From d2b1eed7ab1ba088b1fa3bd014360e1c1bfbd57f Mon Sep 17 00:00:00 2001 From: ggserver Date: Fri, 1 Nov 2024 10:07:58 +0000 Subject: [PATCH] Add updates up until 2024-11-01 10:05:40 --- .../40/024240545C44FFDFFF3CFF4F8C8FC8B0.xml | 213 ++++ .../40/024240545C4AFFD2FF3CFF078839CD0C.xml | 238 +++++ .../40/024240545C4CFFD4FF3CFB2A89E3CC74.xml | 217 ++++ .../40/024240545C59FFC0FF3CFB598891CF83.xml | 139 +++ .../40/024240545C59FFC0FF3CFC9A8BB7CE4D.xml | 104 ++ .../40/024240545C59FFC3FF3CF9978C40CBAC.xml | 244 +++++ .../40/024240545C5AFFC3FF3CFCB98BB7CEAC.xml | 128 +++ .../40/024240545C5AFFC3FF3CFDFA8BB7C96D.xml | 104 ++ .../40/024240545C5FFFC0FF3CFB218814C88C.xml | 231 +++++ .../40/024240545C5FFFC6FF3CFDBD8819CEC8.xml | 227 +++++ .../40/024240545C5FFFC6FF3CFF078BA7C869.xml | 122 +++ .../40/024240545C64FFFDFF3CF9B68BD4CD21.xml | 104 ++ .../40/024240545C64FFFDFF3CFAD38AE5CC60.xml | 110 ++ .../40/024240545C64FFFDFF3CFCB98854CEC6.xml | 125 +++ .../40/024240545C64FFFDFF3CFDFA8BD5C96D.xml | 98 ++ .../40/024240545C67FFF8FF3CFBD3885BC840.xml | 205 ++++ .../40/024240545C67FFFEFF3CFD708B9AC9C4.xml | 102 ++ .../40/024240545C67FFFEFF3CFF4F89C2C82B.xml | 189 ++++ .../40/024240545C6DFFF1FF3CF9408DC8CD30.xml | 785 +++++++++++++++ .../40/024240545C72FFEAFF3CF8CC8DBBCAA8.xml | 104 ++ .../40/024240545C73FFEAFF3CFA4E8DAFCCF9.xml | 104 ++ .../40/024240545C73FFEAFF3CFBEB889CCF38.xml | 97 ++ .../40/024240545C73FFEAFF3CFEFE8B5AC99F.xml | 227 +++++ .../40/024240545C73FFF4FF3CF91F88ADCC3B.xml | 375 +++++++ .../87/036887BC8B288F04FF50FF1BFED3EABC.xml | 159 +-- .../87/036887BC8B3D8F1DFF50FF1BFDF7EF8B.xml | 135 +-- .../D2/0382D24BFFB3B81CEDE9D424FC2EFF12.xml | 163 +++ .../D2/0382D24BFFB8B813EDE9D299FBB7FD42.xml | 358 +++++++ .../D2/0382D24BFFBDB81EEDE9D594FA8FF87C.xml | 391 ++++++++ .../D2/0382D24BFFBFB811EDE9D19DFE7FF9B3.xml | 404 ++++++++ .../87/038F87A8401C567BB5E0B216ECFEFA82.xml | 89 +- .../B5/0394B500FFC0FFA9FF322834D45EFAA8.xml | 124 +++ .../B5/0394B500FFC0FFA9FF322CD4D024FE6C.xml | 120 +++ .../B5/0394B500FFC0FFA9FF322E84D2F4FCC4.xml | 128 +++ .../B5/0394B500FFC4FFADFF322FA4D263F844.xml | 196 ++++ .../B5/0394B500FFC5FFACFF322A76D5DBF845.xml | 150 +++ .../B5/0394B500FFC6FFAFFF322868D2CFFB70.xml | 96 ++ .../B5/0394B500FFC6FFAFFF322988D46CF990.xml | 87 ++ .../B5/0394B500FFC6FFAFFF322A50D0E1F8E8.xml | 134 +++ .../B5/0394B500FFC6FFAFFF322C9CD0BAFED8.xml | 95 ++ .../B5/0394B500FFC6FFAFFF322D98D048FDF8.xml | 130 +++ .../B5/0394B500FFC7FFAEFF322AE0D3B2F844.xml | 96 ++ .../B5/0394B500FFC7FFAEFF322C9CD5DCFEFC.xml | 106 ++ .../B5/0394B500FFC7FFAEFF322DBCD2D1FD68.xml | 106 ++ .../B5/0394B500FFC7FFAEFF322F48D1B2F9C8.xml | 284 ++++++ .../B5/0394B500FFD1FFBBFF3229C1D04AF86F.xml | 277 ++++++ .../B5/0394B500FFD3FFB5FF322C9CD5F7F8AD.xml | 322 ++++++ .../B5/0394B500FFDAFFADFF322FFDD595FC8C.xml | 313 ++++++ .../B5/0394B500FFDAFFB3FF322E61D45DFC3C.xml | 95 ++ .../B5/0394B500FFDDFFB3FF322CD4D249FD80.xml | 641 ++++++++++++ .../21/039F21082240684DFF30FAE0DE91CB8B.xml | 264 +++++ .../21/039F21082240684DFF30FE6CDF96C909.xml | 319 ++++++ .../21/039F21082241684DFF30FA84DE1FCD85.xml | 504 ++++++++++ .../21/039F21082243684FFF30F935DE28CE31.xml | 307 ++++++ .../21/039F21082245684AFF30F8DFDE2FCDA1.xml | 364 +++++++ .../21/039F21082247684AFF30F990DE1FCBC3.xml | 210 ++++ .../21/039F21082247684AFF30FE48D94EC999.xml | 449 +++++++++ .../21/039F2108224A6847FF30FC09DF96CBA1.xml | 431 ++++++++ .../21/039F2108224B6847FF30FC95D951CF60.xml | 794 +++++++++++++++ .../21/039F2108224E6843FF30FACFDEF3CBD2.xml | 264 +++++ .../87/03D687DDD06F9C0DFF0C6382FB28FDA0.xml | 101 +- .../8F/03DE8F5DFF802D382DE9F9BA90644E5A.xml | 197 ++++ .../8F/03DE8F5DFF832D392DE9FA2F96CD4D6D.xml | 191 ++++ .../8F/03DE8F5DFF852D3E2DE9FBE290134CD2.xml | 172 ++++ .../8F/03DE8F5DFF872D3D2DE9F93A93384C5F.xml | 170 ++++ .../8F/03DE8F5DFF882D332DE9FB7C91E14CFF.xml | 220 ++++ .../8F/03DE8F5DFF892D322DE9FF6893BC4EC0.xml | 140 +++ .../8F/03DE8F5DFF892D332DE9F9C891A44F17.xml | 184 ++++ .../8F/03DE8F5DFF8B2D312DE9FCFD97A94C99.xml | 286 ++++++ .../8F/03DE8F5DFF8D2D362DE9FF6890034D81.xml | 172 ++++ .../8F/03DE8F5DFF8D2D372DE9F90A96C24EB1.xml | 189 ++++ .../8F/03DE8F5DFF8E2D0A2DE9FED997334AAC.xml | 295 ++++++ .../8F/03DE8F5DFF8F2D352DE9FDDC92E04BF0.xml | 174 ++++ .../8F/03DE8F5DFF962D222DE9FA5A912B4F39.xml | 161 +++ .../8F/03DE8F5DFF992D222DE9FB9190684CCD.xml | 123 +++ .../8F/03DE8F5DFF9A2D262DE9FC4996184E77.xml | 231 +++++ .../8F/03DE8F5DFF9B2D212DE9F9D790034AF4.xml | 120 +++ .../8F/03DE8F5DFF9D2D272DE9FA5B91F14FA7.xml | 183 ++++ .../8F/03DE8F5DFF9E2D252DE9FA5D912B4CD3.xml | 113 +++ .../8F/03DE8F5DFF9F2D242DE9FC9F91B34CD0.xml | 186 ++++ .../8F/03DE8F5DFFA02D182DE9F96190614E2A.xml | 153 +++ .../8F/03DE8F5DFFA12D1A2DE9FF6897724DFF.xml | 385 +++++++ .../8F/03DE8F5DFFA12D1B2DE9F8D396AC4D69.xml | 369 +++++++ .../8F/03DE8F5DFFA32D192DE9FA9E93384E51.xml | 221 ++++ .../8F/03DE8F5DFFA52D1F2DE9FD4C90C04AF4.xml | 215 ++++ .../8F/03DE8F5DFFA62D1D2DE9FF6890F24D38.xml | 176 ++++ .../8F/03DE8F5DFFA72D1C2DE9FE9193834C86.xml | 380 +++++++ .../8F/03DE8F5DFFA82D132DE9FF68906C4C11.xml | 186 ++++ .../8F/03DE8F5DFFAB2D102DE9FF6893784DCE.xml | 189 ++++ .../8F/03DE8F5DFFAB2D162DE9F8D0965E4944.xml | 239 +++++ .../8F/03DE8F5DFFAC2D142DE9FDA490254A38.xml | 168 ++++ .../8F/03DE8F5DFFAD2D172DE9FD4D91AD4932.xml | 207 ++++ .../8F/03DE8F5DFFAE2D6A2DE9FC23975D4F9F.xml | 236 +++++ .../8F/03DE8F5DFFAF2D152DE9FE9190334BDC.xml | 165 +++ .../8F/03DE8F5DFFB22D092DE9FD4D90794CA8.xml | 167 ++++ .../8F/03DE8F5DFFB32D092DE9FE0093DD4944.xml | 164 +++ .../8F/03DE8F5DFFB52D0F2DE9FC8590614BF0.xml | 209 ++++ .../8F/03DE8F5DFFB62D022DE9F98F91F84D76.xml | 309 ++++++ .../8F/03DE8F5DFFB72D0D2DE9F9E5912A4D3B.xml | 447 +++++++++ .../8F/03DE8F5DFFB82D002DE9FD4392C14830.xml | 193 ++++ .../8F/03DE8F5DFFBA2D012DE9FF68933A4DC1.xml | 224 +++++ .../8F/03DE8F5DFFBA2D072DE9F8CA97A84818.xml | 317 ++++++ .../8F/03DE8F5DFFBC2D042DE9FC7096404AD0.xml | 168 ++++ .../8F/03DE8F5DFFBE2D052DE9FF6890614C72.xml | 261 +++++ .../8F/03DE8F5DFFBF2D042DE9FDB990614C94.xml | 170 ++++ .../8F/03DE8F5DFFD12D6B2DE9FAF391F34C2A.xml | 317 ++++++ .../8F/03DE8F5DFFD22D6E2DE9FC8290B54FA7.xml | 247 +++++ .../8F/03DE8F5DFFD32D692DE9FB9090274809.xml | 208 ++++ .../87/03EF8798FFA9FF8666E8FCDCF5DBFD6B.xml | 205 ++-- .../29/03F029281E01FF91FF215606FAEAFF39.xml | 335 +++++++ .../29/03F029281E05FF9EFF215007FEBAFB99.xml | 530 ++++++++++ .../29/03F029281E21FFB7FF2155E7FDDDF991.xml | 351 +++++++ .../29/03F029281E23FFB0FF2157EFFCC7F81D.xml | 509 ++++++++++ .../29/03F029281E27FFBDFF2151DAFF36F8EE.xml | 366 +++++++ .../29/03F029281E30FFA6FF215097FD1CFD45.xml | 277 ++++++ .../29/03F029281E32FFA0FF21539BFEEDFD31.xml | 398 ++++++++ .../29/03F029281E37FFADFF2155BFFA42FD45.xml | 292 ++++++ .../29/03F029281E39FFA8FF21539BFEBAF88D.xml | 620 ++++++++++++ .../29/03F029281E3DFFAAFF2151DAFA85FAB9.xml | 228 +++++ .../29/03F029281E3EFF95FF2154F0FE94F8C1.xml | 514 ++++++++++ .../29/03F029281E46FFDDFF21536FFA43FD09.xml | 430 ++++++++ .../29/03F029281E49FFDFFF215257FD77FBF5.xml | 311 ++++++ .../29/03F029281E4BFFDAFF2155CBFBBBFAB9.xml | 572 +++++++++++ .../29/03F029281E4EFFC7FF215487FEE5FC09.xml | 753 ++++++++++++++ .../29/03F029281E53FFC1FF215557FBC3FB23.xml | 398 ++++++++ .../29/03F029281E55FFCDFF215479FCCDFF15.xml | 457 +++++++++ .../29/03F029281E59FFC8FF21506BFE62FF39.xml | 369 +++++++ .../29/03F029281E5CFFCBFF215007FC87FDD9.xml | 360 +++++++ .../29/03F029281E5FFFB5FF215327FC12FB99.xml | 347 +++++++ .../29/03F029281E74FFE3FF215477FBB2F808.xml | 478 +++++++++ .../29/03F029281E78FFEEFF2157B3FD9EF988.xml | 359 +++++++ .../8B/03F28B2BFF8E2D74FF3AFB66FC62F973.xml | 148 +++ .../8B/03F28B2BFF8E2D7DFF3AF8CFFB59FDFC.xml | 694 +++++++++++++ .../87/1D1A87C2BB21FFBAFF41E3A5FD71FC97.xml | 330 ++++++ .../87/1D1A87C2BB22FFB4FF41E064FE3FFFE6.xml | 212 ++++ .../87/1D1A87C2BB24FFB7FF41E687FC2FFAAD.xml | 218 ++++ .../87/1D1A87C2BB26FFB1FF41E1FBFA7EFDB6.xml | 212 ++++ .../87/1D1A87C2BB28FFA2FF41E0E9FB1CFF52.xml | 174 ++++ .../87/1D1A87C2BB2BFFBDFF41E5FCFB02FB23.xml | 370 +++++++ .../87/1D1A87C2BB2DFFB9FF41E790FB6FFCBA.xml | 154 +++ .../87/1D1A87C2BB2FFFB8FF41E7BCFE52FCBA.xml | 221 ++++ .../87/1D1A87C2BB34FFA6FF41E1A4FB55F948.xml | 215 ++++ .../87/1D1A87C2BB35FFA0FF41E4F8FC49F8F2.xml | 293 ++++++ .../87/1D1A87C2BB35FFA1FF41E258FC9CFA6E.xml | 246 +++++ .../87/1D1A87C2BB37FFA0FF41E4F8FBD8FF52.xml | 227 +++++ .../87/222E87ABB572C44957C0B422880DFA66.xml | 126 +-- .../87/2B0487A23175FFE1FF1422F2FDCDFD50.xml | 93 ++ .../87/2B0487A2317EFFEFFF1423BFFBCBFE30.xml | 391 ++++++++ .../87/2B0487A2317FFFEBFF14247EFE39F867.xml | 89 ++ .../87/572E87900F0DA70B95FE552B1374FE2F.xml | 252 +++++ .../87/572E87900F0EA70A95FE53741523FE53.xml | 234 +++++ .../87/572E87900F0FA70995FE511713EDFC61.xml | 226 +++++ .../87/572E87900F10A70895FE54A115DEFE2E.xml | 218 ++++ .../87/572E87900F11A71795FE54711692FCDD.xml | 314 ++++++ .../87/572E87900F12A71695FE537817B9FD6C.xml | 239 +++++ .../87/572E87900F13A71595FE543A1531FC65.xml | 327 ++++++ .../87/572E87900F14A71495FE540212CDFCA3.xml | 256 +++++ .../87/572E87900F18A71095FE51A5153AF833.xml | 306 ++++++ .../87/572E87900F1BA71D95FE531D15A7FCD8.xml | 254 +++++ .../87/6725879F7941FFE4CED9FADBFC83F906.xml | 95 ++ .../87/6725879F7941FFEACED9F884FCEAFC79.xml | 176 ++++ .../87/6725879F7942FFE7CED9FC51FAA9F9E1.xml | 136 +++ .../87/6725879F7944FFE0CED9FA4BFA92FDA9.xml | 204 ++++ .../87/6725879F7944FFE1CED9FD0DFA00FB9F.xml | 121 +++ .../87/6725879F7945FFE7CED9FA46FCFFFC31.xml | 181 ++++ .../87/6725879F7946FFE1CED9FA71FD08FD8D.xml | 302 ++++++ .../87/6725879F7949FFD3CED9FBC6FD60FF49.xml | 213 ++++ .../87/6725879F7949FFECCED9FEABFA04FC43.xml | 130 +++ .../87/6725879F794AFFEECED9F935FC67FEF1.xml | 119 +++ .../87/6725879F794BFFEDCED9FE11FB5EF825.xml | 154 +++ .../87/6725879F794DFFE8CED9FB29FE87F99D.xml | 103 ++ .../87/6725879F794DFFEFCED9F9FDFDC8F9DF.xml | 183 ++++ .../87/6725879F794FFFE8CED9F95CFBB6FBE9.xml | 166 ++++ .../87/6725879F794FFFEACED9FB93FB80F93E.xml | 108 ++ .../87/6725879F7958FFFCCED9FB86FA1FFBA1.xml | 137 +++ .../87/6725879F7958FFFDCED9FF14FACFFC04.xml | 164 +++ .../87/6725879F7959FFE3CED9FBE1FF7DFA10.xml | 129 +++ .../87/6725879F795AFFFFCED9FD55FC7FFA55.xml | 205 ++++ .../87/683E87811C61FF8CFF64FACFFE46FCB3.xml | 299 ++++++ .../87/683E87811C62FF80FF64FA54FC3DF8BF.xml | 216 ++++ .../87/683E87811C62FF83FF64F89DFE7FFD9A.xml | 214 ++++ .../87/683E87811C64FF81FF64F8EDFE69FE0A.xml | 238 +++++ .../87/683E87811C64FF86FF64FA80FBE3F96F.xml | 175 ++++ .../87/683E87811C64FF86FF64FC65FEC5FA8F.xml | 192 ++++ .../87/683E87811C65FF86FF64F8B1FD0FFF5E.xml | 129 +++ .../87/683E87811C65FF87FF64F9FBFD03F953.xml | 130 +++ .../87/683E87811C65FF87FF64FB95FE71FA1D.xml | 164 +++ .../87/683E87811C66FF84FF64FAD3FD65F9A1.xml | 131 +++ .../87/683E87811C66FF87FF64F9AFFE84FBB7.xml | 538 ++++++++++ .../87/683E87811C6AFF88FF64FF61FAB8FE04.xml | 148 +++ .../87/683E87811C6BFF89FF64F932FC9FF817.xml | 125 +++ .../87/683E87811C6DFF8FFF64FA81FE15F94F.xml | 206 ++++ .../87/683E87811C6DFF8FFF64FF61FE3DFC18.xml | 328 ++++++ .../87/683E87811C6EFF8CFF64FB63FD31F9A1.xml | 229 +++++ .../87/683E87811C6EFF8CFF64FC91FCACFBE8.xml | 136 +++ .../87/AA1B878AFF868678FF16FA6E7B60FDE4.xml | 97 +- .../87/AA1B878AFF878676FF16FB207BC8F881.xml | 99 +- .../87/AA1B878AFF8F8660FF16FB6E7A11FD63.xml | 105 +- .../87/AA1B878AFF938662FF16FF5378FDFC1F.xml | 97 +- .../D1/E902D143FFBD0E28FF276407EC66FDDF.xml | 127 +-- .../3D/F9023D04FFC8FFF6FF69E6943BF4EDE2.xml | 343 +++++++ .../3D/F9023D04FFCAFFF3FF69E5E93BEBEA57.xml | 346 +++++++ .../3D/F9023D04FFCBFFF0FF69E5B13BEBE90F.xml | 343 +++++++ .../3D/F9023D04FFCEFFF5FF69E2E63BEBEB53.xml | 280 ++++++ .../3D/F9023D04FFD0FFECFF69E3953A74EBEB.xml | 352 +++++++ .../3D/F9023D04FFD3FFE8FF69E3FA3BE4EC33.xml | 416 ++++++++ .../3D/F9023D04FFD4FFF2FF69E4ED3BEBEAEE.xml | 324 ++++++ .../3D/F9023D04FFDBFFE1FF69E7A83BEEEF0F.xml | 444 +++++++++ .../3D/F9023D04FFDDFFE5FF69E7A83BEBEF43.xml | 287 ++++++ .../3D/F9023D04FFDEFFE6FF69E7A83BEBEF1B.xml | 258 +++++ .../3D/F9023D04FFE0FFD8FF69E7A83D65EA64.xml | 173 ++++ .../3D/F9023D04FFE0FFD9FF69E55F3AE9EA0B.xml | 479 +++++++++ .../3D/F9023D04FFE1FFDDFF69E58D3BEBE99F.xml | 378 +++++++ .../3D/F9023D04FFE5FFE2FF69E5793A65EFD9.xml | 592 +++++++++++ .../3D/F9023D04FFEBFFD1FF69E1D23AB5EF08.xml | 358 +++++++ .../3D/F9023D04FFECFFD4FF69E2BD3D67EEB1.xml | 163 +++ .../3D/F9023D04FFECFFD4FF69E3013D67ED5A.xml | 139 +++ .../3D/F9023D04FFECFFD4FF69E4ED385AEC7A.xml | 97 ++ .../3D/F9023D04FFECFFD5FF69E0133D67E976.xml | 177 ++++ .../3D/F9023D04FFEDFFD5FF69E1513D67EFAD.xml | 158 +++ .../3D/F9023D04FFEDFFD5FF69E3FC3D67EE76.xml | 161 +++ .../3D/F9023D04FFEDFFD5FF69E4273D67EC1B.xml | 163 +++ .../3D/F9023D04FFEDFFD5FF69E6513D67EAAD.xml | 160 +++ .../3D/F9023D04FFEEFFD4FF69E7A83BF2EBEA.xml | 369 +++++++ .../3D/F9023D04FFF0FFCEFF69E2843BEEEAA7.xml | 412 ++++++++ .../3D/F9023D04FFF4FFD3FF69E2DC3BEEEA9B.xml | 400 ++++++++ .../3D/F9023D04FFF6FFCFFF69E42C3BEEE92B.xml | 606 +++++++++++ .../3D/F9023D04FFF7FFCCFF69E29E3A32EDF7.xml | 940 ++++++++++++++++++ .../3D/F9023D04FFF7FFCFFF69E6AD3AB5ED25.xml | 228 +++++ .../3D/F9023D04FFFCFFC8FF69E4083A5CE9C7.xml | 746 ++++++++++++++ .../3D/F9023D04FFFFFFC4FF69E06E3BF2EA9B.xml | 193 ++++ .../3D/F9023D04FFFFFFC7FF69E1DA38B5EF4E.xml | 103 ++ .../3D/F9023D04FFFFFFC7FF69E6893AF1EEF9.xml | 420 ++++++++ 233 files changed, 57985 insertions(+), 665 deletions(-) create mode 100644 data/02/42/40/024240545C44FFDFFF3CFF4F8C8FC8B0.xml create mode 100644 data/02/42/40/024240545C4AFFD2FF3CFF078839CD0C.xml create mode 100644 data/02/42/40/024240545C4CFFD4FF3CFB2A89E3CC74.xml create mode 100644 data/02/42/40/024240545C59FFC0FF3CFB598891CF83.xml create mode 100644 data/02/42/40/024240545C59FFC0FF3CFC9A8BB7CE4D.xml create mode 100644 data/02/42/40/024240545C59FFC3FF3CF9978C40CBAC.xml create mode 100644 data/02/42/40/024240545C5AFFC3FF3CFCB98BB7CEAC.xml create mode 100644 data/02/42/40/024240545C5AFFC3FF3CFDFA8BB7C96D.xml create mode 100644 data/02/42/40/024240545C5FFFC0FF3CFB218814C88C.xml create mode 100644 data/02/42/40/024240545C5FFFC6FF3CFDBD8819CEC8.xml create mode 100644 data/02/42/40/024240545C5FFFC6FF3CFF078BA7C869.xml create mode 100644 data/02/42/40/024240545C64FFFDFF3CF9B68BD4CD21.xml create mode 100644 data/02/42/40/024240545C64FFFDFF3CFAD38AE5CC60.xml create mode 100644 data/02/42/40/024240545C64FFFDFF3CFCB98854CEC6.xml create mode 100644 data/02/42/40/024240545C64FFFDFF3CFDFA8BD5C96D.xml create mode 100644 data/02/42/40/024240545C67FFF8FF3CFBD3885BC840.xml create mode 100644 data/02/42/40/024240545C67FFFEFF3CFD708B9AC9C4.xml create mode 100644 data/02/42/40/024240545C67FFFEFF3CFF4F89C2C82B.xml create mode 100644 data/02/42/40/024240545C6DFFF1FF3CF9408DC8CD30.xml create mode 100644 data/02/42/40/024240545C72FFEAFF3CF8CC8DBBCAA8.xml create mode 100644 data/02/42/40/024240545C73FFEAFF3CFA4E8DAFCCF9.xml create mode 100644 data/02/42/40/024240545C73FFEAFF3CFBEB889CCF38.xml create mode 100644 data/02/42/40/024240545C73FFEAFF3CFEFE8B5AC99F.xml create mode 100644 data/02/42/40/024240545C73FFF4FF3CF91F88ADCC3B.xml create mode 100644 data/03/82/D2/0382D24BFFB3B81CEDE9D424FC2EFF12.xml create mode 100644 data/03/82/D2/0382D24BFFB8B813EDE9D299FBB7FD42.xml create mode 100644 data/03/82/D2/0382D24BFFBDB81EEDE9D594FA8FF87C.xml create mode 100644 data/03/82/D2/0382D24BFFBFB811EDE9D19DFE7FF9B3.xml create mode 100644 data/03/94/B5/0394B500FFC0FFA9FF322834D45EFAA8.xml create mode 100644 data/03/94/B5/0394B500FFC0FFA9FF322CD4D024FE6C.xml create mode 100644 data/03/94/B5/0394B500FFC0FFA9FF322E84D2F4FCC4.xml create mode 100644 data/03/94/B5/0394B500FFC4FFADFF322FA4D263F844.xml create mode 100644 data/03/94/B5/0394B500FFC5FFACFF322A76D5DBF845.xml create mode 100644 data/03/94/B5/0394B500FFC6FFAFFF322868D2CFFB70.xml create mode 100644 data/03/94/B5/0394B500FFC6FFAFFF322988D46CF990.xml create mode 100644 data/03/94/B5/0394B500FFC6FFAFFF322A50D0E1F8E8.xml create mode 100644 data/03/94/B5/0394B500FFC6FFAFFF322C9CD0BAFED8.xml create mode 100644 data/03/94/B5/0394B500FFC6FFAFFF322D98D048FDF8.xml create mode 100644 data/03/94/B5/0394B500FFC7FFAEFF322AE0D3B2F844.xml create mode 100644 data/03/94/B5/0394B500FFC7FFAEFF322C9CD5DCFEFC.xml create mode 100644 data/03/94/B5/0394B500FFC7FFAEFF322DBCD2D1FD68.xml create mode 100644 data/03/94/B5/0394B500FFC7FFAEFF322F48D1B2F9C8.xml create mode 100644 data/03/94/B5/0394B500FFD1FFBBFF3229C1D04AF86F.xml create mode 100644 data/03/94/B5/0394B500FFD3FFB5FF322C9CD5F7F8AD.xml create mode 100644 data/03/94/B5/0394B500FFDAFFADFF322FFDD595FC8C.xml create mode 100644 data/03/94/B5/0394B500FFDAFFB3FF322E61D45DFC3C.xml create mode 100644 data/03/94/B5/0394B500FFDDFFB3FF322CD4D249FD80.xml create mode 100644 data/03/9F/21/039F21082240684DFF30FAE0DE91CB8B.xml create mode 100644 data/03/9F/21/039F21082240684DFF30FE6CDF96C909.xml create mode 100644 data/03/9F/21/039F21082241684DFF30FA84DE1FCD85.xml create mode 100644 data/03/9F/21/039F21082243684FFF30F935DE28CE31.xml create mode 100644 data/03/9F/21/039F21082245684AFF30F8DFDE2FCDA1.xml create mode 100644 data/03/9F/21/039F21082247684AFF30F990DE1FCBC3.xml create mode 100644 data/03/9F/21/039F21082247684AFF30FE48D94EC999.xml create mode 100644 data/03/9F/21/039F2108224A6847FF30FC09DF96CBA1.xml create mode 100644 data/03/9F/21/039F2108224B6847FF30FC95D951CF60.xml create mode 100644 data/03/9F/21/039F2108224E6843FF30FACFDEF3CBD2.xml create mode 100644 data/03/DE/8F/03DE8F5DFF802D382DE9F9BA90644E5A.xml create mode 100644 data/03/DE/8F/03DE8F5DFF832D392DE9FA2F96CD4D6D.xml create mode 100644 data/03/DE/8F/03DE8F5DFF852D3E2DE9FBE290134CD2.xml create mode 100644 data/03/DE/8F/03DE8F5DFF872D3D2DE9F93A93384C5F.xml create mode 100644 data/03/DE/8F/03DE8F5DFF882D332DE9FB7C91E14CFF.xml create mode 100644 data/03/DE/8F/03DE8F5DFF892D322DE9FF6893BC4EC0.xml create mode 100644 data/03/DE/8F/03DE8F5DFF892D332DE9F9C891A44F17.xml create mode 100644 data/03/DE/8F/03DE8F5DFF8B2D312DE9FCFD97A94C99.xml create mode 100644 data/03/DE/8F/03DE8F5DFF8D2D362DE9FF6890034D81.xml create mode 100644 data/03/DE/8F/03DE8F5DFF8D2D372DE9F90A96C24EB1.xml create mode 100644 data/03/DE/8F/03DE8F5DFF8E2D0A2DE9FED997334AAC.xml create mode 100644 data/03/DE/8F/03DE8F5DFF8F2D352DE9FDDC92E04BF0.xml create mode 100644 data/03/DE/8F/03DE8F5DFF962D222DE9FA5A912B4F39.xml create mode 100644 data/03/DE/8F/03DE8F5DFF992D222DE9FB9190684CCD.xml create mode 100644 data/03/DE/8F/03DE8F5DFF9A2D262DE9FC4996184E77.xml create mode 100644 data/03/DE/8F/03DE8F5DFF9B2D212DE9F9D790034AF4.xml create mode 100644 data/03/DE/8F/03DE8F5DFF9D2D272DE9FA5B91F14FA7.xml create mode 100644 data/03/DE/8F/03DE8F5DFF9E2D252DE9FA5D912B4CD3.xml create mode 100644 data/03/DE/8F/03DE8F5DFF9F2D242DE9FC9F91B34CD0.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA02D182DE9F96190614E2A.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA12D1A2DE9FF6897724DFF.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA12D1B2DE9F8D396AC4D69.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA32D192DE9FA9E93384E51.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA52D1F2DE9FD4C90C04AF4.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA62D1D2DE9FF6890F24D38.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA72D1C2DE9FE9193834C86.xml create mode 100644 data/03/DE/8F/03DE8F5DFFA82D132DE9FF68906C4C11.xml create mode 100644 data/03/DE/8F/03DE8F5DFFAB2D102DE9FF6893784DCE.xml create mode 100644 data/03/DE/8F/03DE8F5DFFAB2D162DE9F8D0965E4944.xml create mode 100644 data/03/DE/8F/03DE8F5DFFAC2D142DE9FDA490254A38.xml create mode 100644 data/03/DE/8F/03DE8F5DFFAD2D172DE9FD4D91AD4932.xml create mode 100644 data/03/DE/8F/03DE8F5DFFAE2D6A2DE9FC23975D4F9F.xml create mode 100644 data/03/DE/8F/03DE8F5DFFAF2D152DE9FE9190334BDC.xml create mode 100644 data/03/DE/8F/03DE8F5DFFB22D092DE9FD4D90794CA8.xml create mode 100644 data/03/DE/8F/03DE8F5DFFB32D092DE9FE0093DD4944.xml create mode 100644 data/03/DE/8F/03DE8F5DFFB52D0F2DE9FC8590614BF0.xml create mode 100644 data/03/DE/8F/03DE8F5DFFB62D022DE9F98F91F84D76.xml create mode 100644 data/03/DE/8F/03DE8F5DFFB72D0D2DE9F9E5912A4D3B.xml create mode 100644 data/03/DE/8F/03DE8F5DFFB82D002DE9FD4392C14830.xml create mode 100644 data/03/DE/8F/03DE8F5DFFBA2D012DE9FF68933A4DC1.xml create mode 100644 data/03/DE/8F/03DE8F5DFFBA2D072DE9F8CA97A84818.xml create mode 100644 data/03/DE/8F/03DE8F5DFFBC2D042DE9FC7096404AD0.xml create mode 100644 data/03/DE/8F/03DE8F5DFFBE2D052DE9FF6890614C72.xml create mode 100644 data/03/DE/8F/03DE8F5DFFBF2D042DE9FDB990614C94.xml create mode 100644 data/03/DE/8F/03DE8F5DFFD12D6B2DE9FAF391F34C2A.xml create mode 100644 data/03/DE/8F/03DE8F5DFFD22D6E2DE9FC8290B54FA7.xml create mode 100644 data/03/DE/8F/03DE8F5DFFD32D692DE9FB9090274809.xml create mode 100644 data/03/F0/29/03F029281E01FF91FF215606FAEAFF39.xml create mode 100644 data/03/F0/29/03F029281E05FF9EFF215007FEBAFB99.xml create mode 100644 data/03/F0/29/03F029281E21FFB7FF2155E7FDDDF991.xml create mode 100644 data/03/F0/29/03F029281E23FFB0FF2157EFFCC7F81D.xml create mode 100644 data/03/F0/29/03F029281E27FFBDFF2151DAFF36F8EE.xml create mode 100644 data/03/F0/29/03F029281E30FFA6FF215097FD1CFD45.xml create mode 100644 data/03/F0/29/03F029281E32FFA0FF21539BFEEDFD31.xml create mode 100644 data/03/F0/29/03F029281E37FFADFF2155BFFA42FD45.xml create mode 100644 data/03/F0/29/03F029281E39FFA8FF21539BFEBAF88D.xml create mode 100644 data/03/F0/29/03F029281E3DFFAAFF2151DAFA85FAB9.xml create mode 100644 data/03/F0/29/03F029281E3EFF95FF2154F0FE94F8C1.xml create mode 100644 data/03/F0/29/03F029281E46FFDDFF21536FFA43FD09.xml create mode 100644 data/03/F0/29/03F029281E49FFDFFF215257FD77FBF5.xml create mode 100644 data/03/F0/29/03F029281E4BFFDAFF2155CBFBBBFAB9.xml create mode 100644 data/03/F0/29/03F029281E4EFFC7FF215487FEE5FC09.xml create mode 100644 data/03/F0/29/03F029281E53FFC1FF215557FBC3FB23.xml create mode 100644 data/03/F0/29/03F029281E55FFCDFF215479FCCDFF15.xml create mode 100644 data/03/F0/29/03F029281E59FFC8FF21506BFE62FF39.xml create mode 100644 data/03/F0/29/03F029281E5CFFCBFF215007FC87FDD9.xml create mode 100644 data/03/F0/29/03F029281E5FFFB5FF215327FC12FB99.xml create mode 100644 data/03/F0/29/03F029281E74FFE3FF215477FBB2F808.xml create mode 100644 data/03/F0/29/03F029281E78FFEEFF2157B3FD9EF988.xml create mode 100644 data/03/F2/8B/03F28B2BFF8E2D74FF3AFB66FC62F973.xml create mode 100644 data/03/F2/8B/03F28B2BFF8E2D7DFF3AF8CFFB59FDFC.xml create mode 100644 data/1D/1A/87/1D1A87C2BB21FFBAFF41E3A5FD71FC97.xml create mode 100644 data/1D/1A/87/1D1A87C2BB22FFB4FF41E064FE3FFFE6.xml create mode 100644 data/1D/1A/87/1D1A87C2BB24FFB7FF41E687FC2FFAAD.xml create mode 100644 data/1D/1A/87/1D1A87C2BB26FFB1FF41E1FBFA7EFDB6.xml create mode 100644 data/1D/1A/87/1D1A87C2BB28FFA2FF41E0E9FB1CFF52.xml create mode 100644 data/1D/1A/87/1D1A87C2BB2BFFBDFF41E5FCFB02FB23.xml create mode 100644 data/1D/1A/87/1D1A87C2BB2DFFB9FF41E790FB6FFCBA.xml create mode 100644 data/1D/1A/87/1D1A87C2BB2FFFB8FF41E7BCFE52FCBA.xml create mode 100644 data/1D/1A/87/1D1A87C2BB34FFA6FF41E1A4FB55F948.xml create mode 100644 data/1D/1A/87/1D1A87C2BB35FFA0FF41E4F8FC49F8F2.xml create mode 100644 data/1D/1A/87/1D1A87C2BB35FFA1FF41E258FC9CFA6E.xml create mode 100644 data/1D/1A/87/1D1A87C2BB37FFA0FF41E4F8FBD8FF52.xml create mode 100644 data/2B/04/87/2B0487A23175FFE1FF1422F2FDCDFD50.xml create mode 100644 data/2B/04/87/2B0487A2317EFFEFFF1423BFFBCBFE30.xml create mode 100644 data/2B/04/87/2B0487A2317FFFEBFF14247EFE39F867.xml create mode 100644 data/57/2E/87/572E87900F0DA70B95FE552B1374FE2F.xml create mode 100644 data/57/2E/87/572E87900F0EA70A95FE53741523FE53.xml create mode 100644 data/57/2E/87/572E87900F0FA70995FE511713EDFC61.xml create mode 100644 data/57/2E/87/572E87900F10A70895FE54A115DEFE2E.xml create mode 100644 data/57/2E/87/572E87900F11A71795FE54711692FCDD.xml create mode 100644 data/57/2E/87/572E87900F12A71695FE537817B9FD6C.xml create mode 100644 data/57/2E/87/572E87900F13A71595FE543A1531FC65.xml create mode 100644 data/57/2E/87/572E87900F14A71495FE540212CDFCA3.xml create mode 100644 data/57/2E/87/572E87900F18A71095FE51A5153AF833.xml create mode 100644 data/57/2E/87/572E87900F1BA71D95FE531D15A7FCD8.xml create mode 100644 data/67/25/87/6725879F7941FFE4CED9FADBFC83F906.xml create mode 100644 data/67/25/87/6725879F7941FFEACED9F884FCEAFC79.xml create mode 100644 data/67/25/87/6725879F7942FFE7CED9FC51FAA9F9E1.xml create mode 100644 data/67/25/87/6725879F7944FFE0CED9FA4BFA92FDA9.xml create mode 100644 data/67/25/87/6725879F7944FFE1CED9FD0DFA00FB9F.xml create mode 100644 data/67/25/87/6725879F7945FFE7CED9FA46FCFFFC31.xml create mode 100644 data/67/25/87/6725879F7946FFE1CED9FA71FD08FD8D.xml create mode 100644 data/67/25/87/6725879F7949FFD3CED9FBC6FD60FF49.xml create mode 100644 data/67/25/87/6725879F7949FFECCED9FEABFA04FC43.xml create mode 100644 data/67/25/87/6725879F794AFFEECED9F935FC67FEF1.xml create mode 100644 data/67/25/87/6725879F794BFFEDCED9FE11FB5EF825.xml create mode 100644 data/67/25/87/6725879F794DFFE8CED9FB29FE87F99D.xml create mode 100644 data/67/25/87/6725879F794DFFEFCED9F9FDFDC8F9DF.xml create mode 100644 data/67/25/87/6725879F794FFFE8CED9F95CFBB6FBE9.xml create mode 100644 data/67/25/87/6725879F794FFFEACED9FB93FB80F93E.xml create mode 100644 data/67/25/87/6725879F7958FFFCCED9FB86FA1FFBA1.xml create mode 100644 data/67/25/87/6725879F7958FFFDCED9FF14FACFFC04.xml create mode 100644 data/67/25/87/6725879F7959FFE3CED9FBE1FF7DFA10.xml create mode 100644 data/67/25/87/6725879F795AFFFFCED9FD55FC7FFA55.xml create mode 100644 data/68/3E/87/683E87811C61FF8CFF64FACFFE46FCB3.xml create mode 100644 data/68/3E/87/683E87811C62FF80FF64FA54FC3DF8BF.xml create mode 100644 data/68/3E/87/683E87811C62FF83FF64F89DFE7FFD9A.xml create mode 100644 data/68/3E/87/683E87811C64FF81FF64F8EDFE69FE0A.xml create mode 100644 data/68/3E/87/683E87811C64FF86FF64FA80FBE3F96F.xml create mode 100644 data/68/3E/87/683E87811C64FF86FF64FC65FEC5FA8F.xml create mode 100644 data/68/3E/87/683E87811C65FF86FF64F8B1FD0FFF5E.xml create mode 100644 data/68/3E/87/683E87811C65FF87FF64F9FBFD03F953.xml create mode 100644 data/68/3E/87/683E87811C65FF87FF64FB95FE71FA1D.xml create mode 100644 data/68/3E/87/683E87811C66FF84FF64FAD3FD65F9A1.xml create mode 100644 data/68/3E/87/683E87811C66FF87FF64F9AFFE84FBB7.xml create mode 100644 data/68/3E/87/683E87811C6AFF88FF64FF61FAB8FE04.xml create mode 100644 data/68/3E/87/683E87811C6BFF89FF64F932FC9FF817.xml create mode 100644 data/68/3E/87/683E87811C6DFF8FFF64FA81FE15F94F.xml create mode 100644 data/68/3E/87/683E87811C6DFF8FFF64FF61FE3DFC18.xml create mode 100644 data/68/3E/87/683E87811C6EFF8CFF64FB63FD31F9A1.xml create mode 100644 data/68/3E/87/683E87811C6EFF8CFF64FC91FCACFBE8.xml create mode 100644 data/F9/02/3D/F9023D04FFC8FFF6FF69E6943BF4EDE2.xml create mode 100644 data/F9/02/3D/F9023D04FFCAFFF3FF69E5E93BEBEA57.xml create mode 100644 data/F9/02/3D/F9023D04FFCBFFF0FF69E5B13BEBE90F.xml create mode 100644 data/F9/02/3D/F9023D04FFCEFFF5FF69E2E63BEBEB53.xml create mode 100644 data/F9/02/3D/F9023D04FFD0FFECFF69E3953A74EBEB.xml create mode 100644 data/F9/02/3D/F9023D04FFD3FFE8FF69E3FA3BE4EC33.xml create mode 100644 data/F9/02/3D/F9023D04FFD4FFF2FF69E4ED3BEBEAEE.xml create mode 100644 data/F9/02/3D/F9023D04FFDBFFE1FF69E7A83BEEEF0F.xml create mode 100644 data/F9/02/3D/F9023D04FFDDFFE5FF69E7A83BEBEF43.xml create mode 100644 data/F9/02/3D/F9023D04FFDEFFE6FF69E7A83BEBEF1B.xml create mode 100644 data/F9/02/3D/F9023D04FFE0FFD8FF69E7A83D65EA64.xml create mode 100644 data/F9/02/3D/F9023D04FFE0FFD9FF69E55F3AE9EA0B.xml create mode 100644 data/F9/02/3D/F9023D04FFE1FFDDFF69E58D3BEBE99F.xml create mode 100644 data/F9/02/3D/F9023D04FFE5FFE2FF69E5793A65EFD9.xml create mode 100644 data/F9/02/3D/F9023D04FFEBFFD1FF69E1D23AB5EF08.xml create mode 100644 data/F9/02/3D/F9023D04FFECFFD4FF69E2BD3D67EEB1.xml create mode 100644 data/F9/02/3D/F9023D04FFECFFD4FF69E3013D67ED5A.xml create mode 100644 data/F9/02/3D/F9023D04FFECFFD4FF69E4ED385AEC7A.xml create mode 100644 data/F9/02/3D/F9023D04FFECFFD5FF69E0133D67E976.xml create mode 100644 data/F9/02/3D/F9023D04FFEDFFD5FF69E1513D67EFAD.xml create mode 100644 data/F9/02/3D/F9023D04FFEDFFD5FF69E3FC3D67EE76.xml create mode 100644 data/F9/02/3D/F9023D04FFEDFFD5FF69E4273D67EC1B.xml create mode 100644 data/F9/02/3D/F9023D04FFEDFFD5FF69E6513D67EAAD.xml create mode 100644 data/F9/02/3D/F9023D04FFEEFFD4FF69E7A83BF2EBEA.xml create mode 100644 data/F9/02/3D/F9023D04FFF0FFCEFF69E2843BEEEAA7.xml create mode 100644 data/F9/02/3D/F9023D04FFF4FFD3FF69E2DC3BEEEA9B.xml create mode 100644 data/F9/02/3D/F9023D04FFF6FFCFFF69E42C3BEEE92B.xml create mode 100644 data/F9/02/3D/F9023D04FFF7FFCCFF69E29E3A32EDF7.xml create mode 100644 data/F9/02/3D/F9023D04FFF7FFCFFF69E6AD3AB5ED25.xml create mode 100644 data/F9/02/3D/F9023D04FFFCFFC8FF69E4083A5CE9C7.xml create mode 100644 data/F9/02/3D/F9023D04FFFFFFC4FF69E06E3BF2EA9B.xml create mode 100644 data/F9/02/3D/F9023D04FFFFFFC7FF69E1DA38B5EF4E.xml create mode 100644 data/F9/02/3D/F9023D04FFFFFFC7FF69E6893AF1EEF9.xml diff --git a/data/02/42/40/024240545C44FFDFFF3CFF4F8C8FC8B0.xml b/data/02/42/40/024240545C44FFDFFF3CFF4F8C8FC8B0.xml new file mode 100644 index 00000000000..c86f5d3f1fd --- /dev/null +++ b/data/02/42/40/024240545C44FFDFFF3CFF4F8C8FC8B0.xml @@ -0,0 +1,213 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Microhygrodromicus politus + +sp. n. + + + + + + +( +Figs 126 +, +136–141 +) + + + + +Type material examined. +Holotype +♂ +( +Fig. 126 +; dissected): ‘ + +CHINA + +: +YUNNAN PROv. +| Gongshan Co., Biluo Mts. | Pass.; mixed forest and alpine | meadows; +5.–8.vii.2019 +| +28°04.7’N +, +98°45.6’E +, +3890m +| Hájek, Hrůzová, Král, Růžička & Sommer lgt.’ <printed>, ‘ +HOLOTYPE +| + +Microhygrodromicus + +| + +politus + + +sp. n. + +| Shavrin A.V. des. 2024’ <red, printed> ( +NMPC +). + + + + +Description. +Measurements: HW: 0.60; HL: 0.51; OL: 0.20; LT: 0.10; AL: 0.00; PL: 0.68; PWmax: 0.72; PWmin: 0.52; ESL: 1.11; EW: 1.17; MTbL: 0.87; MTrL ( +holotype +): 0.31 (MTrL 1–4: 0.16; MTrL 5: 0.15); AW: 1.19; AedL: 0.85; BL: 3.70. + + + +FIGURES 136–140. + +Microhygrodromicus politus + +: 136—aedeagus, parameral view, 137—aedeagus, lateral view, 138—male genital segment, 139—male tergite VIII, 140—male sternite VIII. Scale bars: 0.1 mm. + + + +Habitus as in +Fig. 126 +. Body shiny; forebody dark-brown, with black abdomen; antennae, maxillary palpomeres 3–4, femori and tarsi brown; mouthparts and tibiae yellow-brown. Forebody without microsculpture except of apical portion of clypeus with sparse transverse reticulation, neck with fine transverse meshes and abdomen with indistinct transverse microsculpture. Pubescence fine and sparse, suberect, denser and longer on elytra and abdomen. + +Head 1.1 times as broad as long, with distinctly elevated middle portion between anterior margins of eyes and infraorbital portion; anterio-median depression wide and deep; interocellar depression wide and moderately deep, subtriangular, from widest middle part at level of anterior third of eyes narrowed posteriad toward neck; anteocellar foveae long and deep, convergent latero-anteriad toward level of anterior third of eyes. Temples convex, twice shorter than longitudinal length of eyes. Distance between ocelli 1.8 times as long as distance between ocellus and eyes. Punctation irregular, sparser and finer in middle and denser between ocelli; neck with fine and sparse punctation. Last maxillary palpomere about as long as penultimate segment. Antennomere 3 slightly longer than 2, 4 slightly shorter than 3, 5–7 indistinctly broader and distinctly longer than 3, 8–9 slightly longer and broader than 7, 10 slightly shorter than 9, apical antennomere 1.6 times as long as 10. +Pronotum moderately wide in apical portion, slightly broader than long and distinctly broader than head, from widest anterior portion strongly narrowed posteriad toward obtuse posterior angles; lateral margins narrowly bordered, without crenulation; mediobasal portion in front of basal margin with moderately deep oval depression; laterobasal portions slightly and widely depressed. Punctation dense and deep, significantly larger than that in middle portion of head, sparser in medioapical portion, with narrow impunctated area in front of mediobasal part. Scutellum with fine and sparse punctation. +Elytra slightly depressed in middle, 1.6 times as long as pronotum. Punctation dense, slightly larger and deeper than that on pronotum, denser and finer around scutellum, and finer and sparser along suture. +Metatarsus distinctly more than twice shorter than metatibiae; apical metatarsomere slightly shorter than preceding four metatarsomeres. +Abdomen broader than elytra. Punctation sparse and fine, sparser in middle portions of abdominal tergites V–VIII. + + +FIGURE 141. +Distribution of + +Microhygrodromicus exiguus + +(circle) and + +M. politus + +(square) in Yunnan, China. + + + +Male. Posterior margin of abdominal tergite VIII straight ( +Fig. 139 +). Posterior margin of abdominal sternite VIII widely concave ( +Fig. 140 +). Genital segment as in +Fig. 138 +. Aedeagus with wide basal portion, narrowed toward median lobe; median lobe gradually narrowed in apical third, with moderately wide apical portion, from middle narrowed toward subacute apex; parameres narrow, disinctly shorter than median lobe, with two long and two short apical setae; internal sac with several elongate sclerotized structures in about middle and preapical portion, with very long flagellum, spirally folded in basal portion ( +Fig. 136 +). Lateral aspect of the aedeagus as in +Fig. 137 +. + +Female unknown. + +Comparative notes. + +Microhygrodromicus politus + + +sp. n. + +can be distingushed from + +M. exiguus + + +sp. n. + +by the larger body, darker abdomen, distinctly finer punctation of the head, longer temples not protruded posteriad, relatively broader apical part of the pronotum without lateral crenulation and with distinctly depressed mediobasal part, shorter elytra, shape of the elongate apical part of the median lobe narrowed toward subacute apex, and other details of the morphology of the aedeagus. + + + + +Distribution. +The species is known only from the +type +locality in Biluo Mts., +Yunnan +, +China +( +Fig. 141 +). + + +Bionomics. +The +holotype +was collected between mixed forest and alpine meadow at an elevation of +3890 m +a.s.l. + + + + +Etymology. +The specific epithet is the Latin adjective + +politus + +, - +a +, - +um +(shiny). It alludes to the shiny forebody. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C4AFFD2FF3CFF078839CD0C.xml b/data/02/42/40/024240545C4AFFD2FF3CFF078839CD0C.xml new file mode 100644 index 00000000000..ea3dbea5284 --- /dev/null +++ b/data/02/42/40/024240545C4AFFD2FF3CFF078839CD0C.xml @@ -0,0 +1,238 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Microhygrodromicus exiguus + +sp. n. + + + + + + +( +Figs 125 +, +127–135 +, +141 +) + + + + +Type material examined. +Holotype +♂ +( +Fig. 125 +; dissected): ‘ + +CHINA + +: +YUNNAN PROv. +| Gongshan Co., | +Dimaluo +vil., | +27°56.82’N +, +098°41.97’E +, +1900 m +| D. Král & J. Růžička leg.’ <printed>, ‘ +6.vii.2019 +. [Y05], | individually under | bark of fallen trunks, | ruderals near road in the village, | above’ <printed>, ‘ +HOLOTYPE +| + +Microhygrodromicus + +| + +exiguus + + +sp. n. + +| Shavrin A.V. des. 2024’ <red, printed> ( +NMPC +). + + + + +FIGURES 131–135. + +Microhygrodromicus exiguus + +: 131—aedeagus, parameral view, 132—aedeagus, lateral view, 133—male genital segment, 134—male tergite VIII, 135—male sternite VIII. Scale bars: 0.1 mm. + + + + +Description. +Measurements: HW: 0.55; HL: 0.42; OL: 0.12; LT: 0.10; AL: 1.42; PL: 0.48; PWmax: 0.60; PWmin: 0.36; ESL: 0.92; EW: 1.00; MTbL: 0.62; MTrL ( +holotype +): 0.27 (MTrL 1–4: 0.19; MTrL 5: 0.08); AW: 1.05; AedL: 0.58; BL: 2.71. + + +Habitus as in +Fig. 125 +. Forebody indistinctly bronze, dark-brown, with blackish abdomen; antennae and legs yellow-brown; mouthparts yellow. Apical portion of clypeus with dense transverse microreticulation, middle part with indistinct transverse diagonal meshes, infraorbital portions with fine subdiagonal reticulation, more visible around each ocellus, mediobasal portion between ocelli and neck with transverse and coriaceous sculpture; neck with dense and fine transverse microreticulation; medioapical portion of pronotum with indistinct transverse meshes, and mediobasal part with distinct isodiametric microreticulation; scutellum with fine isodiametric meshes; abdomen with very dense and fine isodiametric microsculpture. Pubescence of body dense, yellowish, suberect, moderately long, slightly finer on abdominal tergites. + + +Head 1.3 times as broad as long, with slightly elevated median portion in front of level of eyes and strongly elevated infraorbital portions; supra-antennal prominences narrow, elongate and markedly convex; anterio-median depression moderately deep and wide, distinctly narrowed posteriad and connected with interocellar depression; interocellar depression wide and deep (deeper between median level of eyes), from widest apical portion gradually narrowed posteriad. Temples convex, moderately long, slightly shorter than longitudinal length of eyes, slightly protruded posteriad. Distance between ocelli 1.7 times as long as distance between ocellus and posterior margin of eyes. Punctation irregular and moderately large, denser in middle, sparser and slightly deeper on infraorbital portions; mediobasal portion in front of neck with dense and fine punctation; neck with indistinct and very sparse punctation. Labrum as in +Fig. 127 +. Mandibles as in +Fig. 128 +. Labium and mentum as in +Fig. 130 +. Maxillary palpi as in +Fig. 129 +; last maxillary palpomere long, but shorter than penultimate segment. Basal antennomere wide, more than three times as long as broad, antennomere 2 narrower and shorter than basal antennomere, 3 slightly shorter and narrower than 2, 4 shorter than 3, 5–8 slightly longer than 4, 9–10 slightly shorter than 8, apical antennomere 1.7 times as long as 10, from apical third gradually narrowed toward subacute apex. + +Pronotum 1.2 times as broad as long, distinctly broader than head; lateroapical portions gradually and widely rounded apicad, not forming protruded portions; lateral margins distinctly crenulate, markedly stronger along latero-basal margins; posterior angles obtuse; anterior margin widely rounded, about as long as somewhat straight posterior margin. Punctation dense and moderately deep, slightly larger than that in head, sparser in medioapical and denser in middle; mediobasal portion without distinct punctures. Scutellum with several very fine punctures. +Elytra convex, about twice as long as pronotum. Punctation denser and deeper than that in pronotum, finer around scutellum. +Metatarsus about twice shorter that metatibia; apical metatarsomere about twice shorter than preceding four metatarsomeres. +Abdomen indistinctly broader than elytra. Punctation dense and fine. + +Male. Posterior margin of abdominal tergite VIII straight ( +Fig. 134 +). Posterior margin of abdominal sternite VIII widely concave ( +Fig. 135 +). Genital segment as in +Fig. 133 +. Aedeagus with moderately wide basal portion and median lobe, gradually narrowed in apical third, with widely rounded apical part; parameres narrow, slightly not exceeding apex of median lobe, with two long and two short apical setae; internal sac complicated, moderately wide, with large V-shaped slerotized medio-apical and narrow elongate structures in about middle, with very long narrow flagellum, spirally folded in basal portion ( +Fig. 131 +). Lateral aspect of aedeagus as in +Fig. 132 +. + +Female unknown. + +Comparative notes. + +Microhygrodromicus exiguus + + +sp. n. + +can be distinguished from + +M. politus + + +sp. n. + +by the smaller body, paler abdomen, stronger punctation of the head, shorter temples, which are slightly protruded posteriad, narrower apical part of pronotum with presence of lateral crenulation and absence of a mediobasal depression, longer elytra, shape of the rounded apical part of median lobe and other details of the morphology of the aedeagus + + + + +Distribution. +The species is known only from the +type +locality in Gongshan, +Yunnan +, +China +( +Fig. 141 +). + + +Bionomics. +The +holotype +was possibly found under bark of fallen trunks at elevation +1900 m +a.s.l. + + + + +Etymology. +The specific epithet is the Latin adjective + +exiguus + +, - +a +, - +um +(small). It alludes to the small body of the species. + + + + +Remarks. + +Microhygrodromicus exiguus + + +sp. n. + +is the smallest species of the + +Hygrogeus + +complex in the Palaearctic Region. In the Nearctic Region, the smallest species is + +Microedus rogersi +Hatch, 1957 + +( +2.6–2.8 mm +; see +Hatch 1957 +). + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C4CFFD4FF3CFB2A89E3CC74.xml b/data/02/42/40/024240545C4CFFD4FF3CFB2A89E3CC74.xml new file mode 100644 index 00000000000..00087048440 --- /dev/null +++ b/data/02/42/40/024240545C4CFFD4FF3CFB2A89E3CC74.xml @@ -0,0 +1,217 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Himalodromeus grandis + +sp. n. + + + + + + +( +Figs 93, 96 +, +112–113 +, +122 +, +124 +) + + + + +Type material examined. +Holotype +♂ +( +Fig. 93 +; dissected; left antennomeres 10–11 and 5–11 missing): ‘ +Pakistan +( +NWFP +) | Balakot | +23-VI-1953 +| F.Schmid’ <printed>, ‘ +Hygrogeus +| cyanipennis | Cam. | det. V. Puthz 19[printed]81’ <handwritten>, ‘ +HOLOTYPE +| + +Himalodromeus + +| + +grandis + + +sp. n. + +| Shavrin A.V. des. 2024’ <red, printed> ( +MHNG +). + + +Paratype +♀ +(left antenna and right antennomeres 2–11, and right fore leg missing): same data as the holotype, with additional red printed label: ‘ +PARATYPE +| + +Himalodromeus + +| + +grandis + + +sp. n. + +| Shavrin A.V. des. 2024’ <red, printed> ( +MHNG +). + + + + +Description. +Measurements (n=2): HW: 1.60–1.64; HL: 1.15; OL: 0.32–0.38; TL: 0.30; PL: 1.70–2.25; PWmax: 2.30–2.60; PWmin: 1.71–1.85; ESL: 2.65–2.75; EW: 3.10–3.45; MTbL ( +holotype +): 3.25; MTrL ( +holotype +): 1.28 (MTrL 1–4: 0.68; MTrL 5: 0.60); AW: 2.90–3.35; AedL: 1.60; BL: 8.25–9.45 ( +holotype +). + + +Habitus as in +Fig. 94 +. Body dark-brown, with bluish elytra; legs brown; antennae, mouthparts and tarsi yellow-brown (apical maxillary palpomeres distinctly paler). Head with dense isodiametric microsculpture, coarser between ocelli and on neck; pronotum with dense isodiametric microsculpture, finer in mediobasal and medioapical portions; scutellum with dense and moderately coarse transverse microreticulation. + +Head 1.3–1.4 times as broad as long, with slightly elevated infraorbital portions; anterio-median depression connected with slightly depressed subrectangular interocellar depression; anteocellar foveae reaching about level of middle of eyes; basal part of interocellar depression in front of ocelli with widely rounded elevation; temples slightly shorter than longitudinal length of eyes. Ocelli moderately large; distance between ocelli about as long as distance between ocellus and posterior margin of eyes. Punctation dense and large, sparser and finer in middle; mediobasal part between ocelli and neck with fine and sparse pucntation. Apical maxillary palpomere about 1.4 times as long as penultimate segment, distinctly broadened in preapical portion, with rounded apex. Antennomere 2 shorter and narrower than basal antennomere, 3 distinctly longer than 2, 4–6 slightly longer than 3 and 7–9 slightly longer than 6. + +Pronotum 1.1–1.3 times as broad as long, broader slightly in front of middle, from widest part gradually narrowed anteriad and slightly more sharply narrowed posteriad; latero-apical margin distinctly concave; frontal part strongly protruded anteriad, with widely concave apical margin ( +Fig. 96 +); laterobasal margins in front of obtuse hind angles moderately short, subparallel; posterior margin slightly concave; middle portion of disc with shallow and narrow longitudinal depression; mediobasal portion in front of basal margin indistinctly and widely impressed; latero-apical and lateral margins narrowly bordered, reflexed latero-apically ( +holotype +), with smooth crenulation, stronger in +holotype +. Punctation about as that on head, but significantly denser, with interstices between punctures in middle about as long as diameter of nearest punctures, sparser in medioapical and mediobasal portions. Scutellum with distinct dense and moderately fine punctation. + + +Elytra 1.1–1.2 times as broad as long, 1.2–1.5 times as long as pronotum; disc of each elytron with distinct four narrow and elongate elevations in middle, from about mediobasal portion subdiagonally stretching posteriad toward medioapical part; lateral potion widely impressed and slightly reflexed. Punctation about as that on pronotum, but sparser, finer and denser around scutellum and along suture ( +paratype +). + +Abdomen slightly narrower than elytra. + +Male. Pronotum distinctly broader and more convex. Profemora and protarsomeres 1–4 wide. Posterior margin of abdominal tergite VIII straight. Posterior margin of abdominal sternite VIII with significant deep emargination, with dense and very long setation on each latero-apical portion ( +Fig. 122 +). Aedeagus with broad basal part, gradually narrowed toward moderately broad median lobe, from preapical portion strongly narrowed toward elongate and acute apex; basal portions of median lobe with long and narrow lateral sclerotized lobes, curved apically about at level of apical third of median lobe; parameres shortened, not reaching middle of median lobe, with four moderately short apical setae; internal sac without spines, with narrow elongated structures in preapical and middle portions, with long and narrow flagellum, spirally folded in basal portion and significantly broadened in basal part ( +Fig. 112 +). Lateral aspect of the aedeagus as in +Fig. 113 +. + +Female. Pronotum narrower, less convex. Profemuri and protarsomeres 1–4 moderately narrow. Posterior margin of abdominal tergite VIII and sternite VIII straight. + +Comparative notes. +Based on the coloration of the body and the bluish elytra, general shape of pronotum and aedeagus, + +H +. +grandis + + +sp. n. + +is more similar to + +H. cyanipennis + +, from which it differs by the larger pronotum, broader slightly in front of middle, with frontal part more protruded anteriad, denser punctation of the pronotum, the presence of distinct longitudinal elevations on each elytron, the broader apical part of the aedeagus, and other details of the internal and external morphology of the aedeagus. + + + + +Distribution. + +Himalodromeus grandis + + +sp. n. + +is known only from the +type +locality in north-western +Pakistan +( +Fig. 124 +). + + +Bionomics. +Detailed bionomical data are unknown. + + + + +Etymology. +The specific epithet is the Latin adjective + +grandis + +, +-e +(large). It refers to the large body of the species. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C59FFC0FF3CFB598891CF83.xml b/data/02/42/40/024240545C59FFC0FF3CFB598891CF83.xml new file mode 100644 index 00000000000..f2e7e4bb8ac --- /dev/null +++ b/data/02/42/40/024240545C59FFC0FF3CFB598891CF83.xml @@ -0,0 +1,139 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus palpalis +( +Coiffait, 1977 +) + +comb. n. + + + + + + +( +Fig. 89 +) + + + + + + + +Geodromicus palpalis +Coiffait, 1977: 271 + + +; + +Herman 2001: 300 + +, + +Smetana 2004: 244 + +, + +Schülke & Smetana 2015: 314 + +. + + + + + +Type material examined. + +Holotype +♂ +: ‘ +Dampelek +b. +Jumla’ +<printed>, ‘ +Gebiet von Jumla Westnepal +, lg. +H.Franz’ +<printed>, ‘ +Holotype’ +<red, printed>, ‘ +Geodromicus palpalis H. Coiffait 1976 +’ <handwritten> ( +MHNH +). + + + + + +Remarks. + +Geodromicus palpalis + +was originally described from “Dampelek près Jumla, +Nèpal +occidental…” and “…environs de Maharigaon, +3000–3500 m +, région de Jumla…” ( +Fig. 89 +). During the study of the +holotype +, I found that this species belongs to the genus + +Asiageodromicus + +. Maxillary palpus as in fig. 5J and aedeagus as in fig. 5I in +Coiffait (1977) +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C59FFC0FF3CFC9A8BB7CE4D.xml b/data/02/42/40/024240545C59FFC0FF3CFC9A8BB7CE4D.xml new file mode 100644 index 00000000000..7637b6c09f5 --- /dev/null +++ b/data/02/42/40/024240545C59FFC0FF3CFC9A8BB7CE4D.xml @@ -0,0 +1,104 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus namucoicus +( +Cheng & Peng, 2020 +) + +comb. n. + + + + + + + + + +Geodromicus namucoicus +Cheng & Peng, 2020: 148 + + +. + + + + + +Remarks. + +Geodromicus namucoicus + +was originally described from Namucuo Lake in +Xizang +, +China +. Based on the general shape of the body (fig. +57 in + +Cheng +et al +. (2020)) + +and the aedeagus (fig. +61 in + +Cheng +et al +. (2020)) + +, this species belongs to the genus + +Asiageodromicus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C59FFC3FF3CF9978C40CBAC.xml b/data/02/42/40/024240545C59FFC3FF3CF9978C40CBAC.xml new file mode 100644 index 00000000000..38f682cf57f --- /dev/null +++ b/data/02/42/40/024240545C59FFC3FF3CF9978C40CBAC.xml @@ -0,0 +1,244 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus spadiceus +(Shavrin, 2019) + +comb. n. + + + + + + +( +Fig. 89 +) + + + + + +Geodromicus spadiceus +Shavrin, 2019: 576 + +. + + + + + +Material examined. +NEPAL +: +KARNALI +: + +1 ♀ +: Jumla. +2 km +W Gothichaur. +3000 m +a.s.l. +01.05.1995 +. A. Weigel leg. ( +NME +); +1 ♀ +: Dolpa, Kagmara Lekh, Garpung Khola, NN. +4100 m +a.s.l. +12.05.1995 +. M. Hartmann leg. ( +NME +); + +GANDAKI +: + +1 ♀ +: Gorkha, Sama, NN, +28°35’28’’N +84°38’17’’E +. +3680 m +a.s.l. +18.05.2013 +. D. Mattern leg. ( +NME +); +1 ♀ +: +Dhaulagiri +, upp. Myagdi Khola valley bef. Italy Camp. +3400–3500 m +a.s.l. +04.07.1998 +. L.A. Berndt & J. Schmidt leg. ( +SNSD +); +1 spec. +: Kali +Gandaki +Tal, +Dhaulagiri +Gletscher. +28°41’10’’N +83°34’07’’E +. +3800–4100 m +a.s.l., bank of river. +30.05.2001 +. O. Jäger leg. ( +SNSD +); +4 ♂♂ +, +6 ♀♀ +: Annapurna, South Himal, W slope. +4300–4500 m +a.s.l. +23.05.2001 +. J. Schmidt leg. (cSh, +NME +); +1 ♀ +: Annapurna Himal, Sikles range. +1400–2100 m +a.s.l. 05.1996. J. Schmidt leg. ( +NME +); +1 ♂ +: Manaslu Mts. N slope, Samdo Sanam Khola. +3900 m +a.s.l. +01.06.2006 +. J. Schmidt leg. (cSh); + +KOSHI +: + +5 ♂♂ +, +5 ♀♀ +: Sankhua Sabkha District, Thudam. +3550–3650 m +a.s.l., mixed forest mainly + +Betula + +/ + +Rhododendron + +. 25– +27.05.1988 +. J. Martens & W. Schawaller leg. (cSh, +SMNS +); +2 ♀♀ +: same District, Kangla Khol E Thudam. +4100–4200 m +a.s.l., dwarf + +Rhododendron + +, rook debris. 24– +25.05.1988 +. J. Martens & W. Schawaller leg. ( +SMNS +); +1 ♀ +: same District, lower Kangla Khola E Thudam, 3850– +3600 m +a.s.l., + +Abies +- +Betula + +forest. +25.05.1988 +. J. Martens & W. Schawaller leg. ( +SMNS +); +1 ♀ +: Taplejung District, above Walungchung Khola, +3600–3800 m +a.s.l., open + +Abies + +forest with + +Rhododendron + +bushes. +21.05.1988 +. J. Martens & W. Schawaller leg. ( +SMNS +). + + + + +Remarks. + +Geodromicus spadiceus + +was originally described from one locality in Manaslu range, central +Nepal +. New records indicate a much wider distribution of this species in central and eastern +Nepal +( +Fig. 89 +). + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C5AFFC3FF3CFCB98BB7CEAC.xml b/data/02/42/40/024240545C5AFFC3FF3CFCB98BB7CEAC.xml new file mode 100644 index 00000000000..5b9fca2d6ee --- /dev/null +++ b/data/02/42/40/024240545C5AFFC3FF3CFCB98BB7CEAC.xml @@ -0,0 +1,128 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus trapezipennis +( +Coiffait, 1979 +) + +comb. n. + + + + + + + + + +Geodromicus trapezipennis +Coiffait, 1979: 563 + + +; + +Herman 2001: 306 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 315 + +. + + + + + +Type material examined. +Syntype +of + +Geodromicus trapezipennis +Coiffait, 1979 + +♀ +: ‘Kouchtous Torrentourlach 2300–3250 8.[19]76’ <handwritten>, ‘Allotype’ <red, printed>, ‘ + +Geodromicus trapezipennis +H. Coiffait 1978 + +’ ( +MHNH +). + + + + +Remarks. + +Geodromicus trapezipennis + +was originally described from “” +Nouristan +, vallée de l`Agôr Khwar, 2 000–3 000 m…”and “Kouchtous, torrent Ourlach, 2 700–3 +250 m +…” ( +Afghanistan +). Based on the study of the +syntype +from MHNH, the original description and the general shape of the aedeagus (fig. 4B in +Coiffait 1979 +), this species belongs to the genus + +Asiageodromicus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C5AFFC3FF3CFDFA8BB7C96D.xml b/data/02/42/40/024240545C5AFFC3FF3CFDFA8BB7C96D.xml new file mode 100644 index 00000000000..15806db7f20 --- /dev/null +++ b/data/02/42/40/024240545C5AFFC3FF3CFDFA8BB7C96D.xml @@ -0,0 +1,104 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus subquadratus +( +Cheng & Peng, 2020 +) + +comb. n. + + + + + + + + + +Geodromicus subquadratus +Cheng & Peng, 2020: 162 + + +. + + + + + +Remarks. + +Geodromicus subquadratus + +was originally described from two localities in +Xizang +, +China +. Based on the general shape of the body (fig. +57 in + +Cheng +et al +. (2020)) + +and the aedeagus (fig. +61 in + +Cheng +et al +. (2020)) + +, this species belongs to the genus + +Asiageodromicus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C5FFFC0FF3CFB218814C88C.xml b/data/02/42/40/024240545C5FFFC0FF3CFB218814C88C.xml new file mode 100644 index 00000000000..aadf1c78d20 --- /dev/null +++ b/data/02/42/40/024240545C5FFFC0FF3CFB218814C88C.xml @@ -0,0 +1,231 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus dolpoensis +( +Coiffait, 1982 +) + +comb. n. + + + + + + +( +Figs 66 +, +81–82 +, +89 +) + + + + + + + +Geodromicus dolpoensis +Coiffait, 1982: 155 + + +; + +Herman 2001: 294 + +, + +Smetana 2004: 243 + +, + +Schülke & Smetana 2015: 313 + +. + + + + + +Type material examined. +Holotype +♂ +( +Fig. 66 +; immature specimen; dissected): ‘Dolpo, Aufstieg | zum Namu La | +4300–4450 m +| +17. VI. 1973 +’ <photo label>, ‘NEPAL-Expedition | Jochen Martens’ <photo label>, ‘TYPE’ <red, printed>, ‘ +Holo- +| [handwritten in black] | Typus’ <printed, with narrow black margin>, ‘ +Geodromicus +| dolpensis [sic!] | H. COIFFAIT det. 19 [printed] 79’ <handwritten>, ‘SNG-Museum | Frankfurt/Main | Loan-000302’ <printed>, ‘Geodromius | dolpensis [sic!] Coiff.’ <handwritten by blue pen>, ‘ +Asiageodromicus +| + +dolpoensis ( +Coiffait, 1982 +) + +| Shavrin A.V. det. 2023’ <printed> ( +SF +). + + + + +Redescription. +Measurements: HW: 1.05; HL: 0.73; OL: 0.25; TL: 0.16; AL: 4.27; PL: 0.99; PWmax: 1.25; PWmin: 1.17; ESL: 1.95; EW: 1.88; MTbL: 1.75; MTrL: 0.62 (MTrL 1–4: 0.30; MTrL 5: 0.32); AW: 1.75; AedL: 1.10; BL: 4.90. + + +Habitus as in +Fig. 66 +. Head, pronotum and abdomen brown; mouthparts, antennae, elytra and legs yellow-brown; apical segment of maxillary palpomeres and tarsi yellowish. Head with irregular and dense microsculpture: isodiametric in frontoclypeal portion, slightly coarser between antennal insertion, isodiametric in middle between eyes, finer in portions between anterior margin of eye and median part, coarser on infraorbital portions, subdiagonal in lateroposterior portion, coarser in mediobasal part in front of neck; neck with dense isodiametric microsculpture; pronotum with distinct dense and fine transverse microreticulation, finer in middle, mediobasal portion without meshes; scutellum with fine and moderately dense transverse meshes; elytra without microsculpture; abdomen with very dense transverse microreticulation. + + + +FIGURE 89. +Distribution of + +Asiageodromicus + +in the Himalayan Region: + +A. crassipalpis + +(circles), + +A. dolpoensis + +(star), + +A. palpalis +( +Coiffait, 1977 +) + +(squares), + +A. spadiceus + +(triangles), + +A. weiperti + + +sp. n. + +(diamonds) + + +Head 1.4 times as broad as long, elevated between anterior margins of eyes and infraorbital portions; frontal portion with strongly elevated supra-antennal prominences, with markedly wide and deep anteriomedian depression, gradually narrowed basad to about level of anterior margins of eyes; interocellar depression wide and moderately deep, slightly narrowed basad, separated from infraorbital portions by moderately deep and long anteocellar foveae convergent lateroanteriad and reaching level of middle length of eyes; temples convex, moderately long, distinctly more than 1/2 as long as longitudinal length of eyes (if see laterally). Eyes moderately large, convex. Ocelli small, distance between ocelli about as long as distance between ocellus and posterior margin of eyes. Frontoclypeal and middle portions without visible punctures; lateral parts with very small, sparse and irregular punctation; interocellar depression and neck without visible punctures. Maxillary palpomere 3 slightly shorter than preceding segment, significantly broadened apicad; last palpomere 1.7 times as long as preceding segment. Antennae very long, almost reaching apical margin of elytra reclined; basal antennomere wide, distinctly more than three times as long as broad, antennomere 2 about twice shorter and significantly narrower than basal antennomere, 3 very long, slightly less than twice and slightly narrower than 2, 4–5 slightly shorter than 3, 6–10 slightly longer than 5, apical antennomere about 1.3 times as long as 10, slightly broader in preapical part, with small rounded apex. +Pronotum 1.2 times as broad as long, widest in apical portion, with widely rounded apical angles strongly protruded anteriad, relatively strongly narrowed anteriad, laterobasal margins elongate, parallel-sided, hind angles obtuse; anterior margin widely rounded, distinctly shorter than slightly concave basal margin; medioanterior portion with wide and deep impression, narrowing toward middle, mediobasal part with distinct wide impression, deeper in front of basal margin; lateral portions impressed, wider and deeper in laterobasal parts, slightly reflexed laterobasally. Punctation fine and dense, finer and sparser in medioapical and distinctly sparser in mediobasal portions. Scutellum large, with widely rounded apex, without visible punctures. +Elytra slightly longer than broad, slightly less than twice as long as pronotum, distinctly broadened posteriad, reaching apical margin of abdominal tergite V; lateral margins narrowly flattened; hind margins widely rounded. Punctation dense, distinctly larger and deeper than that on pronotum, finer and slightly sparser in mediobasal portion, denser and larger in basal portion and around scutellum, slightly denser and larger along suture. Hind wings fully developed. +Legs very long and slender; metatibia slightly curved in about middle and slightly broadened apically; metatarsus slightly less than three times as long as metatibia. +Abdomen distinctly narrower than elytra, without visible tomentose spots in middle of abdominal tergites IV and V; apical margin of abdominal tergite VII with narrow palisade fringe. Punctation dense and very fine. + +Male. Posterior margin of abdominal tergite VIII straight. Posterior margin of abdominal sternite VIII slightly concave.Aedeagus with narrow basal part and moderately wide median lobe, from preapical part gradually narrowed toward rounded apex; parameres slightly less than apex of median lobe, with four moderately short apical setae; flagellum relatively long, spirally folded in basal part ( +Fig. 81 +). Lateral aspect of aedeagus as in +Fig. 82 +. + +Female unknown. + +Comparative notes. +Based on the general shape of pronotum and aedeagus, + +A. dolpoensis + +is similar to + +A. amplissimus + +, + +A. crassipalpis + +, + +A. spadiceus + +and + +A. subquadratus + +, from which it can be distinguished by the smaller and paler body, narrower pronotum, shorter elytra and details of the external morphology of the aedeagus. See also a key above. + + + + +Distribution. + +Asiogeodromicus dolpoensis + +is known only from the +type +locality in +Karnali Province +, western +Nepal +( +Fig. 89 +). + + +Bionomics. +The specimen was collected at elevations from +4300 to 4450 m +a.s.l. Detailed bionomical data are unknown. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C5FFFC6FF3CFDBD8819CEC8.xml b/data/02/42/40/024240545C5FFFC6FF3CFDBD8819CEC8.xml new file mode 100644 index 00000000000..c28f3f77320 --- /dev/null +++ b/data/02/42/40/024240545C5FFFC6FF3CFDBD8819CEC8.xml @@ -0,0 +1,227 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus crassipalpis +( +Champion, 1920 +) + +comb. n. + + + + + + +( +Figs 68–78 +, +83–89 +) + + + + + + + +Geodromicus crassipalpis +Champion, 1920: 245 + + +; + +Cameron, 1924: 173 + +, + +1930: 164 + +, + +Herman 2001: 293 + +, + +Smetana 2004: 243 + +, + +Schülke & Smetana 2015: 313 + +, Shavrin 2019: 573. + + + + + +Material examined. + + +NEPAL +: +KOSHI +: + +1 ♀ +: +Mechi +/ +Taplejung +, + +23 km +NE Ghunsa + +, +Ghunsa Khola +betw. +Kambachen +and +Lhonak +, +27°45’50’’N +87°59’49’’E +. + +4500 m +a.s.l. + +, waterfall. + +06.05.2003 + +. +A. Weigel +leg. ( +NME +) + +; + +1 ♀ +: same data, + +9 km +NNE Ghunsa + +, +Kambachen +, 27°87’58’’N +87°58’18’’E +. + +4100 m +a.s.l. + + +11.05.2003 + +. +A. Weigel +leg. + +(cSh). + + + + +Remarks. +Habitus as in fig. 1 of Shavrin (2019). Ventral view of head as in +Fig. 72 +. Prothorax as in +Fig. 73 +. Mesoventrite as in +Fig. 74 +. Scutellum as in +Fig. 77 +. Metaventrite as in +Fig. 75 +. Metendosternite as in +Fig. 76 +. Elytron as in +Fig. 78 +. Labrum as in +Fig. 68 +. Mandibles as in +Fig. 69 +. Labium and mentum as in +Fig. 71 +. Maxilla as in +Fig. 70 +. Male abdominal tergite VIII as in +Fig. 83 +and sternite VIII as in +Fig. 84 +; genital segment as in +Fig. 85 +. Female abdominal tergite VIII as in +Fig. 86 +and sternite VIII as in +Fig. 87 +; genital segment as in +Fig. 88 +. + + + +Geodromicus crassipalpis + +was originally described from “Kumaon” and known from several localities in +Uttarakhand +, +India +(Shavrin 2019). It is here recorded from +Nepal +for the first time. Distribution of the species as in +Fig. 89 +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C5FFFC6FF3CFF078BA7C869.xml b/data/02/42/40/024240545C5FFFC6FF3CFF078BA7C869.xml new file mode 100644 index 00000000000..f169cc57f16 --- /dev/null +++ b/data/02/42/40/024240545C5FFFC6FF3CFF078BA7C869.xml @@ -0,0 +1,122 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Asiageodromicus amplissimus +(Shavrin, 2019) + +comb. n. + + + + + + + +Geodromicus amplissimus +Shavrin, 2019: 575 + +. + + + + +Material examined. + + +CHINA +: +SICHUAN +: + +1 ♀ +: north of +Moxi +, +29°50.3899’N +102°02.760`E +. + + +19.06. +2006 + + +. 3098 m a.s.l. +R. Sehnal +& +M. Trýzna +leg. ( +SMNS +) + +. + + + + +Remarks. + +Geodromicus amplissimus + +was originally described based on +56 specimens +from Daxue +Shan +and Gongga +Shan +ranges in +Sichuan +and Meili Xue +Shan +range in northern +Yunnan +. The present record originates from a more northern locality than previously known. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C64FFFDFF3CF9B68BD4CD21.xml b/data/02/42/40/024240545C64FFFDFF3CF9B68BD4CD21.xml new file mode 100644 index 00000000000..a98502f34cb --- /dev/null +++ b/data/02/42/40/024240545C64FFFDFF3CF9B68BD4CD21.xml @@ -0,0 +1,104 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus montanus +( +Coiffait, 1983 +) + +comb. n. + + + + + + + + + +Hygrogeus montanus +Coiffait, 1983: 280 + + +; + +Herman 2001: 297 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Remarks. + +Hygrogeus montanus + +was originally described based on +one male +from “Cachemire, Gangria, 3 +500 m +…”. Based on the description and the shape of the aedeagus (fig. 2D in +Coiffait (1983)) +, this medium-sized (6.0 mm) species belongs to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C64FFFDFF3CFAD38AE5CC60.xml b/data/02/42/40/024240545C64FFFDFF3CFAD38AE5CC60.xml new file mode 100644 index 00000000000..770ac540c16 --- /dev/null +++ b/data/02/42/40/024240545C64FFFDFF3CFAD38AE5CC60.xml @@ -0,0 +1,110 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus meurguesae +( +Coiffait, 1979 +) + +comb. n. + + + + + + + + + +Hygrogeus meurguesae +Coiffait, 1979: 567 + + +; + +Herman 2001: 297 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Remarks. + +Hygrogeus meurguesae + +was originally described based on several specimens from “ +Nouristan +, Khum Ghar, +3800 m +…” and “haute vallée de l`Agôr Khwar, +3200–3900 m +…”. This medium-sized (6.0–7.0 mm) species was compared with + +T. kumaonensis + +(see above). Based on the original description and the shape of the aedeagus (fig. 4H in +Coiffait (1979)) +, this species belongs to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C64FFFDFF3CFCB98854CEC6.xml b/data/02/42/40/024240545C64FFFDFF3CFCB98854CEC6.xml new file mode 100644 index 00000000000..b1a373fd799 --- /dev/null +++ b/data/02/42/40/024240545C64FFFDFF3CFCB98854CEC6.xml @@ -0,0 +1,125 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus longipalpis +( +Coiffait, 1983 +) + +comb. n. + + + + + + + + + +Geodromicus longipalpis +Coiffait, 1983: 279 + + +; + +Herman 2001: 297 + +, + +Smetana 2004: 244 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Type material examined. + +Holotype +♀ +: ‘Cachemire Gulmarg VIII. [19]79 + +3000–3500 m + +G. M[eurgues].— G.L[edoux].’ <handwritten>, ‘TYPE’ <red, printed>, ‘ + +Geodromicus longipalpis H. +Coiffait 1981 + +’ <printed> ( +MHNH +). + + + + + +Remarks. + +Hygrogeus longipalpis + +was originally described based on a female from “Cachemire, Gulmarg, 3 000–3 +500 m +…”. Based on the study of the +holotype +, this medium-sized species ( +4.5 mm +) belongs to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C64FFFDFF3CFDFA8BD5C96D.xml b/data/02/42/40/024240545C64FFFDFF3CFDFA8BD5C96D.xml new file mode 100644 index 00000000000..cb792fe589c --- /dev/null +++ b/data/02/42/40/024240545C64FFFDFF3CFDFA8BD5C96D.xml @@ -0,0 +1,98 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus languidus +( +Coiffait, 1983 +) + +comb. n. + + + + + + + + + +Hygrogeus languidus +Coiffait, 1983: 283 + + +; + +Herman 2001: 309 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Remarks. + +Hygrogeus languidus + +was originally described based on a female from “Cachemire, Pahalgam, 3 000 m…”. Based on the details of the morphology of the body provided in the description, this large (8.0 mm) species undoubtedly belongs to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C67FFF8FF3CFBD3885BC840.xml b/data/02/42/40/024240545C67FFF8FF3CFBD3885BC840.xml new file mode 100644 index 00000000000..8b490d047a2 --- /dev/null +++ b/data/02/42/40/024240545C67FFF8FF3CFBD3885BC840.xml @@ -0,0 +1,205 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus telnovi + +sp. n. + + + + + + +( +Figs 47 +, +51 +, +54–55 +) + + + + +Type material examined. +Holotype +♂ +( +Fig. 51 +; dissected): ‘ + +NEPAL + +W, +Karnali Prov. +, Jumla | Distr., Jumla +13 km +NE to +9 km +| NNW, +29°23’43’’N +82°8’55’’E +to | +29°21’26’’N +82°9’31’’E +, +1.vii.2022 +, | +2770–3550 m +, disturbed montane | forest & pastures, leg. D. Telnov | #2022–22 +BMNH{E} 2022-117 +’ <printed>, ‘ +HOLOTYPE +| + +Trichodromeus + +| + +telnovi + +sp.n. +| Shavrin A.V. des. 2024’ ( +BMNH +). + + + + +Description. +Measurements: HW: 0.95; HL: 0.70; OL: 0.20; LT: 0.15; AL: 3.60; PL: 0.80; PWmax: 1.10; PWmin: 0.85; ESL: 1.52; EW: 1.69; MTbL: 1.27; MTrL ( +holotype +): 0.55 (MTrL 1–4: 0.30; MTrL 5: 0.25); AW: 1.62; AedL: 1.17; BL: 5.45. + + +Habitus as in +Fig. 43 +. Body brown, with slightly paler pronotum, elytra and apical part of abdomen; mouthparts, antennae and legs yellow-brown (preapical maxillary palpomere and basal antennomere slightly darker). Head with distinct microsculpture, transverse on clypeus, subdiagonal on infraorbital portions and indistinct in middle portion between anteocellar foveae, coarser and denser in mediobasal portion and neck; pronotum with isodiametric microreticulation, denser and coarser in medioapical and mediobasal portions and finer in middle; scutellum with fine transverse meshes; abdominal tergites with fine transverse sculpture. + +Head 1.3 times as broad as long, with slightly elevated middle and infraorbital portions; anterio-median depression wide and deep, narrowed basad; interocellar depression wide and shallow, subrectangular, with very short anteocellae foveae, each slightly longer than diameter of ocellus; temples 1.3 times as long as longitudinal length of eyes. Ocelli moderately large, located slightly below level of posterior margins of eyes; distance between ocelli slightly shorter than distance between ocellus and posterior margin of eyes. Punctation dense, moderately large and deep, finer on clypeus and in midle portion between eyes; mediobasal portion without distinct punctures; neck with indistinct and moderately sparse fine punctation. Last (apical) maxillary palpomere distinctly longer than preapical segment, from middle gradually narrowed toward subacute apex. Antenna reaching apical third of elytra when reclined, with elongate antennomeres 3–10; antennomeres 3–4 slightly longer and indistinctly narrower than 2, 5–6 indistinctly narrower and broader than 4, 7–9 slightly longer than 6, 10 indistinctly shorter than 9, apical antennomere 1.2 times as long as 10. + + +FIGURES 59–64. +Abdominal segments (ventral view) of + +Trichodromeus penicillatus + +: 59—male tergite VIII, 60—male sternite VIII, 61—male genital segment, 62—female tergite VIII, 63—female sternite VIII, 64—female genital segment. Scale bar: 0.1 mm. + + +Pronotum 1.2 times as broad as long, from widest anterior part gradually narrowed toward obtuse hind angles; frontal part not protruded anteriad, with slightly concave apical margin, slightly shorter than somewhat straight posterior margin; middle portion with distinct, shallow and narrow longitudinal depression, starting from medioapical part and reaching mediobasal portion; mediobasal portion with distinct transverse and moderately deep depression; laterobasal portions widely impressed. Punctation about as than on head, finer and sparser in middle; interstices between punctures in middle about as long as diameters of one-two nearest punctures. Scutellum without distinct punctation. +Elytra slightly broader than long, gradually broadened posteriad, 1.9 times as long as pronotum; lateral margins narrowly impressed; hind margins widely rounded. Punctation about as that on pronotum, but slightly sparser in middle. Hind wings fully developed. +Metatarsus 1.3 times as long as metatibia; apical metatarsomere slightly shorter than preceding four metatarsomeres. +Abdomen slightly narrower than elytra; middle portion of abdominal tergite IV with two transverse and moderately large tomentose spots; middle portion of abdominal tergite V with two small and oval tomentose. + +Male. Posterior margin of abdominal tergite VIII rounded. Posterior margin of abdominal sternite VIII widely concave. Aedeagus with broad basal part, gradually narrowed toward wide median lobe, with narrow preapical part, gradually narrowed toward subacute apex; parameres narrow, slightly not reaching apex of median lobe, with slightly broadened apical portions, each with three moderately short apical setae; internal sac wide and long, with two narrow and elongate protrusions in preapical part, with long flagellum, spirally folded in basal part of aedeagus; preapical part of flagellum significantly broadened ( +Fig. 54 +). Lateral aspect of the aedeagus as in +Fig. 55 +. + +Female unknown. + +Comparative notes. +Based on the general shape of the body with the frontal part of the pronotum not protruded apicad and slightly broadened elytra, + +T. telnovi + + +sp. n. + +is similar to + +T. jaegeri + +(see above) and + +T. kaliyuga +Shavrin, 2021 + +, but differs from them by the paler coloration, the slightly shorter pronotum, and different external and internal morphology of the aedeagus, with significantly shorter parameres. + + + + +Distribution. + +Trichodromeus telnovi + + +sp. n. + +is known only from the +type +locality in western +Nepal +( +Fig. 47 +). + + +Bionomics. +The +type +specimen was collected at an elevation from +2770 to 3550 m +a.s.l. in disturbed montane forest. + + + + +Etymology. +Patronymic, the species is named to honour my colleague, Dmitry Telnov (London/ +Riga +), collector of the +holotype +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C67FFFEFF3CFD708B9AC9C4.xml b/data/02/42/40/024240545C67FFFEFF3CFD708B9AC9C4.xml new file mode 100644 index 00000000000..232b55b2f21 --- /dev/null +++ b/data/02/42/40/024240545C67FFFEFF3CFD708B9AC9C4.xml @@ -0,0 +1,102 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus sulcicollis +( +Coiffait, 1983 +) + +comb. n. + + + + + + + + + +Hygrogeus sulcicollis +Coiffait, 1983: 284 + + +; + +Herman 2001: 309 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Remarks. + +Hygrogeus sulcicollis + +was originally described based on +one female +from “Cachemire, Pahalgam, Sheshnag, 3 +800 m +…”. Based on the length of the body, this medium-sized (6.0 mm) species was compared with + +T. kumaonensis + +(see above), and distinguished from it by the stronger sculpture of the shorter pronotum, more narrowed basad, and more broadened elytra. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C67FFFEFF3CFF4F89C2C82B.xml b/data/02/42/40/024240545C67FFFEFF3CFF4F89C2C82B.xml new file mode 100644 index 00000000000..e1e3fd5f369 --- /dev/null +++ b/data/02/42/40/024240545C67FFFEFF3CFF4F89C2C82B.xml @@ -0,0 +1,189 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus pusillus +( +Coiffait, 1983 +) + + + + + + + +( +Fig. 50 +) + + + + + + + +Geodromicus pusillus +Coiffait, 1983: 279 + + +; + +Herman 2001: 303 + +, + +Smetana 2004: 244 + +. + + + + + +Trichodromeus pusillus + +: + +Shavrin 2012: 66 + +, + +Schülke & Smetana 2015: 326 + +. + + + + + +Material examined. + + +PAKISTAN +: SKARDU: + +1 ♂ +, +1 ♀ +: +Deosai +, Satpara. + +4000–4100 m +a.s.l. + + +26.08.1997 + +. +W. Heinz +leg. ( +NSMT +); +JAMMU & KASHMIR: +29 ♂♂ +, +47 ♀♀ +: +SW Garhi. + +1500 m +a.s.l. + +10– + +20.07.2003 + +(cSch, cSh); +2 ♂♂ +: same data, +NW Junkar. + +4000 m +a.s.l. + +01– + +10.07.2003 + +(cSh) + +. + + + + +Remarks. + +Geodromicus pusillus + +was originally described from Kashmir, +India +. +Shavrin (2012) +redescribed and transferred it to the genus + +Trichodromeus + +, and provided additional records from Kashmir. + +Trichodromeus pusillus + +( +Fig. 50 +) is known from north-eastern +Pakistan +and Kashmir, +India +. It is here recorded from +Pakistan +for the first time. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C6DFFF1FF3CF9408DC8CD30.xml b/data/02/42/40/024240545C6DFFF1FF3CF9408DC8CD30.xml new file mode 100644 index 00000000000..53b493723f6 --- /dev/null +++ b/data/02/42/40/024240545C6DFFF1FF3CF9408DC8CD30.xml @@ -0,0 +1,785 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus ketmeniensis +( +Bordoni, 1985 +) + + + + + + + +( +Figs 4–5 +, +43–46 +, +48 +) + + + + + + + +Neogeodromicus ketmeniensis +Bordoni, 1985: 374 + + +. + + + + + +Trichodromeus ketmeniensis + +: + +Zerche 1992: 128 + +, + +Herman 2001: 373 + +, + +Smetana 2004: 252 + +, + +Shavrin & Klimenko 2008: 197 + +, + +Schülke & Smetana 2015: 326 + +, + + +Hlavač +et al +. 2016: 3 + + +. + + + + + + +Trichodromeus ovchinnikovi +Shavrin & Klimenko, 2008: 195 + + + +syn. n. + + + + + + +Type material examined. + +Holotype +♂ +( +Fig. 5 +; dissected; damaged: left antennomeres 3–11, right antennomeres 5–11 missing and hind legs missing): ‘ + +17.07.1983 + +[side-printed from the left] | +Kyrgyzstan +| +5 km +up from mouth | + + + +of Kaindy R. | Ovchinnikov S.V.’ <printed>, ‘ +HOLOTYPUS +| + +Trichodromeus + +| +ovchinnkovi +sp.n. det. | +Shavrin & Klimenko 2008 +’ <red, printed>, ‘ + +Trichodromeus + +| + +ketmeniensis +Bordoni, 1985 + +| Shavrin A.V. det. 2024’ <printed> ( +ZIN +). + + +Paratype +: +1 ♀ +(dissected; left antenna and left middle leg missing): same data as the holotype, with additional printed labels: ‘ +PARATYPUS +| + +Trichodromeus + +| +ovchinnkovi +sp.n. det. | +Shavrin & Klimenko 2008 +’ <red>, ‘ + +Trichodromeus + +| + +ketmeniensis +Bordoni, 1985 + +| Shavrin A.V. det. 2024’ ( +ZIN +). + + + +FIGURE 48. +Distribution of + +Trichodromeus ketmeniensis +Bordoni, 1985 + +in the Middle Asia (black circles: specimens studied by the author; white circles: previously published records, specimens not see nby the author). + + + + +Material examined. +KAZAKHSTAN +: +EAST KAZAKHSTAN REGION +: + +2 exs. +: Altai, connections of Tauchilik and Karakoba rivers. +06.08.1989 +. V. Kashcheev leg. ( +ZIN +); +1 ♂ +: Ugam Mts., Sary-Aygyr River. +11.08.1988 +. V. Kashcheev leg. ( +ZIN +); + +ALMATY +: + +1 ♀ +: Ketmen Ridge, Dolaity River. +16.06.1988 +. V. Kashcheev leg. (cSh); +10 ♂♂ +, +6 ♀♀ +, +14 exs. +: same data. 12– +15.07.1988 +. (cSh, +ZIN +); +5 ♂♂ +, +1 ♀ +: same data. +20.07.2009 +. (cSh, +ZIN +); +8 ♂♂ +, +4 ♀♀ +: same data, Kulbastau [=Kol`bastau] River. +14.07.1987 +. (cSh, +ZIN +); +4 ♂♂ +, +3 ♀♀ +, +6 exs. +: same data. +2800 m +a.s.l. +20.08.1987 +. (cSh, +ZIN +); +95 ♂♂ +, +109 ♀♀ +: same data. +3300 m +a.s.l., under stones along snowfield and in litter near stream. (cSh, +ZIN +); +52 ♂♂ +, +39 ♀♀ +: same data. +22.07.1987 +. (cSh, +ZIN +); +18 ♂♂ +, +8 ♀♀ +: same data. +2800–3800 m +a.s.l. +20.08.1987 +. (cSh, +ZIN +); +1 ♂ +, +3 ♀♀ +: same data, +09.06.1988 +(cSh); +27 ♀♀ +, +36 exs. +: same data. 20– +27.07.1988 +. ( +ZIN +); +1 ♂ +, +1 ♀ +: Zhalanash. +14.07.1984 +(cSh); +1 ♂ +, +1 ♀ +: same data, Zhinishke River. +22.06.1988 +. ( +ZIN +); +3 ♂♂ +: Bolshoy Kirgisay. +10.08.1988 +. V. Kashcheev leg. (cSh); +8 ♂♂ +, +8 ♀♀ +: Kungey Alatau, near Alma-Ata, +77°00’N +43°10’E +. 