxa.307.2.7 + +journal article +10.11646/phytotaxa.307.2.7 +1179-3163 +13687733 + + + + + + +Corydalis hualongshanensis +D.Wang + +, + +sp. nov. + +( +Figs. 1 +, +2 +& +3A +) + + + + + + +Type +: + +— +CHINA +. +Shaanxi Province +( + +Ớffl + +): Ankang City ( +Ǡẘḿ +), Hualongshan National Nature Reserve ( +ṁAEƜOiẎDZHṂDzṖỮ +), Baizigou ( +ffiừNj +), growing in mixed forest margins and forest understory, + +32°00 + +24.3 + +N + +, + +109°20 + +40.7 + +E + +, elev. +2250–2310 m +, +5 September 2016 +, +D.Wang 160437 +( +holotype +CCNU +!, +isotype +PE +!) + + + + +FIGURE 1. + +Corydalis hualongshanensis + +. A. Plant showing habit; B. Bract; C. Flower; D. lower petal (left: adaxial view, right: abaxial view); E. inner petals (left: adaxial view, right: abaxial view); F. stamen; G. pistil; H. stigmas; I. seed. Drawn by D. Wang from +D. Wang 160437 +(CCNU). + + + + +FIGURE 2. +A–G: Habit and morphology of + +Corydalis hualongshanensis + +. A. habit; B. inflorescence; C. fruit; D. sepal; E. the apical part of outer petal; F. Fruit; G. 1–8: 1. bract; 2. spur and nectary; 3. lower petal (left: adaxial view, right: abaxial view); 4. inner petal (left: adaxial view, right: abaxial view); 5. stamens (left: abaxial view, right: adaxial view); 6. pistil; 7. stigmas; 8. seed. Photo credits: D. Wang. + + + + +FIGURE 3. +A. + +Corydalis hualongshanensis + +. B(1–3). + +Corydalis pseudofargesii + +. 1. flower; 2. stigma; 3. fruit. C(1–3). + +Corydalis fargesii + +. 1. flower; 2. stigma; 3. fruit. D(1–3). + +Corydalis shennongensis + +. 1. flower; 2. stigma; 3. fruit. Photo credits: D. Wang. + + + + +Diagnosis: +—This species is closely related to + +C. fargesii + +in having entire floral bracts, obtuse crest overtopping apex on outer petals, slightly curved spur that is approximately two times as long as petal lobes, with nectary extended through 2/3–4/5 spur, rectangular stigma with 4 distinct apical papillae, and obovoid to cylindric capsule, but differs by its papillose-hairs finely distributed on the peduncle, the pedicel, the apical part of outer petal, and the surface of fruit. + + + + +Description: +—Biennial suberect to diffuse herbs, +0.5–1.2 m +tall. Taproot slender to swollen with numerous small fibrous roots. Stem ridged or narrowly winged, hollow and weak, leafy and much branched distally. Basal leaves early withering, petiole vaginate; middle and upper leaves with petiole 1–7(–12) cm long, blade broadly ovate, 9–15 × +7–13 cm +, 2(–3)- pinnate, primary leaflets distant, petiolulate; ultimate leaflets entire to 2–3-lobed, ovate to obovate, abaxial veins densely with thin papillae, apex obtuse. Racemes several, peduncle slender, papillose-hairy, +8–10 cm +long, with 10–23 flowers; bracts ovate to narrowly ovate, small, 1.5–2.5 × +0.6–1 mm +, entire, margin with papillose-hairs; pedicel +1–2 mm +long, finely papillose-hairy, recurved in fruit. Flower +20–23 mm +long (measured along curve), sepals ca. +0.5 mm +in diameter, rounded, dentate; corolla yellow; outer petals subacute, with obtuse usually dentate crest clearly overtopping apex, upper petal subacute, the apical part with finely papillose-hairs (except crest), spur slightly sigmoidally curved, cylindric, +15–17 mm +long, nectary ca. 2/3–4/5 as long as spur, thin, lower petal shallowly saccate, base shortly clawed, apex reflexed at anthesis; inner petals not dark tipped, +6–7 mm +long; ovary finely papillose-hairy, with 2–5 ovules, stigma rectangular, with 4 distinct apical papillae and 2–4 subterminal papillae (sometimes 2 of them confluent), a pair of submarginal lateral geminate papillae, and one small papilla at basal corners. Capsule explosively dehiscent, narrowly obovoid-cylindric, 4–8 × +2–2.5 mm +, finely papillose-hairy, 2–5-seeded; style ca. +3 mm +. Seeds in one row, ca. +1.5 mm +in diameter, smooth, elaiosome small, white. + + +Phenology: +—Flowering from July to September and fruiting from August to October. + + +Habitat and Distribution: +— + +Corydalis hualongshanensis + +occurs usually in mixed forest margins and forest understory with elevations ranging from ca. +1440 m +to +2310 m +. It is known only from a very restricted area in the Hualongshan National Nature Reserve, and two adjacent locations in Zhenping county, where are several kilometers southeast of the +type +locality. The forest is commonly dominated by + +Cornus walteri +Wangerin + +( +Cornaceae +), + +Betula albosinensis +Burkill + +( +Betulaceae +), + +Elaeagnus wushanensis +C.Y.Chang + +( +Elaeagnaceae +), + +Malus kansuensis +(Batalin) C.K.Schneid. + +( +Rosaceae +), and + +Rubus mesogaeus +Focke ex Diels + +( +Rosaceae +). + + + + +Etymology: +—The specific epithet refers to the geographic name of the +type +locality. + + +Chinese name suggested: +—Hua long shan huang jin ( +ṁAEƜẤAE +). + + +IUCN Red List category: +—Although a few localities of + +C. hualongshanensis + +have been found, it is probably more common than this number suggests. In the field, we discovered three populations of the species several kilometers apart from each other, each consisting of thousands of individuals. According to the criteria of IUCN Red List ( +IUCN 2012 +), the new species should be classified as DD (Data Deficient). + + + + +Additional specimens examined +( +paratypes +):— + +CHINA +. +Shaanxi +: +Zhenping +, +Miaobachun +( + +Û +ṄỦ + +), +Wuchigou +( + +Ƃ +ṀNj + +), + +31°57 + +48.31 + +N + +, + +109°23 + +6.79 + +E + +, elev. + +1518 m + +, + +1 September 2015 + +, + +Liuping. +019 + +( +CCNU +) + +; + +Miaoba +chun ( + +Û +ṄỦ + +), +Shimengou +( +ƁLJNj +), + +31°56 + +46.63 + +N + +, + +109°23 + +24.85 + +E + +, elev. + +1447 m + +, + +6 September 2016 + +, + +D.Wang + +& + +X.D.Xu +160441 + +( +CCNU +) + +. + + + + +Discussion: +— + +Corydalis hualongshanensis + +is most similar to + +C. fargesii + +, but differs in having papillose-hairs on the peduncle, the pedicel, the apical parts of outer petals and the fruit. It is also similar to + +C. pseudofargesii + +and + +C. shennongensis + +, but differs from the former by its bracts that is not divided and nectary that is about 2/3–4/5 length of spur, and