07.1990. +2500–3500 m +a.s.l. J. Kolibač leg. ( +NHMB +); +2 ♀♀ +: Alma-Ata, Chinbulak. +2000–3200 m +a.s.l. +10.8.1991 +. Snižek leg. (cSch); +2 ♂♂ +: Ili Alatau, Almaty, Big Almaty Lake. +28.06.1991 +. V. Kashcheev leg. (cSh); +1 ♂ +, +2 ♀♀ +: Kegen, Sary-Tau. +1900 m +a.s.l. +16.07.1984 +. V. Kashcheev leg. ( +ZIN +); +1 ♂ +, +1 ♀ +: Trans-Ili Alatau Mts., Kimasar Gorge, +43°09’04’’N +77°06’32’’E +. +29.07.2013 +. Kolov leg. (cKh); +1 ♂ +, +3 ♀♀ +: same data, upper reaches of Kazachka River, +43°06`53``N +77 01`24``E +. +2800 m +a.s.l. (cKh); +1 ♀ +: same Mts.,Ozyornyi Pass. +03.08.1971 +. G. Bugayev leg. ( +ZMM +); +JAMBYL: +1 ♂ +: Aksu-Djabagly, Djabagly River, Kshi-Kaindy. +20.05.1987 +. V. Kashcheev leg. ( +ZIN +); + +KYRGYZSTAN +: TALAS: + +1 ♂ +, +1 ♀ +: Ala-Bell Pass, +42°14’44N +73°03’10E +. +3200 m +a.s.l. +15.07.2003 +. G. Müller-Motzfeld leg. ( +NME +); +8 ♂♂ +, +9 ♀♀ +: same data, +42°14’35’’N +73°03’09’’E +. +3175 m +a.s.l. L. Schmidt leg. ( +NME +); +2 ♂♂ +, +2 ♀♀ +: Talasskiy Alatoo, Otmjok Pass, +42°16’55’’N +, +73°10’29’’E +. +18.07.2006 +. +3300 m +a.s.l. L. Schmidt leg. ( +NME +); +3 ♀♀ +: Otmek mountain pass. +02.07.1997 +. S.V. Ovchinnikov leg. (cSh); +1 ♂ +: Kyrgyzskiy Alatau, Tejo Aschun Pass. +3200 m +a.s.l. +17.07.1998 +. G. Müller-Motzfeld leg. (cSh); +4 ♂♂ +, +3 ♀♀ +: N slope of Kyrgyzskiy Mts., Chunkurchak River. +3500 m +a.s.l. 23– +24.07.1992 +.A. Klimenko leg. (cSh); +2 ♂♂ +, +3 ♀♀ +: same data, Ala-Archa. +2800 m +a.s.l. 26– +28.08.1993 +. A. Klimenko leg. (cSh); +CHUI: +2 ♀♀ +: Chui Tus-Ashuu Pass, +42°21’24’’N +73°48’53’’E +. +3100 m +a.s.l. +14.07.2003 +. G. Müller-Motzfeld ( +NME +); +17 ♂♂ +, +11 ♀♀ +: Chui Kirgizskij Alatau - Tejo-Ashuu Pass, +42°21’24’’N +73°48’53’’E +. +3125 m +a.s.l. +18.07.2006 +., leg. L. Schmidt leg. ( +NME +); +YISSIK-KOL: +3 ♂♂ +, +1 ♀ +: Terskey- Alatoo Mts., N Pass, Chonon Aschuu, +42°23’39``N +79°03’31``E +. +3700 m +a.s.l. 27.VII. M. Motzfield leg. ( +NME +); +2 ♂♂ +, +3 ♀♀ +: same Mts., Turuk Valley, +42°36’17’’N +, +79°18’57’’E +. +2600 m +a.s.l. 30.07– +01.08.2005 +. L. Schmidt leg. ( +NME +); +4 ♂♂ +, +6 ♀♀ +: same data, Kai-Bulak Valley, +41°19’55’’N +78°21’05’’E +. +3050 m +a.s.l. +24.07.2005 +. ( +NME +); +1 ♂ +, +1 ♀ +: same data, Tschon-Ashuu Pass, +42°23’46’’N +, +79°03’15’’E +. +3600 m +a.s.l. +26.07.2005 +. ( +NME +); +3 ♀♀ +: Enylschek Valley, +42°07’21’’N +, +79°20’24’’E +. +2650 m +a.s.l. 27– +28.07.2005 +. L. Schmidt leg. ( +NME +); +NARYN: +1 ♂ +: Inner Tian-Shan, mountains +8–14 km +NE lake Son-Kul, ca. +41°52’N +75°21’E +. +3100–3600 m +a.s.l. 08.1999. Hetzel leg. (cF); +2 ♀♀ +: Dolon Pass. +2700 m +a.s.l. 23– +27.07.1991 +. S. Becvar leg. ( +MHNG +); +3 ♂♂ +: N Kalmak-Ashuu (Pass). +3400 m +a.s.l. +31.07.2009 +. W. Schawaller leg. ( +SMNS +); +JALAL-ABAD: +13 ♂♂ +, +15 ♀♀ +: Sary-Chelek Nature Reserve. +20.07.1983 +. A.B. Ryvkin leg. (cSh, cR, +ZMM +); +1 ♂ +: same data, environs of Arkit. Litter in forest with + +Juglans + +, + +Fraxinus + +, + +Berberis + +. +28.09.1983 +. (cSh); +4 ♂♂ +, +2 ♀♀ +: Chatkal Mts., upper flow of Aflatun River. +23.07.2000 +. V. Gromenko leg. (cSh); + +OSH +: + +1 ♀ +: Osch National Park, Kara Shoro, Uzgenskiy Mts., +40°43’07’’N +73°03’00’’E +. +2900 m +a.s.l. +20.vii.2003 +. L. Schmidt leg. ( +NME +); +1 ♂ +: Uzun-Akhshat. +13.08.1986 +. S. Ovchinnikov leg. (cSh); +BATKEN: +1 ♂ +: Kadamjay District, Isfairamsay. +2800 m +a.s.l. +14.07.1999 +. O.O. Novikov leg. (cSh). + + + + +Redescription. +Measurements (n=500): HW: 0.87–1.02; HL: 0.62–0.77; OL: 0.20–0.27; TL: 0.15–0.26; AL: 2.17–3.22; PL: 0.79–1.00; PWmax: 1.05–1.22; PWmin: 0.78–1.03; ESL: 1.37–1.86; EW: 1.50–1.83; MTbL (averaged): 1.20; MTrL (averaged): 0.42 (MTrL 1–4: 0.21; MTrL 5: 0.21); AW: 1.40–1.96; AedL: 0.73–1.03; BL: 4.50–6.40 ( +holotype +of + +T. ovchinnikovi + +: 6.05). + + +Habitus as in +Figs 4–5 +. Body brown or reddish-brown, with yellow-brown elytra (mediobasal part of elytra usually darkened); mouthparts, antenna and legs yellowish or yellow-brown; apical maxillary palpomere and tarsi yellow. Head with distinct and irregular microsculpture: dense, fine and transverse on clypeus, finer and sometimes indistinct in middle between eyes, subdiagonal on infraorbital portions, isodiametric, distinctly denser and coarser between ocelli and on mediobasal portion; neck with dense transverse or isodiametric microreticulation; pronotum with dense transverse meshes, coarser in medioapical half and finer in middle, mediobasal portion sometimes without meshes; scutellum with fine transverse microreticulation; abdominal tergites with dense, fine or moderately coarse and transverse microsculpture, sometimes finer in middle part of abdominal tergites VI and VII. + +Head 1.3–1.4 times as broad as long, with strongly convex, narrow and elongate supra-antennal prominences, and distinctly convex middle portion at level of anterior margins of eyes and infraorbital portions; anterio-median depression wide and deep, slightly narrowed basad and sometimes connected with narrow and moderately deep subrectangular or subtrapezoidal interocellar depression; anteocellar foveae indistinct or distinct and moderately deep, slightly or strongly convergent latero-anteriad toward level of middle or anterior margin of eyes; temples 1.1–1.3 times as long as longitudinal length of eyes or slightly longer. Ocelli small and sometimes indistinct, located at level of posterior margin of eyes or temples; distance between ocelli about as long as distance between ocelli and posterior margin of eyes, or slightly shorter. Punctation dense, fine or moderately large, finer in middle and larger on infraorbital portions, mediobasal part without distinct punctures; neck without, or with fine and dense punctation. Last maxillary palpomere about as long as preapical segment or indistinctly longer, from widest middle part gradually rounded toward subacute or obtuse apex. Antenna reaching apical third of elytra when reclined, with elongate antennomeres 3–10; basal antennomere wide, about three times as broad as long, antennomere 2 distinctly shorter and narrower than basal antennomere, 3 distinctly longer than 2, 4–10 distinctly shorter and slightly broader than 3, apical antennomere 1.2–1.3 times as long as preapical antennomere, from middle gradually narrowed toward subacute or obtuse apex. + +Pronotum 1.2–1.3 times as broad as long, from widest anterior part gradually ( +Fig. 4 +) or strongly ( +Fig. 5 +) narrowed posteriad toward obtuse hind angles; frontal part slightly or relatively strongly protruded apicad, with widely rounded or distinctly concave apical margin, about as long as or distinctly shorter than somewhat straight posterior margin; laterobasal potions in front of hind angles slightly and widely concave in some specimens; middle portion without or with distinct narrow longitudinal depression; mediobasal portion without or with transverse, shallow or relatively deep depression; lateral margins narrowly bordered; laterobasal portions distinctly and widely depressed. Punctation about as that on head, sometimes slightly larger and deeper, usually finer and sparser in middle; interstices between punctures in middle about as long as diameters of two-three nearest punctures. Scutellum without or with several fine punctures in middle. + +Elytra convex or slightly impressed in middle, 1.2–1.3 times as broad as long, slightly or strongly broadened posteriad, 1.7–1.8 times as long as pronotum; lateral margins narrowly impressed and sometimes slightly reflexed in about middle; hind margins straight or widely rounded. Punctation dense, but distinctly larger and deeper than tat on pronotum, finer around scutellum, usually finer and sparser along suture. Hind wings fully developed. +Metatarsus slightly less than three times as long as metatibia; apical metatarsomere as long as preceding four metatarsomeres. +Abdomen slightly narrower or broader than elytra; middle portion of abdominal tergite IV with two transverse and moderately large tomentose spots; middle portion of abdominal tergite V with two small and oval tomentose spots, sometimes invisible in some specimens. + +Male. Profemora and protarsomeres 1–4 wide. Posterior margin of abdominal tergite VIII straight or sligthly concave. Posterior margin of abdominal sternite VIII widely concave. Aedeagus with broad basal part and relatively short ( +Figs 43, 45 +) or elongate ( +Fig. 46 +) median lobe, from apical third sharply narrowed toward subacute or rounded apex; parameres not exceeding or slightly longer than apex of median lobe, narrow, with broadened apical parts, with three to four relatively short apical setae and several short setae along outer margin of preapical and inner margins of middle portions; internal sac narrow, elongate, with fields of fine spines and sclerotized elongate structures in preapical portion, with long flagellum; preapical part of flagellum widely broadened. Lateral aspect of the aedeagus as in +Fig. 44 +. + +Female. Profemora and protarsomeres 1–4 narrow. Posterior margins of abdominal tergite VIII and sternite VIII straigth or somewhat rounded. + +Comparative notes. +Based on the general shape and the coloration of the body, + +T. ketmeniensis + +is somewhat similar to + +T. schmidti +Zerche, 1992 + +, known from +Tajikistan +, but differs from it by the presence of the ocelli, shorter antennae, and the morphology of the aedeagus (see details in +Zerche (1992)) +. Based on the general shape of the body and the length of the antennae, it somewhat similar to the Middle Asian + +T. penicillatus + +, but can be distinguished from it by the paler coloration, shorter apical maxillary palpomere, somewhat finer microsculpture of the pronotum, and different external and internal structure of the aedeagus. + + + + +Distribution. + +Trichodromeus ketmeniensis + +is widely distributed in Middle Asia from the north-eastern part of +Kazakhstan +(Altai Mts.) to southern +Kyrgyzstan +and eastern +Turkmenistan +( +Fig. 48 +). + + +Bionomics. + +Trichodromeus ketmeniensis + +can be found under stones and debris or between gravel near streams and rivers at altitudes from +2000 to 3800 m +a.s.l. Some specimens were collected by sifting litter in floodplain forest near rivers and under stones near snowfields in the alpine zone. + + + + +Remarks. + +Neogeodromicus ketmeniensis + +was originally described based on several specimens from “Turkestan, Ketmen-tjube, Sussamir Tan…”. +Zerche (1992) +synonymized + +Neogeodromicus +Bordoni, 1985 + +with + +Trichodromeus + +, redescribed + +T +. +ketmeniensis + +and provided additional faunistic data from +Kazakhstan +and +Kyrgyzstan +. + +Trichodromeus ovchinnikovi + +was originally described based on +four specimens +from +Kyrgyzstan +. The pronotum of the +holotype +and +one paratype +from widest anterior part is sharply narrowed toward relatively narrow basal portion ( +Fig. 5 +). I found several specimens from different localities with a similar shape of the pronotum. The external and the internal morphology of the aedeagus of + +T. ovchinnikovi + +is similar to some other studied specimens of + +T. ketmeniensis + +with elongate and relatively narrow median lobe ( +Fig. 46 +). Thus, + +T. ovchinnikovi + +was synonymized with the latter species. Morphologically, it is a more variable species of Middle Asia, therefore I decided to redescribe it. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C72FFEAFF3CF8CC8DBBCAA8.xml b/data/02/42/40/024240545C72FFEAFF3CF8CC8DBBCAA8.xml new file mode 100644 index 00000000000..0ec5f4adf80 --- /dev/null +++ b/data/02/42/40/024240545C72FFEAFF3CF8CC8DBBCAA8.xml @@ -0,0 +1,104 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus alticola +( +Coiffait, 1983 +) + +comb. n. + + + + + + + + + +Hygrogeus alticola +Coiffait, 1983: 283 + + +; + +Herman 2001: 308 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Remarks. + +Hygrogeus alticola + +was originally described based on a female from “Cachemire, Bradinath [Badrinath]...”. This medium-sized ( +5.70 mm +) species was compared with + +H. kumaonensis + +(see below) and distinguished from it by the smaller and narrower body, shorter antennae and larger punctation of the elytra. Based on morphological features provided in the original description, this species belong to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C73FFEAFF3CFA4E8DAFCCF9.xml b/data/02/42/40/024240545C73FFEAFF3CFA4E8DAFCCF9.xml new file mode 100644 index 00000000000..2428b977422 --- /dev/null +++ b/data/02/42/40/024240545C73FFEAFF3CFA4E8DAFCCF9.xml @@ -0,0 +1,104 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus gulmargensis +( +Coiffait, 1983 +) + +comb. n. + + + + + + + + + +Hygrogeus gulmargensis +Coiffait, 1983: 282 + + +; + +Herman 2001: 309 + +, + +Smetana 2004: 245 + +, + +Schülke & Smetana 2015: 316 + +. + + + + + +Remarks. + +Hygrogeus gulmargensis + +was originally described based on a male from “Cachemire, Gulmarg, 3 000– 3 +500 m +…”. Based on the details of the morphology of the body provided in the original description and the aedeagus ( +Fig. 2F +), this medium-sized ( +4.80 mm +) species belongs to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C73FFEAFF3CFBEB889CCF38.xml b/data/02/42/40/024240545C73FFEAFF3CFBEB889CCF38.xml new file mode 100644 index 00000000000..4916de66fd6 --- /dev/null +++ b/data/02/42/40/024240545C73FFEAFF3CFBEB889CCF38.xml @@ -0,0 +1,97 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus chinensis +( +Cheng & Peng, 2019 +) + +comb. n. + + + + + + + + + +Hygrogeus chinensis +Cheng & Peng, 2019: 91 + + +. + + + + + +Remarks. + +Hygrogeus chinensis + +was originally described from +Xizang +, south-western +China +. Based on the original description, the habitus (fig. 1A in +Cheng & Peng (2019)) +, shapes of mouthparts (figs 1E, 1H, 1I, 1F in +Cheng & Peng (2019)) +, and the morphology of the aedeagus (fig. +2 in +Cheng & Peng (2019)) +, this species belongs to the genus + +Trichodromeus + +. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C73FFEAFF3CFEFE8B5AC99F.xml b/data/02/42/40/024240545C73FFEAFF3CFEFE8B5AC99F.xml new file mode 100644 index 00000000000..ab2d3ee1e7f --- /dev/null +++ b/data/02/42/40/024240545C73FFEAFF3CFEFE8B5AC99F.xml @@ -0,0 +1,227 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus armatus +( +Cameron, 1941 +) + + + + + + + +( +Figs 2–3 +, +39–40 +) + + + + + + + +Hygrogoeus +[sic] +armatus +Cameron, 1941: 144 + + +. + + + + + +Trichodromeus armatus + +: + +Zerche 1992: 134 + +; + +Herman 2001: 373 + +, + +Smetana 2004: 251 + +, + +Schülke & Smetana 2015: 326 + +. + + + + + +Type material examined. +Holotype +♂ +: ‘ +Holo- +| type’ <round label with red margin>, ‘Kashmir | Aphar Wat | +13,000 ft. +| Dr.Cameron’ <printed>, ‘H. | armatus | TYPE [red, underlined] +Cam +.’ <handwritten in black>, ‘M.Cameron | Bequest. | B.M. 1955-147.’ <printed>, ‘UNIQUE TYPE | H.K.Kenward [printed] | det. 197[printed]7’ <handwritten in black>, ‘ +Trichodromeus +| +armatus (Cam.) +| Shavrin A.V. det. 2016’ <printed> ( +BMNH +). + + + +Additional material examined. +INDIA +: KASHMIR: + + +1 ♂ +: ‘ +Kashmir Aphar Wat + +13,000 ft. + +Dr.Cameron’ +, ‘ +Hygrogeus’ +, +‘armatus Cam. +’ ( +BMNH +) + +; + +3 ♂♂ +, +3 ♀♀ +: ‘ +Kashmir Aphar Wat + +13,000 ft. + +Dr.Cameron’ +, ‘ +M.Cameron Bequest. +B.M. 1955-147.’ ( +BMNH +) + +; + +1 ♂ +: +Baltal. + +13.07.1981 + +. +G. Ledoux +leg. (cSh) + +; + +1 ♂ +: +NE Srinagar +, +Kolahoi Glacier. + +3500 m + +. + +11.08.2007 + +. +C. Reuter +leg. (cF) + +. + + + + +Remarks. + +Hygrogoeus armatus + +was originally described based on the +holotype +from “Kashmir: Aphar Wat, altitude +13,000 feet +”. +Zerche (1992) +transferred it to + +Trichodromeus + +and recorded from +Pakistan +. The shape of the body is variable ( +Figs 2–3 +). The studied specimen from Kolahoi Glacier has a narrower body and shorter elytra, but the shape of the aedeagus ( +Figs 39–40 +) is identical with that in other studied specimens. From all known species of the genus + +T. armatus + +can be easily recognized by the unusual modification in the middle of the inner side of each metatibia with a long and strong tooth. + + + + \ No newline at end of file diff --git a/data/02/42/40/024240545C73FFF4FF3CF91F88ADCC3B.xml b/data/02/42/40/024240545C73FFF4FF3CF91F88ADCC3B.xml new file mode 100644 index 00000000000..48c56bfdfa6 --- /dev/null +++ b/data/02/42/40/024240545C73FFF4FF3CF91F88ADCC3B.xml @@ -0,0 +1,375 @@ + + + +Review of Hygrogeus Mulsant & Rey, 1880 and Trichodromeus Luze, 1903, with descriptions of three new genera from the eastern Palaearctic Region (Coleoptera: Staphylinidae: Anthophagini: Omaliinae) + + + +Author + +Shavrin, Alexey V. + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5531 + + +1 + + +1 +62 + + + + +http://dx.doi.org/10.11646/zootaxa.5531.1.1 + +journal article +10.11646/zootaxa.5531.1.1 +1175-5334 +14023033 +27F9603C-D2AB-4133-AFB8-5A674ACCD110 + + + + + + + +Trichodromeus jaegeri +Shavrin, 2021 + + + + + + + +( +Figs 41–42 +, +47 +) + + + + + + + +Trichodromeus jaegeri +Shavrin, 2021: 357 + + +. + + + + + +Material examined. + + +NEPAL +: +KARNALI +: + +2 ♀♀ +: +Seti +/ +Bajura + +15 km +W Simikot + +, +Dudh Lekh-Tal +, +29°56’N +81°40’E +. + +4600–4900 m +a.s.l. + +, stone debris near glacier lake. + +02.07.2001 + +. +A. Weigel +( +NME +) + +; + +1 ♂ +: +Humla +, + +16 km +W Simikot + +, +3 km +NW +Sankha La +, +29°57’18’’N +81°39’30’’E +. + +4000–4300 m +a.s.l. + +, stone-debris and alpine mats. 29– + +30.06.2001 + +. +A. Kopetz +leg. ( +NME +) + +; + +1 ♂ +: +Bajura +ca. + +15 km +S Simikot + +, +Malikasthan +, 29°50’42’N +81°47’25’’E +. + +4100 m +a.s.l. + + +07.07.2001 + +. +Creutzburg +leg. ( +NME +) + +; + +1 ♀ +: same data, N pass slope W +Malikasthan +, +29°50’42’’N +81°47’25’’E +. + +4100– 4200 m +a.s.l. + +, stone debris. + +07.07.2001 + +. +A. Weigel +leg. (cSh) + +; + +1 ♂ +, +2 ♀♀ +: + +16 km +N Simikot + +, +3 km +NW +Sankha La +, +29°57’19’’N +81°39’30’’E +, NN. + +4200–4600 m +a.s.l. + +, border of snow fields. + +30.06.2001 + +. +M. Hartmann +leg. (cSh, +NME +) + +; + +1 ♂ +: + +15 km +W Simikot + +, +Dudh Lekh +/ +Dudh Tal +, +29°56’09’’N +81°40’32’’E +. + +4650–4800 m +a.s.l. + +, stone debris, glacier lakeside. + +01.07.2001 + +. +A. Lopetz +leg. ( +NME +) + +; + +1 ♀ +: +Khari Lagna. + +3500–3700 m + +a.s.l.. 23–24.06– + +04.07.1995 + +. +D. Ahrens +& +H. Pommeranz +leg. (cSh) + +; + + +GANDAKI +: + +1 ♂ +: +Dhaulagiri +Kali +, +Gandaki +Valley +upp. +Marpha +, +Yak Kharka. + +4000–4100 m +a.s.l. + +, NN. + +13.07.1998 + +. +J. Schmidt +leg. (cSh) + +. + + + + +FIGURES 39–46. +Aedeagus of + +Trichodromeus + +(Figs 39–40: + +T. armatus + +(Kashmir: Kolahoi Glacier), Figs 41–42: + +T. jaegeri + +(Nepal: Gandaki), Figs 43–46: + +T. ketmeniensis + +(Figs 43–44: Kazakhstan, Kulbastau), Fig. 45: Kyrgyzstan, Sary-Chelek, Fig. 46: Kazakhstan, Dolaity): 39, 42, 43, 45–46—parameral view, 40, 42, 44—lateral view. Scale bar: 0.1 mm. + + + + +FIGURE 47. +Distribution of + +Trichodromeus jaegeri +Shavrin, 2021 + +(circles) and + +T. telnovi + +sp. n. +(square) in Nepal. + + + + +Remarks. + +Trichodromeus jaegeri + +was originally described based on several specimens from two localities in +Gandaki Province +, central +Nepal +. New faunistic data extends the previously known boundaries of the distribution of the species ( +Fig. 47 +). The apical portion of the median lobe of some specimens ( +Figs 41–42 +) is distinctly narrower than that in specimens from +Gandaki Province +(fig. +7 in +Shavrin (2021)) +. It is here recorded from +Karnali Province +of +Nepal +for the first time. + + + + \ No newline at end of file diff --git a/data/03/68/87/036887BC8B288F04FF50FF1BFED3EABC.xml b/data/03/68/87/036887BC8B288F04FF50FF1BFED3EABC.xml index cb443cc2164..e95d62c381d 100644 --- a/data/03/68/87/036887BC8B288F04FF50FF1BFED3EABC.xml +++ b/data/03/68/87/036887BC8B288F04FF50FF1BFED3EABC.xml @@ -1,62 +1,63 @@ - - - -Barbenigma Powell & Miller, a bizarre new genus and two new species of scale insects (Hemiptera: Coccomorpha: Ortheziidae) from the United States + + + +Barbenigma Powell & Miller, a bizarre new genus and two new species of scale insects (Hemiptera: Coccomorpha: Ortheziidae) from the United States - - -Author + + +Author -Powell, Erin C. -Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. +Powell, Erin C. +Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. - - -Author + + +Author -Miller, Douglass R. -0000-0003-4909-8654 -Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. & Retired Research Entomologist, Systematic Entomology Laboratory, Agricultural Research Service, USDA, Rm. 328, Bldg. 003, Beltsville, MD 20705, U. S. A. -rtchok@gmail.com +Miller, Douglass R. +0000-0003-4909-8654 +Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. & Retired Research Entomologist, Systematic Entomology Laboratory, Agricultural Research Service, USDA, Rm. 328, Bldg. 003, Beltsville, MD 20705, U. S. A. +rtchok@gmail.com - - -Author + + +Author -Keller, Oliver -Michigan Pathogen Biorepository, Department of Ecology and Evolutionary Biology, University of Michigan, 3600 Varsity Drive, Ann Arbor, MI 48108, U. S. A. +Keller, Oliver +Michigan Pathogen Biorepository, Department of Ecology and Evolutionary Biology, University of Michigan, 3600 Varsity Drive, Ann Arbor, MI 48108, U. S. A. -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -293 -317 + +293 +317 - -http://dx.doi.org/10.11646/zootaxa.5529.2.4 + +http://dx.doi.org/10.11646/zootaxa.5529.2.4 -journal article -10.11646/zootaxa.5529.2.4 -1175-5326 -0EBB38A4-0B20-419B-8DB2-AD43963D6B18 +journal article +10.11646/zootaxa.5529.2.4 +1175-5326 +14022493 +0EBB38A4-0B20-419B-8DB2-AD43963D6B18 - + @@ -230,7 +231,7 @@ is an abbreviation of the English word “bizarre” and is to be treated as a n Adult female ( -Figs 1–4 +Figs 1–4 ) @@ -249,17 +250,17 @@ wide; long, 0.23−0.95 mm wide; body rotundly oval in mature female ( -Figs 1–2 +Figs 1–2 ), narrow elongate in young females ( -Fig. 3 +Fig. 3 ). Dorsum with robust fimbriate setae ( -Figs 1c +Figs 1c , - + 3m ), each with up to five tines, sparse, two present marginally on each side of each abdominal segment, one present submedially on each abdominal segment, roughly in single longitudinal line on thorax and head, @@ -271,27 +272,27 @@ with one instance of two setae arising from single socket on head, longest seta 16–30 µm), longest seta on head 22 µm long ( paratypes 19–24 µm). Dorsal spines each without setal base ( -Figs 1o +Figs 1o , -3n +3n ), with swollen, rounded apex, sparse, one to three on each side of each abdominal segment, longest spine on submedial area of abdomen 17 µm long ( paratypes 14–19 µm), longest spine on thorax and head 14 µm long ( paratypes 14–23 µm). Tubular ducts scattered over body ( -Figs 1q +Figs 1q , -3o +3o ). Multilocular pores absent. Short conical setae similar to simple pores, either dome-shaped or acorn-shaped, with conical projection, definite setal base ( -Figs 1b +Figs 1b , -3a +3a ), one to several clustered near base of each antenna, 4 µm in height, 4 µm wide ( paratypes 3–5 µm by 3–4 µm). Simple pores each with slightly raised, rounded center, scattered over body ( -Figs 1e +Figs 1e , -3f +3f ). One paratype specimen with structure near each antenna with unequal sides, without base, longest side 7 µm. Anal lobes each bearing enlarged fimbriate seta 48 µm long ( @@ -303,13 +304,13 @@ with structure near each antenna with unequal sides, without base, longest side 48–53 µm), spine with swollen apex, 27 µm long ( paratypes 17–21 µm), on each side of anal ring ( -Fig. 1n +Fig. 1n ). Microtrichia absent. Derm smooth. Anal ring ( -Fig. 3l +Fig. 3l ) wrapping around margin, invaginated in pocket, forming setal basket, with ring of conical pores, bearing six robust anal-ring setae with truncate apices, about equal in size, each about 39 µm long ( paratypes 29−33 µm), 0.7 times ( @@ -320,11 +321,11 @@ with structure near each antenna with unequal sides, without base, longest side Venter with two pairs of thoracic spiracles ( -Figs 1d +Figs 1d , -3d +3d ), spiracular openings projecting above derm, three pairs of abdominal spiracles ( -Fig. 1f +Fig. 1f ), spiracular openings flush with derm.Atria of thoracic and abdominal spiracles each with ring of pores, without loculi, in single row. Anterior thoracic spiracles with 10 ( paratypes 6–9) pores in ring around opening, 12 µm in diameter ( @@ -334,7 +335,7 @@ with two pairs of thoracic spiracles ( 7–11) pores in ring around opening, anterior abdominal spiracular opening 13 µm in diameter ( paratypes 12–15 µm). Body setae ( -Fig. 1k +Fig. 1k ) with blunt apices, not capitate, those on abdomen longer than those on thorax and head, longest seta on thorax or head 14 µm long ( paratypes 10–14 µm), longest seta on abdomen 36 µm long ( @@ -346,17 +347,17 @@ with two pairs of thoracic spiracles ( 34–44 µm long by 31–42 µm wide), only one seta arising from basal sockets. Vulva wide, 230 µm wide ( paratypes 72–201 µm), with smooth margins, one heavily sclerotized lateral bar on each side of vulva. Margins of abdominal segments with heavily sclerotized areas (probably muscle attachment points) (not illustrated in -Figs 1 +Figs 1 , -3 +3 , see -Fig. 2 +Fig. 2 ), the posterior two sclerotizations each typically with two associated tubular ducts on each side. Compound duct clusters ( -Figs 1i +Figs 1i , -3i +3i , -4 +4 Ab and Ba) present marginally, clusters of tubular ducts with quadrilocular centers, spines arising from between quadrilocular tubular ducts, clusters set in sclerotized ring, three pairs on submargins of abdomen, one on each side of each of segments VI –VIII, two medially (one posterior to vulva, one anterior to vulva), eight duct clusters total on abdomen, median clusters 32–34 µm in diameter ( @@ -376,7 +377,7 @@ Ab and Ba) present marginally, clusters of tubular ducts with quadrilocular cent 10–12 µm), one spine with swollen apex, 21 µm long ( paratypes 20–21 µm). Antennae ( -Fig. 1a +Fig. 1a ) each three-segmented, segments short, segments I and III subequal in length, total length about 78 µm ( @@ -394,9 +395,9 @@ subequal in length, total length about 78 µm ( 34–38 µm), one short fleshy subapical seta, curved with rounded blunt tip, 17 µm long ( paratypes 15–20 µm), third fleshy seta at apex, microseta adjacent to apical setae, one capitate spine on apex, unspecialized setae long and straight. Pseudobasal antennal segment absent. Legs ( -Figs 1h +Figs 1h , -3e +3e ) reduced in size, all about equal, trochanter and femur fused, two campaniform sensilla on each surface of trochanter, tibia and tarsus not fused, tarsus one-segmented, coxa 54 µm long ( paratypes 45–51 µm), trochanter + femur 60 µm long ( @@ -413,7 +414,7 @@ subequal in length, total length about 78 µm ( . - + FIGURE 1. @@ -472,7 +473,7 @@ _00073118. =fimbriate seta. - + FIGURE 2. @@ -490,7 +491,7 @@ Powell & Miller , E99-879, FSCA_00073114. - + FIGURE 3. @@ -541,7 +542,7 @@ _00073119. =dome-shaped seta. - + FIGURE 4. (A) @@ -647,13 +648,13 @@ character states in parentheses) in having: more spines on the dorsal abdomen, s We illustrated two forms of adult female. The change in body shape between young adult females ( -Fig. 3 +Fig. 3 ) and older females with eggs ( -Fig. 1 +Fig. 1 ) is remarkable, with the young adult females thin and elongate, half the length and only a quarter of the width of mature females. These young adult females are so different in body shape that they were labeled as “male”, perhaps because previous curators thought they were second-instar nymphs or pre-pupae. However, they have both a distinct vulva, with lateral sclerotized bars, and quadrilocular duct clusters that we posit are homologous with an ovisac band ( -Figs 3 +Figs 3 , -4B +4B ). We found no morphological differences between either form beyond the difference in body shape. The simple pores on the thorax and abdomen may not be homologous to the ones on the head, and we call these simple pores rather than setae. The ones on the head have a lot of depth, easily visible when the structures are viewed from the side. However, those on the thorax and abdomen (both ventral and dorsal) did not have such obvious depth. diff --git a/data/03/68/87/036887BC8B3D8F1DFF50FF1BFDF7EF8B.xml b/data/03/68/87/036887BC8B3D8F1DFF50FF1BFDF7EF8B.xml index 13646131c73..be82581f7b0 100644 --- a/data/03/68/87/036887BC8B3D8F1DFF50FF1BFDF7EF8B.xml +++ b/data/03/68/87/036887BC8B3D8F1DFF50FF1BFDF7EF8B.xml @@ -1,62 +1,63 @@ - - - -Barbenigma Powell & Miller, a bizarre new genus and two new species of scale insects (Hemiptera: Coccomorpha: Ortheziidae) from the United States + + + +Barbenigma Powell & Miller, a bizarre new genus and two new species of scale insects (Hemiptera: Coccomorpha: Ortheziidae) from the United States - - -Author + + +Author -Powell, Erin C. -Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. +Powell, Erin C. +Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. - - -Author + + +Author -Miller, Douglass R. -0000-0003-4909-8654 -Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. & Retired Research Entomologist, Systematic Entomology Laboratory, Agricultural Research Service, USDA, Rm. 328, Bldg. 003, Beltsville, MD 20705, U. S. A. -rtchok@gmail.com +Miller, Douglass R. +0000-0003-4909-8654 +Florida State Collection of Arthropods, Division of Plant Industry, 1911 SW 34 th St., Gainesville, FL 32608, U. S. A. & Retired Research Entomologist, Systematic Entomology Laboratory, Agricultural Research Service, USDA, Rm. 328, Bldg. 003, Beltsville, MD 20705, U. S. A. +rtchok@gmail.com - - -Author + + +Author -Keller, Oliver -Michigan Pathogen Biorepository, Department of Ecology and Evolutionary Biology, University of Michigan, 3600 Varsity Drive, Ann Arbor, MI 48108, U. S. A. +Keller, Oliver +Michigan Pathogen Biorepository, Department of Ecology and Evolutionary Biology, University of Michigan, 3600 Varsity Drive, Ann Arbor, MI 48108, U. S. A. -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -293 -317 + +293 +317 - -http://dx.doi.org/10.11646/zootaxa.5529.2.4 + +http://dx.doi.org/10.11646/zootaxa.5529.2.4 -journal article -10.11646/zootaxa.5529.2.4 -1175-5326 -0EBB38A4-0B20-419B-8DB2-AD43963D6B18 +journal article +10.11646/zootaxa.5529.2.4 +1175-5326 +14022493 +0EBB38A4-0B20-419B-8DB2-AD43963D6B18 - + @@ -138,9 +139,9 @@ The species epithet is a noun in apposition derived from the Medieval Latin word Adult female ( -Figs 8 +Figs 8 and -9 +9 ) @@ -163,7 +164,7 @@ wide; body rotund oval. Dorsum with robust fimbriate setae ( -Fig. 8r +Fig. 8r ), with up to five tines, sparse, one present marginally on each abdominal segment, one present medially on each abdominal segment, roughly in single longitudinal submedial line on thorax and head, longest seta on medial area of abdomen 26 µm long ( paratypes 30–36 µm), longest seta on margin 31 µm long ( @@ -171,26 +172,26 @@ with robust fimbriate setae ( 36–39 µm), longest seta on head 25 µm long ( paratypes 25–27 µm). Dorsal spines ( -Fig. 8q +Fig. 8q ) each without setal base, with swollen, rounded apex, sparse, one to three on each side of each abdominal segment, longest spine on medial area of abdomen 31 µm long ( paratypes 27–31 µm), longest spine on thorax and head 22 µm long ( paratypes 28–29 µm). Tubular ducts ( -Fig. 8h, n, p +Fig. 8h, n, p ) scattered over body. Multilocular pores absent. Short conical setae dome- or acorn-shaped ( -Fig. 8b +Fig. 8b ) one to several clustered near base of each antenna, 4 µm in height, 4 µm wide ( paratypes 4–5 µm by 4 µm). Simple pores ( -Fig. 8c, s +Fig. 8c, s ) each with slightly raised rounded center, scattered over body. Some specimens with unknown structure ( - + Fig. 8t ) near each antenna with unequal sides, without base, longest side 6–7 µm. Anal lobes ( -Fig. 8o +Fig. 8o ) indistinct, each lobe area bearing enlarged fimbriate seta, 45 µm long ( paratype 39 µm), enlarged capitate seta 56 µm long ( @@ -202,7 +203,7 @@ Fig. Anal ring ( -Fig. 8o +Fig. 8o ) wrapping around margin, invaginated in pocket, forming setal basket, with ring of pores, bearing six robust anal-ring setae each with truncate apices, one paratype specimen with seven anal-ring setae, about equal in size, 40 µm long ( @@ -214,7 +215,7 @@ with seven anal-ring setae, about equal in size, 40 µm long ( Venter with two pairs of thoracic spiracles ( -Fig. 8f +Fig. 8f ), spiracular openings projecting above derm by about 7 µm, three pairs of abdominal spiracles, spiracular openings flush with derm; thoracic and abdominal spiracle atria each with ring of pores, these without loculi, typically in single row around spiracle, one thoracic spiracle on holotype with one pore in double row, 7–11 ( @@ -226,7 +227,7 @@ with one pore in double row, 7–11 ( 10–11) pores in ring around each abdominal spiracle, first abdominal spiracular opening 14 µm in diameter ( paratypes 15–17 µm). Body setae ( -Fig. 8j +Fig. 8j ) with capitate apices, those on abdomen longer than those on thorax and head, longest seta on thorax or head 18 µm ( paratypes 18 µm), longest seta on abdomen 36 µm ( @@ -236,17 +237,17 @@ with one pore in double row, 7–11 ( 35 µm by 40 µm), only one seta arising from all basal sockets. Vulva wide, 215 µm wide ( paratypes 192–194 µm), with smooth margins, with heavily sclerotized lateral bars on either side of vulva. Margins of abdominal segments with heavily sclerotized areas (probably muscle attachment points) (not illustrated in -Fig. 8 +Fig. 8 but see -Fig. 9B +Fig. 9B ), the posterior two sclerotizations each typically with two associated tubular ducts on each side ( -Fig. 9B +Fig. 9B ). Compound duct clusters ( -Fig. 8l +Fig. 8l ) present marginally, clusters of tubular ducts ( -Fig. 8k +Fig. 8k ) with quadrilocular centers, spines ( - + Fig. 8m @@ -269,7 +270,7 @@ specimens), 15 µm long ( 14 µm), and one spine with swollen apex, 26 µm long ( paratype 33 µm). Antennae ( -Fig. 8a +Fig. 8a ) each three-segmented, segments short, segments I and III subequal, holotype antennae coming straight up on slide, @@ -279,7 +280,7 @@ total length 83–88 µm, segment I 34–37 µm long, segment II 24–28 µm lon 34 µm), one short fleshy subapical seta, curved with a rounded blunt tip, 18 µm long ( paratypes 17 µm), a third fleshy seta at apex, microseta adjacent to apical setae, one capitate spine on apex, unspecialized setae long and straight. Pseudobasal antennal segment absent. Legs ( -Fig. 8i +Fig. 8i ) reduced in size, all about equal. Trochanter and femur fused, with two campaniform sensilla on each surface. Tibia and tarsus not fused, tarsus one-segmented. Coxa 52 µm long ( paratypes 47–49 µm), trochanter + femur 68 µm long ( @@ -294,7 +295,7 @@ total length 83–88 µm, segment I 34–37 µm long, segment II 24–28 µm lon paratypes 19–21 µm). Leg setae sparse, straight, spiniform dorsally and setiform ventrally, enlarged spines between tibia and tarsus absent. Sensory pore between tibia and tarsus present, sensory seta between tibia and tarsus absent. Tarsal digitules absent. Claw digitules each spine-like with acute apex, shorter than claw, claw denticle absent. - + FIGURE 8. @@ -352,7 +353,7 @@ Powell & Miller =unequal-sided structure. - + FIGURE 9. @@ -441,9 +442,9 @@ As in The antennae of the adult females of both new species are very difficult to measure accurately because the segments are short and round, rarely lying flat (see -Figs 4C, D +Figs 4C, D ; -9C +9C ). When mounted flat, they are crushed and distorted. One of the paratype specimens is mounted in such a way that it was impossible to measure the setae and spines in and around the anal ring. diff --git a/data/03/82/D2/0382D24BFFB3B81CEDE9D424FC2EFF12.xml b/data/03/82/D2/0382D24BFFB3B81CEDE9D424FC2EFF12.xml new file mode 100644 index 00000000000..d3c270c3910 --- /dev/null +++ b/data/03/82/D2/0382D24BFFB3B81CEDE9D424FC2EFF12.xml @@ -0,0 +1,163 @@ + + + +New Cernotina Ross 1938 (Trichoptera: Polycentropodidae) from Serra do Divisor, Acre, Brazil + + + +Author + +Pires, Marcos Adriano Ribeiro +0000-0003-3476-4394 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Pós-graduação em Ciências Biológicas (Entomologia) (PPGEnt), Manaus, Amazonas, Brazil +piresmarcosadriano3@gmail.com + + + +Author + +Pes, Ana Maria +0000-0003-0901-5965 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Capacitação Institucional (PCI), Manaus, Amazonas, Brazil +anampes@gmail.com + + + +Author + +Camargos, Lucas M. +0000-0001-7259-4950 +State Museum of Natural History, Stuttgart, Germany +lmcamargosbio@gmail.com + + + +Author + +Hamada, Neusa +0000-0002-3526-5426 +Instituto Nacional de Pesquisas da Amazônia (INPA), Coordenação de Biodiversidade (COBIO), Manaus, Amazonas, Brazil +neusaha@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +570 +582 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.8 + +journal article +10.11646/zootaxa.5529.3.8 +1175-5326 +14022936 +9CE94C8B-33F2-468B-9F36-32E33B349A51 + + + + + + + +Cernotina waorani +Camargos, Ríos-Touma & Holzenthal, 2017 + + + + + + +Camargos +et al. +, 2017: 6 + +[original description]. + + + + +Material examined: + + +BRAZIL +: +Acre +: + +Mâncio Lima +, PARNA +Serra do Divisor +, +Igarapé Piraporinha +(#07), +7.4678°S + +, + + + +73.7042°W +, + +260 m +a.s.l. + +, + +18–23.vii.2022 + +, +A. Pes +, +G.R. Desidério +, +J.O. Silva +, +R.B. Pinedo +, +H.L.M.S. Ferreira +leg., +Pennsylvania trap +, +1 male +[alcohol] ( +INPA +) + +. + + + + +Distribution: +Ecuador +( +Fig. 7A +), +Brazil +( +Acre State +) ( +Fig. 7B, 7C +). + + + + \ No newline at end of file diff --git a/data/03/82/D2/0382D24BFFB8B813EDE9D299FBB7FD42.xml b/data/03/82/D2/0382D24BFFB8B813EDE9D299FBB7FD42.xml new file mode 100644 index 00000000000..8a479e18adf --- /dev/null +++ b/data/03/82/D2/0382D24BFFB8B813EDE9D299FBB7FD42.xml @@ -0,0 +1,358 @@ + + + +New Cernotina Ross 1938 (Trichoptera: Polycentropodidae) from Serra do Divisor, Acre, Brazil + + + +Author + +Pires, Marcos Adriano Ribeiro +0000-0003-3476-4394 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Pós-graduação em Ciências Biológicas (Entomologia) (PPGEnt), Manaus, Amazonas, Brazil +piresmarcosadriano3@gmail.com + + + +Author + +Pes, Ana Maria +0000-0003-0901-5965 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Capacitação Institucional (PCI), Manaus, Amazonas, Brazil +anampes@gmail.com + + + +Author + +Camargos, Lucas M. +0000-0001-7259-4950 +State Museum of Natural History, Stuttgart, Germany +lmcamargosbio@gmail.com + + + +Author + +Hamada, Neusa +0000-0002-3526-5426 +Instituto Nacional de Pesquisas da Amazônia (INPA), Coordenação de Biodiversidade (COBIO), Manaus, Amazonas, Brazil +neusaha@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +570 +582 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.8 + +journal article +10.11646/zootaxa.5529.3.8 +1175-5326 +14022936 +9CE94C8B-33F2-468B-9F36-32E33B349A51 + + + + + + + +Cernotina chicomendes +Pires, Pes, Camargos & Hamada + +sp. nov. + + + + + + +( +Figs 1 +, +2 +, +3 +) + + + + + +Differential diagnosis. +Cernotina chicomendes + + +sp. nov +. + +is strikingly similar to + +C. lobisomem +Santos & Nessimian 2008 + +. They both have a very similar mesoventral process of each preanal appendage, as well as similar general shapes of the inferior appendages and all their structures, and the phallic apparatus. The two species differ mostly by the shape of the dorsolateral process of each preanal appendage, slightly curved dorsad in + +C. lobisomem + +, and straight apically, directed posterodorsad in + +C. chicomendes + + +sp. nov. + +In addition, each preanal appendage in + +C. chicomendes + + +sp. nov. + +has a lateral secondary branch sub-basally, but + +C. lobisomem + +lacks this branch. The pre-apical spines on the dorsolateral processes of the preanal appendages are also in different positions, being subapical in + +C. chicomendes + + +sp. nov. + +and at mid-length in + +C. lobisomem + +. The intermediate appendages are slightly curved dorsad in + +C. lobisomem + +and straight, pointing slightly ventrad in + +C. chicomendes + +sp, nov. +. Although the intermediate appendages may appear more distinct in dorsal view, their membranous nature precludes the use of their shape as a reliable diagnostic character. + + + + + +Description. +Adult male + +. Length of each forewing (mean = +3.08 mm +, standard deviation = 0.165) (n = 9). General color (in alcohol) pale brown ( +Fig 1A +). Forewings each with apical forks II, IV, and V ( +Fig. 2A +); R stem (not shown) and bases of R1 and radial sector obsolete; discoidal (dc) and thyridial (tc) cells present; Sc and R1 veins gradually wider to apices; wing membrane of stigma thicker between C and apices of Sc and R1 and with inconspicuous crossvein between R1 and R2+3; intersection of M1+2, M3+4, and +m-cu +crossvein with pale spot (outlined by dashed line in +Fig. 2A +). Hind wings each with forks II and V ( +Fig. 2B +); discoidal and thyridial cells absent; Sc and R1 veins short, not reaching mid-length of wing; M stem (not shown) and bases of M1+2 and M3+4 obsolete. Cu2 and 1A not reaching hind margin, 3A vein absent. + + +Male genitalia +. In lateral view ( +Fig. 3A +), sternum IX pentagonal, about half as tall as entire male genital complex; in ventral view ( +Fig. 3C +), with posterior margin wider than anterior margin, with slight lateral concavity on each side, anteroventral margin with deep, broad concavity, with sclerotized ventral ridge extending internally in V-shape, and with posteroventral margin broadly concave.Tergum X fused with intermediate appendages. Intermediate appendages digitate in lateral view ( +Fig. 3A +); in dorsal view ( +Fig. 3B +) membranous, fused basally with dorsolateral processes of preanal appendages, much longer than segment IX, separated mid-dorsally about half their length, without spines but with setae and microsetae on dorsal surfaces. Preanal appendages each composed of two processes; dorsolateral process much longer than segment IX, with 1 subapical spine and 1 apical spine; with numerous fine setae around apical spine; secondary ventrolateral branch on dorsolateral process present about 1/3 distance from base, triangular, short, with 1 apical spine (spine absent on the left side), in lateral view ( +Fig. 3A +) triangular, slightly curved, pointing posterad, in dorsal view ( +Fig. 3B +) projecting laterad and curved posterad; mesoventral process much shorter than dorsolateral process and inferior appendage, truncate in lateral view ( +Fig. 3A +), bearing six to seven stout apical setae ( +Fig. 3F +), in ventral view ( +Fig. 3F +) subtriangular, basally fused with corresponding mesoventral process at midline. Inferior appendages about as long as segment IX; in lateral view ( +Fig 3A +) subrectangular, apically slightly broader and subtruncate, with ventral and dorsal margins almost straight and with very thick straight setae subapicolaterally and ventrolaterally (only alveoli shown for latter in +Figs 3A, 3C +); in ventral view ( +Fig. 3C +), internal margins of appendages divergent and nearly straight, each with broad lobe at mid-length, and apical half deeply excavated; anterior basal plate reaching mid-length of sternum IX in lateral and ventral views ( +Figs 3A, 3C +); apicomesal lobe large, digitiform with slender basal projection, in lateral and ventral views ( +Figs 3A, 3C +) almost entirely hidden by main body of appendage, bearing two stout setae on mesal margin (shown with dashed lines in +Fig. 3A +); dorsal branch slender, elongate in lateral view ( +Fig. 3A +), angled posterodorsad from main body of inferior appendage and curved caudad, bearing 7 stout setae mesally and apically (inset, +Fig. 3C +). Phallus broad, slightly bent at mid-length ( +Fig. 3D +), with 2 elongate phallic spines free in phallic membranes; phallotremal sclerite at mid-length, large, with 2 lobes recurved anterad in dorsal view ( +Fig. 3E +). + + + +FIGURE 1. + +Cernotina chicomendes + + +sp. nov. + +, male adult holotype. 1A, habitus, left lateral. 1B–1D, genitalia: 1B, left lateral; 1C, dorsal; 1D, ventral. Scale bars: 1A = 1 mm; 1B, 1C, 1D = 0.1 mm. + + + + +FIGURE 2. + +Cernotina chicomendes + + +sp. nov. + +, male adult holotype, right wings, dorsal. 2A, forewing; 2B, hind wing. Scale bar: 0.5mm. Abbreviations: C = costal vein; CU1a, CU1b, Cu2 = cubital veins, dc = discoidal cell; I–V = apical forks, M1–M4 = medial veins; m-cu = mediocubital crossvein; R1–R5 = radial veins; r = radial crossvein; r-m = radiomedial crossvein; s = sectoral crossvein; Sc = subcostal; tc = thyridial cell; 1A–3A = anal veins + + + + +FIGURE 3. + +Cernotina chicomendes + + +sp. nov. + +, male adult holotype, genitalia. 3A, left lateral; 3B, dorsal; 3C, ventral; 3D, phallus, left lateral; 3E, phallus, dorsal; 3F, paired mesoventral processes of preanal appendages, ventral. Scale bar: 0.1 mm. + + + +Female and immature stages: +Unknown. + + + + +Type material. + + +Holotype +male: +BRAZIL +: +Acre +: + +Mâncio Lima +, +Parque Nacional da Serra do Divisor +, +Igarapé Cachoerinha +(#06), +7.4952°S +, +73.6989°W +, + +250 m +a.s.l. + +, + +17–22.vii.2022 + +, +A. Pes +, +G.R. Desidério +, +J.O. Silva +, +R.B. Pinedo +, +H.L.M.S. Ferreira +leg., +Pennsylvania trap +, +1 male +[alcohol] (INPA-TRI 000147) ( +INPA +) + +. + + +Paratypes +: +BRAZIL +: + +same data as for holotype, +6 males +, [alcohol] (INPA-TRI 000148) ( +INPA +) + +, + +1 male +[alcohol] ( +MNRJ +) + +, + +1 male +[alcohol] ( +MZUSP +) + +. + + + + +Distribution. +BRAZIL +, +Acre State +(7B, 7C). + + + + +Etymology. +The name is given to this species as a noun in apposition, and refers to Francisco Alves Mendes Filho, known as ‘Chico Mendes’. Chico Mendes, a rubber tapper, and environmentalist from the +Acre State +, ardently opposed deforestation, and the encroachment of landowners. His life was tragically cut short, but it sparked the concept of protected areas. Acknowledged as the National Patron of the Environment, Chico Mendes has left an enduring legacy, and his commitment to nature protection will never be forgotten. + + + + \ No newline at end of file diff --git a/data/03/82/D2/0382D24BFFBDB81EEDE9D594FA8FF87C.xml b/data/03/82/D2/0382D24BFFBDB81EEDE9D594FA8FF87C.xml new file mode 100644 index 00000000000..d5841b3a49f --- /dev/null +++ b/data/03/82/D2/0382D24BFFBDB81EEDE9D594FA8FF87C.xml @@ -0,0 +1,391 @@ + + + +New Cernotina Ross 1938 (Trichoptera: Polycentropodidae) from Serra do Divisor, Acre, Brazil + + + +Author + +Pires, Marcos Adriano Ribeiro +0000-0003-3476-4394 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Pós-graduação em Ciências Biológicas (Entomologia) (PPGEnt), Manaus, Amazonas, Brazil +piresmarcosadriano3@gmail.com + + + +Author + +Pes, Ana Maria +0000-0003-0901-5965 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Capacitação Institucional (PCI), Manaus, Amazonas, Brazil +anampes@gmail.com + + + +Author + +Camargos, Lucas M. +0000-0001-7259-4950 +State Museum of Natural History, Stuttgart, Germany +lmcamargosbio@gmail.com + + + +Author + +Hamada, Neusa +0000-0002-3526-5426 +Instituto Nacional de Pesquisas da Amazônia (INPA), Coordenação de Biodiversidade (COBIO), Manaus, Amazonas, Brazil +neusaha@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +570 +582 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.8 + +journal article +10.11646/zootaxa.5529.3.8 +1175-5326 +14022936 +9CE94C8B-33F2-468B-9F36-32E33B349A51 + + + + + + + +Cernotina hastilis +Flint, 1996 + + + + + +Flint, 1996: 75 +[originl description]; +Botosaneanu, 2002: 95 +[checklist]; +Holzenthal and Calor, 2017: 415 +[catalog]; + +Camargos +et al. +, 2017: 6 + +[distribution]. + + + + +FIGURE 6. + +Cernotina divisor + + +sp. nov. + +, male adult holotype, genitalia. 6A, left lateral; 6B, dorsal; 6C, ventral; 6D, phallus, left lateral; 6E, phallus, dorsal; 6F, paired mesoventral processes of preanal appendages, ventral. Scale bar: 0.1 mm. + + + + +Material examined: + + +BRAZIL +: +Acre +: + +Mâncio Lima +, PARNA +Serra do Divisor +, +Igarapé do Mundico +(#17), +7.4277°S +, +73.6622°W +, + +260 m +a.s.l. + +, + +19–27.vii.2022 + +, +A. Pes +, +G.R. Desidério +, +J.O. Silva +, +R.B. Pinedo +, +H.L.M.S. Ferreira +leg., +Malaise trap +, +1 male +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé Capitão da Mata +(#09), +7.4586°S +, +73.6959°W +, + +260 m +a.s.l. + +, + +24–26.vii.2022 + +, +Pennsylvania trap +, +2 males +[alcohol] ( +INPA +) + +. + +Same +data as above, excepet: +Igarapé do Véio +(#14), +7.4589°S +, +73.6327°W +, + +220 m +a.s.l. + +, + +19–25.vii.2022 + +, +Pennsylvania trap +, +5 males +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé do Bruquinês +(#15), +7.4602°S +, +73.6487° W +, + +260 m +a.s.l. + +, + +19–25.vii.2022 + +, +Malaise trap +, +1 male +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé do Bruquinês +(#15), +7.4602 S +, +73.6487°W +, + +260 m +a.s.l. + +, + +25–27.vii.2022 + +, +Pennsylvania trap +, +7 males +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé Piraporinha +(#07), +7.4678°S +, +73.7042°W +, + +260 m +a.s.l. + +, + +18–26.vii.2022 + +, +Malaise trap +, +2 males +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé Piraporinha +(#07), +7.4678°S +, +73.7042°W +, + +260 m +a.s.l. + +, + +18– 23.vii.2022 + +, +Pennsylvania trap +, +2 males +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé Jenilson +, afluente do +Igarapé Ramón +(#04), +7.4879°S +, +73.7185°W +, + +260 m +a.s.l. + +, + +17–26.vii.2022 + +, +Malaise trap +, +3 males +[alcohol] ( +INPA +) + +. + +Same +data as above, except: +Igarapé Cachoerinha +(#06), +7.4952°S +, +73.6989°W +, + +250 m +a.s.l. + +, + +17–22.vii.2022 + +, +Pennsylvania trap +, +10 males +[alcohol] ( +INPA +) + +. + + + + +Distribution: +Ecuador +( +Fig. 7A +) +Trinidad and Tobago +( +Fig. 7A +), +Brazil +( +Acre State +) ( +Fig. 7B, 7C +). + + + + \ No newline at end of file diff --git a/data/03/82/D2/0382D24BFFBFB811EDE9D19DFE7FF9B3.xml b/data/03/82/D2/0382D24BFFBFB811EDE9D19DFE7FF9B3.xml new file mode 100644 index 00000000000..9f903b930bf --- /dev/null +++ b/data/03/82/D2/0382D24BFFBFB811EDE9D19DFE7FF9B3.xml @@ -0,0 +1,404 @@ + + + +New Cernotina Ross 1938 (Trichoptera: Polycentropodidae) from Serra do Divisor, Acre, Brazil + + + +Author + +Pires, Marcos Adriano Ribeiro +0000-0003-3476-4394 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Pós-graduação em Ciências Biológicas (Entomologia) (PPGEnt), Manaus, Amazonas, Brazil +piresmarcosadriano3@gmail.com + + + +Author + +Pes, Ana Maria +0000-0003-0901-5965 +Instituto Nacional de Pesquisas da Amazônia (INPA), Programa de Capacitação Institucional (PCI), Manaus, Amazonas, Brazil +anampes@gmail.com + + + +Author + +Camargos, Lucas M. +0000-0001-7259-4950 +State Museum of Natural History, Stuttgart, Germany +lmcamargosbio@gmail.com + + + +Author + +Hamada, Neusa +0000-0002-3526-5426 +Instituto Nacional de Pesquisas da Amazônia (INPA), Coordenação de Biodiversidade (COBIO), Manaus, Amazonas, Brazil +neusaha@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +570 +582 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.8 + +journal article +10.11646/zootaxa.5529.3.8 +1175-5326 +14022936 +9CE94C8B-33F2-468B-9F36-32E33B349A51 + + + + + + + +Cernotina divisor +Pires, Pes, Camargos & Hamada + +sp. nov. + + + + + + +( +Figs. 4 +, +5 +, +6 +) + + + + + +Differential diagnosis. +Cernotina divisor + + +sp. nov. + +shares similarities with + +Cernotina tiputini +Camargos, Ríos-Touma & Holzenthal, 2017 + +from +Ecuador +, particularly in segment IX and the inferior appendage in lateral and ventral views. It differs from the Ecuadorian species by the shape of the dorsolateral process of the preanal appendage, which is not round as in + +C +. +tiputini + +. The dorsolateral spines are located in the preapical region and are surrounded by microsetae diverging from the apical spines in + +C +. +tiputini + +. The dorsolateral process also involves the intermediate appendage, which does not occur in + +C +. +tiputini + +. The intermediate appendage length is longer and narrower, possessing three apical spines. The mesoventral process of each preanal appendage also differs from the Ecuadorian species by bearing stout setae. The dorsal branch of each inferior appendage is also different in its form and the presence of a line of spines from mid-to-apical regions. + + + + + +Description. +Adult male + +. Length of each forewing (mean = +3.55 mm +, standard deviation = 0.196) (n = 8). General color (in alcohol) pale brown ( +Fig 4A +). Forewings each with apical forks II, IV, and V; fork II sessil ( +Fig. 5A +); discoidal and thyridial cells present; Sc vein extending to mid-length of costal margin; base of R vein attenuate, R1 vein gradually wider from +r +crossvein to apex, wing membrane of stigma thicker between C, apical portion of Sc vein, and mid-length of R1 vein; intersection of M1+2, M3+4, and +m-cu +crossvein with pale spot (outlined by dashed line in +Fig. 5A +). Hind wings each with apical forks II and V ( +Fig. 5B +); discoidal and thyridial cells absent; Sc vein thick basally, gradually attenuate apically. R1 vein thick throughout its length. Radial vein (R) main branch obsolete basally; R2+3 gradually thicker to apex; 3A vein absent. + + +Male genitalia +. In lateral view ( +Fig. 6A +), sternum IX pentagonal, about 3/4 as tall as entire male genital complex; in ventral view ( +Fig. 6C +), with anterolateral margin almost as wide as posterolateral margin, anteroventral margin with deep, broad concavity, with sclerotized ventral ridge extending internally in V-shape, and posteroventral margin broadly concave and sinuous. Tergum X fused with intermediate appendages. Intermediate appendages in lateral view ( +Fig. 6A +) membranous, strongly curved ventrad, with blunt apices, each partially fused with corresponding dorsolateral process of preanal appendage, longer than segment IX, with three stout apical setae; in dorsal view ( +Fig. 6B +) closely proximate with each other in basal half, divergent mid-dorsally in apical half, with setae and microsetae on dorsal surfaces. Preanal appendages each composed of two processes: (1) dorsolateral process in lateral view ( +Fig. 6A +) shorter than segment IX, with dorsal and ventral margins concave, several setae dorsolaterally, and two thick subapical spines surrounded by dense fine setae; in dorsal view ( +Fig. 6B +) subtriangular; (2) mesoventral process in lateral view ( +Fig. 6A +) shorter than dorsolateral process, intermediate appendage, and inferior appendage, triangular, bearing seven stout setae along mesoventral margin, in ventral view ( +Fig. 6F +) basally fused with corresponding mesoventral process at midline. Inferior appendages about as long as segment IX; in lateral view ( +Fig. 6A +) digitiform, bent slightly ventrad, each with ventral margin slightly concave, dorsal margin slightly convex, apically round; in ventral view ( +Fig. 6C +), mesal margin of appendage basally straight with protuberance at 2/3 length and stout preapical setae in concave preapical region, three stout setae on apicodorsomesal margin above stout subapical tooth; anterior basal plate extending to 2/3 of ventral midline of sternum IX; apicomesal lobe absent; dorsal branch oblong in lateral view, sinuous, with apex round, almost as long as main body of appendage and arising basally on it, directed posterad and slightly laterad, bearing 15 stout setae mesally and apically ( +Fig. 6C +inset), without basal projection. Phallus slender, apical half sinuously curved ventrad then slightly recurved dorsad ( +Fig. 6D +), with 2 elongate phallic spines free in phallic membrane; phallotremal sclerite anteroventral, large, cordate in lateral view ( +Fig. 6D +), with 2 lobes projecting posterad in dorsal view ( +Fig. 6E +). + + + +FIGURE 4. + +Cernotina divisor + + +sp. nov. + +, male adult holotype. 4A, habitus, left lateral. 4B–4D, genitalia: 4B, left lateral; 4C, dorsal; 4D, ventral. Scale bars: 4A = 1 mm; 4B, 4C, 4D = 0.1 mm. + + + + +FIGURE 5. + +Cernotina divisor + + +sp. nov. + +, male adult holotype, right wings, dorsal. 5A, forewing; 5B, hind wing. Scale bar: 0.5 mm. Abbreviations: C = costal vein; CU1a, CU1b, Cu2 = cubital veins, dc = discoidal cell; I–V = apical forks, M1–M4 = medial veins; m-cu = mediocubital crossvein; R1–R5 = radial veins; r = radial crossvein; r-m = radiomedial crossvein; s = sectoral crossvein; Sc = subcostal; tc = thyridial cell; 1A–3A = anal veins + + + +Female and immature stages: +Unknown. + + + + +Type material. + + +Holotype +male: +BRAZIL +, +Acre +: + +Mâncio Lima +, +Parque Nacional da Serra do Divisor +, +Igarapé do Mundico +(#17), +7.4277°S +, +73.6622°W +, + +260 m + +a.s.l, + +19–27.vii.2022 + +, +A. Pes +, +G.R. Desidério +, +J.O. Silva +, +R.B. Pinedo +, +H.L.M.S. Ferreira +leg., +Malaise trap +, +1 male +[alcohol] (INPA-TRI 000149) ( +INPA +) + +. + + + +Paratypes + +: +BRAZIL +: + +same data as for holotype, +2 males +[alcohol] (INPA-TRI 000150) ( +INPA +) + +. Same + +data as for holotype, except: +Igarapé Morro da Poronga +(#16), +7.4299°S +, +73.6620°W +, + +260 m +a.s.l. + +, + +19–27.vii.2022 + +, +Pennsylvania trap +, +2 males +[alcohol] (INPA-TRI 000151) ( +INPA +) + +. Same + +data as for holotype, except: +Igarapé da Caverna +(#10), +7.4476°S +, +73.6825°W +, + +250 m +a.s.l. + +, + +18–26.vii.2022 + +, +Malaise trap +, +1 male +[alcohol] (INPA-TRI 000152) ( +INPA +) + +. Same + +data as for holotype, except: +Igarapé Cachoerinha +(#06), +7.4952°S +, +73.6989°W +, + +250 m +a.s.l. + +, + +17–26.vii.2022 + +, +Malaise trap +, +1 male +[alcohol] ( +MNRJ +) + +. Same + +data as for holotype, except: +Igarapé Cachoerinha +(#06), +7.4952°S +, +73.6989°W +, + +250 m +a.s.l. + +, + +17–22.vii.2022 + +, +Pennsylvania trap +, +1 male +[alcohol] ( +MZUSP +) + +. + + + + +Distribution. +BRAZIL +, +Acre State +( +Fig. 7B, 7C +). + + + + +Etymology. +The specific epithet is a noun in apposition that refers to the +type +locality of the new species, Parque Nacional da Serra do Divisor. + + + + \ No newline at end of file diff --git a/data/03/8F/87/038F87A8401C567BB5E0B216ECFEFA82.xml b/data/03/8F/87/038F87A8401C567BB5E0B216ECFEFA82.xml index 916ce480565..c46ffd9f968 100644 --- a/data/03/8F/87/038F87A8401C567BB5E0B216ECFEFA82.xml +++ b/data/03/8F/87/038F87A8401C567BB5E0B216ECFEFA82.xml @@ -1,60 +1,61 @@ - - - -A new species of Ctenocheles Kishinouye, 1926 (Decapoda, Axiidea, Ctenochelidae) from China + + + +A new species of Ctenocheles Kishinouye, 1926 (Decapoda, Axiidea, Ctenochelidae) from China - - -Author + + +Author -Kou, Qi -Institute of Oceanology, Chinese Academy of Sciences, Qingdao, Shandong 266071, China & Laboratory for Marine Biology and Biotechnology, Laoshan Laboratory, Qingdao, Shandong 266237, China & University of Chinese Academy of Sciences, Beijing 100049, China +Kou, Qi +Institute of Oceanology, Chinese Academy of Sciences, Qingdao, Shandong 266071, China & Laboratory for Marine Biology and Biotechnology, Laoshan Laboratory, Qingdao, Shandong 266237, China & University of Chinese Academy of Sciences, Beijing 100049, China - - -Author + + +Author -Poore, Gary C. B. -Museums Victoria, Melbourne, VIC 3001, Australia +Poore, Gary C. B. +Museums Victoria, Melbourne, VIC 3001, Australia - - -Author + + +Author -Li, Xinzheng -Institute of Oceanology, Chinese Academy of Sciences, Qingdao, Shandong 266071, China & Laboratory for Marine Biology and Biotechnology, Laoshan Laboratory, Qingdao, Shandong 266237, China & University of Chinese Academy of Sciences, Beijing 100049, China +Li, Xinzheng +Institute of Oceanology, Chinese Academy of Sciences, Qingdao, Shandong 266071, China & Laboratory for Marine Biology and Biotechnology, Laoshan Laboratory, Qingdao, Shandong 266237, China & University of Chinese Academy of Sciences, Beijing 100049, China -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -381 -395 + +381 +395 - -http://dx.doi.org/10.11646/zootaxa.5529.2.9 + +http://dx.doi.org/10.11646/zootaxa.5529.2.9 -journal article -10.11646/zootaxa.5529.2.9 -1175-5326 -C451EEC7-AE2D-410E-9A79-5634C1BA08C7 +journal article +10.11646/zootaxa.5529.2.9 +1175-5326 +14022565 +C451EEC7-AE2D-410E-9A79-5634C1BA08C7 - + @@ -70,7 +71,7 @@ ( -Figs. 1–7 +Figs. 1–7 ) @@ -279,11 +280,11 @@ Generally similar to male, body stouter. Pleopod 1 uniramous, unsegmented, rod-l Colour in life. Body and pereopods generally yellowish; gastric region and cheliped fingers pink; ovary orange; cornea blackish ( -Fig. 1 +Fig. 1 ). - + FIGURE 1. diff --git a/data/03/94/B5/0394B500FFC0FFA9FF322834D45EFAA8.xml b/data/03/94/B5/0394B500FFC0FFA9FF322834D45EFAA8.xml new file mode 100644 index 00000000000..e638d3a1a4a --- /dev/null +++ b/data/03/94/B5/0394B500FFC0FFA9FF322834D45EFAA8.xml @@ -0,0 +1,124 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Hylekobolus rufus +Wesener, 2009 + + + + + + + +Material examined +. + +1 F, + +CASENT9068302 +, +BLF + + + +14777 +, +Fianarantsoa +, +Parc National Befotaka-Midongy +, +Papango + +27.7 km +S Midongy-Sud + +, +Mount Papango +, + +940 m + +, rainforest, 23˚50’07” S, 046˚57’49” E, coll. +B.L. Fisher +et al. +, + +13.xi.2006 + +; 1 M + +, + + +FMNH-INS 3119889 + +, +Madagascar +, +Midongy-Befotaka +, + +1055 m + +, VS1536 + +. + + + + +Remarks +. So far, the most widespread species of the genus. Genetic barcoding of this population was successful. Unfortunately, it is the only sequence available for members of the +Spirobolellidae +from +Madagascar +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC0FFA9FF322CD4D024FE6C.xml b/data/03/94/B5/0394B500FFC0FFA9FF322CD4D024FE6C.xml new file mode 100644 index 00000000000..c4cf976c3fc --- /dev/null +++ b/data/03/94/B5/0394B500FFC0FFA9FF322CD4D024FE6C.xml @@ -0,0 +1,120 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Dactylobolus bivirgatus +( +Karsch, 1881 +) + + + + + + + +Material examined +. + +1 F, + +FMNH-INS 2858683 +-B + +, +Madagascar +, +Antsiranana +, +Sava +, +Nosy Ankao +, + +18 km +S of Ampisikinana + +, +Nosy Ankao Forest +, in degraded transitional dry-humid forest dominated by +Capurondendrom +, + +6 m + +, +12°42’31’’ S +, +49°49’27’’ E +, coll. +S.M. Goodman +, +pitfalls +, + +9–14.III.2016 + + +. + + + + +Remark +s. This relatively widespread species, one of the few non-endemic millipede species from +Madagascar +( +Wesener & Enghoff 2022 +), is commonly found in disturbed coastal forest in northern +Madagascar +(see also +Wesener & Anilkumar 2020 +). + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC0FFA9FF322E84D2F4FCC4.xml b/data/03/94/B5/0394B500FFC0FFA9FF322E84D2F4FCC4.xml new file mode 100644 index 00000000000..fbda1ebf52b --- /dev/null +++ b/data/03/94/B5/0394B500FFC0FFA9FF322E84D2F4FCC4.xml @@ -0,0 +1,128 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Madabolus maximus +Wesener & Enghoff, 2008 + + + + + + + +Material examined +. + +3 M, + +CASENT9068305, +BLF22790 + +, +Majunga +, +Reserve +forestiere +Beanka +, + +50.2 km +E Maintirano + +, tropical dry forest on tsingy, + +250 m + +, +18°01’35” S +, +44°03’02” E +, coll. +B. L. Fisher +et al. +, + +18.–26.x.2009 + + +; + +2 M, + +FMNH-INS 3119871 + +, +Province +Mahajanga +, + +Forêt +de Beanka + +, + +220 m + +, +18°01’25’’ S +, +44°30’08’’ E +, slightly disturbed dry deciduous tsingy forest, coll. +V +. +Soarimalala +, + +17.X.2009 + + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC4FFADFF322FA4D263F844.xml b/data/03/94/B5/0394B500FFC4FFADFF322FA4D263F844.xml new file mode 100644 index 00000000000..2bf5fa170ff --- /dev/null +++ b/data/03/94/B5/0394B500FFC4FFADFF322FA4D263F844.xml @@ -0,0 +1,196 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Spiromimus endemicus + +sp. nov. + + + + + + +Fig. 11A–E + + + + +Material examined +. + +Holotype +M, + +CASENT 9032793 + +, + +BLF 3123 + +, +Province d’Antsiranana +, +Montagne des Français +, +7.2 km +142° SE +Antsiranana +(=Diego Suarez), tropical dry forest, + +180 m + +, +12°19’22” S +, +49°20’17” E +, coll. +Fisher +, +Griswold +et al. +, +pitfall trap +, + +22–28.ii.2001 + +. + + + + +Paratype +: 1 F and several posterior fragments of +additional specimens +CASENT 9032793 +, + +BLF 3123 + +, same data as holotype + +. + + + + +Derivatio nominis +. endemicus, adjective, after the isolated position of the +type +locality. + + + + +Diagnosis +. + +Spiromimus endemicus + + +sp. nov. + +shares the particular-shaped posterior gonopods with a basally wide mesal branch with no other of the 13 previously described species of the genus, except maybe for + +Spiromimus dorsovittatus +( +de Saussure & Zehntner, 1901 +) + +, which differs virtually in all other characters. + + + + +Description +. + + +Measurements: Male circa +33 mm +long, only 2.4 wide, 44+0 body rings. Immature female +28 mm +long, +2.9 mm +wide, with 34+3 body rings. + +Colour: Laterally and ventrally dark, dorsally with slender yellow stripe. +Head: Male antenna reaching back to seventh body ring. Eyes with 30/28 black ommatidia. Antenna and gnathochilarium typical for the genus. Mandible not examined. +Legs: In males 1.1 times as long as body ring width. Male coxa three elongated into slender process projecting to sixth coxa. Coxa four elongated into rod-shaped process projecting towards sixth coxa. Coxae five and six flattened, mesally with short and slender projection. Coxa seven with a large cone. + +Ozopore starting at ring 6, located on suture between meso- and metazonite.Telson typical for the genus, without a preanal process, subanal scale inconspicuous and anal valves with weak lips ( +Fig. 11A +). + + +Anterior gonopod: sternal lobe broken ( +Fig. 11B +). Telopodite without excavation ( +Fig. 11B, C +). Tip of telopodite slender, with weakly developed retrorse process ( +Fig. 11B, C +). + + +Posterior gonopod sternite sclerotized, triangular ( +Fig. 11E +). Telopodite, tip of main branch bent backwards, forming well-rounded ‘hook’ ( +Fig. 11D +). Mesal branch slightly slenderer but as long as main branch ( +Fig. 11E +). Mesal branch not tapering, at tip slightly bent towards main branch ( +Fig. 11E +). Mesal and main branch only basally connected by membranous folds ( +Fig. 11E +). Main branch basally of well-rounded apex with short membranous lobe which slightly projects towards the mesal branch ( +Fig. 11E +). + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC5FFACFF322A76D5DBF845.xml b/data/03/94/B5/0394B500FFC5FFACFF322A76D5DBF845.xml new file mode 100644 index 00000000000..345e6307188 --- /dev/null +++ b/data/03/94/B5/0394B500FFC5FFACFF322A76D5DBF845.xml @@ -0,0 +1,150 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Aphistogoniulus aridus +Wesener, 2009 + + + + + + + +Material examined +. 1 M, + + +ZFMK-MYR886 + +, +Madagascar +, +Province +Toliara +, +Ranobe +, spiny forest, +23°00.568’ S +, +043°36.604’ E +, coll. +Martina Petru +, + +May 2011 + +; +3 juveniles + +, + + +ZFMK-MYR887 + +, same data as previous; 1 M, 2 F + +, + + +ZFMK-MYR888 + +, +Madagascar +, +Province +Toliara +, +Ifaty +, spiny forest, +23°07.368’ S +, +43°37.081’ E +, coll. +Martina Petru +, + +May 2011 + + +. + + + + +Remarks +. The new localities are more than +350 km +NW of the +type +locality. Morphologically, the specimens are identical to the +type +series—unfortunately no molecular data is available for the +type +locality, Andohahela. + +A. aridus + +could be one of the widespread spiny forest species, such as the giant pill-millipedes + +Zoosphaerium libidinosum +( +de Saussure & Zehntner, 1897 +) + +and + +Sphaeromimus musicus +( +de Saussure & Zehntner, 1897 +) + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC6FFAFFF322868D2CFFB70.xml b/data/03/94/B5/0394B500FFC6FFAFFF322868D2CFFB70.xml new file mode 100644 index 00000000000..ffa552dad65 --- /dev/null +++ b/data/03/94/B5/0394B500FFC6FFAFFF322868D2CFFB70.xml @@ -0,0 +1,96 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Colossobolus semicyclus +Wesener, 2009 + + + + + + + +Material examined +. + +1 M, + +CASENT 9068309 +, +BLF + + + +26521 + +, + +Antsiranana +, +Makirovana forest +, rainforest, + +415 m + +, +14°10’14” S +, +49°57’15” E +, coll. +B. L. Fisher +et al. +, + +28.iv.–02.v.2011 + + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC6FFAFFF322988D46CF990.xml b/data/03/94/B5/0394B500FFC6FFAFFF322988D46CF990.xml new file mode 100644 index 00000000000..1595884f57a --- /dev/null +++ b/data/03/94/B5/0394B500FFC6FFAFFF322988D46CF990.xml @@ -0,0 +1,87 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Spiromimus albipes +Wesener & Enghoff, 2009 + + + + + + + +Material examined +. + +1 F, + +FMNH-INS 000104243 +, + +S Cap +d´Ambre, near +Anjiabe +, limestone outcrop near river, viny dry deciduous forest on limestone +12.1093° S +, +49.3232° E +, + +69 feet + +, + +5/15/2007 + +, Ken Emberton MBI-2149 + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC6FFAFFF322A50D0E1F8E8.xml b/data/03/94/B5/0394B500FFC6FFAFFF322A50D0E1F8E8.xml new file mode 100644 index 00000000000..9c416b058b8 --- /dev/null +++ b/data/03/94/B5/0394B500FFC6FFAFFF322A50D0E1F8E8.xml @@ -0,0 +1,134 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Spiromimus litoralis +Wesener & Enghoff, 2009 + + + + + + + +Material examined +. 1 F, + + +FMNH-INS 000104272 +, + +Foret +d´Orangea, ENE slope of +Mamelon Vert +, scrubby dry deciduous forest, +12.2811° S +, +49.3889° E +, + +22 m + +, + +3/26/2007 + +, Ken Emberton MBI-2003; 1 M + +, + + +FMNH-INS 000104273 +, + +Foret +d´Orangea, + +Baie de Sakalava +, N + +coast, dry coastal scrub on limestone, +12.2613° S +, +49.3938° E +, + +13m + +, + +3/25/2007 + +, Ken Emberton MBI-2001; 1 F + +, + + +FMNH-INS 000104271 +, + +Foret +d´Orangea, summit of +Mamelon Vert +, dry manmade gulley, scrubby dry deciduous forest on limestone, +12.2809° S +, +49.3856° E +, + +75 m + +, + +3/26/2007 + +, Ken Emberton MBI-2006 + + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC6FFAFFF322C9CD0BAFED8.xml b/data/03/94/B5/0394B500FFC6FFAFFF322C9CD0BAFED8.xml new file mode 100644 index 00000000000..694ba3b3134 --- /dev/null +++ b/data/03/94/B5/0394B500FFC6FFAFFF322C9CD0BAFED8.xml @@ -0,0 +1,95 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Aphistogoniulus diabolicus +Wesener, 2009 + + + + + + + +Material examined +. + +7 M and F, + +CASENT 9068290 +, +BLF14945 + +, +Fianarantsoa +, +Parc National Befotaka-Midongy +, +Papango + +28.5 km +S Midongy-Sud + +, +Mount Papango +, + +1250 m + +, montane rainforest, 23˚50’27” S, 046˚57’27” E, coll. +B.L. Fisher +et al. +, + +17.xi.2006 + + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC6FFAFFF322D98D048FDF8.xml b/data/03/94/B5/0394B500FFC6FFAFFF322D98D048FDF8.xml new file mode 100644 index 00000000000..9edb03eb23a --- /dev/null +++ b/data/03/94/B5/0394B500FFC6FFAFFF322D98D048FDF8.xml @@ -0,0 +1,130 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Aphistogoniulus erythrocephalus +( +Pocock, 1893 +) + + + + + + + +Material examined +. 2 M, + + +CASENT 9068309 +, + + + + +BLF 26521 + +, +Antsiranana +, +Makirovana forest +, rainforest, + +415 m + +, +14°10’14” S +, +49°57’15” E +, coll. +B. L. Fisher +et al. +, + +28.iv.–02.v.2011 + +; 1 M, 2 F + +, + + +CASENT 9068308 + +, + + + +BLF 30972 + +, +Antsiranana +, +Galoko +chain, +Mont Galoko +, rainforest, + +520 m + +, +13°35’06’’ S +, +048°43’05’’ E +, coll. +B.L. Fisher +et al. +, + +21.ii.2013 + + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC7FFAEFF322AE0D3B2F844.xml b/data/03/94/B5/0394B500FFC7FFAEFF322AE0D3B2F844.xml new file mode 100644 index 00000000000..66fd29447d4 --- /dev/null +++ b/data/03/94/B5/0394B500FFC7FFAEFF322AE0D3B2F844.xml @@ -0,0 +1,96 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Flagellobolus pauliani +Wesener, 2009 + + + + + + + +Material examined +. + +1 M, + +FMNH-INS 3196511 + +, +Madagascar +, +Nosy Manampaho +, + +11 m + +, island grass, +12°48’32.1’’S +, +49°52’05.9’’ E + +, + +SMG19476 + +. + + + + +Remarks +. The record of this characteristic species at Nosy Manampaho, far away from the known records of distribution at Andasibe and Anjozorobe (Wesener +et al. +2009; Spelzhausen +et al. +2020) is surprising. A DNA extraction for genetic barcoding unfortunately failed. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC7FFAEFF322C9CD5DCFEFC.xml b/data/03/94/B5/0394B500FFC7FFAEFF322C9CD5DCFEFC.xml new file mode 100644 index 00000000000..97c6d119c24 --- /dev/null +++ b/data/03/94/B5/0394B500FFC7FFAEFF322C9CD5DCFEFC.xml @@ -0,0 +1,106 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Spiromimus simplex +Wesener & Enghoff, 2009 + + + + + + + +Material examined +. 1 M, + +1 imm. + +ZFMK +MYR 13628 + +, +Province +Toamasina +, +Makira NP +, +Maroantsetra +, + +44.5 km +NW Antainambalana River + +tributary, +1 km +around coordinates, primary lowland rainforest on basalt, + +240–670 m + +, +15°4’15’’ E +, +49°34’48’’ E +, coll. +D. Telnov +, + +30.viii.–08.ix. 2023 + +, hand collecting + +. + + + + +Remarks +. Only second locality known for the species, first described from Marojejy. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC7FFAEFF322DBCD2D1FD68.xml b/data/03/94/B5/0394B500FFC7FFAEFF322DBCD2D1FD68.xml new file mode 100644 index 00000000000..af846150263 --- /dev/null +++ b/data/03/94/B5/0394B500FFC7FFAEFF322DBCD2D1FD68.xml @@ -0,0 +1,106 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Spiromimus triaureus +Wesener & Enghoff, 2009 + + + + + + + +Material examined +. + +1 M, + +FMNH-INS 3119881 + +, Province +Mahajanga +, + +Forêt +de Beanka + +, + +220 m + +, 18°01’25’’, 44°30’08’’, slightly disturbed dry deciduous tsingy forest, coll + +. + +V +. Soarimalala, + +17.x.2009 + + +. + + + + +Remarks +. While the anterior and posterior gonopods fit perfectly those of + +S. triaureus + +, the colour pattern of the single male, although faded due to ethanol, differs: the lateral golden band is missing, only the wider dorsal band is visible. The male has 44+0 body rings, is +43 mm +long and +3.4 mm +wide. DNA extraction for barcoding was unfortunately unsuccessful. This is a first record of the species from the Forêt de Beanka, but the species is widespread in western +Madagascar +(see Wesener & Enghoff 2009). + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFC7FFAEFF322F48D1B2F9C8.xml b/data/03/94/B5/0394B500FFC7FFAEFF322F48D1B2F9C8.xml new file mode 100644 index 00000000000..266fcb240b1 --- /dev/null +++ b/data/03/94/B5/0394B500FFC7FFAEFF322F48D1B2F9C8.xml @@ -0,0 +1,284 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Spiromimus univirgatus +de Saussure & Zehntner, 1901 + + + + + + + +Material examined +. 1 F, + + +FMNH-INS 000104232 +, + +Ankarana Reserve +, talus at base of high tsingy dry deciduous forest on limestone, +12.8635 S +, +49.1253 E +, + +138 m + +, + +4/10/2007 + + +, + +Ken Emberton +MBI-2044; 1 F + +, + + +FMNH-INS000104229 + +, +Ankarana Reserve +, talus at base of high tsingy dry deciduous forest on limestone, +12.8635 S +, +49.1253 E +, + +138 m + +, + +4/10/2007 + + +, + +Ken Emberton +MBI-2044; 1 M + +, + + +FMNH-INS 000104234 + +, N +Ankarana Reserve +, dry deciduous forest on basalt, +12.8639 S +, +49.1242 E +, + +138 m + +, + +4/10/2007 + + +, + +Ken Emberton +MBI-2042; 1 M + +, + + +FMNH-INS 000104233 + +, N +Ankarana Reserve +, small isolated tsingy dry deciduous forest on limestone, +12.8271 S +, +49.1582 E +, 29 + +5m + +, + +4/5/2007 + + +, + +Ken Emberton +MBI-2019; 1 M + +, + + +FMNH-INS 000104230 + +, N +Ankarana Reserve +, talus at base of high tsingy dry deciduous forest on lava, +12.8654 S +, +49.1261 E +, + +143m + +, + +4/10/2007 + + +, + +Ken Emberton +MBI-2046; 1 F + +, + + +FMNH-INS 000104181 + +, N +Ankarana Reserve +, dry deciduous forest on limestone, +12.8734 S +, +49.2242 E +, + +307m + +, + +4/14/2007 + + +, + +Ken Emberton +MBI-2065; 2 M, 2 F (fragmented) + +, + + +FMNH-INS 2858683 +-B + +, +Antsiranana +, +Sava +, +Nosy Ankao +, + +18 km +S of Ampisikinana + +, +Nosy Ankao Forest +, in degraded transitional dry-humid forest dominated by +Capurondendrom +, + +6 m + +, +12°42’31’’ S +, +49°49’27’’ E +, coll. +S.M. Goodman +, +pitfalls +, + +9–14.III.2016 + + +. + + + + +Remarks +. The population from Nosy Ankao is quite distant from the known area of distribution of the species (Wesener & Enghoff 2009). The colour and ring number (45) fit very well to the original description. Like the specimens from Nosy Be, the ones from Nosy Ankao are smaller than those from Ankarana (42 versus +32 mm +in male length, 3.2 versus +2.6 mm +in width). The anterior and posterior telopods, as well as the colour patter and the male anterior legs fit also to + +S. univirgatus + +. We successfully barcoded the Nosy Ankao population of + +S. univirgatus + +, but a comparison is difficult. Only sequences of two other + +Spiromimus +species + +are available: + +S. scapularis +Wesener & Enghoff 2009 + +from the NW Forêt de Binara and + +S. triaureus +Wesener & Enghoff, 2009 + +from the western dry forests. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFD1FFBBFF3229C1D04AF86F.xml b/data/03/94/B5/0394B500FFD1FFBBFF3229C1D04AF86F.xml new file mode 100644 index 00000000000..790958d1198 --- /dev/null +++ b/data/03/94/B5/0394B500FFD1FFBBFF3229C1D04AF86F.xml @@ -0,0 +1,277 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Aphistogoniulus amberivery + +sp. nov. + + + + + + +Fig. 2A–G + + + + +Material examined +. + +1 M +holotype +, + +FMNH-INS 3196506 + +, +Mahajanga +, +Sofia +, +Bemanevika +, +Amberivery Forest +, + +1570 m + +, slightly disturbed montane forest, +14°20’47.3’’ S +, +48°34’47.3’’ E +, coll. +pitfalls +, + +X.2013 + +, +S.M. Goodman +and +Toky Randriamora + +. + + +DNA barcode +: PQ307145 + + + + +Derivatio nominis. +amberivery, noun in apposition, after the +type +and only known locality of the species. + + + + +Diagnosis. +Characteristic colour with laterally entirely black body rings, which are above the ozopores dorsally bright red with a wide black posterior margin. Collum black, anterior and posterior margin with a red stripe. Head, antenna and legs black. The posterior gonopod with the shorter basal branch and the main branch with the numerous membranous fringes resembles only those of + +A. hova + +(deSaussure & Zehntner, 1897). + +A. amberivery + +differs from + +A. hova + +in fewer body rings (51 versus +54–57 in + +A. hova + +), as well as the anterior gonopod, where the retrorse process is located apically and not medially. Compared to the +lectotype +of + +A. hova + +, the sternite of the anterior gonopods of + +A. amberivery + + +sp. nov. + +is single-tipped (double-tipped in + +A. hova + +), and the retrorse process is strongly protruding above the lateral margin of the telopodite (only very slightly protruding in + +A. hova + +). + +A. amberivery + + +sp. nov. + +differs from all sampled 6 populations of + +A. hova + +in a p-distance of the COI barcoding fragment of 11–12%. + + + + +FIGURE 2. + +Aphistogoniulus amberivery + +, + +sp. nov. + +, holotype ( +FMNH-INS 3196506 +). +A +. Multi-layer photograph, male anterior body, lateral view; +B +. Multi-layer photograph, male leg pairs 1–7, ventral view; +C +. Multi-layer photograph, male posterior body end with telson; +D +. Anterior gonopod, anterior view; +E +. Anterior gonopod, posterior view; +F +. Right posterior gonopod, anterior view; +G +. Right posterior gonopod, posterior view. +Abbreviations +: Apo = apodeme; av = paraprocts; bb = basal branch of posterior gonopod; Co = collum (ring 1); Cx = coxite; fs-p = finger-shaped process; Gn = gnathochilarium; Gr = groove; mb = main branch of posterior gonopod; Md = basal joints of mandible; oz = ozopore; Pre = epiproct; rp = retrorse process; sf = setiferous foveolae; St = sternite; sub = hypoproct; T = telopodite; numbers refer to leg pair number. +Scale bars += 1 mm. + + + + +Description + + +Measurements: 51+0 body rings plus telson, circa +110 mm +long, +10.2 mm +wide. + + +Colour faded in ethanol. Body rings laterally entirely black, above ozopores dorsally bright red with a wide black posterior margin. Collum black, anterior and posterior margin with a red stripe ( +Fig. 2A +). Head, antenna and legs black ( +Fig. 2B +). Telson black, except for anal valves which have a large red spot ( +Fig. 2C +). + + +Head typical for the genus ( +Fig. 2A, B +). Antenna short, extending back to ring 4 ( +Fig. 2B +). + +Ozopore starting at ring 6, located on suture between meso- and metazonite. + +Male legs 3–7 with coxae and prefemora slightly invaginated ( +Fig. 2B +). + + +Telson without projecting preanal scale, anal valves without developed lips, subanal scale inconspicuous ( +Fig. 2C +). + + +Anterior gonopod sternite triangular, no shoulders, rounded tip ( +Fig. 2D +). Coxite process elongated, slightly shorter than telopodite ( +Fig. 2D, E +). Telopodite appendage only weakly swollen, sharp-edged retrorse process starting to project apically ( +Fig. 2E +). + + +Posterior gonopod telopodite branches forming a ‘C’ ( +Fig. 2F, G +). Basal branch stout, shorter than main branch ( +Fig. 2F +) Tips of main and basal branch distant from one another. Main branch at apically with membranous the numerous membranous fringes ( +Figs 2F, G +). Main branch slenderer but much longer than basal branch. + + + + +Ecology +. + +A. amberivery + +occurs in sympatry with two microendemic species of + +Zoosphaerium +Pocock, 1895 + +( +Sagorny & Wesener 2017 +), highlighting the only recently protected area of Bemanevika as a center of millipede endemism. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFD3FFB5FF322C9CD5F7F8AD.xml b/data/03/94/B5/0394B500FFD3FFB5FF322C9CD5F7F8AD.xml new file mode 100644 index 00000000000..d37ab2142a3 --- /dev/null +++ b/data/03/94/B5/0394B500FFD3FFB5FF322C9CD5F7F8AD.xml @@ -0,0 +1,322 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Aphistogoniulus manombo + +sp. nov. + + + + + + +Figs 3A–D +, +4A–D + + + + +Material examined +. 1 M + +holotype +, +CASTYPE 21623 +, +Province +Fianarantsoa +, + +24.5 km +SW of Farafangana + +, +Réserve Speciale Manombo +, rainforest, + +30 m + +, +23°00’57’’ S +, +47°43’08’’ E +, +Brian L. Fisher +et al. +, general collecting, + +20.iv.2006 + +. 1 M, 2 F + + +paratypes +, +CASENT 9032822 +, same data as holotype + +. + + +DNA barcode +: HQ891232 + + + + +Derivatio nominis +. manombo, noun in apposition, after the +type +locality. + + + + +Diagnosis +. Posterior gonopod of unique special shape, with a sharp-edged basal branch and an apico-mesal fringe at main branch, identifying + +A. manombo + + +sp. nov. + +as a member of the + +diabolicus + +-clade, in which it also groups based on the phylogeny of the COI barcoding gene ( +Fig. 12 +). + +A manombo + + +sp. nov. + +closely resembles + +A. jeekeli + +(Decker & + +Wesener, +2011 + +in + +Wesener +et al. +2011 + +), of which it was described originally as a subpopulation. The two species differ in colour (collum black except posterior margin versus red in + +A. jeekeli + +), a different number of body rings (50–54 versus 57 or +58 in + +A. jeekeli + +), as well as the gonopods. In + +A. manombo + + +sp. nov. + +the main branch of posterior gonopod at its apex forming a long flat plateau like a waiter holding a tablet ( +Figs 4C, D +), while the apex is folded, almost touching the basal branch in + +A. jeekeli + +. + +A. manombo + + +sp. nov. + +differs from + +A. jeekeli + +in a p-distance of the COI barcoding fragment of 11.3 % + + + + +FIGURE 3. + +Aphistogoniulus manombo + + +sp. nov. + +. +A +. Living specimen from inaturalist.org, photo taken by Prof. Nicolas Block in 2009; +B +. Living specimen from inaturalist.org, photo taken by Herindrainy Davidson; +C +. Holotype ( +CASTYPE 21623 +); +D +. Female paratype ( +CASENT 9032822 +), multi-layer photographs, taken by Rachel Diaz-Bastin, California Academy of Sciences. +Scale bars += 1 cm. + + + + +FIGURE 4. + +Aphistogoniulus manombo + + +new species + +, holotype ( +CASTYPE 21623 +), multi-layer photographs. +A +. Anterior gonopod, anterior view; +B +. Anterior gonopod, posterior view; +C +. Posterior gonopod, anterior view; +D +. Posterior gonopod, posterior view. Photos taken by Rachel Diaz-Bastin, California Academy of Sciences. +Abbreviations +: app = apical process; bb = basal branch of posterior gonopod; cp = coxite process; Cx = coxite; Lo = lobe; mb = main branch of posterior gonopod; rp = retrorse process; St = sternite; sub = hypoproct; T = telopodite; numbers refer to leg pair number. +Scale bars += 1 mm. + + + + +Description + + +Measurements. Males 53 or 54 body rings, circa +110 mm +long, +9 mm +wide. Females 50 body rings, circa +105 mm +long, +8 mm +wide. + + +Colour of head, antenna, legs and telson bright red ( +Fig. 3A–D +). Mesozonites of body rings dorsally red, ventrally black up to ozopore level. Dorsally, posterior half of metazonite black, anterior half red. Black colour spreading through full metazonite dorsally, creating an interrupted black stripe ( +Fig. 3A, B +). + + +Head typical for the genus. Antenna short, extending back to ring 3 ( +Fig. 3A, B, D +). + +Ozopore starting at ring 6, located on suture between meso- and metazonite. + +Anterior gonopod sternite triangular, no shoulders, sharp tip ( +Fig. 4A +). Coxite process elongated, as long as or slightly longer than telopodite ( +Fig. 4A, B +). Telopodite appendage swollen, sharp-edged retrorse process starting to project medially. + + +Posterior gonopod telopodite branches forming an ‘O’ ( +Fig. 4C +). Tips of main and basal branch close to but not touching one another. Main branch at mesal margin and apically with membranous folds, tip forming a long flat plateau like a waiter holding a tablet ( +Fig. 4D +). Main branch slenderer and shorter than basal branch. Basal branch along its length of equal width, but tapering into sharp apex ( +Fig. 4C, D +); mesally with rectangular lobe ( +Fig. 4D +). + + + + +Ecology +. + +A. manombo + + +sp. nov. + +occurs in sympatry with a microendemic, gigantic species of giant pill-millipede of the genus + +Sphaeromimus +de Saussure & Zehntner, 1902 + +, + +S. titanus +Wesener, 2014 + +( + +Wesener +et al. +2014 + +), highlighting the only recently protected area of Manombo as a center of millipede endemism. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFDAFFADFF322FFDD595FC8C.xml b/data/03/94/B5/0394B500FFDAFFADFF322FFDD595FC8C.xml new file mode 100644 index 00000000000..c6f745cec1b --- /dev/null +++ b/data/03/94/B5/0394B500FFDAFFADFF322FFDD595FC8C.xml @@ -0,0 +1,313 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +? +Eucarlia tampolo + +sp. nov. + + + + + + +Fig. 10A–H + + + + +Material examined +. + +Holotype +: 1 M, + +FMNH-INS 7796 + +, +Toamasina +, +Station Forestiere de Tampolo +, + +10 m + +, +17°17.2’ S +, +49°24.5’ E +, coll. +S.M. Goodman +, +pitfalls +, + +3–16.iv.1997 + +. + + + + +Paratypes +: 4 M (mature?), 5 F, + +FMNH-INS 7796 + +, same data as holotype + +. + + + + +Derivatio nominis +. tampolo, noun in apposition, after the littoral forest of Tampolo, the +type +and only known locality of the species. + + + + +Diagnosis +.? + +Eucarlia tampolo + + +sp. nov. + +shares the presence of a strong transverse ridge across the mentum, separating a basal, transversely striate part and an apical, smooth part, which is recessed when the gnathochilarium is viewed from below ( +Fig. 10A +) with species of the genera + +Flagellobolus +Wesener, 2009 + +, + +Riotintobolus +Wesener, 2009 + +, + +Pseudocentrobolus +Wesener, 2009 + +, + +Granitobolus +Wesener, 2009 + +, + +Caprobolus +Wesener, 2009 + +, + +Alluviobolus +Wesener, 2009 + +, + +Ostinobolus +Wesener, 2009 + +and +Zehnterobolus +Wesener, 2009. Sperm canal of posterior gonopod apically free ( +Fig. 10H, I +), like in species of + +Flagellobolus + +and + +Caprobolus + +, but differs from all known Malagasy +Spirobolida +species in the combination of a simple wide anterior gonopod lacking projections or processes ( +Fig. 10F, G +)) with a special shape of the posterior gonopod ( +Figs 10H, I +). + + + + +Description + + +Measurements: All 43+0 rings. Male +holotype +38 mm +long, 3.2 wide. Largest female circa +46 mm +long, +4.8 mm +wide. Habitus small and slender, body rings like + +Granitobolus +Wesener, 2009 + +, thick. + +Colour strongly faded, mesozonites dark, metazonite white. Collum dark except for posterior margin. Anal scale and part of anal valves white, rest of telson black. Legs and antennae whitish. + +Head: Eyes very large, male eyes with 35 ommatidia, arranged in 7 rows, female similar. Antennae short, male antennae reaching back to third, female to second ring. Mandible basal joint without projection. Gnathochilarium with ridge, stipites each with three marginal setae, lamellae linguales each with two setae located behind one another ( +Fig. 10A +). Female leg 1 with fused coxo-sternite ( +Fig. 10B +), leg 2 also with coxo-sternite, coxal part elongated ( +Fig. 10C +). Legs 8+ in both sexes at each podomere, except tarsus, with single ventral spine. Tarsus in male ( +Fig. 10D +) with tarsal pad (except for posterior legs) and a pair of ventral spines. Claw large, apical spine quite small ( +Fig. 10D +). + + + +FIGURE 10. +? + +Eucarlia tampolo + +, + +sp. nov. + +, holotype ( +FMMC 7796 +), drawings. +A +. Gnathochilarium, ventral view; +B +. Coxosternite of female leg 1, posterior view; +C +. Coxosternite of female leg 2, posterior view; +D. +Male midbody leg, posterior view; +E +. Posterior body end with telson, lateral view; +F +. Anterior gonopod, anterior view; +G +. Anterior gonopod, posterior view; +H +. Right posterior gonopod, tip, anterior view; +I +. Right posterior gonopod, posterior view. +Abbreviations +: av = paraprocts; Cx = coxa; Cx-St = coxosternite; cx = coxite; Fe = femur; L = ledge on mentum of gnathochilarium; LL = lamella linguales; main = main branch of posterior telopod; Me = mentum; mes = mesal branch of posterior gonopod; pre = epiproct; Pre = prefemur; Po = postfemur; st = sternite; St = stipites; sub = hypoproct; t = telopodite; Ta = tarsus; ta-p = tarsal pad; Ti = tibia; Vu = vulva. +Scale bars += 1 mm. + + + +Ozopores starting at ring 6, located on or even posterior of suture ( +Fig. 10E +). + + +Telson without projecting preanal scale, inconspicuous subanal scale, anal valves with weak lips ( +Fig. 10E +). + +Vulvae bivalve-like, posterior valve slightly overlapping anterior valve. +Male coxae 3–7 unmodified, but tarsi 3 - midbody legs with a tarsal pad. + +Anterior gonopods sternite well-rounded, not protruding as high as coxite process ( +Fig. 10F +). Sternal apodemes ( +Fig. 10F +) short. Coxite wide, projecting mesally into a wide, broadly-rounded process ( +Fig. 10F +), tip of process slightly overreaching telopodite process mesally but not apically ( +Fig. 10G +). Telopodite apically expanding into a wide, well-rounded process, process almost as wide as base of telopodite ( +Fig. 10G +). + + +Posterior gonopod clearly separated into coxite and telopodite, with coxite greatly extended and longer than telopodite ( +Fig. 10I +). Sternite small but sclerotized, triangular ( +Fig. 10I +). Coxite mesally with a single groove, elongated into a long stem ( +Fig. 10I +). Telopodite long, but shorter than elongated coxite ( +Fig. 10I +), basally deeply divided into two branches, main branch and mesal branch, both curved mesally ( +Fig. 10I +). Main branch slender on whole length, apical part slightly slenderer than basal 3/4, with well-rounded tip weakly curved towards mesal branch, sclerotized. Mesal branch with basal half sclerotized, apical half twice as wide as basal half and membranous ( +Fig. 10H +). Tip of mesal branch with two openings of the sperm canal ( +Fig. 10I +), the upper canal strongly and freely projecting mesally from membranous part of branch ( +Fig. 10H +). + + + + +Remarks +. The littoral forest of Tampolo is currently also the only known locality of the critically endangered Tampolo giant pill-millipede + +Zoosphaerium tampolo +Wesener, 2009 + +( +Rudolf & Wesener 2017c +). + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFDAFFB3FF322E61D45DFC3C.xml b/data/03/94/B5/0394B500FFDAFFB3FF322E61D45DFC3C.xml new file mode 100644 index 00000000000..c7a1756486d --- /dev/null +++ b/data/03/94/B5/0394B500FFDAFFB3FF322E61D45DFC3C.xml @@ -0,0 +1,95 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + +Genus + +Eucarlia +Brölemann, 1913 + + + + + + + +Remarks. +The status of the genus + +Eucarlia + +is still unresolved since the transfer of the four species known from the +Seychelles +to the Asian genus ( +Golovatch & Korsós 1992 +). The +variety shown +by the different + +Eucarlia +species + +in their anterior and posterior gonopods ( +Golovatch & Gerlach 2010 +) indicates that more than one genus might be hiding behind the name. The species described below is the first record of the genus from +Madagascar +. The assignment of the new species to + +Eucarlia + +is tentative at best, given the unclear definition of the genus. However, as the only other alternative would be the description of a new monotypic genus—already the 16th of the family +Pachybolidae +known from +Madagascar +, the species described below is tentatively placed in + +Eucarlia + +. + + + + \ No newline at end of file diff --git a/data/03/94/B5/0394B500FFDDFFB3FF322CD4D249FD80.xml b/data/03/94/B5/0394B500FFDDFFB3FF322CD4D249FD80.xml new file mode 100644 index 00000000000..c84f232c1b9 --- /dev/null +++ b/data/03/94/B5/0394B500FFDDFFB3FF322CD4D249FD80.xml @@ -0,0 +1,641 @@ + + + +Five new species and numerous locality records of Spirobolida millipedes from Madagascar (Diplopoda, Spirobolida, Pachybolidae) + + + +Author + +Wesener, Thomas + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +461 +486 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.3 + +journal article +10.11646/zootaxa.5529.3.3 +1175-5326 +14022748 +716EDF67-C933-484D-911B-4585B11187A6 + + + + + + + +Alluviobolus omega + +sp. nov. + + + + + + +Figs 5–9 + + + + +Material examined +. + +Holotype +: 1 M, + +FMNH-INS 5458 + +, +Madagascar +, +Province +Toliara +, + +Forêt +de Vohibasia + +#3, + +59 km +NE Sakaraha + +, tropical dry forest, + +780 m + +, +22°27.5’ S +, +044°50.5’ E +, coll. +S. Goodman +, + +10–16.i.1996 + +. + + + + +Paratypes +: 1 F, + +FMNH-INS 5458 + +, same data as holotype; 3 M, 1 F + +, + + +FMNH-INS 5462 + +, +Province de Toliara +, +Forêt de Vohibasia +, + +59 km +NE Sakaraha + +, + +780 m + +, +22°27.5’ S +, +44°50.5’ E +, leg. +S. Goodman +, + +10–16.i.1996 + + +; 1 M, + + +FMNH-INS 5403 + +, +Province de Toliara +, +Forêt de Vohibasia +, + +59 km +NE Sakaraha + +, + +780 m + +, +22°27.5’ S +, +44°50.5’ E +, coll. +S.M. Goodman +, + +10.i.1996 + + +. + + +Other material: 1 M, + + +FMNH-INS 5396 + +, +Province de Toliara +, +Forêt de Vohimena +, + +35 km +SE Sakahara + +, + +780 m + +, +22°41.0’ S +, +44°49.8’ E +, coll. +S.M. Goodman +, +pitfalls +, + +17–24.i.1996 + + +; 10 M, 2 F, + + +CAS +BLF 7381 + +, +Madagascar +, +Province +Fianarantsoa +, +Forêt d’Analalava +, + +29.6 km +280° W Ranohira + +, tropical dry forest, + +700 m + +, +22°35’30” S +, +045°07’42” E +, coll. +Fisher +, +Griswold +et al. +, +pitfall trap +, + +1–5.ii.2003 + + +; 1 M, + + +CAS +BLF 7306 + +, +Madagascar +, +Province +Fianarantsoa +, +Parc National d’Isalo +, + +9.1 km +354°N Ranohira + +, gallery forest, + +725 m + +, +22°28’54” S +, +045°27’42” E +, coll. +Fisher +, +Griswold +et al. +, +pitfall trap +, + +27–31.i.2003 + + +. + + + + +Derivatio nominis +. omega, noun in apposition, after the last letter of the Greek alphabet.The posterior gonopods resemble the letter “Z”, the last letter in our Lain alphabet. + + + + +FIGURE 5. + +Alluviobolus omega + +, + +sp. nov. + +, paratype what ( +FMMC 5403 +), multi-layer photographs. +A +. Male anterior body, lateral view; +B +. Male leg pairs 1–7, ventral view; +C +. Male posterior body end with telson; +D +. Anterior gonopod, anterior view; +E +. Anterior gonopod, posterior view; +F +. Posterior gonopod, anterior view; +G +. Posterior gonopod, posterior view. +Abbreviations +: a = spinose membranous area; Apo = apodeme; av = paraprocts; b= lateral opening of the sperm canal; bb = basal branch of posterior gonopod; c = membranous fringe below the apex; Co = collum (ring 1); Cx = coxite; d = large membranous area located mesally; Gn = gnathochilarium; h = ‘hole’-like structure on the posterior gonopod; Md = basal joints of mandible; oz = ozopore Pre = epiproct; sf = setiferous foveolae; sg = spermatic groove; St = sternite; sub = hypoproct; t = telopodite; numbers refer to leg pair number. +Scale bars += 1 mm. + + + + +FIGURE 6. + +Alluviobolus omega + +, + +sp. nov. + +, holotype ( +FMMC 5458 +), drawings. +A +. Anterior gonopod, anterior view; +B +. Anterior gonopod, posterior view; +C +. Posterior gonopod, tip, anterior view; +D +. Posterior gonopod, tip, posterior view; +E +. Posterior gonopod, base, posterior view; +F. +Male midbody leg, posterior view; +G +. Female midbody leg, posterior view. +Abbreviations +: a = spinose membranous area; b= lateral opening of the sperm canal; bb = basal branch of posterior gonopod; c = membranous fringe below the apex; Cx = coxite; d = large membranous area located mesally; Fe = femur; fs-p = finger-shaped process; Gr = groove; h = ‘hole’-like structure on the posterior gonopod; Pre = prefemur; Po = postfemur; sg = spermatic groove; St = sternite; t = telopodite; Ta = tarsus; Ti = tibia. +Scale bars += 1 mm. + + + + +Diagnosis +. The gnathochilarium with the division of the mentum and the sclerotized ledges on the stipites and mentum identify this species a member of a group uniting several genera of small-bodied Malagasy +Pachybolidae +(see + +Wesener +et al. +2009a + +). This species is placed in the genus + +Alluviobolus + +because of the posterior telopods, in which the coxite and telopodite are clearly separated, the telopodite with a torsion so that the opening of the spermatic groove (or sperm channel) discharges apico-laterally. + +A. omega + + +sp. nov. + +differs strongly from the other three + +Alluviobolus +species + +distributed in the SE of +Madagascar +: the anterior telopod has a weaker telopodite process, the posterior telopod is unique, almost resembling the letter ‘Z’ with a hole in anterior view and numerous large membranous folds apico-mesally. + + + + +FIGURE 7. + +Alluviobolus omega + +, + +sp. nov. + +, paratype ( +FMMC 5462 +), SEM. +A +. Left antenna, overview; +B +. Left antenna, antennomeres 5–7, apical view; +C +. Fine structures between antennomere 6 and 7. +Abbreviations +: A1–A7 = antennomeres 1–7; ac = apical cones; d = antennal disc; sb = sensilla basiconica. + + + + +Description + + +Measurements: +holotype +male with 45+0 body rings, ca. +36 mm +long, midbody rings +3.1 mm +wide. Other males with 45 or 46+0 body rings, length up to +39 mm +, midbody ring width up to +3.4 mm +. Females larger, large +paratype +female with eggs ca. +56 mm +long, at midbody rings +5.1 mm +wide, with 46+0 body rings. + + +Colour: Head and collum black, only on margins red ( +Fig. 5A +), legs, antennae ( +Fig. 5B +) and anal valves ( +Fig. 5C +) red. Telson and body black, dorsally with a thin red stripe. + + +Head:Eyes with 30 ommatidia arranged in 4–5 rows ( +Fig.5A +).Antennae, length of antennomeres1<<2>3>4>5=6 ( +Fig 7A +), with fields on sensilla basiconica on 5th and 6th ( +Figs 7B, C +), 4 apical cones ( +Fig. 7B +). Antennae in male long, reaching back to 5th body ring ( +Fig. 5A +), in female much shorter, protruding back to body ring 2. Head with 2/2 labral grooves and 2/2 setae on lamellae linguales of gnathochilarium ( +Fig. 5A +). Gnathochilarium with a mentum divided by a suture, stipites each with three apical setae ( +Fig. 8A +). Central pads of gnathochilarium with two sets of sensory cones, one rounded spot with 6 or 7 located more apically and an oval field with cones in 3–4 rows closer to the endochilarium ( +Fig. 8B +). Mandible with a 3-combed inner tooth, pectinate lamellae with teeth in 5–6 rows, molar plate relatively small, with 6 ridges ( +Fig. 8C +). + + + +FIGURE 8. + +Alluviobolus omega + +, + +sp. nov. + +, paratype ( +FMMC 5462 +), SEM. +A +. Gnathochilarium underside; +B +. Gnathochilarium, detail of central pads; +C +. Right mandible; +D +. Female midbody leg, overview; +E +. Female midbody leg, detail of tarsus; +F. +Right female vulva, mesal view. +Abbreviations +: 3iT = 3-combed inner tooth; as = apical spine; av = anterior orientated plate; cl = claw; cp = central pads; Cx = coxa; Endo = endochilarium; eP = lateral palpi; eT = external tooth; Fe = femur; iP = inner palpi; LT = lateral tooth; mp = molar plate; O = operculum; pL = pectinate lamellae; Po = postfemur; Pre = prefemur; pv = posterior orientated plate; vs = ventral spine; Ta = tarsus; Ti = tibia. + + + +Ozopore starting at 6th ring ( +Fig. 5A +), located on suture between meso- and metazonite ( +Figs 5C +, +9B +). + + +Legs in both sexes long, longer than width of body rings ( +Fig. 6F, G +). Male legs without tarsal pads ( +Figs 6F +, +8D, E +). Male legs 3–5 with cylindrical coxa processes, tip broadly rounded. Process of coxae 3 and 4 bent posteriorly, 3rd tip protruding to 4th, 4th tip protruding to 5th coxa. 5th coxa process not bent, short. 6th and 7th coxae flat & broad ( +Fig. 5B +). Legs 8+ in male with a cylindrical, basally tapering coxa, femur longest podomere, length of podomeres: coxa <prefemur<femur>postfemur>tibia<tarsus, tarsus as long as prefemur. Each podomere in both sexes with an apical spine ( +Fig. 6F, G +). Male tarsus with short sharp claw with small paronychium ( +Fig. 8D, E +), single short apical spine above claw ( +Figs 6F +, +8E +) and 5 or 6 short ventral spines. Female leg similar to male leg, with four ventral spines ( +Fig. 6G +). + + +Anal valves not invaginated. No pre-anal processes ( +Fig. 5C +). + + + +FIGURE 9. + +Alluviobolus omega + +, + +sp. nov. + +, population from Vohimena ( +FMMC 5396 +), multi-layer photographs. +A +. Male anterior body, lateral view; +B +. Midbody rings, lateral view; +C +. Male leg pairs 1–7, ventral view; +D +. Male posterior body end with telson; +E +. Anterior gonopod, anterior view; +F +. Anterior gonopod, posterior view; +G +. Right posterior gonopod, anterior view; +H +. Right posterior gonopod, posterior view. +Abbreviations +: a = spinose membranous area; av = paraprocts; b= lateral opening of the sperm canal; bb = basal branch of posterior gonopod; c = membranous fringe below the apex; Co = collum (ring 1); Cx = coxite; d = large membranous area located mesally; Gn = gnathochilarium; h = ‘hole’-like structure on the posterior gonopod; Md = basal joints of mandible; Me = mesozonite; Mt = metazonite; oz = ozopore; pe = pseudopenis; Pre = epiproct; sf = setiferous foveolae; sg = spermatic groove; St = sternite; sub = hypoproct; t = telopodite; numbers refer to leg pair number. +Scale bars += 1 mm. + + + +Female vulva simple, bivalve-like, with a small, poorly sclerotized operculum at base ( +Fig. 8F +). Posterior valve apically overlapping part of anterior one. Basally on each valve towards opening with two or three rows of setae + + +Anterior gonopods massive and wide ( +Figs 5D, E +, +6A, B +). Median sternal projection triangular and elongated with a well-rounded, rectangular tip ( +Figs 5D, E +, +6A, B +). Sternal process always far longer than coxite and telopodite, except for telopodite process. Coxite process weakly developed, broadly rounded mesally and barely visible behind massive sternite ( +Fig. 6A, B +). Telopodite mesally with a slender, apically tapering process ( +Figs 5D, E +, +6A, B +). Tip with a small, sharp-edged, retrorse process ( +Fig. 6B +). + + +Posterior gonopods +in situ +almost completely covered by coxite and telopodite of anterior gonopod. Coxite and telopodite of posterior gonopod clearly separated, with telopodite located at different level and angle than coxite ( +Figs 5F, G +). Sternite sclerotized and well-visible ( +Figs 5G +, +6E +). Coxite mesally with a single groove,protruding into a short stem towards telopodite. Telopodite longer than coxite, curved posteriorly ( +Figs 5F, G +, +6 C–E +). Telopodites arranged parallel to one another. A torsion present in telopodites, sperm canal discharging apico-laterally ( +Fig. 5F, + + +G), telopodites resembling the letter ‘Z’. Telopodite in anterior view centrally with a ‘hole-like’ structure ( +Fig. 6C +), apex with four specific areas labelled a–d: (a) is a spinose membranous area, (b) the lateral opening of the sperm channel, (c) a membranous fringe below the apex and (d) a large membranous area located mesally ( +Fig. 6C, D +). + + + + +Distribution +. Intermediate rain-dry forests ( +Moat & Smith 2007 +) in Vohibasia, Isalo and Vohimena. + + +Intraspecific variation +. The three populations at Vohibasia, Isalo and Vohimena differ from one another slightly in their size, ring number and gonopods. The population from Vohimena has 47 body rings, differs slightly in the colour pattern ( +Fig. 9A, B +), missing a coxal processes on male coxa 5 ( +Fig. 9C +), and in a completely red telson ( +Fig. 9D +). The anterior ( +Fig. 9E, F +) and posterior gonopods ( +Fig. 9G, H +) appear very similar to those of the +type +series from Vohibasia. Future studies should elucidate if these are three different species, like what was observed in the giant pill-millipede genus + +Zoosphaerium + +, where similar but distinct species can be found in Vohibasia, Isalo and Vohimena (Wesener 2009; +Wesener & Anilkumar 2020 +). + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082240684DFF30FAE0DE91CB8B.xml b/data/03/9F/21/039F21082240684DFF30FAE0DE91CB8B.xml new file mode 100644 index 00000000000..93352b05df4 --- /dev/null +++ b/data/03/9F/21/039F21082240684DFF30FAE0DE91CB8B.xml @@ -0,0 +1,264 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.16. + +Gyrophaena +(s.str.) +williamsi +A. +Strand, 1935 + + + + + + +( +Figs 257–259 +, +309 +) + + + + + + + +Gyrophaena williamsi +A. +Strand, 1935: 402 + + +. + + + + + + +Material examined. + +JEWISH +AUTONOMOUS AREA + +: + + +4 ♂♂ +, +8 ♀♀ +: +Pashkovo. + +3.VII.1977 + +. +A.B. Ryvkin +leg. (cIE, +ZMM +) + +; + + +AMUR +AREA + +: + + +4 ♂♂ +, +3 ♀♀ +: +Zeyskiy District +, +Zeyskiy Nature Reserve +, near +Tyoplyi Klyutch +kordon, +53.85613°N +127.36116°E +. + +368 m +a.s.l. + +, steep rocky fold: in gill fungi. + +24.VIII.2016 + +. +A.B. Ryvkin +leg. ( +ZMM +. cIE) + +; + + +KHABAROVSK +TERRITORY + +: +1 ♂ +, +1 ♀ +: +Komsomol’skiy District + +, + +Amur +River +, environs of Komsomol’sk-na-Amure, +Pivan’ +, +50º31,5’N +137º03,9’E +. + +40 m +a.s.l. + + +5.VIII.2014 + +. +V + +.K. Zinchenko leg. (cIE); + + +MARITIME PROVINCE + +: +5 ♂♂ +, +9 ♀♀ +: +Ussuriyskiy District +, +Ussuriyskiy Nature Reserve +, +Komarova +kordon, +43º39.220’N +132º24.728’E +. +In + +Tricholomopsis decora +(Fr.) Singer. + + +6.VIII.2021 + +. +Yu.A. Rebriev +leg. ( +FEB +, cIE) + +. + + + + +Distribution. + +Gyrophaena +(s.str.) +williamsi + +is a widely distributed Transpalaearctic species. The distribution of the species in Eastern Siberia and Far Eastern +Russia +is shown in +Fig. 309 +. + + + + +Remarks +.Habitus as in +Fig. 257 +. Aedeagus as in +Fig. 258 +. Male abdominal tergite VIII as in +Fig. 259 +. + + +The species is here recorded from Far Eastern +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082240684DFF30FE6CDF96C909.xml b/data/03/9F/21/039F21082240684DFF30FE6CDF96C909.xml new file mode 100644 index 00000000000..72a6f00b907 --- /dev/null +++ b/data/03/9F/21/039F21082240684DFF30FE6CDF96C909.xml @@ -0,0 +1,319 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.15. + +Gyrophaena +(s.str.) +triquetra +Weise, 1877 + + + + + + +( +Figs 253–256 +, +308 +) + + + + + + + +Gyrophaena triquetra +Weise, 1877: 91 + + +; + +Kim & Ahn 2010: 335 + +, 2014: 192, + +Glotov 2022: 382 + +. + + + + + + +Gyrophaena sunanica +Pasńik, 2001: 191 + + +. + + + + + + +Gyrophaena flammula +Pace, 2007: 111 + + +. + + + + + +Material examined. + + +MARITIME PROVINCE +: + +1 ♂ +: +Ussuriyskiy District +, +Gorno-Tayozhnoye +, +43º41.680’N +132º08.378’E +. +In + +Crepidotus calolepis +(Fr.) P. Karst. + + +27.VIII.2021 + +. +Yu.A. Rebriev +leg. (cIE) + +; + +1 ♂ +: +Kamenushka +, +43º37.532’N +132º14.550’N +. +In + +Lentinula edodes +(Berk.) Pegler. + + +28.VIII.2021 + +. +Yu.A. Rebriev +leg. ( +MSPU +) + +. + + + + +Distribution +. + +Gyrophaena +(s.str.) +triquetra + +is eastern Palaearctic species known from Far Eastern +Russia +( +Maritime Province +( +Fig. 308 +)), +North Korea +, +Japan +and +China +. + + + + +Remarks +. +Paśnik (2001) +described + +G. sunanica + +from +North Korea +. +Kim &Ahn (2010) +synonymized + +G. sunanica + +with + +G. triquetra + +. +Pace (2007) +described + +G. flammula + +from +Taiwan +. +Glotov (2022) +studied the +type +material of + +G. sunanica + +, + +G. triquetra + +and + +G. flammula + +, synonymized + +G. flammula + +with + +G. triquetra + +, and confirmed the previously established synonymy of + +G. sunanica + +. Among all known species of the + +affinis + +group, + +G. triquetra + +is most similar to + +G. rousi +Dvořák 1966 + +. Based on the general structure of aedeagus (three-lobe ventral plate and long, filiform internal sac), + +G. triquetra + +is similar to the Taiwanese + +G. taiwanensis +Pace 2007 + +, + +G. minimonstruosa +Pace 2007 + +and + +G. pulli +Pace 2007 + +(see original descriptions in +Pace 2007 +). It can be easily distinguished from them by details of the morphology of the aedeagus and the different shape of the male abdominal tergite VIII. + + +Habitus as in +Fig. 253 +. Aedeagus as in +Fig. 254 +. Male abdominal tergite VIII as in +Fig. 255 +. Male abdominal sternite VIII as in +Fig. 256 +. + + +It is here recorded from +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082241684DFF30FA84DE1FCD85.xml b/data/03/9F/21/039F21082241684DFF30FA84DE1FCD85.xml new file mode 100644 index 00000000000..64c9311f8c3 --- /dev/null +++ b/data/03/9F/21/039F21082241684DFF30FA84DE1FCD85.xml @@ -0,0 +1,504 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.14. + +Gyrophaena +(s.str.) +pulchella +Heer, 1839 + + + + + + +( +Fig. 307 +) + + + + + + + +Gyrophaena pulchella +Heer, 1839: 310 + + +. + + + + + + +Gyrophaena glabrella +Motschulsky, 1858: 229 + + +. + + + + + +Material examined. + + +AMUR +AREA + +: +7 ♂♂ +, +4 ♀♀ +: +Skovorodinskiy District +, left side of +Urka River +, + +4 km +N Yerofey Pavlovich + +, +54°00’40,89’’N +121°57’43,75’’E +. + +525 m +a.s.l. + +, in + +Lyophyllum fumosum +(Fr.) P.D. Orton. + + +27.VIII.2014 + +. I + +. + +V +. +Enushchenko +& A + +. +V +. +Shavrin +leg. ( +FEB +, cIE); + +12 ♂♂ +, +21 ♀♀ +: same data. +In + +Clitocybe odora + +. + +28.VIII.2014 + +. ( +ZMM +, cIE) + +; + +2 ♀♀ +: same data. +In + +Lyophyllum ulmarium + +. + +28.VIII.2014 + +. I + +. + +V +. +Enushchenko +& A + +. +V +. +Shavrin +leg. (cIE); + +7 ♂♂ +, +2 ♀♀ +: same data, + +8 km +N Yerofey Pavlovich + +, +54°02’24,84’’N +121°58’30,69’’E +. + +552 m +a.s.l. + +, in + +Hebeloma mesophaeum + +. + +31.VIII.2014 + +. (cIE) + +; + +11 ♂♂ +, +9 ♀♀ +: same data, + +13 km +N Yerofey Pavlovich + +, +54°03’49,37’’N +121°58’37,69’’E +. + +556 m +a.s.l. + +, in + +Clitocybe +sp. +1 + +.IX.2014. (cIE) + +; + +1 ♂ +: +Selemdzhinskiy District +, +Norskiy Reserve +, +Nora River +basin near +Maltsevskiy +kordon. +In +geophilous gill fungus. + +29.VIII.2004 + +. +A.B. Ryvkin +leg. ( +ZMM +) + +; + +5 ♂♂ +, +6 ♀♀ +: same +Reserve +, +Nora River +, near +Meunskiy +kordon, mouth of +Meun River +. + +250 m +a.s.l. + +, in white geophilous gill fungus. + +17.IX.2008 + +. +E.M. Veselova +& +A.B. Ryvkin +leg (cIE) + +; + +7 ♂♂ +, +14 ♀♀ +: same +Reserve +(buffer zone), +Burunda River +basin, + +4.5 km +NW of Burunda + +kordon. +In +geophilous gill fungi. + +14.IX.2004 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + +8 ♂♂ +, +39 ♀♀ +: same data, + +2 km +SE of Burunda + +kordon. +In +geophilous gill fungi. + +26.09.2004 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + +2 ♀♀ +: +Mazanovskiy District +, right side of +Selemdzha River +between +Nora River +mouth and Ust’- +Norskaya mountain +, +Lodochnikova +channel. + +215-230 m +a.s.l. + +, in geophilous gill fungi. + +11.VIII.2006 + +. +E.M. Veselova +& +A.B. Ryvkin +leg. ( +ZMM +) + +; + + +KHABAROVSK +TERRITORY: + +1 ♂ +: +Verkhnebureinskiy District +, +Dublikanskiy Nature Refuge +, right side of +Dublikan River +, +1.5 km +below kordon. + +320 m +a.s.l. + +, in geophilous and epigenous fungi in flood-plain. + +24.VIII.2008 + +. +A.B. Ryvkin +leg. ( +ZMM +) + +; + + +SAKHALIN +AREA +: + +4 ♂♂ +, +1 ♀ +: environs of +Tret’ya Pad’ +, valley of +Plastinikha (Pastushka) River +, +46º42’04’’N +142º45’44’’E +. + +VII.2003 + +. I + +. +V +. +Mel’nik +leg. (cIE); + + +MARITIME PROVINCE +: + +1 ♂ +, +1 ♀ +: +Petrov Island +, +42°52’47’’N +133°48’25’’ E +. + +26.IX.1934 + +. +A.M. +D’yakonov leg. ( +ZIN +) + +. + + + + +Distribution. + +Gyrophaena +(s.str.) +pulchella + +is a widely distributed Transpalaearctic species. The distribution of the species in Eastern Siberia and Far Eastern +Russia +is shown in +Fig. 307 +. + + + + +Remarks +. For illustrations of the species see + +Figs +58–60 + +in +Enushchenko & Semenov (2016) +. + + +It is here recorded from Far Eastern +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082243684FFF30F935DE28CE31.xml b/data/03/9F/21/039F21082243684FFF30F935DE28CE31.xml new file mode 100644 index 00000000000..ee01fd56071 --- /dev/null +++ b/data/03/9F/21/039F21082243684FFF30F935DE28CE31.xml @@ -0,0 +1,307 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.17. + +Gyrophaena +(s.str.) +zhagaensis +PaCe, 2003 + + + + + + +( +Figs 260–264 +, +310 +) + + + + + + + +Gyrophaena zhagaensis +Pace, 2003: 643 + + +; + +Pace 2010: 129 + +. + + + + + + +Gyrophaena peniculi +Pace, 2007: 117 + + + +syn +. +nov. + + + + + + +Material examined +. + + +MARITIME PROVINCE + +: +1 ♂ +: +Spasskiy District +, +Siniy Mts. +, + +4 km +E Evseyevka. + + +7–9.VIII.1999 + +. A. +V + +. +Shavrin +leg. ( +MSPU +); + +1 ♂ +: +Khasanskiy District +, +Cheryomukhovaya River +, +15 km +down of +Cheremshan +, +Kedrovaya +Pad` +Stream. + +21.VII.1986 + +. +V + +. + +Zherikhin +& +V + +. Grachev leg. (cIE); + +1 ♂ +: +Lazovskiy District +, +Lazo +, + +18.IX.2009 + +. +S.A. Shabalin +leg. (cIE) + +. + + + + +Distribution. +The eastern Palaearctic + +Gyrophaena +(s.str.) +zhagaensis + +is known from Far Eastern +Russia +( +Maritime Province +( +Fig. 310 +)), +China +( +Hubei +, +Shaanxi +, +Sichuan +) and +Taiwan +. + + + + +Remarks +. + +Gyrophaena zhagaensis +Pace, 2003 + +was originally described from +China +( +Sichuan +, +Shaanxi +) and was compared with the Nepalese + +G. narendra +Pace, 1989 + +. Later, +Pace (2010) +recorded + +G. zhagaensis + +from +Sichuan +, +Hubei +and +Shaanxi +. + +Gyrophaena peniculi + +was originally described from +Taiwan +. The shape of the aedeagus and the male abdominal tergite VIII from Maritime Province (see above) are similar to these in + +G. zhagaensis + +( + +Figs +77–80 + +in +Pace 2003 +) and + +G. peniculi + +( + +Figs +79–82 + +in +Pace 2007 +). Thus, the latter species is here synonymized with + +G +. +zhagaensis + +. + + +Habitus as in +Fig. 260 +. Aedeagus as in +Fig. 261 +. Paramere as in +Fig. 262 +. Male abdominal tergite VIII as in +Fig. 263 +. Male abdominal sternite VIII as in +Fig. 264 +. + + +The species is here recorded from +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082245684AFF30F8DFDE2FCDA1.xml b/data/03/9F/21/039F21082245684AFF30F8DFDE2FCDA1.xml new file mode 100644 index 00000000000..8a66bb1b8bc --- /dev/null +++ b/data/03/9F/21/039F21082245684AFF30F8DFDE2FCDA1.xml @@ -0,0 +1,364 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.10. + +Gyrophaena +(s.str.) +permixta +PaCe, 2003 + + + + + + +( +Figs 242–249 +, +303 +) + + + + + + + +Gyrophaena permixta +Pace, 2003: 629 + + +; + +Pace 2010: 130 + +. + + + + + + +Gyrophaena bifurcata +Assing, 2005: 30 + + + +syn +. +nov. + + + + + + +Material examined. + + +MARITIME PROVINCE + +: +1 ♂ +: +Lazovskiy District +, +Lazo. + +18.IX.2009 + +. +S.A. Shabalin +leg. (cIE) + +; + +5 ♂♂ +, +5 ♀♀ +: +Oktyabr’skiy District +, environs of +Vladimirovka. In + +Pleurotus pulmonarius +(Fr.) Sacc. + + + +5. +VI +.2010 + + +. +S.A. Shabalin +leg. ( +ZMM +, cIE) + +; + +3 ♂♂ +: +Pozharskiy District +, +Anisimovka +, +Gribanovka +hostel, +43°06.195’N +132°46.975’E +. +In + +Armillaria +sp. +1 + +.IX.2021. +Yu.A. Rebriev +leg. (cIE) + +; + +1 ♂ +: +Anisimovka +, +Klyuch Smol’nyi Stream +, +43°07.44’N +132°45.626’E +. +In + +Lepiota +sp. +3 + +.IX.2021. +Yu.A. Rebriev +leg. (cIE) + +; + +6 ♂♂ +, +5 ♀♀ +: same data, +43°06.430’N +132° 45.863’E +. +In + +Pholiota +sp. + +( +FEB +, cIE) + +; + +6 ♂♂ +, +9 ♀♀ +: +Ussuriyskiy District +, +Kamenushka +, +43°35.920’N +132°13.767’E +. +In + +Crepidotus calolepis +(Fr.) P. Karst. + + +29.VIII.2021 + +. +Yu.A. Rebriev +leg. ( +ZMM +, cIE) + +. + + + + +Distribution. +The eastern Palaearctic + +Gyrophaena +(s.str.) +permixta + +is known from Far Eastern +Russia +( +Maritime Province +( +Fig. 303 +)) and +China +( +Heilongjiang +, +Jilin +, +Sichuan +, +Yunnan +) + + + + +FIGURES 242–249. + +Gyrophaena +(s.str.) +permixta + +: 242—habitus, 243—aedeagus, lateral view, 244—paramere, 245—male abdominal tergite VIII, 246—male abdominal sternite VIII, 247—female abdominal tergite VIII, 248—female abdominal sternite VIII, 249—spermatheca. Scale bars: 1.0 mm (Fig. 242), 0.1 mm (Figs 243–249). + + + + +Remarks +. + +Gyrophaena permixta + +was originally described from +Sichuan +, +China +. Later, +Pace (2010) +recorded it from northern +Yunnan +. + +Gyrophaena bifurcata + +was originally described from +Jilin +and +Heilongjiang +. +Assing (2005) +noticed that this species is characterized by the morphology of the aedeagus and by the modification of the male abdominal tergite VII and VIII, but did not compare this species with other congeners. Based on the study of material from Maritime Province (see above) and original descriptions of both + +G. permixta + +and + +G. bifurcata + +, the senior author concluded that all these specimens are conspecific in external and internal morphology. Thus, + +G. bifurcata + +was synonymized with + +G. permixta + +. + + +Habitus as in +Fig. 242 +. Aedeagus as in +Fig. 243 +. Paramere as in +Fig. 244 +. Male abdominal tergite VIII as in +Fig. 245 +. Male abdominal sternite VIII as in +Fig. 246 +. Female abdominal tergite VIII as in +Fig. 247 +. Female abdominal sternite VIII as in +Fig. 248 +. Spermatheca as in +Fig. 249 +. + + +It is here recorded for the fauna of +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082247684AFF30F990DE1FCBC3.xml b/data/03/9F/21/039F21082247684AFF30F990DE1FCBC3.xml new file mode 100644 index 00000000000..2dfac9d9349 --- /dev/null +++ b/data/03/9F/21/039F21082247684AFF30F990DE1FCBC3.xml @@ -0,0 +1,210 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.12. + +Gyrophaena +(s.str.) +pseudonana +A. +Strand, 1939 + + + + + + +( +Figs 250–252 +, +305 +) + + + + + + + +Gyrophaena pseudonana +A. +Strand, 1939: 108 + + +. + + + + + + +Material examined. + +AMUR +AREA + + +: + +1 ♂ +, +5 ♀♀ +: +Skovorodinskiy District +, left side of +Urka River +, ca. + +8 km +N Yerofey Pavlovich + +, +54º02’24,8’’N +121º58’30,7’’E +. +In + +Hedeloma mesophaeum +(Pers.) Quel. + + +31.VIII.2014 + +. I. +V + +. + +Enushchenko +& A. +V + +. Shavrin leg. (cIE); + + +KHABAROVSK +TERRITORY + +: +1 ♂ +: +Verkhnebureinskiy District +, +Ust’-Urgal Nature Park +(project), near +Semicha River +mouth. + +280 m +a.s.l. + +, in geophilous and epigenous fungi. + +26.VIII.2009 + +. +A.B. Ryvkin +leg. ( +ZMM +) + +. + + + + +Distribution. + +Gyrophaena +(s.str.) +pseudonana + +is a widely distributed Transpalaearctic species. The distribution of the species in Eastern Siberia and Far Eastern +Russia +as in +Fig. 305 +. + + + + +Remarks +. Habitus as in +Fig. 250 +. Aedeagus as in +Fig. 251 +. Male abdominal tergite VIII as in +Fig. 252 +. + + +It is here recorded from Far Eastern +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F21082247684AFF30FE48D94EC999.xml b/data/03/9F/21/039F21082247684AFF30FE48D94EC999.xml new file mode 100644 index 00000000000..e5a25c3de8c --- /dev/null +++ b/data/03/9F/21/039F21082247684AFF30FE48D94EC999.xml @@ -0,0 +1,449 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.11. + +Gyrophaena +(s.str.) +poweri +Crotch, 1867 + + + + + + +( +Fig. 304 +) + + + + + + + +Gyrophaena poweri +Crotch, 1867: 439 + + +; + +Enushchenko & Shavrin 2011: 1209 + +. + + + + +Gyrophaena puncticollis +Thomson, 1867: 232 + +. + + + + + +Gyrophaena punctulata +Mulsant & Rey, 1870: 156 + + +. + + + + + + +Material examined. + +AMUR +AREA + + +: + +4 ♂♂ +, +7 ♀♀ +: +Skovorodinskiy District +, left side of +Urka River +, + +8 km +N Yerofey Pavlovich + +, +54º02’24,8’’N +121º58’30,7’’E +. +In + +Hedeloma mesophaeum +(Pers.) Quel. + + +31.VIII.2014 + +. I. +V + +. + +Enushchenko +& A. +V + +. Shavrin leg. (cIE); + +2 ♂♂ +, +4 ♀♀ +: +Selemdzhinskiy District +, +Selemdzhinsk. + +VIII.1976 + +. +A.B. Ryvkin +& +E.M. Veselova +leg. ( +ZMM +, cIE) + +; + +KHABAROVSK +TERRITORY + +: + +1 ♂ +: +Okhotskiy District +, larch forest near +Skalistyi Stream. + +18.VIII.1986 + +. +N. Sukacheva +leg. (cIE) + +; + +2 ♂♂ +, +4 ♀♀ +: +Verkhnebureinskiy District +, +Dublikanskiy Nature Refuge +near kordon. + +350 m +a.s.l. + +, in rotten geophilous fungi. + +3.IX.2009 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + +1 ♂ +, +2 ♀♀ +: same +District +, lower reaches of +Verkhniy Mel’gin River +near 1st rapid. + +300-350 m +a.s.l. + +, in fungi. + +19.VIII.2009 + +. +A.B. Ryvkin +leg. (cIE) + +; + +1 ♀ +: +Komsomol’skiy District +, +Bikin River +basin, +Bol’shaya Svetlovodnaya (Biamo) River +, +40 km +upper from the mouth. + +7.VIII.1976 + +, +V + +. + +V + +. +Zherikhin +leg. ( +ZIN +); + + +MARITIME PROVINCE + +: +2 ♂♂ +, +3 ♀♀ +: +Pozharskiy District +, +Anisimovka +, +Klyuch Smol’nyi Stream +, +43º07.744’N +132º45.626’E +. +In + +Lepiota +sp. +3 + +.IX.2021. +Yu.A. Rebriev +leg. (cIE) + +; + +5 ♂♂ +, +10 ♀♀ +: same data, +Gribanovka +hostel, +43º06.195’N +132º46.975’E +. +In + +Armillaria +sp. +1 + +.IX.2021. (cIE) + +; + +4 ♂♂ +, +3 ♀♀ +: +Kamenushka +, +43º37.532’N +132º14.550’E +. +In + +Crepidotus calolepis +(Fr.) P. Karst. + + +28.VIII.2021 + +. +Yu.A. Rebriev +leg. ( +FEB +, cIE) + +; + +2 ♂♂ +, +2 ♀♀ +: +Kamenushka +, +43º36.083’N +132º13.412’E +. +In + +Russula +sp. + + +29.VIII.2021 + +. +Yu.A. Rebriev +leg. (cIE) + +; + +1 ♂ +: same data. + +20. +VI + + +.1980, A.B. Ryvkin leg. (cIE); + +5 ♂♂ +, +4 ♀♀ +: +Ussuriyskiy District +, +Gorno-Tayozhnoye +, +43º41.680’N +132º08.378’E +. +In + +Crepidotus calolepis +(Fr.) P. Karst. + + +27.VIII.2021 + +. +Yu.A. Rebriev +leg. ( +FEB +, cIE) + +. + + + + +Distribution. + +Gyrophaena +(s.str.) +poweri + +is a widely distributed Transpalaearctic species. The distribution of the species in Eastern Siberia and Far Eastern +Russia +is shown in +Fig. 304 +. + + + + +Remarks +. +Enushchenko & Shavrin (2011) +recorded it from +Maritime Province +. For illustrations of the species see + +Figs +55–57 + +in +Enushchenko & Semenov (2016) +. + + +It is here recorded from +Amur +Area and +Khabarovsk +Territory for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F2108224A6847FF30FC09DF96CBA1.xml b/data/03/9F/21/039F2108224A6847FF30FC09DF96CBA1.xml new file mode 100644 index 00000000000..68c6f445129 --- /dev/null +++ b/data/03/9F/21/039F2108224A6847FF30FC09DF96CBA1.xml @@ -0,0 +1,431 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.9. + +Gyrophaena +(s.str.) +pasniki +Assing, 2005 + + + + + + +( +Figs 232–241 +, +302 +) + + + + + + + +Gyrophaena pasniki +Assing, 2005: 26 + + +; Kim & Ahn 2014: 192. + + + + + + +Gyrophaena koreana +Paśnik, 2001: 190 + + +; + +Pace 2010: 132 + +. + + + + + +Material examined +. + +KHABAROVSK +TERRITORY + +: + +1 ♂ +, +5 ♀♀ +: +Verkhnebureinskiy District +, +NW of Chegdomyn +, right side of +Urgal River +, +51°11.324’N +132°59.884’E +. + +356 m +a.s.l. + +, in fungi. + +10.VIII.2015 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + +1 ♂ +: same +District +, basin of +Egono River +, short canyon by left side of +Chort River valley +, +50°42.799’N +133°29.977’E +. + +750-770 m +a.s.l. + +, in + +Paxillus +sp. + + +29.VIII.2015 + +. +A.B. Ryvkin +leg. (cIE) + +; + +1 ♂ +, +1 ♀ +: same +District +, right side of +Egono River +, +50°42.157’N +133°32.537’E +. + +660 m +a.s.l. + +, in gill fungi. + +21.VIII.2015 + +. +A.B. Ryvkin +leg. (cIE) + +; + +8 ♂♂ +, +12 ♀♀ +: same +District +, +Dublikanskiy Nature