from the latter by its spur that is two times as long as petal lobe, sepal that is rounded and about +0.5 mm +in diameter, and bract that is ovate and about 1.5–2.5 × +0.6–1 mm +( +Figs. 2 +& +3 +). In respect to stigma morphology of + +C. hualongshanensis + +, we found that the number of marginal papillae showed a little variation among individuals, while the outline of stigma and the number of apical papillae are stable. + +Corydalis hualongshanensis + +and the related species are compared with each other in table 1. The four species can also be distinguished by the following key. + + +Key to species of + +Corydalis hualongshanensis + +and morphologically related species + + + + + + + +1. Spur equaling petal lobe ........................................................................................................................................... + +C. shennongensis + + + + +- Spur ca. 2× as long as petal lobe ....................................................................................................................................................... 2 + + + + + +2. Nectary extended through ca. 1/3 of spur ................................................................................................................ + +C. pesudofargesii + + + + +- Nectary extended through 2/3–4 /5 of spur.......................................................................................................................................3 + + + + + +3. Pedicel, the apical part of outer petal and capsule glabrous ............................................................................................... + +C. fargesii + + + + + +- Pedicel, the apical part of outer petal and capsule finely papillose-hairy ......................................................... + +C. hualongshanensis + + + + + + + + \ No newline at end of file diff --git a/data/03/D1/24/03D12430FFD8BC4BB4CD8614FB54C262.xml b/data/03/D1/24/03D12430FFD8BC4BB4CD8614FB54C262.xml new file mode 100644 index 00000000000..4f18ef6a6ef --- /dev/null +++ b/data/03/D1/24/03D12430FFD8BC4BB4CD8614FB54C262.xml @@ -0,0 +1,214 @@ + + + +Spinulum lioui, a new species referred as to Lycopodium neopungens (Lycopodiopsida: Lycopodiaceae) in China + + + +Author + +Chen, De-Kui +College of Life Sciences, Chongqing Normal University, Shapingba, Chongqing 401331, China; + + + +Author + +Zhou, Xin-Mao +CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization, Chengdu Institute of Biology, Chinese Academy of Sciences, P. O. Box 416, Chengdu, Sichuan 610041, China. & Missouri Botanical Garden, P. O. Box 299, St. Louis, Missouri 63166 - 0299, U. S. A. + + + +Author + +He, Hai +College of Life Sciences, Chongqing Normal University, Shapingba, Chongqing 401331, China; + + + +Author + +Zhang, Li-Bing +Missouri Botanical Garden, P. O. Box 299, St. Louis, Missouri 63166 - 0299, U. S. A. + +text + + +Phytotaxa + + +2017 + +2017-05-23 + + +307 + + +2 + + +161 +163 + + + + +http://dx.doi.org/10.11646/phytotaxa.307.2.9 + +journal article +302285 +10.11646/phytotaxa.307.2.9 +872f1511-8434-48bf-847c-688c2bbcdb6c +1179-3163 +13687784 + + + + + + +Spinulum lioui +Li Bing Zhang & H.He + +, + +sp. nov. + +, +Fig. 1 +. + + + +Vernacular name: +DZỄệaeƃffi +. + + + + +Type:— +CHINA +: +Heilongjiang +: Xiaoxing’anling, Hongxing, Hongqi Experimental Forest Farm of +Beijing +Forestry College [48˚19 +ʹ +N +, 129˚19 +ʹ +E +], under + +Larix + +forest, +2 September 1963 +, + +T +. +N +. Liou et al. 10407 + +( +holotype +HIB-0099100!, +isotype +PE +!). + + +Diagnosis: This new species is most similar to + +Spinulum canadense + +, but the former has trophophylls acicular and sporophylls with broad membranous transparent erose margins, while the latter has trophophylls narrow-lanceolate to narrow-ovate and sporophylls with very narrow membranous transparent erose margins. + + +Stolons slender and creeping, up to +1.4 m +, green, with sparse trophophylls; lateral branches ascending, +8–17 cm +tall, 1–3 times forked, sparse, whole branches terete, stem together with leaves +8–12 mm +in diam. Trophophylls spirally arranged, dense, angled upward, acicular, 3–6 × +0.7–1.3 mm +, leathery, without transparent hairs, midrib indistinct abaxially, visible adaxially, base cuneate, decurrent, sessile, margins entire, apex acuminate. Strobili solitary, terminal on branchlets, erect, terete, sessile, +2–3.3 cm +× ca. +4 mm +; sporophylls broadly ovate, ca. 3 × +2 mm +, papery, with broad membranous transparent erose margins, apex acute. Sporangia enclosed. + + +Distribution and habitat:—Northeast +China +; forests, forest margins; ca. +1000 m +. + + +Etymology:—In honor of the late Prof. Tchen-Ngo Liou ( + +ḾDZỄ + +1898–1975), one of the founders of Chinese botany and one of the collectors of the +type +of this species. + + + +FIGURE 1. +Holotype of + +Spinulum lioui + +(HIB-0099100).—A. Habit.—B. Trophophylls.—C. Strobilus. + + + +Notes:— + +Lycopodium neopungens + +is a nom. nov. for + +L. pungens +La Pylaie ex +Iljin (1934: 117) + +, non +Alderwerelt (1915: 26) +, based on the invalid name “ + +L. annotinum +var. +pungens +La Pylaie ex Desvaux + +” (1827: 182), with its +type +(not designated) from Europe. At species rank, + +L. canadense + +is the oldest name ( +Haines 2003 +). +Zhang & Iwatsuki (2013) +also suspected that all these names represent the same species. + + +One duplicate of the type ( +isotype +) at +PE +, examined by LBZ in the 1990s, was not found by us. + + + + \ No newline at end of file diff --git a/data/2C/17/6A/2C176A0BFFC59C5A3EA8AE1B521A133A.xml b/data/2C/17/6A/2C176A0BFFC59C5A3EA8AE1B521A133A.xml index 0a81a102e41..ef72f10530e 100644 --- a/data/2C/17/6A/2C176A0BFFC59C5A3EA8AE1B521A133A.xml +++ b/data/2C/17/6A/2C176A0BFFC59C5A3EA8AE1B521A133A.xml @@ -1,45 +1,45 @@ - - - -Beyond appearances: the genus Ernassa Walker, 1856 (Lepidoptera, Erebidae, Arctiinae, Phaegopterina) and the description of eight new species + + + +Beyond appearances: the genus Ernassa Walker, 1856 (Lepidoptera, Erebidae, Arctiinae, Phaegopterina) and the description of eight new species - - -Author + + +Author -Grados, Juan -Universidad Nacional Mayor de San Marcos, Museo de Historia Natural, Departamento de Entomología, Lima, Perú +Grados, Juan +Universidad Nacional Mayor de San Marcos, Museo de Historia Natural, Departamento de Entomología, Lima, Perú -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-08-13 + +2024 + +2024-08-13 - -5493 + +5493 - -4 + +4 - -301 -327 + +301 +327 - -http://dx.doi.org/10.11646/zootaxa.5493.4.1 + +http://dx.doi.org/10.11646/zootaxa.5493.4.1 -journal article -10.11646/zootaxa.5493.4.1 -1175-5326 -13330137 -9CEA6F9D-A998-4967-8E00-AC2BE9A0AE13 +journal article +10.11646/zootaxa.5493.4.1 +1175-5326 +13330137 +9CEA6F9D-A998-4967-8E00-AC2BE9A0AE13 @@ -115,9 +115,9 @@ is narrow, elongate and somewhat curved, whereas - + Type material: - + HOLOTYPE @@ -126,14 +126,12 @@ macho ( ): PERÚ -. -MADRE DE DIOS +. MADRE DE DIOS . 