Refuge +, right side of +Dublikan River valley +, 5- +1 km +up-stream of kordon. + +360- 400 m +a.s.l. + +, in geophilous and epigenous fungi. + +26.VIII.2008 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + + +AMUR +AREA + +: +1 ♀ +: +Zeyskiy District +, +Zeyskiy Nature Reserve +, 52nd km kordon, +54.08803°N +126.87342°E +. + +598 m +a.s.l. + +, in geophilous gill fungi. + +16.VIII.2016 + +. +A.B. Ryvkin +leg. (cIE) + +; + + +MARITIME PROVINCE + +: +10 ♂♂ +, +9 ♀♀ +: +Vladivostok. In + +Lentinula edodes +(Berk) Pegler. + + +1. +VI + + +.2010. +S.A. Shabalin +leg. ( +FEB +, cIE); + +4 ♂♂ +, +2 ♀♀ +: +Vladivostok +, Botanical Garden of Bio-Soil Institute +FEB + + +RAS. +In + +Lentinula edodes +(Berk) Pegler. + + +29. +V + + +.2014. I.Yu. Morozov leg. (cIE); + +3 ♂♂ +, +5 ♀♀ +: +Khasanskiy District +, + +8 km +NW Zanadvorovka + +, stream +lower GusaevskiySourse +, +43º21’50’’N +131º33’37’’E +. + +26. +V + + +.2023. K. +V +. Makarov leg. (cIE). + + + + +Distribution +.The eastern Palaearctic + +G. +(s.str.) +pasniki + +is known from Far Eastern +Russia +( +Amur +Area, +Khabarovsk +Territory, +Maritime Province +( +Fig. 302 +)), +North Korea +and +China +( +Heilongjiang +, +Shaanxi +, +Hubei +, +Yunnan +). + + + + +Remarks +. + +Gyrophaena koreana + +was originally described from +North Korea +. +Assing (2005) +renamed this species due to this name being a junior primary homonym of + +G. koreana +Bernhauer, 1936 + +, and recorded it from +Heilongjiang +, +China +. +Pace (2010) +recorded it (as + +G. koreana + +) from +Shaanxi +, +Hubei +and +Yunnan +, +China +. + + +Habitus as in +Fig. 232 +. Aedeagus as in +Figs 233–234 +. Paramere as in +Fig. 235 +. Male abdominal tergite VIII as in +Figs 236–237 +. Male abdominal sternite VIII as in +Fig. 238 +. Female abdominal tergite VIII as in +Fig. 239 +. Female abdominal sternite VIII as in +Fig. 240 +. Spermatheca as in +Fig. 241 +. + + +It is here recorded from +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F2108224B6847FF30FC95D951CF60.xml b/data/03/9F/21/039F2108224B6847FF30FC95D951CF60.xml new file mode 100644 index 00000000000..1d1ec8cc52b --- /dev/null +++ b/data/03/9F/21/039F2108224B6847FF30FC95D951CF60.xml @@ -0,0 +1,794 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.8. + +Gyrophaena +(s.str.) +orientalis +A. +Strand, 1938 + + + + + + +( +Figs 231–231 +, +301 +) + + + + + + + +Gyrophaena orientalis +A. +Strand, 1938: 39 + + +; + +Glotov 2014: 181 + +. + + + + + + +Gyrophaena transsylvanica +Ádám, 2008: 164 + + +. + + + + + + +Material examined. + +JEWISH +AUTONOMOUS AREA + +: + + +12 spec. +: +Obluchenskiy District +, +Pashkovo +, + +11.VIII.1977 + +. +A.B. Ryvkin +leg ( +ZMM +) + +; + +1 ♂ +: same data. + +4.VII.1977 + +. (cIE) + +; + +5 ♂♂ +, +6 ♀ +: +Birobidzhanskiy District +, +Dichun. + +11.VIII.1977 + +. +A.B. Ryvkin +leg. ( +ZMM +) + +; + + +AMUR +AREA + + +: + +1 ♂ +: +Skovorodinskiy District +, left side of +Urka River +, + +4 km +N Yerofey Pavlovich + +, +54º00’40,89’’N +121º57’43,75’’E +. +In + +Clitocybe odora +(Fr.) Kumm. + + +28.VIII.2014 + +. I. +V + +. + +Enushchenko +&A. +V + +. + +Shavrin +leg. (cIE); +2 ♂♂ +, +1 ♀ +: same data, + +8 km +N Yerofey Pavlovich + +, +54º02’24,8’’N +121º58’30,7’’E +. +In + +Hedeloma mesophaeum +(Pers.) Quel. + + +31.VIII.2014 + +. I. +V + +. + +Enushchenko +& A. +V + +. Shavrin leg. (cIE); + +2 ♂♂ +: +Selemdzhinskiy District +, +Selemdzhinsk. + +VIII.1976 + +. +A.B. Ryvkin +& +E.M. Veselova +leg. ( +ZMM +) + +; + +27 ♂♂ +, +21 ♀♀ +: +Selemdzha River +basin, + +51 km +below Ekimchan + +, near +Angelokit Rill. + +404 m +a.s.l. + +, in? + +Kuehneromyces mutabilis + +on firewood near hut. + +8.VIII.2005 + +. +A.B. Ryvkin +leg. ( +ZMM +, +FEB +, cIE) + +; + +3 ♂♂ +, +3 ♀♀ +: same data, +Norsk +, in geophilous gill fungus. + +8.IX.2004 + +. ( +ZMM +, cIE) + +; + +1 ♂ +, +5 ♀♀ +: same +District +, +Norskiy Reserve +, +Selemdzha River +basin near +Dvadtsatikha +kordon. +In +geophilous and epigenous gill fungi ( +NN38-39 +). + +24. +VI + + +.2005. +E.M. Veselova +& +A.B. Ryvkin +leg. ( +ZMM +, cIE); + +2 ♂♂ +: same data, +Nora River +basin near +Meunskiy +kordon. +In +epigenous gill fungi (?oyster fungi). + +14.VII.2005 + +. (cIE) + +; + +4 ♂♂ +, +8 ♀♀ +: same data, +Nora River +basin near +Osinovoye Lake. In +epigenous gill fungi (?oyster fungi) on fallen rotten birch trunk. + +27.VII.2005 + +. ( +ZMM +, cIE) + +; + +4 ♂♂ +, +4 ♀♀ +: same data, +Burunda River +basin, + +0.5-1 km +NW of Burunda + +kordon. +In +geophilous and epigenous gill fungi. + +12.IX.2004 + +. ( +ZMM +) + +; + +39 ♂♂ +, +35 ♀♀ +: same data, + +2 km +SE of Burunda + +kordon, in geophilous gill fungi, + +26.IX.2004 + +. ( +ZMM +, +FEB +, cIE) + +; + +1 ♀ +: +Mazanovskiy District +, right bank of +Nora River +, +Zmeinaya Mt. +In geophilous and epigenous gill fungi. + +17.VII.2005 + +. +A.B. Ryvkin +leg. (cIE) + +; + + +KHABAROVSK +TERRITORY + +: +2 ♀♀ +: +Verkhnebureinskiy District +, +Tyrma River +below +Alanap village +, near thermal spring + +, + +50°03.32’N +131°51.00’E +. + +290-320 m +a.s.l. + +, in gill fungi. + +8.VIII.2009 + +. +A.B. Ryvkin +leg. (cIE); +4 ♂♂ +, +6 ♀♀ +: same +District +, +Ust’-Urgal Nature Park +(project), forest road +NW of Ust’ +- +Niman + +, + +51°23.97’N +132°43.98’E +. + +290- 320 m +a.s.l. + +, in epigenous and geophilous fungi. + +4.VIII.2009 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE); +2 ♂♂ +, +2 ♀♀ +: same data, island on +Bureya River +below +Yerdak +winter hut + +, + +51°15.39’N +132° 31.61’E +. + +250 m +a.s.l. + +, in epigenous and geophilous fresh and rotten fungi. + +6.VIII.2009 + +. ( +ZMM +, cIE) + +; + +3 ♀♀ +: same +District +, +Dublikanskiy Nature Refuge +near kordon. + +350 m +a.s.l. + +, in rotten and fresh geophilous fungi. + +1.IX.2009 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + +1 ♀ +: same data. + +350 m +a.s.l. + +, in epigenous gill fungi. + +4.IX.2009 + +. (cIE) + +; + +3 ♂♂ +, +3 ♀♀ +: same +District +, lower reaches of +Verkhniy Mel’gin River +near 1st rapid. + +300-350 m +a.s.l. + +, in geophilous fungi. + +18.VIII.2009 + +. +A.B. Ryvkin +leg. ( +ZMM +, cIE) + +; + +14 ♂♂ +, +16 ♀♀ +: same +District +, +Bureya River +basin, flood plain of +Levyi Ussomakh River +near mouth + +, + +51°31.688’N +133°48.894’E +. + +469 m +a.s.l. + +, in epigenous gill fungi. + +2.IX.2014 + +. +A.B. Ryvkin +leg. ( +ZMM +, +FEB +, cIE); +6 ♂♂ +, +2 ♀♀ +: same +District +, +Bureinskiy Nature Reserve +, right side of +Pravaya Bureya River +below +Bezymyannyi +stream mouth + +, + +52°03.971’N +134°17.782’E +- +52°03.952’N +134°17.781’E +. + +822-824 m +a.s.l. + +, in geophilous gill fungi. + +17.VIII.2014 + +. +A.B. Ryvkin +leg. (cIE); +1 ♀ +: same data + +, +51°57.178’N +134°22.685’E +. +734 m +a.s.l., gill fungi in flood-plain forest. +23.VIII.2014 +. (cIE); + + +MARITIME PROVINCE +: + +1 ♂ +: +Ussuriyskiy District +, + +Ussuriyskiy Nature Reserve +. + + +3.VII.1980 + +. +A.B. Ryvkin +leg. ( +ZMM +) + +; + +1 ♂ +: same +District +, +Kamenushka. + +VI + + +.1983, +A.B. Ryvkin +leg. ( +ZMM +); + + +SAKHALIN +AREA +: + +1 ♂ +: S + + +Sakhalin +, vicinity of +Tret’ya Pad’ +settlement, valley of +Plastunikha (Pastushka) River +, +46°42’04’’N +142°45’44’’E +. + +VII.2003 + +. I. +V + +. Mel’nik leg. (cIE). + + + + +Distribution. + +Gyrophaena +(s.str.) +orientalis + +is a widely distributed species in the Transpalaearctic region. The distribution of the species in Eastern Siberia and Far Eastern +Russia +is shown in +Fig. 301 +. + + + + +Remarks +. Some specimens of + +G. orientalis + +from +Amur +Area have a slightly different shape of the apical portion of the aedeagus in dorsal view (apex with moderately deep and wide protrusion ( +Fig. 231 +), not shallow and small as in other studied specimens of + +G. orientalis + +) somewhat similar to that in Nearctic + +G. keeni +Casey 1911 + +. The pronotum and the elytra of these specimens are glossy and without distinct reticulate microsculpture compared to these in other studied specimens of + +G. orientalis + +from different Palaearctic localities. Other specimens are distinguished by a small and shallow ( + +G. orientalis + +- +type +) apical protrusion in the aedeagus and weak reticulate microsculpture on the pronotum compared to some + +G. keeni + +. It is possible that this is a result of morphological variability. In any case, a comparison of these specimens with + +G. keeni + +is required. For illustration of + +G. orientalis + +see + +Figs +52–54 + +in +Enushchenko & Semenov (2016) +. Aedeagus as in +Figs 230–221 +. + + +The species is recorded for the fauna of Far Eastern +Russia +for the first time. + + + + \ No newline at end of file diff --git a/data/03/9F/21/039F2108224E6843FF30FACFDEF3CBD2.xml b/data/03/9F/21/039F2108224E6843FF30FACFDEF3CBD2.xml new file mode 100644 index 00000000000..a2bb788cc8a --- /dev/null +++ b/data/03/9F/21/039F2108224E6843FF30FACFDEF3CBD2.xml @@ -0,0 +1,264 @@ + + + +Review of the subtribe Gyrophaenina Kraatz, 1856 (Coleoptera: Staphylinidae: Aleocharinae: Homalotini) of Kunashir Island, with notes on species of Far Eastern Russia + + + +Author + +Enushchenko, Ilya V. +0000-0002-8166-6079 +Testing Laboratory of the Baikalskiy branch of the All-Russian Plant Quarantine Center, Krasnoyarskaya str. 77, Irkutsk, 664023, Russia. deschampsia @ yandex. ru; https: // orcid. org / 0000 - 0002 - 8166 - 6079 +deschampsia@yandex.ru + + + +Author + +Makarov, Kirill V. +0000-0002-9184-7869 +Moscow State Pedagogical University, Malaya Pirogovskaya str., 1 / 1, 119435, Moscow kvmac @ inbox. ru; http: // orcid. org / 0000 - 0002 - 9184 - 7869 +kvmac@inbox.ru + + + +Author + +Shavrin, Alexey V. +0000-0001-6487-4530 +Institute of Life Sciences and Technologies, Daugavpils University, Vienibas 13, Daugavpils, LV- 5401, Latvia. ashavrin @ hotmail. com; https: // orcid. org / 0000 - 0001 - 6487 - 4530 * Corresponding author +ashavrin@hotmail.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5535 + + +1 + + +1 +81 + + + + +http://dx.doi.org/10.11646/zootaxa.5535.1.1 + +journal article +10.11646/zootaxa.5535.1.1 +1175-5334 +42A7715C-0CE3-4CE7-BF67-BDB5D5B9F12B + + + + + +3.2.5. + +Gyrophaena +(s.str.) +fusicornis +Eppelsheim, 1887 + + + + + + +( +Figs 217–225 +, +298 +) + + + + + + + +Gyrophaena fusicornis +Eppelsheim, 1887: 120 + + +; + +Glotov 2014: 180 + +; + +Enushchenko & Shavrin 2021: 340 + +. + + + + + +Material examined. + + +MARITIME PROVINCE + +: +18 ♂♂ +, +26 ♀♀ +: ‘Яковлевка, Спас[ский]. у[еЗд]. Уссур[ийский]. кр[ай]., 30.VIII.[1]926 ДьЯконов Филипьев [Yakovlevskiy District, Yakovlevka […] Djakonov Filipyev]’, ‘Пасека +Квашука +[apiary of Kvashuk]’ ( +ZIN +, +ZMM +, +MSPU +, cIE) + +; + +2 ♂ +, +1 ♀ +: +Ussuriyskiy Nature Reserve +. In tree mushrooms. + +03.VII.1980 + +. +A.B. Ryvkin +leg. (cIE) + +; + +1 ♂ +, +1 ♀ +: same data. + +11.IX.1964 + +. +A.G. Kirejchuk +leg. (cIE) + +; + +31 ♂♂ +, +48 ♀♀ +: +Ussuriyskiy District +, + +3 km +NEE Kamenushka + +, +Komarovka River +, +43º37,52’N +132º23’E +. + +115 m +a.s.l. + +, in + +Pleurotus citrinopileatus +Sing. + + +10.VIII.2004 + +. +V +. +K. Zinchenko +leg. (cIE) + +; + +2 ♀♀ +: +Lazovskiy District +, +Lazovskiy Nature Reserve +, +Prosyolochnaya Bay +. + +31.VIII–02.IX.2007 + +. +Yu.N. Sundukov +& +V +. +P. Shokhrin +(cIE) + +. + + + + +Distribution. + +Gyrophaena +(s.str.) +fusicornis + +is known from several localities in the +Maritime Province +, +Russia +( +Fig. 298 +). + + + + +Remarks. +The species was originally described from “Ussuri”. The +type +material was studied by +Glotov (2014) +. Besides that, the latter author recorded it from Lazo ( +Maritime Province +). + + +Habitus as in +Fig. 217 +. Aedeagus as in +Figs 218–219 +. Paramere as in +Fig. 220 +. Male abdominal tergite VIII as in +Fig. 221 +. Male abdominal sternite VIII as in +Fig. 222 +. Female abdominal tergite VIII as in +Fig. 223 +. Female abdominal sternite VIII as in +Fig. 224 +. Spermatheca as in +Fig. 225. + + + + \ No newline at end of file diff --git a/data/03/D6/87/03D687DDD06F9C0DFF0C6382FB28FDA0.xml b/data/03/D6/87/03D687DDD06F9C0DFF0C6382FB28FDA0.xml index 9784dd896b7..84a85ed1f14 100644 --- a/data/03/D6/87/03D687DDD06F9C0DFF0C6382FB28FDA0.xml +++ b/data/03/D6/87/03D687DDD06F9C0DFF0C6382FB28FDA0.xml @@ -1,60 +1,61 @@ - - - -New species, new records and complementary descriptions of two species of the genus Tenuipalpus Donnadieu (Acari: Tenuipalpidae) + + + +New species, new records and complementary descriptions of two species of the genus Tenuipalpus Donnadieu (Acari: Tenuipalpidae) - - -Author + + +Author -Elgoni, Nasreldeen Ahmed -Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh, 11451, Saudi Arabia; +Elgoni, Nasreldeen Ahmed +Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh, 11451, Saudi Arabia; - - -Author + + +Author -Kamran, Muhammad -Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh, 11451, Saudi Arabia; +Kamran, Muhammad +Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh, 11451, Saudi Arabia; - - -Author + + +Author -Alatawi, Fahad Jaber -Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh, 11451, Saudi Arabia; +Alatawi, Fahad Jaber +Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh, 11451, Saudi Arabia; -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -341 -358 + +341 +358 - -http://dx.doi.org/10.11646/zootaxa.5529.2.6 + +http://dx.doi.org/10.11646/zootaxa.5529.2.6 -journal article -10.11646/zootaxa.5529.2.6 -1175-5326 -0CAED0B0-567F-48DF-95AA-F07038C83C39 +journal article +10.11646/zootaxa.5529.2.6 +1175-5326 +14022401 +0CAED0B0-567F-48DF-95AA-F07038C83C39 - + @@ -114,7 +115,7 @@ are longest. Dorsum ( -Fig. 1 +Fig. 1 ): Colour in life red, propodosoma wider than proximal section of opisthosoma. Length of body from setae @@ -186,7 +187,7 @@ which is flagelliform, whip-like. Setal lengths: Venter ( -Fig. 2 +Fig. 2 ): Propodosoma with longitudinal striations laterally, area posterior to coxae II with few transverse striae; area between setae @@ -248,7 +249,7 @@ short. Setal lengths: Gnathosoma ( -Fig. 3–4 +Fig. 3–4 ): Palpi one-segmented, with single eupathidium @@ -262,7 +263,7 @@ Palpi one-segmented, with single eupathidium Legs ( -Fig. 5-8 +Fig. 5-8 ): Legs measured from trochanter to tarsus; leg I 112(111–117); leg II 101 (100–106); leg III 90 (89–94) and leg IV 93 (92–96); Number of setae on leg I-IV (from coxa to tarsus, solenidion in parenthesis): coxae 3-2-1-1; trochanters 1-1-2-1; femur 4-4-2–1; genu 2-2-1-1; tibiae 4-4-3-3; tarsus 8(1)-8(1)-5-5. @@ -270,14 +271,14 @@ Legs measured from trochanter to tarsus; leg I 112(111–117); leg II 101 (100 Description of male (n=1) ( -Fig. 9–16 +Fig. 9–16 ). Dorsum ( -Fig. 9 +Fig. 9 ): Length of body from setae @@ -367,7 +368,7 @@ flagelliform. Setal lengths: Venter ( -Fig. 10 +Fig. 10 ): Ventral cuticle medially smooth, propodosoma with longitudinal striations laterally. Genital and ventral plates smooth. Setae @@ -425,7 +426,7 @@ short. Setal lengths: Gnathosoma ( -Fig. 11–12 +Fig. 11–12 ): Palpi one segmented, with single eupathidium @@ -439,7 +440,7 @@ Palpi one segmented, with single eupathidium Legs ( -Fig. 13–16 +Fig. 13–16 ): Legs measurement from trochanter to tarsus; leg I 111, leg II 98, leg III 85 and leg IV 90. Number of setae on leg I–IV similar to female legs. diff --git a/data/03/DE/8F/03DE8F5DFF802D382DE9F9BA90644E5A.xml b/data/03/DE/8F/03DE8F5DFF802D382DE9F9BA90644E5A.xml new file mode 100644 index 00000000000..34897260ae7 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF802D382DE9F9BA90644E5A.xml @@ -0,0 +1,197 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +11. + +Sphaerotrypes montanus +Buhroo & Knížek, 2020 + + + + + + +( +Figure 15 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons somewhat flat and impressed similarly as in other species of the genus, covered with dense greyish pubescence and sparse long setae pointing upwards to middle of vertex, roughened with longitudinal shining granules and a median shining longitudinal carina on the lower part of frons; epistomal margin substraight with a fringe of sparse, long golden setae; vertex distinctly convex with fine pubescence and minute punctures; eyes bipartite, the two parts separated by 1.2× the width of an upper part of the eye, united by a fine keel, each part plano-convex, sub-triangular; antennal funicle with seven segments; club oval, rounded, slightly flattened, with six distinct pseudo-sutures marked by micro setae; pronotum 1.72× as wide as long; widest at base, lateral margins and base bordered by a distinct ridge, anterior margin somewhat straight, median dorsal line distinct; base of pronotum produced backwards to form an obtuse angle, and slightly concave on either side, sides rounded and strongly narrowed from base to apex; dorsum convex, impressed behind anterior margin, surface rugosely punctate with some granules, somewhat shining with a scanty covering of short pale scale-like setae and fine pubescence, mainly at apex, base and on sides, its anterior border fringed with longer erect setae; scutellum oblong with minute punctures; elytra somewhat globose, wider than pronotum, 1.1× as long as wide, 1.86× as long as pronotum; basal margin of each elytron procurved and ornamented with 14 crenulations, lateral margins gradually tapering posteriorly; declivity sloping gently from near the base of elytra; striae rather deep, shining, with obsolete punctures and reaching almost the elytral apex except striae 5 and 6 joining before reaching elytral apex; interstriae much wider than striae, flat except basal one-fifth slightly convex with distinct asperities, on apical four-fifth with irregular rows of rounded blunt granules; all interstriae gradually narrowing towards declivity, covered with very tiny scale-like setae and sparse longer obliquely erected scale-like setae, few whitish scales at the base of elytra; body length: +2.75–2.96 mm +, 1.54× as long as wide. + + + +FIGURE 15. + +Sphaerotrypes montanus + +. Holotype male: dorsal view +A +, lateral view +B +. + + + +Female similar to male except elytra longer, the frons is slightly more convex and the apex of the pronotum is less constricted; body length: +2.85 mm +, 1.53× as long as wide. + + +Remarks: + +Sphaerotrypes montanus + +is related to + +S. querci +( +Stebbing, 1908 +) + +but can be distinguished by the strongly constricted anterior part of the pronotum, much more impressed behind the anterior margin compared to + +S. querci + +. The sculpture and vestiture on the frons and pronotum is much coarser and dense in + +S. querci + +. There are three longer hair-like and transversely set setae on either side of median line at base of pronotum in + +S. montanus + +as opposed to more numerous (6 or 7) on entire base of pronotum in + +S. querci + +, and missing in + +S. pila +Blandford, 1894 + +. + + + + +Material examined: +Holotype +♂ +, + +Allotype +♀ +in KUIC. Type locality: +Jammu +, +Ramban +, +Batote +, +India + + + + +New +record: +India +: +2 ♂ +′s. +Jammu +, +Kishtwar +( +33° 18.787′ N +, +075° 46.451′ E +, + +5610 ft. + +), +A.A. Buhroo +, + +10.09.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Jammu and Kashmir +(Batote, Kishtwar). + + + + +Hosts: + +Prunus persica + +( +Rosaceae +). + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF832D392DE9FA2F96CD4D6D.xml b/data/03/DE/8F/03DE8F5DFF832D392DE9FA2F96CD4D6D.xml new file mode 100644 index 00000000000..e6022990932 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF832D392DE9FA2F96CD4D6D.xml @@ -0,0 +1,191 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +12. + +Sphaerotrypes querci +Stebbing, 1908 + + + + + + +( +Figure 16 +) + + += +tectus +Beeson, 1921 + + +This species is diagnosed by the following morphological characters: +♂ +frons somewhat flat and impressed, fringed with dense white pubescence, roughened with longitudinal granules and small median tubercules above the epistomal margin; epistomal margin substraight with a fringe of long pale setae; vertex distinctly convex with minute granules; antennal scape curved, funicle with seven segments and club with 8 or 9 distinct pseudo-sutures marked by rows of setae; pronotum wider, one and a half times as wide as long, widest at the base, converging anteriorly with weak convex lateral margins; anterior margin somewhat straight with some minute granules, median line distinct but not forming any ridge; dorsal surface minutely granulate punctuate, covered with dense scale-like setae, some scattered erect hairs on entire base of pronotum; posterior margin with distinct ridge forming somewhat V-shaped divergence, laterally; elytra somewhat globose slightly longer than broad and almost double the pronotum; basal margin of each elytron outcurved with 13 or 14 crenulations; lateral margins strongly outcurved, gradually narrowing posteriorly and terminating into a angularly rounded apex; striae distinctly depressed marked with shallow punctures and reaching almost up to the elytral apex except striae 5 and 6; interstriae much wider, flat except basal one-fifth becoming somewhat convex with distinct regular asperities; discal interstriae with three to four rows of granules and covered with scale like minute setae throughout; declivity commencing on the posterior third, gradually slopping posteriorly with convex face; declivital interstriae with somewhat distinct minute tubercules becoming somewhat prominent towards apex; body length: +3.46 mm +, 1.58× as long as wide. + + + +FIGURE 16. + +Sphaerotrypes querci + +. Lectotype: dorsal view +A +, lateral view +B +, frons +C +. + + +Females are similar to males, except the frons is plano-convex. + + + +Material examined: + +Lectotype +(here designated). Label information: + +Sphaerotrypes querci +, Kumaon, N.W. Himalaya, E.P. Stebbing + +( +FRI +) + + + + + +Distribution: +India +: +Maharashtra +, Punjab, +Uttarakhand +. +China +: +Anhui +, Haibei, +Shanxi +, +Sichuan +, +Yunnan + + + + +Hosts: + +Quercus floribunda + +, + +Q. leucotrichophora + +, + +Q. semecarpifolia + +( +Fagaceae +) + + +Phylogenetic assessment: + + +The Himalayan + +Sphaerotrypes montanus + +, along with other closely related species of the genus ( + +S. hagedorni +Eggers, 1920 + +) and other genera ( + +Hylesinus + +, and + +Dryocoetes + +), were subjected to a phylogenetic study utilizing the COX-1 gene. Due to a lack of COX-1 sequences of + +Sphaerotrypes + +(except + +S. hagedorni + +) in GenBank, it was compared with species from other closely related genera. The phylogenetic tree, however, ( +Fig. 17 +), revealed that + +Sphaerotrypes montanus + +constituted a distinct group/clade from the others and had a nucleotide divergence of 19.43% from + +S. hagedorni +. + +The populations of the other genera were monophyletic individually in the current study. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF852D3E2DE9FBE290134CD2.xml b/data/03/DE/8F/03DE8F5DFF852D3E2DE9FBE290134CD2.xml new file mode 100644 index 00000000000..6537589579e --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF852D3E2DE9FBE290134CD2.xml @@ -0,0 +1,172 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +13. + +Coccotrypes cinnamomi +( +Eggers, 1936 +) + + + + + + +( +Figure 18 +) + + + + += + +Thamnurgides cinnamomi +Eggers, 1936 + + + +This species is diagnosed by the following morphological characters: frons somewhat convex, sub-shining, surface with longitudinal aciculations denser towards eyes and a fine median longitudinal raised line extending from epistoma upto the upper level of eyes; surface with sparse, yellowish long setae and fringe of dense setae on epistomal margin; antennal funicle with five segments; club obliquely truncate with two recurved sutures marked by short, golden setae on posterior face; eyes shallowly anteriorly emarginate; pronotum as long as wide, sides weakly outcurved almost upto middle and then narrowing anteriorly towards broadly rounded apex, surface sub-convex with fine granulate asperities and small punctures on posterior third; vestiture of rather long erect hair-like setae, longer and semi-recumbent anterolaterally; scutellum shining, tongue shaped, longer than wide; elytra 1.52× longer than pronotum, basal margin sub-striaght, lateral sides sub-parallel upto basal two-thirds, converging posteriorly with rather narrowly rounded apex; surface shining, smooth, striate punctate, striae not impressed with small, shallow punctures separated by about half of their diameter from one another; interstriae 2.5× wider than striae, flat with much smaller punctures, each with an erect bristle with knobbed apex; declivity commencing on posterior third, somewhat convex rather steep, punctures and vestiture as on disc; procoxae narrowly separated; pro, meso and meta-tibiae broader towards apex; pro with four, meso and meta with five-socketed teeth; body pitchy brown; body length: +1.78–1.81 mm +, 2.42× as long as wide. + + + +Sexes indistinct in the material studied. + + + +Material examined: + +New +records: +India +: +2 specimens +. +Himachal Pradesh +, +Tanda Palampur +( +32° 06.141 N +, +076° 32.036′ E +, + +4008 ft. + +), +A.A. Buhroo +, + +25.09.2018 + +( +KUIC +) + + + + + +Distribution: +India +: +Himachal Pradesh +(first country record). +Sri Lanka +, +Indonesia +, +Malaysia +, +Seychelles +, +American Samoa + + + + +Hosts: +Collected from an unknown host in the current study. Boring seeds of various hosts: + +Carapa procera + +( +Meliaceae +), + +Cinnamomum verum + +( +Lauraceae +), + +Cola nitida + +( +Malvaceae +), + +Pentadesma butyracea + +( +Clusiaceae +), + +Planchonella garberi + +( +Sapotaceae +). + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF872D3D2DE9F93A93384C5F.xml b/data/03/DE/8F/03DE8F5DFF872D3D2DE9F93A93384C5F.xml new file mode 100644 index 00000000000..4c09daf4953 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF872D3D2DE9F93A93384C5F.xml @@ -0,0 +1,170 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +15. + +Dryocoetes asperatus + +sp. nov. + + + + + +( +Figure 20 +) + + + + +Diagnosis: +This new species is exceptionally distinct and differs from other Indian species of the genus by its smaller size; covex, rugosely reticulate frons; serrate anterior pronotal margin; shining elytra with weakly impressed striae on disc; declivital interstriae with sparse, minute granules, more prominent apically; vestiture of sparse and short hairs on pronotum and elytra. The species also differs from + +D. alni +( +Georg, 1856 +) + +by having a wider declivital interstraie 2 and outwardly curved striae 2 on the middle of its declivity; and short vestitutre with a brown body color versus long, dense vestiture and black color in + +D. alni + +. + + + + +FIGURE 20. + +Dryocoetes asperatus + + +sp. nov. + +Holotype: dorsal view +A +, lateral view +B +, frons +C +, elytral declivity +D +, ventral view +E +. + + + + +Description: +The species is new in this genus by the following morphological characters: frons convex, sub-shining, impressed just above epistoma, surface rugose reticulate, longitudinal rugosities stronger towards eyes; surface sparsely finely punctured with sparse, moderately long setae and fringe of dense setae on epistomal margin; vertex shining, finely reticulate; antennal funicle with five segments; club obliquely truncate with recurved sutures on anterior face and one suture on posterior face; eyes of normal size, with upper part above emargination smaller than lower part, and not extending onto frons, finely faceted; pronotum slightly longer than wide (1.03×), widest close to base, posterior angles broadly rounded, sides sub-parallel in basal half, rather narrowly rounded anteriorly; anterior pronotal margin with serrations, summit at middle, anterior slope with numerous, densely placed asperities of variable size, arranged more or less concentrically, asperities somewhat triangular, larger and more elevated anteriorly; disc with a distinct, smooth median impunctate area, rest irregularly punctate upto base, becoming rugulose postero-laterally; vestiture of sparse, moderately long, setae on anterior slope and margin, shorter at sides; scutellum shining, broad, tongue shaped; elytra 1.51× as long as wide, 1.56× as long as pronotum, slightly wider than pronotum at base; sides parallel up to basal three-fourths, thence evenly rounded to apex; elytral surface shining; striae feebly impressed marked by distinct shallow, round punctures, separated by about half the width of one puncture, each with a microhair; interstriae 2–3× wider than striae, interstrial punctures uniseriate, much smaller and more widely separated, with short hairs visible laterally; declivity rather steep and convex, strongly impressed along stria 1 and 2; strial punctures somewhat smaller than those on disc; interstriae 1, 2 and 3 raised with minute, sparse granules more prominent towards apex, rest of interstriae also with few minute granules; declivital striae 2 rather outwardly curved on its middle; vestiture inconspicuous; protibia somewhat broader towards apex with five-socketed teeth on outer margin, meso and meta tibiae also with five spines on their outer margin; ventrites with short, rather recumbent and moderately dense setae; body color brownish; body length: +2.01–2.21 mm +, 2.53× as long as wide. + + +Remark: Sex could not be determined and also confirmation of the species using molecular data was not possible as only +two specimens +were available for the study. + + + + +Material examined: + +India +: +Holotype +: +Kashmir +, +Ganderbal +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +03.09.2019 + +( +KUIC +); 1 PT NHMW. + + + + +Type +Locality: + +Kashmir (Sonamarg) + + + + +Hosts: +Unknown + + + + +Etymology: +The species epithet asperatus refers to the presence of asperities on the anterior slope of pronotum. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF882D332DE9FB7C91E14CFF.xml b/data/03/DE/8F/03DE8F5DFF882D332DE9FB7C91E14CFF.xml new file mode 100644 index 00000000000..0a4565f42ee --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF882D332DE9FB7C91E14CFF.xml @@ -0,0 +1,220 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +18. + +Dryocoetes indicus +Stebbing, 1914 + + + + + + +( +Figure 23 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons rugose-punctate with dense minute punctures and sparse hairs, not forming tufts; epistomal margin with a brush of yellowish hairs; eyes emarginate anteriorly; funicle five-segmented and club obliquely truncate with two recurved sutures on anterior face, and one suture near apex on posterior face; pronotum almost as long as wide, disc convex, sides uniformly curved from base to apex; surface rugose with minute asperities, pubescence long and rather scattered, more prominent antero-laterally; scutellum large, heart-shaped, smooth, shining, dark brown; elytra 1.51× as long as pronotum and 1.42× as long as wide, broader apically than pronotum, apex rather sharply declivous, rounded; disc shining and strongly punctate, strial punctures placed in rows, large, shallow, each with a microhair; interstriae much wider than striae, set with a row of minute punctures; declivity shining, the sutural striae most strongly impressed in upper part, the punctures smaller, becoming very fine and scattered apically; vestiture of long, spiny interstrial hair-like setae, more longer laterally and on declivity; minute but evident tubercles on declivity; body dark brown; body length: 4.0– +4.36 mm +, 2.46× as long as wide. + +Females have a bright yellow tuft of dense hair-like setae on frons, much longer towards the margins; body length: 3.0–4.0 mm. + + + +Material examined: + +New +records: +India +: +5 ♂ +′s, +3 ♀ +′s. +Kashmir +, +Baramulla +, +Check +post +Gulmarg +( +34° 03.797′ N +, +074° 24.948′ E +, + +7552 ft. + +), +A.A. Buhroo +, + +25.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Bandipora +, +Chorwan Gurez +( +34° 39.242′ N +, +074° 53.581′ E +, + +8275 ft. + +), +A.A. Buhroo +, + +17.08.2018 + +( +KUIC +) + +. + +Kashmir +, +Baramulla +, +Baba Reshi +( +34° 03.92′ N +, +074° 24.54′ E +, + +7600 ft. + +), +A.A. Buhroo +, + +10.07.2019 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Tangdhar +( +34° 23.527′ N +, +073° 51.894′ E +, + +6525 ft. + +), +A.A. Buhroo +, + +10.07.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Kashmir, +Uttarakhand +. +Nepal + + + + +Hosts: + +Abies pindrow + +, + +Picea smithiana + +, + +Pinus wallichiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF892D322DE9FF6893BC4EC0.xml b/data/03/DE/8F/03DE8F5DFF892D322DE9FF6893BC4EC0.xml new file mode 100644 index 00000000000..ee35306ff00 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF892D322DE9FF6893BC4EC0.xml @@ -0,0 +1,140 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +16. + +Dryocoetes brownei +Mandelshtam & Petrov, 2010b + + + + + + +( +Figure 21 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons surface shiny with rather dense uniform punctures, and a small fovea in the center; vertex with smaller, less dense punctures and median longitudinal black line (sulcus); long, sparse, yellowish hair-like setae more longer at the lateral sides of frontal area; epistoma with long dense yellowish setae directed downwards; eyes rather large, emarginate anteriorly, funicle five-segmented, club obliquely truncate with recurved sutures on anterior face, and one suture on apical posterior face; pronotum slightly longer than wide; sides sub parallel in basal three fourth, rounded towards apex; pronotal surface mostly granulate, without reticulation, coarser anteriorly; punctures on small area on central portion of pronotal base around short impunctate median line; lateral and anterior margin of pronotum with long, curved, yellow hair-like setae; scutellum, tongue-shaped, flat, reddish- brown; elytra slightly wider than pronotum, slightly more so towards apex; elytra coarsely punctured on disc, especially on striae 1–3; juxtasutural stria not impressed on disc and declivity, punctures on striae 1 +st +and 2 +nd +deep, large up to the commencement of declivity; interstriae in central part of disc narrow, 1.6–2.0× narrower than striae, minute punctures in one irregular row on each interstria; rather convex and shining; declivity slightly flattened, convex, not steep, dull; ventro-lateral sides of declivity not armed and without minute tubercles on declivital surface; 1 +st +and 2 +nd +interstriae widened at declivity, punctures on 1 +st +and 2 +nd +striae larger than punctures on other striae on declivity; 1 +st +and 2 +nd +striae slightly divergent towards elytral apex; elytral interstriae with rather long yellow hair-like setae, longer laterally and on declivity; short recumbent hair-like setae on striae; body length: +5.1 mm +. + + + +FIGURE 21 +. + +Dryocoetes brownei +. + +Holotype: dorsal view ( +Mandelshtam & Petrov, 2010b +). + + +Female similar to male, except that the frons has a dense tuft of long yellow hair-like setae. + +Remarks: This species differs from all other Indian species of the genus + +Dryocoetes + +by the exceptionally large punctures of the elytral discal striae and the large size of the body. + + + + +Material examined: + +Holotype +♂ +in NHMUK (image). Type locality: +Kashmir +, +Gulmarg +, +India +. + + + + + +Distribution: +India +: Kashmir, +Afghanistan + + + + +Hosts: +Unknown + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF892D332DE9F9C891A44F17.xml b/data/03/DE/8F/03DE8F5DFF892D332DE9F9C891A44F17.xml new file mode 100644 index 00000000000..26ae64b5d26 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF892D332DE9F9C891A44F17.xml @@ -0,0 +1,184 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +17. + +Dryocoetes himalayensis +Strohmeyer, 1908a + + + + + + +( +Figure 22 +) + + +This species is diagnosed by the following morphological characters: +♂ +head globose; frons plano-convex, transversely impressed above epistoma; surface glabrous with scattered minute granules and long hairs, granules denser towards epistomal margin; epistomal margin with a fringe of long, golden hairs; eyes elongate with a shallow, wide emargination anteriorly; antennal club with two recurved sutures on anterior face; pronotum 1.10× longer than broad; sides sub-parallel on basal half, then gradually narrowing anteriorly, anterior margin broadly rounded; apical half finely and closely asperate and extending laterally up to base; rest of the basal half densely and coarsely punctured; hairs distinct anteriorly and postero-laterally; scutellum pear shaped, smooth and black; elytra 1.32× as long as pronotum and 1.51× as long as wide, sides parallel upto the commencement of declivity; elytral disc shiny; striae distinct marked with fairly large, shallow punctures running almost to the elytral end; punctures devoid of any distinct hairs; interstriae shiny, with widely spaced minute punctures and scattered long hairs, nearly as wide as striae; striae 1 and 2 rather impressed on elytra and within declivity, striae 1 to 3 running up to posterior margin; interstriae 1 to 3 also prominent up to the tip; interstriae 4 and 5 terminated at the commencement of declivity; declivity commencing on posterior fourth; declivital face stiff marked with interstrial setose granules, hairs longer on declivity and lateral sides of elytra; declivital margin not so demarcated but somewhat marked by slightly swollen interstriae 1 to 3; body dark redish-brown; body length: +2.70–2.81 mm +, 2.61× as long as wide. + + + +FIGURE 22 +. + +Dryocoetes himalayensis + +. Male: Dorsal view +A +, lateral view +B +. + + + +The 1 +st +stria is strongly deepened on the disc and declivity, more evident in males of this species, though it is also developed in the females. + + +Remarks: This species differs from + +D. indicus +Stebbing, 1914 + +due to its much smaller body size and the strongly impressed first and second striae on the disc and declivity. + + + + +Material examined: + +New +records: +India +: +4 ♂ +ꞌs. +Kashmir +, +Baramulla +, +Chandilora Tangmarg +( +34° 04′31.29′′ N +, +074° 26′59.74′′ E +, + +6600 ft. + +), +A.A. Buhroo +, + +23.09.2020 + +( +KUIC +). +Kashmir +, +Anantnag +, +Larkipora +( +33° 38′42.96′′ N +, +075° 10′24.51′′ E +, + +5482 ft. + +), +A.A. Buhroo +, + +06.07.2012 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Uttarakhand +, Kashmir + + + + +Hosts: + +Juglans regia + +( +Juglandaceae +), + +Sorbus lanata + +( +Rosaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF8B2D312DE9FCFD97A94C99.xml b/data/03/DE/8F/03DE8F5DFF8B2D312DE9FCFD97A94C99.xml new file mode 100644 index 00000000000..ac568150bfc --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF8B2D312DE9FCFD97A94C99.xml @@ -0,0 +1,286 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +19. + +Dryocoetes quadrisulcatus +Strohmeyer, 1908c + + + + + + +( +Figure 24 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons subconvex, coarsely granulate-punctate, surface with few long sparse hairs; minute granules denser on flattened area above epistoma and on lateral sides; epistomal margin with fringe of dense, long yellow hairs; vertex shiny, smooth, irregularly punctured; eyes elongate, anteriorly emarginate; antennal club sub-circular, slightly longer than wide, obliquely truncate with two recurved sutures on anterior face, and one suture on apical posterior face, basal corneous portion occupies about half the total length; pronotum slightly longer than wide (1.08×); evenly convex; basally truncate, sides sub-straight up to middle, narrowed and curved towards rounded apex; pronotal surface mostly granulate, coarser antero-laterally; somewhat irregular punctures around impunctate median line towards pronotal base; sparse, long yellow hairs on anterior and lateral portions; scutellum elongate, tongue-shaped, smooth, shiny-black; elytral base as wide as pronotum, 1.55× longer than pronotum and 1.67× as long as wide; basal margin truncate, sides parallel, posteriorly somewhat broadly rounded; elytra strongly striate punctate, strial punctures large, closely placed and especially deeply impressed on first two striae; interstriae as wide as striae, punctures much smaller, as numerous as on striae; declivity somewhat steep, striae 1 strongly and 2 less strongly sulcate and both dilated away from sutural line towards apex; sutural interstriae slightly elevated, with minute setose granules on declivital interstriae; elytral interstriae with long yellow hair-like setae, somewhat longer on lateral sides and on declivity; body dark brown; body length: +2.24–2.61 mm +, 2.80× as long as wide. + + +Female body length: +2.25 mm +. The strongly deepened, striae 1 on the disc and declivity is more evident in males of this species, though it is also developed in the females. + +Remarks: This species is distinct from the rest of the Indian species due to its grooved (sulcate) striae 1 and 2 on its declivity. + + + +Material examined: + +New +records: +India +: +4 ♂ +′s, +4 ♀ +′s. +Kashmir +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9865 ft. + +), +A.A. Buhroo +, + +12.07.2012 + +( +KUIC +). +Kashmir +, +Bandipora +, +Tragbal Gurez +( +34° 29.647′ N +, +074° 38.1652′ E +, + +9432 ft. + +), +A.A. Buhroo +, + +18.08.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: Kashmir, +Uttarakhand + + + + +Hosts: + +Abies pindrow + +( +Pinaceae +) + + +Phylogenetic assessment: + + +The phylogenetic analysis based on COX-1 gene comparison was carried out between the Himalayan + +Dryocoetes +species + +and other closely related species of the genus ( +Fig. 25 +). The NJ tree analysis revealed that + +Dryocoetes quadrisulcatus + +and + +D. himalayensis + +formed different clades and were monophyletic with a nucleotide difference of 11.52%. Along with North American + +Dryocoetes affaber +( +Mannerheim, 1852 +) + +, Himalayan + +D. indicus + +likewise belonged to a distinct monophyletic group, although it differed from it by a nucleotide difference of 8.38–9.01%. The European populations of + +Dryocoetes + +also formed distinct clades. The nucleotide divergence between + +Dryocoetes quadrisulcatus + +and + +D. indicus + +was 16%. + + + +FIGURE 24. + +Dryocoetes quadrisulcatus + +. Male: dorsal view +A +, latero-declivital view +B +; female: dorso-lateral view +C +. + + + + +FIGURE 25. +A phylogenetic tree obtained from the NJ for the COX-1 genes of + +D. indicus + +, + +D. quadrisulcatus + +(in blue) and related species. Numbers at the branches represent bootstrap values. + + + + +Genus + +Taphrorychus +Eichoff, 1878b + + + + + +Taphrorychus +species + +are diagnosed by the following morphological characters: body length: +1.5–2.7 mm +; funicle with five segments; club flat, round with three slightly procurved sutures; pronotum as long as wide, anteriorly constricted, with rows of fine granules; elytra with striae; +♂ +elytral declivity flat; female declivity rounded; +♂ +frons granulate with sparse filliform setae; +♀ +frons with crown of dense, short, filliform setae; body black to brown; antennae and legs light brown; hosts: deciduous trees and conifers. + + + + + +Key to the Himalayan species of + +Taphrorychus +Eichoff, 1878b + + + + + + + +1 Elytral disc very distinctly striate-punctate, the strial punctures of moderate size and closely placed; interstriae much wider, in places finely transversely wrinkled and each with median row of widely spaced rather large punctures as those on the main striae.................................................................................. + +T. betulae +Schedl + + + + + +- Elytral disc with indistinctly marked striate and interstriae, striae 1 and 2, well-marked and impressed; punctures on both striae and interstriae of equal size and depth, declivital interstriae marked by long erect hairs and few minute granules.............................................................................................. + +T. hewetti +(Stebbing) + + + + + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF8D2D362DE9FF6890034D81.xml b/data/03/DE/8F/03DE8F5DFF8D2D362DE9FF6890034D81.xml new file mode 100644 index 00000000000..daa78eeb4e2 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF8D2D362DE9FF6890034D81.xml @@ -0,0 +1,172 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +20. + +Taphrorychus betulae +Schedl, 1974 + + + + + + +( +Figure 26 +) + + +This species is diagnosed by the following morphological characters: +♂ +body pitchy black, frons densely granulate punctate, with long sparse yellow hairs; flattened above epistoma; epistomal margin with a fringe of yellow hairs; eyes elongate, anteriorly emarginate; antennal club sub-circular, basal corneous portion on less than half of length, rest pubescent non-corneous portion with two recurved sutures; pronotum 1.11× longer than wide, postero-lateral angles moderately rounded, sides parallel up to more than the middle, narrowed anteriorly with rounded apex; anterior pronotum obliquely convex and densely covered with small asperities, basal area densely rather coarsely punctate, median line impunctate and feebly raised, pubescence rather long and erect; scutellum of medium size, shining; elytra slightly wider than pronotal base, 1.53× longer than pronotum and 1.64× as long as wide; lateral sides parallel up to basal three-fourth, converging posteriorly to moderately rounded apex; disc shining, very distinctly striate-punctate, the striae deeper towards the declivity, the strial punctures of moderate size and closely placed; interstriae much wider, in places finely transversely wrinkled and each with median row of widely spaced small punctures with rather long erect pale hair-like setae, the size of these punctures not quite as large as those on the main striae; declivity commencing from behind middle and obliquely convex; sutural interstriae elevated, with a row of setose granules; striae 1 deeply impressed, interstriae 2 somewhat similar to sutural one, some of its punctures and on rest of the interstriae replaced by minute setose granules; body length: +2.70–2.74 mm +, 2.78× as long as wide. + + + +FIGURE 26. + +Taphrorychus betulae + +. Male: dorsal view +A +, lateral view +B +; female: fronto-lateral view +C +. + + + +Females with finely and very densely punctured frons and with tufts of long incurved hairs along margins; body length: +2.48 mm +. + + + + +Material examined: + +New +records: +India +: +2 ♂ +′s, +4 ♀ +′s. +Kashmir +, +Bandipora +, +Barnoi Gurez +( +34° 36.543′ N +, +074° 57.182′ E +, + +8360 ft. + +), +A.A. Buhroo +, + +17.08.2018 + +( +KUIC +). +Kashmir +, +Ganderbal +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +03.09.2019 + +( +KUIC +) + +. + + + + +Distribution: +India +: Kashmir (Barnoi, Sonamarg) (first country record). +Pakistan + + + + +Hosts: + +Betula utilis + +( +Betulaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF8D2D372DE9F90A96C24EB1.xml b/data/03/DE/8F/03DE8F5DFF8D2D372DE9F90A96C24EB1.xml new file mode 100644 index 00000000000..7a4214fd2af --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF8D2D372DE9F90A96C24EB1.xml @@ -0,0 +1,189 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +21. + +Taphrorychus hewetti +( +Stebbing, 1908 +) + + + + + + +( +Figure 27 +) + + + + += + +Dryocoetes hewetti +Stebbing 1908 + + + +This species is diagnosed by the following morphological characters: +♂ +frons plano-convex, surface rugose-punctate, with long scattered hairs and roughened with fine granules; epistomal margin with a fringe of long hairs; eyes slightly emarginate at the antennal base; antennal funicle with five segments; club spatulate with procurved sutures; pronotum slightly longer than broad (1.04×), summit distinct, almost at the middle; basal margin substraight; lateral sides sub-parallel up to more than middle, narrowing anteriorly with rounded margin; coarser asperities on anterior half and much finer posteriorly; long sparse hairs on surface, especially anteriorly and laterally; scutellum rounded, convex and shiny; elytra 1.52× longer than pronotum and 1.6× as long as its width; basal margin substraight; lateral sides strictly parallel upto three fourth portion, afterwards narrowing posteriorly to a rounded posterior margin; disc shiny, punctures on both striae and interstriae of equal size and depth, striae and interstriae hardly demarcated, except striae 1 and 2, being impressed; declivity commencing on posterior fourth; declivital face somewhat steep, shiny; declivital margin marked by long erect hairs and few minute granules in respective interstriae; interstriae 1, 3 and 4 with few minute setose granules on upper half as well as towards posterior margin; body length: +2.7 mm +, 2.68× as long as wide. + + + + +FIGURE 27 +. + +Taphrorychus hewetti + +. Lectotype male: dorsal view +A +, lateral view +B +. + + + + +Remarks: This species was formerly placed in + +Dryocoetes + +( + +D. hewetti +Stebbing, 1908 + +) but due to its spatulate antennal club, and extremely long declivital pubescence, it was transferred to + +Taphrorychus +( +Wood & Bright 1992 +) + +. + + + + +Material examined: + +Lectotype +(here designated). Label information: + +Dryocoetes hewetti + +n. sp. +, Type, +Nainital, E.P. +Stebbing, 1908 +( +FRI +) + + + + + +Distribution: +India +: +Himachal Pradesh +, +Uttarakhand + + + + +Hosts: + +Quercus floribunda + +, + +Q. leucotrichophora + +( +Fagaceae +) + + +Phylogenetic assessment: + + +The Himalayan + +Taphrorychus betulae + +and other closely related species of the genus and other genera were compared phylogenetically using the COX-1 gene ( +Fig. 28 +). The phylogenetic analysis revealed that the populations of + +T. betulae + +found in the Himalayas belonged to a distinct monophyletic group and displayed a 2.21% intraspecific nucleotide divergence. It was also clear that the Himalayan + +Taphrorychus +species + +is extremely different from the non-Himalayan + +Taphrorychus +species + +, which formed a distinct monophyletic cluster in the analysis. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF8E2D0A2DE9FED997334AAC.xml b/data/03/DE/8F/03DE8F5DFF8E2D0A2DE9FED997334AAC.xml new file mode 100644 index 00000000000..4c5ae8177f4 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF8E2D0A2DE9FED997334AAC.xml @@ -0,0 +1,295 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +23. + +Ernoporus squamosus + +sp. nov. + + + + + +( +Figure 30 +) + + + + +Diagnosis: +This new species is diagnosed by the reticulate frons and longitudinally aciculate vertex; by the pattern of asperities arranged in four concentric rows on the anterior slope of the pronotum. + +Ernoporus squamosus + + +sp. nov. + +is very similar to + +E. tillae +( +Panzer,1793 +) + +but differs from it in the arrangement of asperities (in + +E. tillae + +, the anterior two rows have discontinuous asperities). + + + + +FIGURE 30. + +Ernoporus squamosus + + +sp. nov. + +Holotype female: dorsal view +A +, lateral view +B +, frons +C +; Allotype male: dorsal view +D +, frons +E +. + + + + +Description: +The species is new in + +Ernoporus + +by the following morphological characters: +♀ +frons convex, weakly impressed just above epistoma, surface sub-shining, reticulate punctate, vertex with fine longitudinal aciculations; vestiture of erect, moderately dense hair-like setae on frontal surface, with a fringe of long hairs on epistomal margin; eyes oval, entire; antennal funicle with four segments, club flat, sub-round with three slightly procurved sutures indicated by rows of setae; pronotum 1.20× wider than long; sides widest slightly above base, arcuately converging; apical margin moderately produced anteriorly, set with four distinct closely placed asperities, median pair larger; summit situated at middle, anterior slope of summit concentrically asperate in four rows, of which posterior two rows fused to form two arcuate carinae, third row of fused asperities with rounded free apices, and fourth row with distinct triangular closely placed asperities; disc somewhat flat, sub-shinning, surface reticulate, rugose on postero-lateral sides; vestiture of moderately long, erect hair-like setae with some shorter, broad, dagger-like setae antero-laterally, posterior half with pale, short, dense, scales intermixed with some relatively longer, stout and blunt scales (nearly as long as wide); suture between pronotum and elytra somewhat straight; scutellum distinct, triangular; elytra 1.71× as long as pronotum, 1.42× as long as wide; sides parallel on more than basal two-thirds, rounded towards apex; elytral surface dark, iridescent; striae narrow, weakly impressed with small, oval, deep punctures separated from each other by about the diameter of a puncture; interstriae nearly 2.5× as wide as striae; interstrial surface with a row of medial pale, erect, flat and blunt scales, separated within the row by the length of a scale, and two rows of dense short scales (each on either side of medial row); declivity evenly convex with sculpture and vestiture as on rest of elytra; undersurface reticulate with moderately dense pubescence; body color dull, black; body length: +1.41–1.45 mm +, 2.29× as long as wide. + + +Male similar to female, except for a slightly more produced apical margin of pronotum, and frons with a smooth, shining and impressed circular area above epistoma; body length: +1.42 –1.54 mm +. + + + + +Material examined: + +Holotype +: +♀ +: +India +: +Kashmir +, +Srinagar +, +Theed Harwan +( +34° 09.858 N +, +074° 54.590′ E +, + +5608 ft. + +), +A.A. Buhroo +, + +02.10.2018 + +( +KUIC +) + +. +Allotype +, +♂ +: the same site and date as HT; + +Paratypes +: the same data as HT ( +1 ♀ +, +3 ♂ +), except, +Kupwara +, +Teetwal +( +34° 23.596′ N +, +073° 46.458′ E +, + +3582 ft. + +), +A.A. Buhroo +, + +17.07.2017 + + +; + +Dachigam National Park +( +34° 08.754′ N +, +074° 55.604′ E +, + +5610 ft. + +), +A.A. Buhroo +, + +02.10.2017 + + +; + +Jammu +, +Kishtwar +, +Shasho Padder +( +33° 19.855′ N +, +076° 02.182′ E +, + +5260 ft. + +), +A.A. Buhroo +, + +09.09.2017 + + +; + +Kishtwar +( +33° 18.787′ N +, +075° 46.451′ E +, + +5610 ft. + +), +A.A. Buhroo +, + +10.09.2017 + + +; HT, AT and PTs deposited at KUIC; 2 PTs NHMW. + + + + +Type +locality: + +India +: +Kashmir +: +Srinagar +, +Harwan + + + + + +Hosts: + +Ficus palmata + +, + +Morus alba + +( +Moraceae +) + + + + +Etymology: +The species epithet + +squamosus + +refers to the presence of scale-like setae on the body. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF8F2D352DE9FDDC92E04BF0.xml b/data/03/DE/8F/03DE8F5DFF8F2D352DE9FDDC92E04BF0.xml new file mode 100644 index 00000000000..d2b32c8954c --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF8F2D352DE9FDDC92E04BF0.xml @@ -0,0 +1,174 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +22. + +Eidophelus indicus +( +Wood, 1989 +) + + + + + + +( +Figure 29 +) + + + + += + +Scolytogenes indicus +Wood, 1989 + + + +This species is diagnosed by the following morphological characters: +♂ +frons broadly convex, median line above eyes forming a transversely etched, indefinite summit; a transverse pair of widely spaced granules near middle, surface above finely rugose-reticulate, smooth and rough below; vestiture of fine, rather inconspicuous hair of moderate length; pronotum nearly as long as wide, widest on basal third, sides moderately arcuate, anterior margin rather broadly rounded; summit near middle, asperities on anterior slope rather coarse, finely closely punctured behind, punctures around summit slightly elevated to form granules; vestiture of rather short, recumbent hair; elytra 1.3× as long as pronotum and 1.2× as long as wide; striae not impressed, except weakly near declivity; strial punctures rather deep, small, in definite rows, somwhat confused near base on disc; interstriae almost twice as wide as striae, punctures near base resembling those on striae, punctures granulate towards declivity; declivity steep, broadly convex; sculpture about as on disc except interstriae 1 distinctly impressed, granules on all interstriae wider than on disc; vestiture consists of very minute strial hair and rows of erect, pointed bristles; each bristle as long as distance between rows, setae stout but not scale like, apical third of each tapered to a sharp point; a few short, scale-like setae also visible on declivity; body color dark brown, pronotum almost black; body length: +1.2 mm +, 2.30× as long as wide. + + + + +FIGURE 29 +. + +Eidophelus indicus + +. Holotype male: dorsal view +A +, lateral view +B +. (Courtesy: Smithsonian NMNH). + + + +Female similar to male except area behind pronotal summit apparently more granulate; small scale-like setae on elytral declivity more numerous. + + + +Material examined: + +Holotype +in NMNH (image), +Smithsonian Institution +, +Washington +, D.C. +USA +. Type locality: +Amarkantak +, +Rewah State, C. I. + +3500 ft. + +, FRI, Dehradun + + + + + +Distribution: +India +: Kashmir, +Uttarakhand +. Oriental region + + + + +Hosts: + +Hedera helix + +( +Araliaceae +), + +Moringa oleifera + +( +Moringaceae +), + +Wrightia tinctoria + +( +Apocynaceae +) + + + +Genus + +Ernoporus +Thomson, 1859 + + + + + +Ernoporus +species + +are diagnosed by the following morphological characters: body length: +1.4–2 mm +; eyes entire; club oval, with three procurved sutures; pronotum arched; anterior pronotum with concentric rows of asperities, + +forming a distinct summit, medial anterior pronotal margin with two or more protruding asperities; host: deciduous trees. + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF962D222DE9FA5A912B4F39.xml b/data/03/DE/8F/03DE8F5DFF962D222DE9FA5A912B4F39.xml new file mode 100644 index 00000000000..4a2a8119f63 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF962D222DE9FA5A912B4F39.xml @@ -0,0 +1,161 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +1. + +Pityophthorus cedri +Wood, 1989 + + + + + + +( +Figure 3 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons convex, shining, coarsely and closely punctured, subglabrous, with conspicuous, acute median carina; epistomal margin fringed with long, pale erect hairs, short sparse setae on frontal surface; the anterior margin of compound eye emarginate; pronotum as long as wide, widest slightly above base, narrowing anteriorly and sinuate before apex; anterior margin broadly rounded with six serrations; anterior half with a number of asperities arranged in concentric rows; pronotal disc shiny, closely and deeply punctured with a median impunctate area; pronotal surface with short, recumbent, blunt setae prominent laterally; scutellum shiny black, wider and broadly rounded; elytra slightly narrower at base than pronotum, wider apically, 1.51× as long as pronotum; sides straight on basal three-fourth, then constricted towards broadly rounded apex; the basal area with transverse rugosities, rest glabrous, punctate; strial punctures deeply round, 1 +st +striae distinctly impressed than others; punctures somewhat irregular on discal striae; interstriae glabrous, impunctate, nearly twice as wide as striae; elytral declivity distinctly shallowly sulcate from elevated sutural interstriae to interstriae 3; interstriae impunctate, 1–4 armed by small granules with filamentous setae over each granule; strial punctures minute; vestiture of fine, sparse setae, more prominent on sides and declivity, setae on interstriae 3 rather long; body length: +1.61–1.64 mm +, 2.51× as long as wide. + + + +FIGURE 3. + +Pityophthorus cedri + +. Female: dorsal view +A +; lateral view +B +; male: dorsolateral view +C +. + + + +Males are similar to females except serrations on anterior margin of pronotum and granules on elytral declivity distinctly larger; body length: +1.70–1.74 mm +, 2.58× as long as wide. + + +Remarks: This species differs from other Indian species of this genus by the moderately impressed elytral declivity, a conspicuous median carina present on frons of both sexes, and the more nearly concentric pronotal asperities ( +Wood 1989 +). + + + + +Material examined: + +New +record: +India +: +2 ♀ +′s, +2 ♂ +′s. +Jammu +, +Kishtwar +, +Kijaye Padder +( +33° 16.144′ N +, +076° 07.680 E +, + +6145 ft. + +), +A.A. Buhroo +, + +09.09.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: Jammu (new record), Kashmir, +Himachal Pradesh + + + + +Hosts: + +Cedrus deodara + +, + +Pinus gerardiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF992D222DE9FB9190684CCD.xml b/data/03/DE/8F/03DE8F5DFF992D222DE9FB9190684CCD.xml new file mode 100644 index 00000000000..043a1b88559 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF992D222DE9FB9190684CCD.xml @@ -0,0 +1,123 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +2. + +Pityophthorus chilgoza +Wood, 1989 + + + + + + +( +Figure 4 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons flat from eye to eye, finely, rather closely punctured near margins, ornamented by a marginal fringe of long hairs, setae in central area sparse to obsolete and much shorter; the anterior margin of compound eye emarginate; pronotum almost as long as wide; sides on basal half sub-straight, rather narrowly rounded anteriorly, anterior margin armed by four serrations, median pair much longer; anterior half asperate, asperities smaller and more confused than in other Indian species; posterior areas smooth, shining, rather finely, not closely punctured; glabrous except for sparse setae near margins; scutellum somewhat sub-triangular, elytra 1.8× as long as wide; sides almost straight and parallel on basal two-thirds, rather narrowly rounded posteriorly; striae not impressed, punctures moderately large, deep; interstriae nearly one and a half times as wide as striae, smooth, shining, impunctate; declivity rather steep, weakly bisulcate; strial punctures minute, interstriae 2 widened, smooth, shining, impunctate, 3 unarmed, a few small punctures evident; vestiture of minute strial hair and, on declivity, a few short, erect, interstrial setae; body length: +1.4 mm +, 2.70× as long as wide. + + +Male similar to female except frons somewhat convex, its surface irregularly rugose punctate, shining with a short, acute median carina; body length: +1.45 mm +. + + +Remarks: Although this species resembles + +P. deodara + +in appearance, they are not closely related. It may be distinguished by the long pubescence on the female frons, the absence of a carina on the female frons, the less strongly (shallowly) impressed declivital sulcus, and the much more confused arrangement of smaller pronotal asperities. + + + + +Material examined: +Holotype +♀ +and + +Allotype +in Smithsonian NMNH, USA (images). Type locality: Kilba ( + +7000 ft. + +), +U. Bashahr Div. +, Punjab, +India + + + + + +Distribution: +India +: +Himachal Pradesh + + + + +Hosts: + +Pinus gerardiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF9A2D262DE9FC4996184E77.xml b/data/03/DE/8F/03DE8F5DFF9A2D262DE9FC4996184E77.xml new file mode 100644 index 00000000000..8fabfe20b10 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF9A2D262DE9FC4996184E77.xml @@ -0,0 +1,231 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +5. + +Cryphalus himalayensis + +sp. nov. + + + + + +( +Figure 8 +) + + + + +Diagnosis: +This species can be distinguished from other + +Cryphalus +species + +that are similar to it by its size ( +1.38– 1.43 mm +), proportions (2.15× as long as wide), the male frons with a transverse carina, the female frons with somewhat triangular elevation medially, many scale-like (feather-like) setae on the pronotal disc extending to the lateral margins, and darker elytra with barely apparent striae. + + + +C. himalayensis + + +sp. nov. + +is very similar +to + +C. morivorus +Johnson, 2020 + +and can be distinguished by the number of pronotal marginal asperities (four in + +C. himalayensis + + +sp. nov. + +versus six in + +C. morivorus + +), the sculpture of female frons (rugose and with triangular, broad, medial elevation in + +C. himalayensis + + +sp. nov. + +versus shining, smooth in + +C. morivorus + +), and the elytral bristles (rounded at apices in + +C. himalayensis + + +sp. nov. + +versus pointed at apices in + +C. morivorus + +). + + + + +Description: +The species description is based on the following morphological characters: +♀ +frons broadly plano-convex; surface somewhat reticulate with minute granules; a black, shining tubercle-like elevation on medial area; vertex somewhat convex, finely reticulate punctate; epistomal margin with a fringe of long, pale hairs; sparse pale, hairs on entire frontal surface; eyes oval, slightly emarginate anteriorly; antennal scape long, funicle four-segmented, club oval with three straight to weakly procurved sutures; pronotum light brown, 1.14× wider than long; sides widest slightly above base, arcuately converging and rounded in front, lateral margins marked by a distinct carina, anterior margin armed by four distinctly spaced serrations, median pair large and longer; pronotum steeply arched, summit slightly behind middle; pronotal anterior two-third with more than fifty asperities, asperities distinctly sharp and longer, moderately spaced, areas between asperities glossy with obscure minute punctures and a mixture of pale, short, fine and moderately longer hair-like setae; posterior one-third with minute, rugose punctures, with dense pale, minute feathery scales (nearly 1.5× as long as wide) and sparse, longer hair-like setae with rounded apices; suture between pronotum and elytra almost straight; scutellum small, broadly triangular; elytra 1.18× as long as wide,1.47× as long as pronotum, usually darker than pronotum; sides parallel on more than basal two-thirds, rounded towards apex with no clear transition to the declivity; elytral texture rugose, striae weakly visible as rows of slightly larger punctures and fine, white, hair-like setae; interstriae irregularly rugose marked by somewhat smaller punctures; interstrial vestiture with rows of moderately longer, sparse whitish erect bristles, widened and rounded at tips, pointing posteriorly and ground cover of two to three rows of minute, tridentate scales, with a weak iridescence; procoxae with sparse, somewhat longer hair-like setae; protibiae and protarsi with short, hair-like setae; mesocoxae moderately separated, more than distance between metacoxae; abdominal ventrites with pale, dense, moderately long hair-like setae; body length: +1.43 mm +, 2.15× as long as wide. + + + +FIGURE 8. + +Cryphalus himalayensis + + +sp. nov. + +Holotype female: dorsal view +A +, lateral view +B +, frons +C +; Allotype male: dorsal view +D +, ventral view +E +, frons +F +. + + + +Male similar to female except: body length: +1.38 mm +, 2.10× as long as wide; frons with a distinct, shining transverse carina above the level of eyes; pronotal asperities slightly less numerous; elytra slightly less rugose than female; protibiae and protarsi with only hair-like setae, almost same as in female; last abdominal ventrite clearly emarginated; pronotal profile rounded triangular, somewhat more protruding apically than in female. + + + + +Material examined: + +India +: +Holotype +: +♀ +Kashmir, Srinagar, Hazratbal (University Campus), ( +34° 07′51.10 ′′ N +, +074° 50′ 01.09′′ E +, + +5220 ft. + +), +A.A. Buhroo +, + +10.08.2019 + +( +KUIC +) + +. +Allotype +, +♂ +: the same site and date as HT; HT and AT deposited at KUIC; 2 PTs NHMW. + + + + +Type +locality: + +India +: +Kashmir +: +Hazratbal Srinagar +(University Campus) + + + + + +Hosts: + +Ficus palmata + +( +Moraceae +) + + + + +Etymology: +The species epithet is in reference to the Himalayan distribution. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF9B2D212DE9F9D790034AF4.xml b/data/03/DE/8F/03DE8F5DFF9B2D212DE9F9D790034AF4.xml new file mode 100644 index 00000000000..0390db732cf --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF9B2D212DE9F9D790034AF4.xml @@ -0,0 +1,120 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +4. + +Cryphalus fulmineus +Wood, 1989 + + + + + + +( +Figure 7 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons very broadly convex, a slight, almost flat impression in median area just above epistoma; vertex without a transverse carina; surface rather strongly reticulate; punctures moderately coarse, indistinct; antennal club rather broad, sutures distinctly procurved; pronotum slightly wider than long; sides sub-parallel and feebly arcuate on basal half, gradually narrowing anteriorly; anterior margin armed by six serrations, median pair usually much larger; summit slightly behind middle, asperities on anterior half rather coarse, moderately abundant; posterior areas with fine granules and few obscure punctures in lateral areas; vestiture hair-like, erect, not abundant, longer near anterior and lateral margins; elytra 1.3× as long as wide and 1.7× longer than pronotum; sides almost straight and parallel on more than basal two-thirds, rather broadly rounded towards apex; striae not impressed, with shallow, distinct, punctures not closely placed; interstriae somewhat smooth and more than three times wider than striae, with very fine, numerous punctures; declivity steep, convex; elytral vestiture consisting of a ground cover of abundant, short scales, each scale slightly longer than wide; rows of erect setae extend almost to base, each moderately slender and placed in rows on interstriae; body length: 2.0 mm, 2.26× as long as wide. + + +Male similar to female but somewhat smaller in size, with slightly smaller pronotal asperities; body length: +1.8 mm +. + + + + +Material examined: + +Allotype +♀ +in FRI Dehradun. Type localities: +Tharali +, +Garwal +, +Uttarakhand +(U.P.) and +Jubal +, +Simla +, +Himachal Pradesh +, +India + + + + + +Distribution: +India +: +Himachal Pradesh +, +Uttarakhand + + + + +Hosts: + +Alnus nitida + +( +Betulaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF9D2D272DE9FA5B91F14FA7.xml b/data/03/DE/8F/03DE8F5DFF9D2D272DE9FA5B91F14FA7.xml new file mode 100644 index 00000000000..415a3e53b95 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF9D2D272DE9FA5B91F14FA7.xml @@ -0,0 +1,183 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +6. + +Cryphalus major +Stebbing, 1903 + + + + + + +( +Figure 9 +) + + += +morinda +Stebbing, 1903 + + +This species is diagnosed by the following morphological characters: +♀ +frons broadly convex, surface finely punctured, smooth and shining at middle, somewhat reticulate towards eyes; vertex convex, with a weak, shiny, transverse carina on median third, reticulate above carina; epistomal margin with a fringe of erect hairs medially; vestiture of fine, sparse hairs, restricted to area below carina; eyes anteriorly emarginate; antennal funicle with five segments, club flat oblong, with three slightly recurved sutures, marked by setae; pronotum 1.36× wider than long; sides sub-parallel and feebly arcuate on basal half, narrowing anteriorly; anterior margin armed by four serrations, median pair large and longer; pronotum steeply arched, summit slightly behind middle; asperities on anterior two-third distinct and longer, less numerous (30–35), areas between asperities shiny; posterior one-third with small, regular, close punctures, with dense minute feathery scales; sparse somewhat long setae on pronotal surface, more longer anteriorly and laterally; scutellum indistinctly visible; elytra 1.51× as long as wide and twice as long as pronotum; sides almost straight and parallel on more than basal two-thirds, rather broadly rounded towards apex; striae 1 slightly impressed, strial punctures shallow, distinct, close placed in rows becoming obscure towards declivity; interstriae somewhat smooth and more than three times wider than striae, with very fine, numerous punctures; interstriae clothed with three to four rows of minute, light dense, trifid scales and sparse long, erect hair-like setae; declivity moderately steep, convex; strial punctures irregular on declivity, vestiture same as on disc; procoxae with sparse, longer hair-like setae; protibiae and protarsi with short intermixed with few long, hair-like setae; abdominal ventrites with fine, recumbent hair-like setae; body blackish; body length: +1.65 mm +, 2.29× as long as wide. + + + +FIGURE 9. + +Cryphalus major + +. Male: dorsal view +A +, lateral view +B +; female: fronto-lateral view C. + + + +Male similar to female except being somewhat smaller in size ( +1.40–1.46 mm +long, 2.18× as long as wide) and yellowish brown in color. + + + + +Material examined: + +New +records: +India +: +1 ♀ +, +3 ♂ +′s. +Himachal Pradesh +, +Kandaghat Solan +( +30° 58.278 N +, +077° 06.726′ E +, + +5110 ft. + +), +A.A. Buhroo +, + +10.07.2011 + +( +KUIC +). +Himachal Pradesh +, +Dalhousie +, +Banikhet +( +32° 32.939 N +, +075° 57.027′ E +, + +5490 ft. + +), +A.A. Buhroo +, + +27.09.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, +Uttarakhand + + + + +Hosts: + +Picea smithiana + +, + +Pinus roxburghii + +, + +P. wallichiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF9E2D252DE9FA5D912B4CD3.xml b/data/03/DE/8F/03DE8F5DFF9E2D252DE9FA5D912B4CD3.xml new file mode 100644 index 00000000000..4c30bafe197 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF9E2D252DE9FA5D912B4CD3.xml @@ -0,0 +1,113 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +9. + +Crypturgus beesoni +Eggers, 1936 + + + + + + +( +Figure 12 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons slightly convex with fine, dense punctures; vestiture of short, fine hairs; pronotum 1.44× as long as wide, sides almost parallel, anterior margin broadly rounded, postero-lateral corners somewhat rounded; surface slightly convex, shiny, without a clear median line; punctures dense, clear, but not coarse; elytra 1.90× as long as pronotum and 1.66× as long as wide; basal margin clearly wider than pronotum, lateral sides parallel, narrowly rounded towards apex; disc somewhat convex with slightly impressed striae; strial punctures small, round, dense and shallow; interstriae slightly wider than striae, smooth, shiny with extremely fine, dense punctures; declivity convex, moderately steep; body vestiture consists of fine and short hairs, longer throughout the body margins; body dark brown; body length: 1.0 mm. + +Female similar to male, except sides of pronotum somewhat bulging laterally, elytral apex almost rounded in a semicircle. + + + +Material examined: + +Lectotype +♂ +in NMNH (image), +Smithsonian Institution +, +Washington +, D.C. +USA +. Type locality: +Kashmir + + + + + +Distribution: +India +: Kashmir, +Uttarakhand +. + + + + +Hosts: + +Cedrus deodara + +, + +Pinus roxburghii + +( +Pinaceae +). + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFF9F2D242DE9FC9F91B34CD0.xml b/data/03/DE/8F/03DE8F5DFF9F2D242DE9FC9F91B34CD0.xml new file mode 100644 index 00000000000..5867e39b972 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFF9F2D242DE9FC9F91B34CD0.xml @@ -0,0 +1,186 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +8. + +Cryphalus strohmeyeri +Stebbing, 1914 + + + + + + +( +Figure 11 +) + + + + + += +indicus +Stebbing, 1902 + + + +This species is diagnosed by the following morphological characters: +♀ +frons plano-convex; surface coarsely reticulate with some sparse minute granules, a short median carina just above epistoma, feebly impressed on either sides; vertex finely reticulate; frontal surface with sparse fine hairs, longer and denser towards epistoma, epistomal margin with fringe of pale yellow hairs at middle; eyes oval, emarginated anteriorly on less than one-third of its width; antennal scape long, funicle with four segments; club flat, oval with three straight or slightly procurved sutures marked by pale, short hairs; pronotum 1.18× as wide as long, widest slightly above base; lateral sides rounded gently narrowing anteriorly towards rounded apex; anterior margin set with six to seven distinctly spaced asperities; pronotal summit distinctly humped and placed more towards base, anterior slope steeply declivous with approximately fifty distinct, irregularly placed asperities, denser towards summit; prontal disc less than one-fourth the length of pronotum, surface below summit and postero-laterally somewhat impressed and reticulate with fine granules; entire surface with erect, fine hairs longer anteriorly and laterally; scutellum small, triangular; elytra 1.80× as long as pronotum; elytral base wider than pronotum and the suture between pronotum and elytra sinuate; lateral sides widest at base converging posteriorly with rather broadly rounded apex; elytral disc somewhat convex; striae narrow marked by small, closely placed punctures, distinctly indicated almost up to declivity, each with a microhair; interstriae more than three times wider than striae; interstrial surface with dense coat of minute, feather-like scales and fine punctures; each interstria with a row of erect, hair-like bristles with pointed apices, denser and longer laterally; declivity rounded and sloping with uneven surface, interstriae relatively of variable width with same vestiture as on disc; procoxae with sparse, somewhat longer hair-like setae; protibiae and protarsi with short, hair-like setae; mesocoxae moderately separated, more than distance between metacoxae; abdominal ventrites with fine, short hair-like setae; head and pronotum dark-brown, elytral vestiture translucent yellow-brown with a weak iridescence; body length: +1.91–1.94 mm +, 2.10× as long as wide. + + + + +Male similar to the female, except pronotal asperities slightly smaller; body length: +1.87–1.90 mm +, 1.96× as long as wide. + + + + +Material examined: + +New +records: +India +: +3 ♀ +′s, +4 ♂ +′s. +Kashmir +, +Baramulla +, +Monkey Hill Gulmarg +( +34° 02′50.97′′ N +, +074° 22′53.63′′ E +, + +8900 ft. + +), +A.A. Buhroo +, + +13.08.2015 + +( +KUIC +). +Kashmir +, +Baramulla +, +Check +post +Gulmarg +( +34° 03.797′ N +, +074° 24.948′ E +, + +7552 ft. + +), +A.A. Buhroo +, + +25.05.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: Kashmir, Uttarakhund, +West Bengal +. +China +: +Sichuan +, +Yunnan +, +Xizang + + + + +Hosts: + +Abies densa + +, + +A. pindrow + +, + +Pinus wallichiana + +( +Pinaceae +). + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA02D182DE9F96190614E2A.xml b/data/03/DE/8F/03DE8F5DFFA02D182DE9F96190614E2A.xml new file mode 100644 index 00000000000..6df79a159cd --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA02D182DE9F96190614E2A.xml @@ -0,0 +1,153 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +39. + +Polygraphus setosus +Schedl, 1979 + + + + + + +( +Figure 50 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons transversely depressed, with indistinct fine punctures and short fine hairs, longer and denser on epistomal margin, a pair of median transversely set tubercles at the upper level of eyes; pronotum 1.63× wider than long with a distinct, median, longitudinal, impunctate line upto basal two-third, anterior-third with a transverse coller-like depression; surface shiny, convex with fine punctures, each puncture with recumbent fine hair; basal margin with a sharp transverse ridge; scutellum indistinct; elytra 1.57× as long as its width, 2.56× as long as pronotum, lateral sides subparallel, converging into a rounded apex; anterior margin distinctly asperate throughout, surface convex and roughened with some granules; discal striae 1, 2 and 3 with some granules and those on others indistinct but with roughened surface; interstria 1 distinctly marked up to apex, interstria 2 distinct upto declivity and rest feebly marked; interstrial surface with a row of widely spaced long, erect, scale-like setae and ground cover of very short blunt, feathery scales and fine hairs; declivity distinct on posterior third, surface weakly convex, but sharply declivous with distinct scale-like setae; interstriae 1, 2 and 3 with some granules; striae 1, 2 and 3 somehow prominent, rest indistinct; head and pronotum black, elytra dark-brown; body length: +2.28 mm +, 2.32× as long as wide. + + + +FIGURE 50. + +Polygraphus setosus +. + +Female: dorsal view +A +, lateral view +B +; male: lateral view +C +. + + + +Male frons shallowly concave with sparse, hairs becoming longer on upper, lateral and epistomal margins and without a pair of tubercles on frons; body lenth: +2.23–2.30 mm +. + + + + +Material examined: + +New +records: +India +: +2 ♂ +′s, +1 ♀ +. +Himachal Pradesh +, +Dalhousie +, +Banikhet +( +32° 32.939 N +, +075° 57.027′ E +, + +5490 ft. + +), +A.A. Buhroo +, + +27.09.