1 male , -Albergue Refugio -Amazonas +Albergue Refugio Amazonas , 12°52’30”S , @@ -157,7 +155,7 @@ macho ( JGA-MUSM ). 9 - + PARATYPES . @@ -166,10 +164,10 @@ macho ( . 1 female , -Albergue Refugio - - + +Albergue Refugio Amazonas + , 12°52’30”S , @@ -185,18 +183,28 @@ macho ( , D. Couceiro ( -MUSM +MUSM , ART-476 -JGA COLLECTION -)(Voucher DNA barcoding, -ARCT #139 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, + +ARCT +#139 + JGA-MUSM )(GENITALIA # JGA-1315 , -MUSM -); +MUSM +); + + 1 male , idem except, @@ -207,13 +215,17 @@ macho ( & D. Couceiro ( -MUSM +MUSM , ARCT-498 COLLECTION -)(Voucher DNA barcoding, Arct # 161 +)(Voucher +DNA +barcoding, Arct # 161 JGA-MUSM -); +); + + 1 male , idem except, @@ -222,29 +234,43 @@ macho ( , D. Couceiro ( -MUSM +MUSM , ARCT-855 -JGA COLLECTION -)(Voucher DNA barcoding, Arct # 518 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct # 518 JGA-MUSM )(GENITALIA # JGA-1293 , -MUSM -); +MUSM +); + + 1 male , idem except, 13.xi.2017 ( -MUSM +MUSM ARCT-972 -JGA COLLECTION -)(Voucher DNA barcoding, Arct # 635 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct # 635 JGA-MUSM -); +); + + 1 male , idem except, @@ -254,78 +280,111 @@ macho ( J.D. Shoobridge et al. ( -MUSM +MUSM ARCT-1053 -JGA COLLECTION -)(Voucher DNA barcoding, Arct # 716 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct # 716 JGA-MUSM -); +); + + 1 male , idem except, 19.iii.2018 ( -MUSM +MUSM , ARCT-1060 , -JGA COLLECTION -)(Voucher DNA barcoding, Arct # 723 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct # 723 JGA-MUSM -); +); + + 1 male , idem except, 07.iv.2018 ( -MUSM +MUSM , ARCT-1077 -JGA COLLECTION -)(Voucher DNA barcoding, Arct #740 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct #740 JGA-MUSM -); +); + + 1 male , idem except, 25.iv.2018 ( -MUSM +MUSM , ARCT-1215 -JGA COLLECTION -)(Voucher DNA barcoding, Arct # 878 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct # 878 JGA-MUSM )(GENITALIA # JGA-1294 , -MUSM -); +MUSM +); + + 1 male , idem except, 06.v.2018 ( -MUSM +MUSM ART-1196 -JGA COLLECTION -)(Voucher DNA barcoding, Arct #859 + +JGA +COLLECTION + +)(Voucher +DNA +barcoding, Arct #859 JGA-MUSM ). All deposited in the -MUSM -. +MUSM +. + + EXAMINED EXTRA MATERIAL - . - MADRE DE DIOS @@ -367,12 +426,14 @@ deposited in the T . Mc Cabe -; +; + + 1 male , Albergue Refugio - + Amazonas , 12°52’30”S @@ -388,12 +449,12 @@ deposited in the , D. Couceiro -; +; + + 1 male , Albergue Refugio - - Amazonas , 12°52’30”S @@ -410,13 +471,17 @@ deposited in the , J.D. Shoobridge et al. -; +; + + 1 male , idem except, 25.ix.2018 -; +; + + 1 male , idem except, @@ -428,25 +493,33 @@ deposited in the 26.x.2018 -; +; + + 1 male , idem except, 09.iv.2019 -; +; + + 1 male , idem except, 17.vii.2019 -; +; + + 1 male , idem except, 30.vii.2019 -; +; + + 1 male , Tambopata Research Center @@ -468,7 +541,9 @@ deposited in the G. Serrano & J. Grados -; +; + + 1 male , idem except, @@ -478,31 +553,36 @@ deposited in the G. Serrano & J. Grados -; +; + + 1 male , idem except, 06.xi.2021 -; +; + + 1 male , idem except, 26.xi.2021 -; +; + + 1 male , idem except, 06.xi.2021 -; 1 +; - - - -male, -P. N. Bahuaja-Sonene + +1 male +, +P. N. Bahuaja-Sonene , 13°11’35”S , @@ -520,9 +600,9 @@ male, , E. Rázuri & -J. Barrientos. All -deposited in the -MUSM +J. Barrientos +. All deposited in the +MUSM . @@ -673,7 +753,7 @@ is as follows (Voucher DNA barcoding, ARCT #635 , MUSM ) (GenBank: BankIt2839965 gnl|uoguelph|RFEWA635-18.COI-5P PP911852) (See -Table 1 +Table 1 ). AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTACTAATTCGT GCTGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACAT GCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGTTTCGGTAATTGATTAGTCCCTT TAATATTAGGAGCTCCGGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTCTTACCCCCAT CATTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGAGCCGGAACAGGATGAACAGTT TATCCCCCACTTTCATCTAATATTGCCCATGGTGGAAGTTCAGTAGATTTAGCTATCTTTTCTTTA CATTTAGCGGGAATCTCTTCAATTTTAGGTGCTATTAACTTTATTACAACAATTATTAATATACGAT TAAATAACTTATCATTTGATCAAATACCATTATTTGTGTGAGCAGTAGGAATTACTGCATTCCTATTAT TACTTTCATTACCTGTTTTAGCAGGGGCTATTACAATACTTTTAACTGATCGAAACTTAAATACCT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTCTATCAACACTTATTT diff --git a/data/48/27/E3/4827E337FFFC1449FF32125DFC7722EC.xml b/data/48/27/E3/4827E337FFFC1449FF32125DFC7722EC.xml new file mode 100644 index 00000000000..cee6752ab48 --- /dev/null +++ b/data/48/27/E3/4827E337FFFC1449FF32125DFC7722EC.xml @@ -0,0 +1,174 @@ + + + +Three Excavatum species Tuber badium, T. depressum and T. verrucosivolvum from Sichuan Province, China + + + +Author + +Wan, Shanping +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + + + +Author + +Xu, Wenjun +Faculty of Ecotourism, Southwest Forestry University, Kunming 650224, PR China + + + +Author + +Tan, Nianwu +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + + + +Author + +Wang, Yun +New Zealand Institute for Plant and Food Research Limited, Christchurch 8140, New Zealand + + + +Author + +Zheng, Yi +College of Resource and Environment, Yunnan Agricultural University, Kunming 650100, People’s Republic of China + + + +Author + +Yu, Fuqiang +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + +text + + +Phytotaxa + + +2017 + +2017-02-20 + + +296 + + +3 + + +228 +238 + + + + +http://dx.doi.org/10.11646/phytotaxa.296.3.2 + +journal article +10.11646/phytotaxa.296.3.2 +1179-3163 + + + + + + +Tuber badium +S.P. Wan + +, + +sp. nov. + +( +Fig. 3 +). + + +MycoBank:—MB 818791 + + + +Type +:— +CHINA +. +Sichuan Province +: Huidong County, in soil under forest dominated by + +P. armandii +, Dec. 2012 + +, +wsp090 +, +HKAS +88789. + + +Ascomata +subglobose, +2–3 cm +in diam., firm, with typical basal cavities, covered with distinctly verrucose warts in some areas, with brown superficial furrows, yellow brown to brown; interior cavity surface covered with many fine, irregular scales and large warts, white to yellow when fresh. + +Peridium + +50–480 μm thick including the 11–83 μm high verrucose warts, pseudoparenchymatous, the outer layer 35–169 μm thick composed of big, subglobose to subangular cells, 2–23 × 1.5–11 μm, pale brown or hyaline; the inner layer 15–333 μm thick, composed of intricately interwoven, hyaline and thin-walled hyphae, 1–4.5 μm in diam. + +Gleba + +solid, yellowish brown when mature, marbled with white-yellow veins. +Gleba +composed of hyaline, interwoven, thin-walled hyphae, 1–6 μm broad at the septa, the cells cylindrical interwoven to inflated, 1.5–22 × 1–13 μm. +Odor +pleasant. Taste not recorded. +Asci +globose to subglobose, pyriform, ellipsoid or irregular, (82–)89–130(–139) × (35–)37–97(–99) μm, hyaline, sessile or with a short or tall stalk, thin walled 1–2 μm thick, 1–4(5) spored. +Ascospores +broadly ellipsoid, ellipsoid, sometimes subglobose or globose, hyaline when young, becoming brown at maturity; excluding their alveolate-reticulate ornamentation, in 1-spored asci (32–)36–43(–51) × (25–)27–33(–37) μm, in 2-spored (32–)34–48 × 27–34(–35) μm, in 3-spored 33–44 × 26–31(–32) μm, in 4-spored (29–)31–40(–41.5) × 24–31.5 μm, and in 5-spored 32–37 × 25.5–29.5 μm; +Q += 1–1.67, Qm = 1.36 ± 0.12; reticulum with 2–4 meshes along the spore length and 2–4 across, the alveolar walls up to 2–13 μm tall. + + + + +Diagnosis: +— + +Tuber depressum + +differs in its thichker peridium (200–640 μm), fusiform ascospores and lower alveolar walls (2–9 μm). + +Tuber verrucosivolvum + +differs in its high verrucose warts (36–185 μm) and less numerous spores per ascus (1–4 spored). + + +Habit, habitat and distribution: +—Hypogeous, in soil under forest dominated by + +P. armandii + +in +Sichuan Province +, +China +. Only known from +China +. + + + + +Etymology: +—In reference to the brown and yellow color of the ascoma. + + + + \ No newline at end of file diff --git a/data/48/27/E3/4827E337FFFC144AFF3215B5FBA22F66.xml b/data/48/27/E3/4827E337FFFC144AFF3215B5FBA22F66.xml new file mode 100644 index 00000000000..e2af44c90af --- /dev/null +++ b/data/48/27/E3/4827E337FFFC144AFF3215B5FBA22F66.xml @@ -0,0 +1,208 @@ + + + +Three Excavatum species Tuber badium, T. depressum and T. verrucosivolvum from Sichuan Province, China + + + +Author + +Wan, Shanping +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + + + +Author + +Xu, Wenjun +Faculty of Ecotourism, Southwest Forestry University, Kunming 650224, PR China + + + +Author + +Tan, Nianwu +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + + + +Author + +Wang, Yun +New Zealand Institute for Plant and Food Research Limited, Christchurch 8140, New Zealand + + + +Author + +Zheng, Yi +College of Resource and Environment, Yunnan Agricultural University, Kunming 650100, People’s Republic of China + + + +Author + +Yu, Fuqiang +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + +text + + +Phytotaxa + + +2017 + +2017-02-20 + + +296 + + +3 + + +228 +238 + + + + +http://dx.doi.org/10.11646/phytotaxa.296.3.2 + +journal article +10.11646/phytotaxa.296.3.2 +1179-3163 + + + + + + +Tuber depressum +S.P. Wan + +, + +sp. nov. + +( +Fig. 4 +). + + +MycoBank:—MB 818795 + + + +Type +:— +CHINA +. +Sichuan Province +: Huidong County, in soil under forest dominated by + +Pinus armandii +, Dec. 2012 + +, +wsp098 +, +HKAS +95396. + + +Ascomata +subglobose, +1.5–3 cm +in diam., firm, with typical basal cavities, covered with distinctly verrucose warts in some areas, especially at the surface of cavity area, yellow brown to brown; interior cavity surface covered with many fine, irregular scales and large warts, white to yellow when fresh. + +Peridium + +200–640 μm thick including the 3–88 μm high verrucose warts, pseudoparenchymatous, the outer layer 30–290 μm thick composed of big, subglobose to subangular cells, 2–21 × 1.5–17 μm, pale brown or hyaline; the inner layer 90–540 μm thick, composed of intricately interwoven, hyaline and thin-walled hyphae, 1.5–6.5 μm in diam. + +Gleba + +solid, yellowish brown when mature, marbled with white-yellow veins. +Gleba +composed of hyaline, interwoven, thin-walled hyphae, 1–6.5 μm broad at the septa, the cells cylindrical interwoven to inflated, 2.5–16 × 2–7.5 μm. +Odor +pleasant. Taste not recorded. +Asci +globose to subglobose, pyriform, ellipsoid or irregular, 94–111(–114) × 81–93(–100) μm, hyaline, sessile or with a short or tall stalk, thin walled 1–2 μm thick, 1–5 spored. +Ascospores +ellipsoid, fusiform, broadly ellipsoid, sometimes subglobose, hyaline when young, becoming brown at maturity; excluding their alveolate-reticulate ornamentation, in 1-spored asci 42.5–52.5(–55) × 29–34(–38.5) μm, in 2-spored (28.5–)30–48.5(–50) × 23–31.5(–32) μm, in 3-spored 32–46(–49) × 24–31(–32) μm, in 4-spored 23.5–41(–41.5) × (23–)24–29(–30) μm, and in 5-spored (25–)27–38(–42) × 21–27.5 μm; +Q += 1.1–1.7, Qm = 1.42 ± 0.14; reticulum with 2–5 meshes along the spore length and 2–3 across, the alveolar walls up to 2–9 μm tall. + + + + +FIGURE 4. + +Tuber depressum + +(HKAS 95396, holotype). a, c. Ascomata and sections. b. Surface warts of ascoma d. +Peridium +sections. e. Scanning electron micrograph of ascospore. f. Light micrograph (LM) of asci and ascospores. + + + + +Diagnosis: +— + +Tuber neoexcavatum + +differs in its prosenchymatous peridium, 2–4 spored asci and the absence of subglobose ascospores. + + +Habit, habitat and distribution: +—Hypogeous, in soil under forest dominated by + +P. armandii + +in +Sichuan Province +, +China +. Only known from +China +. + + + + +Etymology: +—In reference to the distinctly verrucose warts of the ascoma. + + +Other material examined: +— +CHINA +. +Sichuan Province +: Huidong County, in soil under forest dominated by + +P. armandii +, Dec. 2012 + +, +wsp093 +, HKAS 88895, +ibid +., +wsp094 +, HKAS 88896, all collected by S.P. Wan. +CHINA +. +Sichuan Province +, Huidong county, +3 Nov. 2006 +, +CJ411 +, HKAS 52006, collected by J. Chen. + + + + \ No newline at end of file diff --git a/data/48/27/E3/4827E337FFFE1444FF3210CBFC1825BA.xml b/data/48/27/E3/4827E337FFFE1444FF3210CBFC1825BA.xml new file mode 100644 index 00000000000..94c34e94f5c --- /dev/null +++ b/data/48/27/E3/4827E337FFFE1444FF3210CBFC1825BA.xml @@ -0,0 +1,204 @@ + + + +Three Excavatum species Tuber badium, T. depressum and T. verrucosivolvum from Sichuan Province, China + + + +Author + +Wan, Shanping +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + + + +Author + +Xu, Wenjun +Faculty of Ecotourism, Southwest Forestry University, Kunming 650224, PR China + + + +Author + +Tan, Nianwu +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + + + +Author + +Wang, Yun +New Zealand Institute for Plant and Food Research Limited, Christchurch 8140, New Zealand + + + +Author + +Zheng, Yi +College of Resource and Environment, Yunnan Agricultural University, Kunming 650100, People’s Republic of China + + + +Author + +Yu, Fuqiang +Key Laboratory of Economic Plants and Biotechnology, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, PR China + +text + + +Phytotaxa + + +2017 + +2017-02-20 + + +296 + + +3 + + +228 +238 + + + + +http://dx.doi.org/10.11646/phytotaxa.296.3.2 + +journal article +10.11646/phytotaxa.296.3.2 +1179-3163 + + + + + + +Tuber verrucosivolvum +S.P. Wan + +, + +sp. nov. + +( +Fig. 5 +). + + +MycoBank:—MB 818793 + + + +Type +:— +CHINA +. +Sichuan Province +: Huidong County, in soil under forest dominated by + +P. armandii +, Dec. 2012 + +, +wsp060 +, +HKAS +88863. + + + +FIGURE 5. + +Tuber verrucosivolvum + +(HKAS 88863, holotype). a. Ascoma and sections. b. Surface warts of ascoma. c, d. +Peridium +sections. e. Light micrograph (LM) of asci and ascospores. f. Scanning electron micrograph of ascospore. + + + +Ascomata +subglobose, +1–1.5 cm +in diam., firm, with small basal hole, entire surface covered with distinctly high pyramidal warts, cracked in some areas, yellow to brown; interior cavity surface covered with many fine, irregular scales and large warts, yellow to brown when fresh. + +Peridium + +300–640 μm thick including the 36–185 μm high verrucose warts, pseudoparenchymatous, the outer layer 60–290 μm thick, composed of big, subglobose to subangular cells, 3–23 × 1–13.5 μm, yellow, pale brown or hyaline; the inner layer 70–450 μm thick, composed of intricately interwoven, hyaline and thin-walled hyphae, 1–5 μm in diam. + +Gleba + +solid, yellowish brown when mature, marbled with white-yellow veins. +Gleba +composed of hyaline, interwoven, thin-walled hyphae, 1–6 μm broad at the septa, the cells cylindrical interwoven to inflated, 3.5–27 × 2.5–17.5. +Odor +pleasant. Taste not recorded. +Asci +90–120 × (62–)64– 87 μm, globose to subglobose, pyriform, ellipsoid or irregular, hyaline, sessile or with a short stalk, thin walled 1–2 μm thick, 1–4 spored. +Ascospores +broadly ellipsoid, ellipsoid, sometimes globose or subglobose, hyaline when young, becoming brown at maturity; excluding their alveolate-reticulate ornamentation, in 1-spored asci (38–)39–55(–58) × (29.5–)31–47 μm, in 2-spored (27–)35–47 × (24–)28–40(–45) μm, in 3-spored 28(–31)–43 × 26–33.5(–36) μm, and in 4-spored (20.5–)30–39(–40) × (20.5–)26–31.5(–32) μm; +Q += 1–1.6, Qm = 1.25 ± 0.11; reticulum with 3–5 meshes along the spore length and 2–4 across, the alveolar walls up to 2–9.5 μm tall. + + + + +Diagnosis: +— + +Tuber sinoexcavatum + +differs in its lower peridium (200–300 μm), single +type +of ascospores (globose) and lower alveolar walls (5 μm). + +Tuber fulgens + +differs in its orange-brown ascomata and relatively single +type +of ascospores (globose to subglobose). + + +Habit, habitat and distribution: +—Hypogeous, in soil under forest dominated by + +P.armandii + +in +Sichuan Province +, +China +. Only known from +China +. + + + + +Etymology: +—In reference to the distinctly verrucose warts of the ascoma. + + +Other material examined: +— +CHINA +. +Sichuan Province +: Huidong County, in soil under forest dominated by + +P. armandii +, Dec. 2012 + +, +wsp061 +, HKAS 88864, collected by S.P. Wan. + + + + \ No newline at end of file diff --git a/data/76/17/87/761787C0A000FF917AA3FB5EE2B6FB3E.xml b/data/76/17/87/761787C0A000FF917AA3FB5EE2B6FB3E.xml new file mode 100644 index 00000000000..12b7ee62af3 --- /dev/null +++ b/data/76/17/87/761787C0A000FF917AA3FB5EE2B6FB3E.xml @@ -0,0 +1,539 @@ + + + +Four new rupicolous species of Pleroma (Melastomataceae) endemic to Espírito Santo, Brazil + + + +Author + +Meyer, Fabrício Schmitz +Universidade Federal do Paraná, Departamento de Botânica, Herbarium UCPB, Caixa Postal 19031, CEP 81531 - 970, Curitiba, Paraná, Brazil. + + + +Author + +Kollmann, Ludovic J. C. +Instituto Nacional da Mata Atlântica, Museu de Biologia Professor Mello Leitão, CEP 29650 - 000, Santa Teresa, Espírito Santo, Brazil. + + + +Author + +Fraga, Claudio Nicoletti De +Instituto Nacional da Mata Atlântica, Museu de Biologia Professor Mello Leitão, CEP 29650 - 000, Santa Teresa, Espírito Santo, Brazil. & Instituto de Pesquisas Jardim Botânico do Rio de Janeiro, CEP 22460 - 030, Rio de Janeiro, Rio de Janeiro, Brazil. + + + +Author + +Goldenberg, Renato + +text + + +Phytotaxa + + +2018 + +2018-05-04 + + +348 + + +4 + + +235 +253 + + + + +http://dx.doi.org/10.11646/phytotaxa.348.4.1 + +journal article +10.11646/phytotaxa.348.4.1 +1179-3163 +13687796 + + + + + + +4. + +Pleroma venetiense +F.S.Mey., L.Kollmann & R.Goldenb. + + + +sp. nov +. + +( +Figures 8–9 +) + + + + + +Diagnosis:— + +Pleroma venetiense + +differs from + +Tibouchina radula + +by the leaves with shorter petioles ( +2.2–5.5 mm +long +vs. +10–20 mm +long in + +T. radula + +), ovate blade with cordate to slightly cordate bases ( +vs. +elliptical to elliptical-lanceolate blade with acute to obtuse bases), and scabrous adaxial leaf surfaces ( +vs. +strigose). + + + +Type:— +BRAZIL +. +Espírito Santo +: Nova Venécia, +Área de Proteção Ambiental +– APA + +da +Pedra do Elefante + +, + +16 March 2016 + +(fl., fr.), + +L +. +O +. Azevedo, +L +. +F +. +A +. Paula & +R +. +C +. Forzza 441 + +( +holotype +: +UPCB +!; +Isotype +: +RB +!) + +. + + +Erect shrub +0.3–1.2 m +tall. Younger and older branches quadrangular, younger not winged, older angulose, with wings +0.6–1.1 mm +long, both sparsely strigose, trichomes +0.2–0.6 mm +long, eglandular, appressed, narrow at the base; nodes thickened. Leaves opposite; petioles +2.2–5.5 mm +long; blades 4.4–7.1 × +2.4–4.5 cm +, coriaceous, concolorous, ovate, base cordate to slightly cordate, apex acute to obtuse, 5–7 acrodromous nerves, basal, if 7 the marginals tenuous, main nerves prominent, reticulation impressed on the adaxial surface, prominent on the abaxial surface, adaxial surface flat, rough, dark green or brown, densely scabrous, trichomes +0.3–1.2 mm +long, eglandular, appressed, immersed and with a many branched forked base, abaxial surface foveolate, soft, light brown to brown, densely hirsutulous on the surface and terciary veins, trichomes +0.1–0.3 mm +long, eglandular, erect, narrow at the base, primary and secondary veins moderately to sparsely strigose, trichomes +0.3–0.9 mm +long, eglandular, appressed, slightly enlarged at the base. Thyrsoid 28.5–31.5 × +4–7.5 cm +, terminal, axis terete or subquadrangular, with the same indumentum as the branches, brown to greenish yellow; bracts late deciduous, leafy, petioles +2.2–3.4 mm +long, blade 23.9–36.4 × +7–18.6 mm +, ovate to lanceolate, indumentum the same as on the leaves; bracteoles early deciduous, 3.6–4.6 × +0.9–2.1 mm +, ovate to lanceolate, apex acute to attenuate, not covering the apex of the flower bud, margins entire, ciliate, adaxial surface glabrous, abaxial surface densely strigose, trichomes +0.2–0.9 mm +long, eglandular, appressed, slightly enlarged at the base. Flowers 5-merous, pedicels +1.2–1.5 mm +long; hypanthium 4–4.6 × +2.7–3.1 mm +, oblong, not costate, densely strigose, the trichomes +0.3–0.9 mm +long, eglandular, appressed, with short lateral projections (dendritic), slightly enlarged at the base; sepals late deciduous, 4.8–5.5 × +1.8–2 mm +, triangular, margins ciliolate, apex attenuate, adaxial surface glabrous, abaxial surface with the same trichomes as the hypanthium; petals purple with a white base, 22.1–23.2 × +20–21.2 mm +, obovate, apex retuse to emarginated, forming an angle ≥ 90° in relation to the hypanthium (in living specimens); stamens 10, dimorphic, antesepalous with filaments white, +3.9–4.3 mm +long, moderately setulose on the lower two-thirds, trichomes +0.1–0.3 mm +long, glandular, curved, narrow at the base, pedoconnective white to light purple, +0.7–0.9 mm +prolonged below the thecae, densely to moderately setulose, trichomes +0.2–0.4 mm +long, glandular, erect, narrow at the base, ventral appendages bilobed, inconspicuous, ca. +0.2 mm +long, densely to moderately setulose, trichomes +0.1–0.4 mm +long, glandular, erect, narrow at the base, thecae 3.4–3.6 × +0.2–0.3 mm +, filiform, narrow, white to light purple, antepetalous stamens with filaments white, +3.3–3.7 mm +long, moderately setulose on the lower two-thirds, trichomes +0.1–0.4 mm +long, glandular, curved, narrow at the base, pedoconnective white to light purple, ca. +0.4 mm +prolonged below the thecae, glabrous or sparsely setulose, trichomes ca. +0.2 mm +long, glandular, curved, narrow at the base, ventral appendages bilobed, inconspicuous, ca. +0.1 mm +long, glabrous or sparsely setulose, trichomes ca. +0.2 mm +long, glandular, curved, narrow at the base, thecae 3.2–3.4 × +0.5–0.6 mm +, widely and shortly falcate, narrow, white to light purple; ovary ca. 3.1 × +2.4 mm +, 5-locular, apex densely setulose, trichomes +0.2–0.6 mm +long, usually glandular but seldom eglandular, erect, slightly enlarged at the base; style white, +2.7–3 mm +long, apex curved, moderately setulose on the lower two-thirds, trichomes +0.2–0.4 mm +, eglandular, curved, slightly enlarged at the base, stigma orbicular. Velatidium 6.8–7.8 × +5.2–6 mm +, costate, epicarp undivided when mature. + + + +FIGURE 8 +. Images of the holotype of + +Pleroma venetiense +. + +A. Branch with inflorescence. B. Leaf (abaxial surface) C. Detail of the leaf indumentum (adaxial surface). D. Detail of the leaf indumentum (abaxial surface). E. Compound Cyme, apex of the inflorescence, with a mature velatidium on the central portion of the cyme. F. Bracteole (abaxial surface) G1. Antesepalous stamen. G2. Antepetalous stamen H. Gynoecium. I. Velatidium. (A–H: +Azevedo et al. 441 +, I: +Kollmann et al. 10702 +). + + + + +FIGURE 9 +. Photos of + +Pleroma venetiense + +. A. Natural habitat and habit. B. Leaf (abaxial surface). C. Apex of the inflorescence. D. Flower. (Photo A by L. Azevedo, B-D by L.J.C. Kollmann). + + + + + +Paratypes + +:— +BRAZIL +. +Espírito Santo +: +Nova Venécia +, +Área de Proteção Ambiental +– APA +da Pedra do Elefante +, + +19 February 2008 + +(fl.), + +L +. Kollmann et al. 10702 + +( +RB +!, +UPCB +!) + +; + +ibidem +, + +14 January 2009 + +(fl.), + +L +. Kollmann et al. 11397 + +( +CEPEC +!, +MBML +!, +RB +!) + +; + +ibidem +, + +15 january 2009 + +(fl.), + +L +. Kollmann et al. 11412 + +( +CEPEC +!, +MBML +!, +RB +!) + +; + +ibidem +, + +21 March 2016 + +(fl.), + +H +. +V +. Pinto Junior 258 + +( +SAMES +, +UPCB +!) + +; + +Serra de Baixo +, +Pedra da Torre +, + +18 February 2008 + +(fr.), + +A +. +P +. +Fontana +et al. 4845 + +( +MBM +!, +MBML +!, +RB +!) + +. + + + + +Distribuition and habitat +:— + +Pleroma venetiense + +is endemic to the “Área de Proteção Ambiental da Pedra do Elefante”, +Espírito Santo +, +Brazil +. It is a rupicolous plant, occuring in low, sparse vegetation on granitic and gneissic inselbergs between + +400– +700 m + +. + + +Phenology +:—Collected with flowers between January and March, and with fruits between January and March. + + +Conservation status +:— + +Pleroma venetiense + +is represented by a few populations with scattered individuals; the AOO is +8 km +2 +and the EOO is +1.008 km +2 +. These populations occur in the same areas as + +P. cucculatum + +, and are subject to the same conditions (see comments under this species). Therefore, following the criteria of the IUCN ( +IUCN 2012 +), + +P. venetiense + +should be considered as Critically Endangered [CR: B1ab(i,ii,iii,v)+2ab(i,ii,iii)]. + + + + +Etymology +:—The epithet refers to the municipality of Nova Venécia, place of occurrence of the species. The municipality was founded mainly by Italian colonizers, and its name is a reference to the city of Venice, in +Italy +. + + +Affinities +:— + +Pleroma venetiense + +is morphologically similar to + +T. radula + +and + +P. fornograndense + +due to the rough leaves on the adaxial surface, ovate to lanceolate bracteoles, strigose hypanthia, flowers with purple petals with a white base and antesepalous stamens with the pedoconnective covered with glandular trichomes. It differs from + +T. radula + +by the characters pointed in the diagnosis, and also by the coriaceous leaves ( +vs. +chartaceous in + +T. radula + +; +Table 1 +). + +Pleroma venetiense + +differs from + +P. fornograndense + +by the smaller leaves (4.4–7.1 × +2.4–4.5 cm +vs. +5.6–12 × +3–6.1 cm +in + +P. fornograndense + +), with trichomes with many-branched forked bases on the adaxial surface ( +vs. +leaves with trichomes with non-forked bases on the adaxial surface). + +Pleroma venetiense + +is also similar to + +P. heteromallum + +and its putative synonyms (see comments under + +P. cucculatum + +) due to the lanceolate bracteoles, flowers with purple petals with a white base and antesepalous stamens with the pedoconnective covered with glandular trichomes. + +Pleroma venetiense + +differs from + +P. heteromallum + +and its putative synonyms by the smaller leaves (4.4–7.1 × +2.4–4.5 cm +vs +. 12.5–21 × +8.5–15 cm +in + +P. heteromallum + +and its putative synonyms) that are coriaceous ( +vs. +chartaceous) and scabrous on the adaxial surface ( +vs. +strigose). + +Pleroma venetiense + +differs from + +P. multiflorum + +(one of the species synonymyzed under + +P. heteromallum + +) by the smaller leaves (4.4–7.1 × +2.4–4.5 cm +vs +. 6.8–11.2 × +4.2–6.2 cm +in + +P. multiflorum + +) that are coriaceous ( +vs +. chartaceous), with a rough indumentum on the adaxial surface ( +vs +. soft; +Table 1 +). + + + + \ No newline at end of file diff --git a/data/76/17/87/761787C0A007FF8C7AA3FA3EE576FB12.xml b/data/76/17/87/761787C0A007FF8C7AA3FA3EE576FB12.xml new file mode 100644 index 00000000000..79568f8d0c2 --- /dev/null +++ b/data/76/17/87/761787C0A007FF8C7AA3FA3EE576FB12.xml @@ -0,0 +1,512 @@ + + + +Four new rupicolous species of Pleroma (Melastomataceae) endemic to Espírito Santo, Brazil + + + +Author + +Meyer, Fabrício Schmitz +Universidade Federal do Paraná, Departamento de Botânica, Herbarium UCPB, Caixa Postal 19031, CEP 81531 - 970, Curitiba, Paraná, Brazil. + + + +Author + +Kollmann, Ludovic J. C. +Instituto Nacional da Mata Atlântica, Museu de Biologia Professor Mello Leitão, CEP 29650 - 000, Santa Teresa, Espírito Santo, Brazil. + + + +Author + +Fraga, Claudio Nicoletti De +Instituto Nacional da Mata Atlântica, Museu de Biologia Professor Mello Leitão, CEP 29650 - 000, Santa Teresa, Espírito Santo, Brazil. & Instituto de Pesquisas Jardim Botânico do Rio de Janeiro, CEP 22460 - 030, Rio de Janeiro, Rio de Janeiro, Brazil. + + + +Author + +Goldenberg, Renato + +text + + +Phytotaxa + + +2018 + +2018-05-04 + + +348 + + +4 + + +235 +253 + + + + +http://dx.doi.org/10.11646/phytotaxa.348.4.1 + +journal article +10.11646/phytotaxa.348.4.1 +1179-3163 +13687796 + + + + + +3. + + +Pleroma fornograndense +F.S.Mey. + +, +R.Goldenb. & L.Kollmann + + +sp. nov +. + +( +Figures 6–7 +) + + + + + +Diagnosis:— + +Pleroma fornograndense + +differs from + +Tibouchina radula + +by the prostrate habit ( +vs. +erect in + +T. radula + +), ovate leaves with cordate base ( +vs. +elliptical to elliptical-lanceolate leaves with acute to obtuse base) and larger petioles ( +18.2–58.1 mm +long +vs. +10–20 mm +long). + + + +Type +:— +BRAZIL +. +Espírito Santo +: +Castelo +, +Parque Estadual do Forno Grande +, + +16 July 2008 + +(fl.), + +L +. Kollmann & +A +. +P +. +Fontana +11082 + +( +holotype +: +UPCB +!; +Isotypes +: +MBML +!, +RB +!) + +. + + +Prostrate shrub +0.8–1.8 m +tall. Younger and older branches terete, both not winged, both sparsely to moderately strigose, trichomes +0.2–1.2 mm +long, eglandular, appressed, narrow at the base; nodes slender. Leaves opposite; petioles +18.2– 58.1 mm +long; blades 5.6–12 × +3–6.1 cm +, coriaceous, concolorous, ovate, base cordate, apex acute to obtuse, 7–9 acrodromous nerves, basal, if 9 the marginals tenuous, main nerves prominent, reticulation impressed on the adaxial surface, prominent on the abaxial surface, adaxial surface bullate, rough, dark green or brown, densely scabrous, trichomes +0.8–3 mm +long, eglandular, curved, enlarged at the base (bullate), abaxial surface foveolate, soft, light brown or brown, moderately strigose on the primary and secondary veins, trichomes +0.3–1.6 mm +long, eglandular, appressed, narrow at the base, densely hirsutulous on the surface and tertiary veins, trichomes +0.2–0.6 mm +long, eglandular, erect, narrow at the base. Thyrsoids 36–61.5 × +6.5–9 cm +, terminal, axis terete, with the same indumentum as the branches, dark red; bracts late deciduous, leafy, petioles +8.3–13.7 mm +long, blades 38.9–67.9 × +23.7–34.7 mm +, ovate, indumentum the same as on the leaves; bracteoles early deciduous, 6.1–9.3 × +2.6–4.8 mm +, ovate to lanceolate, apex acute, not covering the apex of the flower bud, margins entire, ciliate, adaxial surface glabrous, abaxial surface moderately to densely strigose, trichomes +0.3–1.4 mm +long, eglandular, appressed, slightly enlarged at the base. Flowers 5-merous, pedicels +1–1.3 mm +long; hypanthium 5.1–5.4 × +3–3.2 mm +, oblong, not costate, moderately to densely strigose, the trichomes +0.2–1.1 mm +long, eglandular, appressed, slightly enlarged at the base; sepals late deciduous, 5–6.5 × +1.9–2.1 mm +, triangular, margins ciliolate, apex acute, adaxial surface glabrous, abaxial surface with the same trichomes as the hypanthium; petals purple with a white base, 23.1–25.9 × +24.1–25.2 mm +, obovate, apex retuse to emarginate, forming an angle ≥ 90° in relation to the hypanthium (in living specimens); stamens 10, dimorphic, antesepalous with filaments white, +3.7–4.2 mm +long, sparsely setulose on the lower two-thirds, trichomes +0.1–0.6 mm +long, glandular, curved, narrow at the base, pedoconnective white, ca. +0.4 mm +long prolonged below the thecae, densely to moderately setulose, trichomes +0.2–0.4 mm +long, glandular, erect, narrow at the base, ventral appendages bilobed, inconspicuous,ca. +0.2 mm +long, densely to moderately setulose, trichomes +0.1–0.4 mm +long, glandular, erect, narrow at the base, thecae 3–3.2 × +0.4 mm +, falcate to botuliform, narrow, white, antepetalous stamens with filaments white, +2.9–3.3 mm +long, sparsely setulose on the lower two-thirds, trichomes +0.2–0.4 mm +long, glandular, curved, narrow at the base, pedoconnective white, ca. +0.4 mm +prolonged below the thecae, glabrous or sparsely setulose, trichomes ca. +0.2 mm +long, glandular, curved, narrow at the base, ventral appendages bilobed, inconspicuous,ca. +0.1 mm +long, glabrous or sparsely setulose, trichomes ca. +0.2 mm +long, glandular, curved, narrow at the base, thecae 2.9–3.1 × +0.4–0.5 mm +, widely and shortly falcate, narrow, white; ovary ca. 4.6 × +3 mm +, 5-locular, apex densely sericeous, trichomes +0.2–0.6 mm +long, eglandular, appressed, slightly enlarged at the base; style white, ca. +4.9 mm +long, apex curved, moderately to sparsely setulose on the lower half, trichomes +0.2–0.4 mm +long, eglandular, curved, slightly enlarged at the base, stigma orbicular. Velatidium 8.1–9 × +4.6–4.9 mm +, costate, epicarp undivided when mature. + + + +FIGURE 6 +. Images of the holotype of + +Pleroma fornograndense +. + +A. Branch with inflorescence. B. Detail of the leaf indumentum (adaxial surface). C. Detail of the leaf indumentum (abaxial surface). D. Detail of the indumentum on the inflorescence axis. E. Bracteoles, variation in size (abaxial surface). F. Cyme, portion of the inflorescence. G. Detail of the indumentum on the hypanthium. H1. Antesepalous stamen. H2. Antepetalous stamen. I. Gynoecium. J. Velatidium. (A–I: + +Kollmann & +Fontana +11082 + +, J: +Goldenberg et al. 1281 +). + + + + +FIGURE 7 +. Photos of + +Pleroma fornograndense + +. A. Leaves and prostrated habit. B. Detail of the branch with reddish petioles. C. Inflorescence. D. Apex of the inflorescence. E. Flower. (Photos by L.J.C. Kollmann). + + + + + +Paratypes + +:— +BRAZIL +. +Espírito Santo +: +Castelo +, +Parque Estadual do Forno Grande +, + +29 January 2004 + +(fl.), + +L +. +Kollmann +6441 + +( +MBML +!) + +; + +ibidem +, + +31 May 2006 + +(fl.), + +L +. +Kollmann +et al. 9144 + +( +MBML +!, +UPCB +!) + +; + +ibidem +, + +21 January 2009 + +(fr.), + +R +. +Goldenberg +et al. 1281 + +( +MBML 37566 +!, +MBML 43446 +!, +RB +!, +UPCB +!) + +; + +ibidem +, + +20 May 2010 + +(fl., fr.), + +J +. +Meirelles +et al. 463 + +( +RB +!) + +; + +ibidem +, + +31 October 2012 + +(fl., fr.), + +T +. +B +. +Flores +& +O +. +R +. +Campos +1735 + +( +ESA +, +RB +!) + +. + + + + +Distribuition and habitat +:— + +Pleroma fornograndense + +is endemic to “Parque Estadual do Forno Grande”, +Espírito Santo +, +Brazil +. It is a rupicolous plant, occuring in vegetation on granitic and gneissic inselbergs between +1000–1700 m +elevation. On these places the vegetation is low, sparse, composed by shrubs and herbs. + + +Phenology +:—Collected with flowers and/or fruits between May and January. + + +Conservation status +:— + +Pleroma fornograndense + +is endemic to a single location, where it has been collected in two points. The AOO is +8 km +2, +and the EOO is undefined. Although their populations are inside a fully protected Conservation Unit, they are small and prone to the effects of stochastic events in the near future. Therefore, following the criteria of the IUCN ( +IUCN 2012 +), + +P. fornograndense + +should be considered as vulnerable [VU: D2]. + + + + +Etymology +:—The epithet derives from the locality of “Forno Grande”, where the plants come from. + + +Affinities +:—These populations have been cited as + +T. radula + +by +Meirelles & Goldenberg (2012) +. In fact, + +Pleroma fornograndense + +is morphologically similar to + +T. radula + +due to the leaves with a rough indumentum on the adaxial surface, ovate to lanceolate bracteoles, inflorescences in apical thyrsoids, flowers with purple petals with a white base, and antesepalous stamens with the pedoconnective covered with glandular trichomes. It differs from + +T. radula + +by the characters pointed in the diagnosis, and also by the coriaceous leaves ( +vs. +chartaceous in + +T. radula + +) and dark red inflorescence axes ( +vs. +whitish). + + + +Pleroma fornograndense + +is similar to + +P. heteromallum + +and its putative synonyms (see comments under + +P. cucculatum + +) due to the ovate leaves, ovate to lanceolate bracteoles, flowers with purple petals with a white base and antesepalous stamens with the pedoconnective covered with glandular trichomes. It differs from + +P. heteromallum + +and its putative synonyms by the prostrate habit ( +vs. +erect in + +P. heteromallum + +and its putative synonyms), coriaceous leaves ( +vs. +chartaceous leaves), that are scabrous on the adaxial surface ( +vs +. strigose). + +Pleroma fornograndense + +differs from + +P. multiflorum + +(one of the species synonymyzed under + +P. heteromallum + +) by the prostate habit ( +vs. +erect in + +P. multiflorum + +), coriaceous leaves ( +vs +. chartaceous leaves) that are scabrous on the adaxial surface ( +vs +. sericeous on the adaxial surface), and strigose hypanthium ( +vs. +sericeous hypanthium; +Table 1 +). + +Pleroma fornograndense + +is also similar to + +Pleroma venetiense + +(see affinities for this species below). + + + + \ No newline at end of file