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Punjab, +Uttarakhand + + + + +Hosts: + +Pinus roxburghii + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA12D1A2DE9FF6897724DFF.xml b/data/03/DE/8F/03DE8F5DFFA12D1A2DE9FF6897724DFF.xml new file mode 100644 index 00000000000..290aef42f81 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA12D1A2DE9FF6897724DFF.xml @@ -0,0 +1,385 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +37. + +Polygraphus major +Stebbing, 1903 + + + + + + +( +Figure 48 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons plano-concave, with shiny surface and dense punctures throughout; tufts of long hairs around the upper margin of concavity almost touching each other at the middle of frons; eyes deeply emarginated; antennal club acute; pronotum 1.26× wider than long with distinct median line; basal margin substraight, lateral sides somewhat convex; surface shiny with dense punctures and scale-like setae; scutellum indistinct; elytra 1.52× as long as its width, 1.90× as long as pronotum, lateral sides subparallel upto basal three fourth, narrowing posteriorly with rounded apex; stria 1 distinctly impressed; other striae marked by minute shallow punctures, each with a microhair; interstriae with irregular minute punctures and granules, with vestiture of short scale-like setae; declivity convex and declivital interstriae 1 elevated, with uniseriate sparse granules intermixed with punctures; body dark-brown, body length: +3.33–3.40 mm +, 2.46× as long as wide. + + + +FIGURE 48. + +Polygraphus major +. + +Female: dorsal view +A +, lateral view +B +; male: dorso-lateral view +C +. + + + +In males, the frons is without tufts of hairs but has a pair of closely placed tubercles on the middle of the frons; body length: +3.10–3.17 mm +. + + +Remarks: The species can be distinguished from + +P. aterrimus + +by its tuft of hairs on frons. + + + + +Material examined: + +New +records: +India +: +9 ♂ +′s, +4 ♀ +′s. +Kashmir +, +Budgam +, +Yousmarg +( +33° 50.015′ N +, +074° 40.131′ E +, + +7955 ft. + +), +A.A. Buhroo +, + +29.06.2011 + +( +KUIC +) + +. + +Kashmir +, +Verinag +, +Halan +( +33° 29.365′ N +, +075° 16.394′ E +, + +7132 ft. + +), +A.A. Buhroo +, + +29.06.2011 + +( +KUIC +) + +. + +Jammu +, +Ramban +, +Batote +( +33° 06.844′ N +, +075° 18.512′ E +, + +5318 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Baramulla +, +Tangmarg Dharhama +( +34° 03.121′ N +, +074° 28.377′ E +, + +7955 ft. + +), +A.A. Buhroo +, + +25.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Marsary +( +34° 27.264′ N +, +074° 00.987′ E +, + +6750 ft. + +), +A.A. Buhroo +, + +09.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Tangdhar +( +34° 23.527′ N +, +073° 51.894′ E +, + +6525 ft. + +), +A.A. Buhroo +, + +10.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Anantnag +, +Daksum +( +33° 36.120′ N +, +075° 27.595′ E +, + +8975 ft. + +), +A.A. Buhroo +, + +08.09.2017 + +( +KUIC +) + +. + +Kashmir +, +Bandipora +, +Mastan Gurez +( +34° 37.728′ N +, +074° 50.378′ E +, + +8410 ft. + +), +A.A. Buhroo +, + +17.08.2018 + +( +KUIC +) + +. + +Kashmir +, +Bandipora +, +Chorwan Gurez +( +34° 39.242′ N +, +074° 53.581′ E +, + +8275 ft. + +), +A.A. Buhroo +, + +17.08.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Punjab, +Jammu and Kashmir +, +Uttarakhand +. +Bhutan +, +China +, +Nepal +. + + + + +Hosts: + +Abies pindrow + +, + +Cedrus deodara + +, + +Picea smithiana + +, + +Pinus gerardiana + +, + +P. wallichiana + +( +Pinaceae +). + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA12D1B2DE9F8D396AC4D69.xml b/data/03/DE/8F/03DE8F5DFFA12D1B2DE9F8D396AC4D69.xml new file mode 100644 index 00000000000..8bd6617a1d7 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA12D1B2DE9F8D396AC4D69.xml @@ -0,0 +1,369 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + + +38. + +Polygraphus pini +Stebbing, 1914 + + + + + + + +( +Figure 49 +) + + + + + += +minor +Stebbing, 1903 + + + +This species is diagnosed by the following morphological characters: +♂ +frons shallowly concave, surface shiny with punctures, denser towards epistoma; thick, curled tuft of hairs, touching each other at the middle of frons, covering frontal two-third portion; pronotum 1.3× wider than long; surface shiny, median line inconspicuous, with distinct, dense punctures and moderately fine hairs; scutellum submerged; elytra 1.54× as long as its width, 2.1× as long as pronotum, basal margin weakly crenulate; discal striae 1 and 2 distinctly impressed up to the commencement of declivity; striae marked by shallow punctures; interstriae nearly three times as wide as striae, surface roughened, marked with small granules, becoming distinct towards declivity and covered with irregular rows of short scale-like setae; declivity strongly convex; striae 1 and 2 indistinct; interstria 1 marked by granules and scale-like setae; interstria 2 terminating at the commencement of declivity, others also well marked with small granules; body dark-brown, body length: +2.10–2.16 mm +, 2.46× as long as wide. + + + + +FIGURE 49. + +Polygraphus pini + +. Male: dorsal view +A +, lateral view +B +; female: dorsal view +C +. + + + + +Females are similar to males but the frons is devoid of any tuft of hairs but with a pair of tubercles at its middle; elytral interstriae are roughened with somewhat distinct granules; body length: +2.49–2.63 mm +. + + + + +Material examined: + +New +records: +India +: +5 ♂ +′s, +5 ♀ +′s. +Kashmir +, +Anantnag +, +Achabal +(33° 40′58.74′ N, 075° 13′22.89′ E, + +5505 ft. + +), +A.A. Buhroo +, + +09.08.2011 + +( +KUIC +) + +. + +Jammu +, +Ramban +, +Batote +( +33° 06.844′ N +, +075° 18.512′ E +, + +5318 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +) + +. + +Jammu +, +Ramban +, +Dugalaid Batote +( +33° 07.053′ N +, +075° 18.967′ E +, + +5420 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Tangdhar +( +34° 23.527′ N +, +073° 51.894′ E +, + +6525 ft. + +), +A.A. Buhroo +, + +10.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Anantnag +, +Daksum +( +33° 36.120′ N +, +075° 27.595′ E +, + +8975 ft. + +), +A.A. Buhroo +, + +08.09.2017 + +( +KUIC +) + +. + +Kashmir +, +Baramulla +, +Boniyar +( +34° 07.405′ N +, +074° 10.717′ E +, + +5715 ft. + +), +A.A. Buhroo +, + +30.09.2017 + +( +KUIC +) + +. + +Kashmir +, +Bandipora +, +Chorwan Gurez +( +34° 39.242′ N +, +074° 53.581′ E +, + +8275 ft. + +), +A.A. Buhroo +, + +17.08.2018 + +( +KUIC +) + +. + +Kashmir +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +30.08.2018 + +( +KUIC +) + +. + +Himachal Pradesh +, +Dalhousie +, +Banikhet +( +32° 32.939′ N +, +075° 57.027′ E +, + +5490 ft. + +), +A.A. Buhroo +, 27.092018 ( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, +Jammu and Kashmir +, Punjab, +Uttarakhand + + + + +Hosts: + +Abies pindrow + +, + +Cedrus deodara + +, + +Picea smithiana + +, + +Pinus wallichiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA32D192DE9FA9E93384E51.xml b/data/03/DE/8F/03DE8F5DFFA32D192DE9FA9E93384E51.xml new file mode 100644 index 00000000000..932a84038c6 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA32D192DE9FA9E93384E51.xml @@ -0,0 +1,221 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +40. + +Polygraphus trenchi +Stebbing, 1905 + + + + + + +( +Figure 51 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons plano-concave, surface shiny; two prominent, reddish-golden brushes of long hairs around the upper and lateral margins of frons, curled inwards and downwards without intersecting medially to about halfway and then continue in two thin strands, a few separate hairs covering the inner surface of eyes also meet the thin strands; antennal club ovate with pointed apex; pronotum 1.38× wider than long; lateral sides somewhat rounded on the basal half, narrowly constricted towards anterior third; a median conspicuous longitudinal raised line on pronotum, surface shining with minute punctures each with a fine hair, lateral margins set with moderate scales; scutellum depressed; elytra 1.43× as long as its width, twice as long as pronotum; basal margin crenulate, lateral sides somewhat parallel on basal two third, converging posteriorly into a rounded apex; striae narrow, marked with small round punctures on basal half of disc becoming much smaller posteriorly, striae 1 more impressed upto declivity; interstriae nearly four times wider than striae with close, fine granulations becoming larger and wider apart in apical fourth, interstrial surface with dense short scale-like setae; declivity convex with rows of minute interstrial granules; body moderately shining, dark brown; body length: +3.08–3.15 mm +, 2.44× as long as wide. + + +Males are smaller than females; frons has few sparse yellow hairs and two small, median tubercles, placed transversely; body length: +2.90–2.97 mm +. + + + +FIGURE 51. + +Polygraphus trenchi + +. Male: dorsal view +A +, lateral view +B +; female: dorsal view +C +, lateral view +D +. + + +Remarks: The position and configuration of frontal brushes in females serve as a diagnostic feature in the identification of this species. + + + +Material examined: + +New +records: +India +: +2 ♂ +′s, +2 ♀ +′s. +Jammu +, +Kishtwar +, +Kundhal Padder +( +33° 18.820′ N +, +076° 04.492′ E +, + +7000 ft. + +), +A.A. Buhroo +, + +09.09.2017 + +( +KUIC +). +Jammu +, +Kishtwar +, +Kijaye Padder +( +33° 16.144′ N +, +076° 07.680 E +, + +6145 ft. + +), +A.A. Buhroo +, + +09.09.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: Jammu (new record), +Punjab +, +Pakistan + + + + +Hosts: + +Pinus gerardiana + +( +Pinaceae +) + + +Phylogenetic assessment +: + + +The phylogenetic treatment of the Himalayan + +Polygraphus + +along with other closely related species was carried out using the COX-1 genes to examine the monophyly and sister groups of each species ( +Fig. 52 +). The NJ tree showed that + +P. trenchi + +populations are monophyletic with + +P. proximus +Blandford, 1894 + +populations distributed in +Russia +and that they differ from them by 14.73–14.89%, while + +P. pini + +populations formed a separate monophyletic cluster with well-supported bootstrap values and that their intraspecific nucleotide difference was between 0.5–1.92%. The research also revealed that + +P. trenchi + +and + +P. major + +differed by 14.07%, whilst + +P. major + +and + +P. pini + +were 15.37% dissimilar. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA52D1F2DE9FD4C90C04AF4.xml b/data/03/DE/8F/03DE8F5DFFA52D1F2DE9FD4C90C04AF4.xml new file mode 100644 index 00000000000..ebefb93b968 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA52D1F2DE9FD4C90C04AF4.xml @@ -0,0 +1,215 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +41. + +Scolytus kashmirensis +Schedl, 1958 + + + + + + +( +Figure 53 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons plano-concave, surface rugose punctate except a median smooth area, a short median raised line above epistoma upto the smooth area; lateral margins of frons with two parallel rows of long, erect setae; eyes much elongated with a wide shallow emargination anteriorly; pronotum as wide as long (1.03×), constricted and impressed near the anterior margin; surface shiny with minute punctures on pronotal disc, denser towards apex; pronotum black on anterior 2/3, posterior 1/3 of pronotum and elytra light brown in color (with some black shade in the middle of each elytra); scutellum set deeply in scutellar impression, covered with elongated scale-like white setae; elytra 1.11× as long as its width, 1.20× as long as pronotum, strial and interstrial punctures somewhat large, round and shallow, nearly equal in size; the 2 +nd +abdominal ventrite near its anterior border with a low blunt tooth-like structure, posterior margin armed with a lip-like extension in the middle, with a knobbed tooth on each side; lateral sides of pronotum, posterior portion of elytra, 1 +st +, 2 +nd +and 5 +th +abdominal ventrites, and hind legs covered by long hair-like setae, setae much longer on posterior elytra and hind legs; body lenth: +3.72–4.30 mm +, 2.38× as long as wide. + + + +FIGURE 53. + +Scolytus kashmirensis + +. Male: dorsal view +A +, abdominal declivity +B +; female: dorsal view +C +, abdominal declivity +D +. + + + +In females, the median tooth on the 2 +nd +abdominal ventrite is much larger, the lip-like structure is strongly reduced, the lateral teeth on the posterior border much smaller and farther apart from each other; frons is covered by sparse hair-like setae throughout; body length: +4.24 mm +. + + + + +Material examined: + +New +records: +India +: +2 ♂ +′s, +1 ♀ +. +Kashmir +, +Anantnag +, +Danter +( +33° 43′34.07′′ N +, +075° 09′13.58′′ E +, + +5270 ft. + +), +A.A. Buhroo +, + +01.08.2011 + +( +KUIC +) + +. + +Kashmir +, +Anantnag +, +Halan Verinag +( +33° 29.365′ N +, +075° 16.394′ E +, + +7132 ft. + +), +A.A. Buhroo +, + +22.08.2012 + +( +KUIC +) + +. + +Kashmir +, +Anantnag +, +Thajiwara Bijbehara +( +33° 47.59′ N +, +075° 08.67′ E +, + +5420 ft. + +), +A.A. Buhroo +, + +07.09.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: Kashmir + + + + +Hosts: + +Ulmus villosa + +, + +U. wallichiana + +( +Ulmaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA62D1D2DE9FF6890F24D38.xml b/data/03/DE/8F/03DE8F5DFFA62D1D2DE9FF6890F24D38.xml new file mode 100644 index 00000000000..bf1b8960678 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA62D1D2DE9FF6890F24D38.xml @@ -0,0 +1,176 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +44. + +Scolytus stepheni +Mandelstam and Petrov, 2010a + + + + + + +( +Figure 56 +) + + +This species is diagnosed by the following characters: +♂ +frons flat, longitudinally aciculate, its surface with fine pale hair-like setae; lateral parts of frons near eyes covered by denser and longer hair-like setae; vertex deeply punctured; pronotum reddish-brown, wider than long; lateral sides parallel for most of their length, gently rounded towards apex; apical pronotum with a weakly developed constriction; pronotal surface shiny with small punctures, larger on anterior portion; scutellum triangular with weak scutellar impression; elytra reddish-brown, rather shining, as wide as pronotal base and 1.12× as long as its width, 1.5× as long as pronotum; elytral base slightly elevated; striae slightly impressed, strial punctures round, closely placed; interstriae flat with smaller punctures and less closely placed than striae; sub apical elytral constriction distinct; prior to apex, elytra with faint impression with irregularly set punctures; pale sparse erect hair-like setae near elytral apex; 5 +th +abdominal ventrite laterally thickened on posterior margin with two strong adjacent conical projections, each with a bundle of golden hair-like setae; body length: +4.6 mm +, 2.40× as long as wide. + + + +FIGURE 56. + +Scolytus stepheni + +. Female: dorsal view +A +, lateral view +B +. + + + +The female similar to male except larger in size; the frons is more convex, uniformly punctured, and evenly covered with short and less dense hairs; the 5 +th +abdominal ventrite has weakly developed callous-like elevations with short hair-like setae not forming bundles. + + + + +Material examined: +Non-type specimens in FRI Dehradun. Locality: Pahalgam, +7000 ft +, Lidar valley, Kashmir, C.F.C. Beeson, +07.06.1928 + + + + +Distribution: +India +: Kashmir + + + + +Hosts: + +Ulmus wallichiana + +( +Ulmaceae +) + + +Phylogenetic assessment: + + +A phylogenetic analysis of + +Scolytus nitidus + +, + +S. kashmirensis + +, + +S. rugulosus +( +Müller, 1818 +) + +, + +S. amygdali +Guérin-Méneville, 1847 + +and other closely related species was performed using the COX-1 genes to determine the monophyly and sister groups of each species ( +Fig. 57 +). According to the NJ tree, + +S. nitidus + +and + +S. amygdali + +formed sister clades with well-supported bootstrap values, and the interspecific nucleotide difference between the two clades was greater than 10%. The two species came together to create a distinct monophyletic group. The tree also showed that + +S. kashmirensis + +and + +S. obelus +Wood, 1962 + +formed distinct clades. Together, + +Scolytus regulosus + +and + +S. intricatus +( +Ratzeburg, 1837 +) + +formed a monophyletic cluster. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA72D1C2DE9FE9193834C86.xml b/data/03/DE/8F/03DE8F5DFFA72D1C2DE9FE9193834C86.xml new file mode 100644 index 00000000000..c7077cd1b39 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA72D1C2DE9FE9193834C86.xml @@ -0,0 +1,380 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +43. + +Scolytus nitidus +Schedl, 1936a + + + + + + +( +Figure 55 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons flat, longitudinally aciculated, with a dense brush of yellowish hair-like setae on either sides sloping from vertex to epistoma; antennal club elliptical with acutely procurved suture, surface with minute, dense pubescence; pronotum slightly wider than long (1.05×), lateral sides somewhat parallel upto middle, moderately narrowing towards substraight anterior margin; anterior pronotum with a subapical coller-like constriction; surface shiny black,with minute and widely separated punctures; scutellum large, scutellar impression covered by white long hair-like setae; elytra dark red brown, 1.09× as long as its width, 1.16× as long as pronotum; elytral strial punctures moderately large, round and shallow, interstrial punctures slightly widely placed than strial punctures; a small subapical elytral constriction visible; 2 +nd +abdominal ventrite ascending abruptly and perpendicularly with a minute pointed tubercle in the middle near its posterior border; body length: +3.08–3.34 mm +, 2.40× as long as wide. + + + +FIGURE 55. + +Scolytus nitidus + +. Male: dorsal view +A +, lateral view +B +; female: dorsal view +C +, fronto-lateral view +D +. + + + +The female similar to male but can be distinguished by somewhat convex frons with sparse long hair-like setae on its surface; the abdominal tubercle is slightly larger in +♂ +than in +♀ +; body length: +3.58–3.64 mm +. + + + + +Material examined: + +New +records: +India +: +7 ♂ +′s, +3 ♀ +′s. +Kashmir +, +Srinagar +, +Zakura +( +34° 09′31.49′′ N +, +074° 50′01.04′′ E +, + +5272 ft. + +), +A.A. Buhroo +, + +24.09.2012 + +( +KUIC +) + +. + +Kashmir +, +Baramulla +, +Darkash Tangmarg +( +34° 02.676′ N +, +074° 28.360′ E +, + +6888 ft. + +), +A.A. Buhroo +, + +25.5.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Tangdhar +( +34° 23.527′ N +, +073° 51.894′ E +, + +6365 ft. + +), +A.A. Buhroo +, + +10.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Semari Teetwal +( +34° 25.032′ N +, +073° 48.148′ E +, + +3670 ft. + +), +A.A. Buhroo +, + +11.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Ganderbal +, +Nuner +( +34° 12′56.26′′ N +, +074° 47′00.90′′E +, + +5259 ft. + +), +A.A. Buhroo +, + +18.09.2020 + +( +KUIC +) + +. + +Kashmir +, +Baramulla +, +Salamabad Uri +( +34° 05.186′ N +, +074° 01.765′ E +, + +4415 ft. + +), +A.A. Buhroo +, + +30.09.2017 + +( +KUIC +) + +. + +Kargil +, +Poyen +( +34° 33.692′ N +, +076° 08.122′ E +, + +8710 ft. + +), +A.A. Buhroo +, + +31.08.2018 + +( +KUIC +) + +. + +Kargil +, +Hardass +( +34° 36.371′ N +, +076° 05.507′ E +, + +8770 ft. + +), +A.A. Buhroo +, + +31.08.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Kashmir, Ladakh, +Uttarakhand +. +Nepal +, +Pakistan +, +China +( +Xizang +) + + + + +Hosts: + +Crataegus songarica + +and + +Cydonia oblonga + +( +Rosaceae +) (new host records). + +Betula utilis + +( +Betulaceae +), + +Cotoneaster microphyllus + +( +Rosaceae +), + +Juglans regia + +( +Juglandaceae +), + +Malus domestica + +, + +Prunus armeniaca + +, + +P. avium + +, + +Sorbus lanata + +( +Rosaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFA82D132DE9FF68906C4C11.xml b/data/03/DE/8F/03DE8F5DFFA82D132DE9FF68906C4C11.xml new file mode 100644 index 00000000000..2343bbf2a23 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFA82D132DE9FF68906C4C11.xml @@ -0,0 +1,186 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +45. + +Scolytoplatypus daimio +Blandford, 1893b + + + + + + +( +Figure 58 +) + + += +muticus +Hagedorn, 1904 + + += +siomio +Blandford, 1893b + + +This species is diagnosed by the following morphological characters: +♂ +frons weakly concave, impunctate dull with uniform fine granules throughout; anterolateral edges with long golden hairs extending from upper frontal area almost up to epistoma, forming inwardly curled tufts on upper level of eyes; eyes entire; antennal club ovate, elongate, widest at base, 1.7× longer than wide, narrowly rounded at the apex, surface densely covered with setae, longer setae on base and apex; pronotum 1.22× wider than long, widest at anterior third, devoid of any distinct summit and asperities, surface finely reticulate with minute punctures, set 3–4 diameters apart from each other; dorsal surface somewhat smooth with sparse minute pubescence; prosternum with a pair of widely separated, divergent, straight processes on the anterior margin; scutellum triangular, flush with elytral surface; elytra 1.29× as long as wide, 2× as long as pronotum, clearly widened posteriorly; basal angles rectangular, sides parallel to abruptly declivous apex; elytral surface shining, with irregularly placed minute punctures; striae & interstriae indistinct; declivity commencing on posterior fourth, sub-convex; striae 1 and 2 somewhat visible, rest confused; interstriae shortly carinate at the commencement of declivity, 1 and 3 well- marked, lined with a row of distinct tubercles, interstriae 7 toothed forming a lateral tooth on elytron; elytral apex with distinct carina; surface with long, pale hairs; elytral color yellowish, gradually becoming darker posteriorly, without a distinct darker band along suture; body length: +2.97–3.22 mm +, 2.16× as long as wide. + + + +FIGURE 58. + +Scolytoplatypus daimio + +. Male: dorsal view +A +, lateral view +B +, frons +C +, prosternum +D +; female: dorsal view +E +, frons +F +. + + + +Female is very similar to male except the frons being strongly convex with a feeble longitudinal median impression, either side of which is finely but distinctly punctate with sparse minute hairs; commencement of elytral declivity devoid of any distinct longitudinal ridges; odd numbered interstriae with few minute, scattered tubercles on the declivity; body length: 3.0– +3.28 mm +. + + + + +Material examined: + +New +records: +India +: +3 ♂ +′s, +3 ♀ +′s. +Kashmir +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +30.08.2018 + +( +KUIC +). +Kashmir +, +Pahalgam +( +34° 05.15′ N +, +075° 15.47′ E +, + +8000 ft. + +), +A.A. Buhroo +, + +07.09.2019 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Kashmir, +Uttarakhand + + + + +Hosts: + +Acer caesium + +( +Sapindaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFAB2D102DE9FF6893784DCE.xml b/data/03/DE/8F/03DE8F5DFFAB2D102DE9FF6893784DCE.xml new file mode 100644 index 00000000000..c13205b5202 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFAB2D102DE9FF6893784DCE.xml @@ -0,0 +1,189 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +46. + +Scolytoplatypus darjeelingi +Stebbing, 1914 + + + + + + +( +Figure 59 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons concave; surface reticulate on lower half, upper half smooth and shiny with sparse small hairs; presence of callosity below the eyes; fringe of long curled golden hairs around the margin of vertex up to posterior level of eyes, except on median portion; eyes elongate, weakly convex; antennal club elongately oval, with dense fine hairs along with sparse and moderately long erect hairs on anterior face; pronotum 1.2× as wide as long, widest at the middle; basal margin feebly bisinuate; lateral sides distinctly outcurved and feebly ridged; surface feebly convex and finely reticulate with minute punctures and dense pubescence; prosternum similar to that of + +S. daimio + +with a pair of widely separated, straight processes on the anterior margin diverging away laterally; scutellar tip only visible; elytra 1.2× as long as pronotum, much wider than pronotum and 1.2× as long as its width; basal margin substraight and weakly carinate up to stria 5, lateral sides sub parallel on basal three-fourths; postero-lateral margins carinate, weakly granulate towards interstria 9; apex broadly rounded; disc smooth and shiny; striae marked by minute punctures, becoming more distinct towards declivity; interstriae much wider than striae, with fine punctures; declivital face steep and convex; striae feebly impressed at declivital face with inconspicuous punctures; interstriae 1 and 2 with sparse and prominent granules, interstriae 1 with granules up to apices; entire declivital surface reticulate and roughened; surface with dense admixture of fine and a few erect hairs; elytral color yellowish anteriorly, becoming darker towards declivity, with darker extensions along suture and sides of elytra to base; body length: +2.65–2.80 mm +, 2.14× as long as wide. + + + +FIGURE 59. + +Scolytoplatypus darjeelingi + +. Lectotype female: dorsal view +A +, lateral view +B +. + + + +Females are very similar to males but comparatively longer ( +3.10 mm +); frons convex, devoid of tuft of hairs on margin of vertex; pronotum with a rounded mycangium; declivity less roughened with comparatively smaller granules. + + +Remarks: + +S. darjeelingi + +resembles + +S. daimio + +by its very similar male prosternum and the incurved brushes of hair-like setae extending beyond the middle of frons, usually reaching the epistomal margin but differs by its elytral disc becoming evenly rounded into declivity and the elytral color being yellowish anteriorly, becoming brown just before summit of declivity with darker extensions along suture and sides of elytra up to the base. + + + + +Material examined: + +Lectotype +(here designated). +Label +information: + +Scolytoplatypus darjeelingi +Steb. + +, +Type +, +Darjeeling, E.P +. Stebbing, + +24.02.1903 + +( +FRI +) + + + + + +Distribution: +India +: +Himachal Pradesh +, +Uttarakhand + + + + +Hosts: + +Acer caesium + +( +Sapindaceae +), + +Alnus nepalensis + +( +Betulaceae +), + +Eucalyptus globulus + +( +Myrtaceae +), + +Grevillea robusta + +( +Proteaceae +), + +Prunus nepalensis + +( +Rosaceae +), + +Quercus lamellosa + +( +Fagaceae +), + +Symplocos theaefolia + +( +Symplocaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFAB2D162DE9F8D0965E4944.xml b/data/03/DE/8F/03DE8F5DFFAB2D162DE9F8D0965E4944.xml new file mode 100644 index 00000000000..3008ec68eb9 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFAB2D162DE9F8D0965E4944.xml @@ -0,0 +1,239 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +47. + +Scolytoplatypus denticauda + +sp. nov. + + + + + +( +Figure 60 +) + + + + +Diagnosis: +This new species is distinct from other species of the genus by its indistinct discal striae and interstriae, a transverse incised dark band on the pronotum, the distinct tubercles on the declivital interstriae 1 and 3, and the strongly concave propleura and pyriform fovea at the antero-ventral corners. + + + +FIGURE 60. + +Scolytoplatypus denticauda + + +sp. nov. + +Holotype male: dorsal view +A +, lateral view +B +, frons +C +, ventral view +D +; Allotype female: dorsal view +E +, lateral view +F +. + + + +The new species closely resembles with + +S. gardeneri +Maiti & Saha, 2009 + +but can be distinguished by: the indistinct discal striae and interstriae in + +S. denticauda + + +sp. nov. + +versus distinct discal striae and interstriae in + +S. gardeneri +; + +a transverse incised dark band on the pronotum of + +S. denticauda + + +sp. nov. + +versus not seen in + +S. gardeneri +. + +The new species also resembles with + +S. ruficauda + +Eggers, +1939 + + +in its prosternum but differs in other features. + + + + +Description: +The species is new by the following morphological characters: +♂ +frons broadly, moderately concave, surface micro-reticulate, with evenly spaced fine punctures, a broad V-shaped shining area on lower one-third; a distinct incised line from vertex up to middle; vestiture on entire surface with sparse, moderately long hairs, somewhat longer on the margins; antennal funicle with six segments, club flattened, elongate widest at the base, 2.21× longer than wide, narrowly rounded at the apex, surface covered by short setae, and a few longer hairs on margins and apex; eyes elongate and weakly convex; pronotum 1.25× wider than long, widest in the middle, anterior margin with distinct median emargination, basal margin indistinctly bisinuate, not produced in the middle; postero-lateral corners sub-angular, lateral sides divergent up to middle; dorsal surface shining, finely reticulate, with small punctures, punctures shallow and set 2–3 diameters apart from each other, somewhat more denser towards anterior and basal margins; pronotum with a broad transverse dark band below anterior margin and a raised longitudinal median line; vestiture of short fine hairs prominent anteriorly; lateral margins of pronotum distinctly ridged and propleura strongly concave, antero-ventral angles of pronotum with a relatively deep, pyriform fovea separated from anterior margin by a narrow ridge; prosternum raised medially on posterior half with a distinct triangular elevation anteriorly between procoxae, its pointed apex oriented anteriorly; anterior margin projecting in two sub-rounded lobes, with asymmetrical, weakly sclerotised translucent process between them; procoxae somewhat flattened, with sparse, setae on the inner surface and a few long, erect setae posteriorly; scutellum small, triangular and sunken; elytra 1.18× longer than wide, 1.87× as long as pronotum, shining; elytral base carinate, sides slightly diverging posteriorly, widest on apical fourth, apex slightly angularly rounded and carinate, disc flat, shinning with small punctures not arranged in distinct striae and interstriae, except lateral (last) two rows of strial punctures set in regular fashion; declivity towards apical fourth, steeply convex with well-marked impressed striae up to middle of declivity, with somewhat larger punctures than on disc; interstriae convex, granulate, unevenly alternately raised; interstriae 1 with seven to eight distinct tubercles, 2 somewhat depressed, 3 with four distinct tubercles and a few tubercles on lateral interstriae, 9 toothed, confluent with carinate, raised apex; vestiture on declivity with fine covering of short hairs; ventrites with shallow, dense punctures and vestiture of short, fine yellowish setae directed backwards, more longer medially and on last ventrite; body dark brown, anterior half of elytra yellowish brown; body length: +2.64–2.74 mm +, 1.88× as long as wide. + + +Female is very similar to male except with convex frons, pronotum with somewhat projecting postero-lateral angles, pronotal surface without a transverse band; fovea on antero-ventral angles absent; declivity with less impressed striae and a few, less stronger tubercles on declivity. Mycangial pore on the pronotum absent. Body length: +3.03–3.07 mm +. + + + + +Material examined: + +Holotype +: +♂ +India +: +Kashmir +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +30.08.2018 + + +. +Allotype +, +♀ +: the same site and date as HT; + +Paratypes +: the same data as HT ( +1 ♀ +), except, Aru, Pahalgam ( +34° 05.15′ N +, +075° 15.47′ E +, + +8000 ft. + +), +A.A. Buhroo +, + +07.09.2019 + +( +1 ♂ +, +1 ♀ +); HT, AT and 3 PT deposited at KUIC; 3 PTs NHMW + +. + + + + +Type +locality: + +India +: +Kashmir +(Sonamarg) + + + + + +Hosts: + +Acer caesium + +( +Sapindaceae +) + + + + +Etymology: +The species epithet refers to the presence of tubercles on the declivity. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFAC2D142DE9FDA490254A38.xml b/data/03/DE/8F/03DE8F5DFFAC2D142DE9FDA490254A38.xml new file mode 100644 index 00000000000..b8bea1c321a --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFAC2D142DE9FDA490254A38.xml @@ -0,0 +1,168 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + + +49. + +Scolytoplatypus minimus +Hagedorn, 1904 + + + + + + + +( +Figure 62 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons concave, surface dull, finely reticulate with minute punctures and sparse, micro-hairs; fringe of long dense incurved golden hairs around the margin of vertex up to lower side of eyes (except on upper half of eyes); eyes elongate and weakly convex; antennal club lanceolate, entirely pubescent, along with a few long hairs; pronotum sub-quadrate, 1.2× wider than long; basal margin bisinuate; lateral sides ridged on basal two-thirds, weakly so anteriorly; basal third narrowest; widest at anterior third; surface finely reticulate and dull, punctures and hairs inconspicuous; prosternum with a small triangular median projection anteriorly, posteriorly a pair of widely separated, weakly shining, flattened areas; scutellum submerged; elytra 1.21× as long as pronotum and slightly wider (1.08×) than its own length; basal margin somewhat bisinuate and carinate; lateral sides sub-parallel up to two-thirds; postero-lateral margins carinate, converging posteriorly and confluent with interstria 9; discal striae impressed marked by indistinct punctures; interstriae weakly convex gradually elevated posteriorly; interstriae 1 to 8 terminating into single spine at commencement of declivity, spines on interstriae 1–5 alternately longer and shorter, interstrial surface rough with somewhat indistinct granules; declivity abrupt, face sub-convex, entire surface roughened with minute granules; striae and interstriae indistinctly marked; color yellowish brown, postero-lateral margins of pronotum and anterior half of elytra much lighter; body length: +1.60 mm +, 1.79× as long as wide. + + + +FIGURE 62. + +Scolytoplatypus minimus + +. Male: dorsal view +A +, latero-declivital view +B +, frons and prosternum +C +. + + + +Females: pronotum about as long as wide with a mycangial pore, striae and interstriae obsolete on apical part of elytral declivity. Remarks: This species is smallest among all representatives of the genus from +India +. +Material examined: +New record: +India +: +1 ♂ +. +Himachal Pradesh +, Palampur, Tanda ( +32° 06.141′ N +, +076° 32.036′ E +, +4008 ft. +), A.A. Buhroo, +25.09.2018 +(KUIC). +Distribution: +India +: +Uttarakhand +, +Himachal Pradesh +, +West Bengal +. +Thailand +Hosts: + +Grevillea robusta + +( +Proteaceae +) (new host record). + +Acrocarpus fraxinifolius + +( +Fabaceae +), + +Alnus nitida + + + +( +Betulaceae +), + +Cornus macrophylla + +( +Cornaceae +), + +Prunus armeniaca + +( +Rosaceae +), + +Salix tetrasperma + +( +Salicaceae +), + + + +Wendlandia tinctoria + +( +Rubiaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFAD2D172DE9FD4D91AD4932.xml b/data/03/DE/8F/03DE8F5DFFAD2D172DE9FD4D91AD4932.xml new file mode 100644 index 00000000000..7949f35ce74 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFAD2D172DE9FD4D91AD4932.xml @@ -0,0 +1,207 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +48. + +Scolytoplatypus kunala +Strohmeyer, 1908a + + + + + + +( +Figure 61 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons concave, with uniform fine granules and minute punctures; vestiture on frontal surface with very fine erect and somewhat longer hair-like setae; upper and lateral edges of frons with long hair-like setae, those on upper part until middle of eyes somewhat curved towards center of frons; pronotum 1.30× wider than long, widest at anterior third, vestiture of fine and short hair-like setae denser at anterior margin; pronotal surface shining, minutely punctured, punctures very shallow and set 3–4 diameters apart from each other, surface between punctures minutely reticulate; lateral margins of pronotum sharply elevated and propleura strongly concave; prosternum weakly convex, with an obscure triangular elevation between procoxae, its indistinct pointed apex oriented backwards, anterior margin armed with two divergent translucent processes set far apart; scutellum small, triangular, flush with elytral surface; elytra 1.14× as long as wide, 1.71× as long as pronotum, sides almost parallel upto the commencement of declivity with abruptly declivous apex; elytral surface minutely punctured, shining, without signs of reticulation; elytral punctures not organized in rows and interstriae invisible; interstriae finely carinate at declivity, except interstriae 1 broadly elevated, not carinate bearing 9–10 tubercles of medium size, diverging towards elytral apex; carina on all other interstriae very low with a few tubercles; elytral declivity convex, not impressed; posterior dark carinate portion of elytra with yellowish and dense recumbent hair-like setae; color pale brown, elytra with only slightly darkened suture; each elytron with a large yellow area extending from anterior margin up to middle of elytral length; body length: +2.78 mm +, 2.05× as long as wide. + + + +FIGURE 61. + +Scolytoplatypus kunala + +. Male: dorsal view +A +, frons +B +, ventral view +C +; female: dorsal view +D +, lateral view +E +. + + + +Female similar to male, but frons is not impressed and long pubescence at lateral and upper edges of frons is not developed; pronotum has a median mycangial pore in its centre; body length: +3.26 mm +. + + +Remarks: We agree with +Mandelshtam & Petrov (2010b) +that + +S. kunala + +is distinct from + +S. daimio +. + +This species resembles + +S. daimio + +, but is smaller in size and has different color pattern on elytra. Short frontal vestiture easily distinguishes the male + +S. kunala + +from + +S. daimio + +and + +S. darjeelingi + +males in which the longest setae extend in a brush from the upper frontal parts up to the epistoma. + + + + +Material examined: + +New +records: +India +: +1 ♂ +, +1 ♀ +. +Kashmir +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +30.08.2018 + +( +KUIC +). +Kashmir +, +Pahalgam +( +34° 05.15′ N +, +075° 15.47′ E +, + +8000 ft. + +), +A.A. Buhroo +, + +07.09.2019 + +( +KUIC +) + +. + + + + +Distribution: +India +: Kashmir + + + + +Hosts: + +Acer caecium + +( +Sapindaceae +), + +Prunus cornuta + +( +Rosaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFAE2D6A2DE9FC23975D4F9F.xml b/data/03/DE/8F/03DE8F5DFFAE2D6A2DE9FC23975D4F9F.xml new file mode 100644 index 00000000000..50530f895bc --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFAE2D6A2DE9FC23975D4F9F.xml @@ -0,0 +1,236 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +51. + +Hypothenemus birmanus +( +Eichhoff, 1878a +) + + + + + + +( +Figure 64 +) + + + + += + +Triarmocerus birmanus +Eichhoff, 1878a + + += +birmanus +Eichhoff, 1878b + + + += +maculicollis +Sharp, 1879 + + + + += +peritus +Blandford, 1894 + + += +farinosus +Blandford, 1896a + + += +valens +Sampson, 1914 + + += +perkinsi +Hopkins, 1915 + + += +psidii +Hopkins, 1915 + + += +sterculiae +Hopkins, 1915 + + += alter +Eggers, 1923 + + += +uter +Eggers, 1923 + + += +nibarani +Beeson, 1933 + + += +ampliatus +Eggers, 1936 + + += +pacificus +Beeson, 1940 + + += +castaneus +Wood, 1954 + + += +dubius +Schedl, 1971 + + +This species is diagnosed by the following morphological characters: +♀ +frons moderately convex, feebly impressed above epistoma, with median longitudinal strip smooth and shiny, laterally finely reticulate; vertex strongly reticulate; surface with small, obscure, rather sparse punctures; vestiture of fine, sparse, rather short hair somewhat long and abundant on epistoma; eyes shallowly emarginate, finely faceted; antennal funicle with four segments; club flattened, suture 1 partly septate; other two sutures rather procurved; pronotum 1.14× wider than long, widest on basal third, sides rather strongly arcuate, converging towards narrowly rounded anterior margin; anterior margin with four closely placed serrations, median pair largest; summit at middle, anterior slope armed by 18–20 distinct asperities; posterior areas smooth, shining with small punctures; vestiture of ground cover of short semi-recumbent hair, intermixed with sparse, longer bristles anteriorly and laterally, sparse slender scales near base; elytra 1.49× as long as wide, 1.76× as long as pronotum; lateral sides subparallel upto basal two-thirds, narrowing posteriorly with rounded apex; striae weakly impressed on base and declivity, punctures moderately larger near base, small towards declivity; interstriae more than twice as wide as striae, with irregular 2–3 rows of minute punctures; declivity convex, moderately steep; sculpture nearly same as on disc; vestiture of ground cover of short hairs on disc, more stout and denser on declivity; uniseriate erect interstrial scales (each scale 2–4× as long as wide); flattened interstrial scales stout and more denser on declivity than on disc; body color dark-brown to black; body length: +2.10–2.12 mm +, 2.38× as long as wide. + + + +FIGURE 64. + +Hypothenemus birmanus + +. Female: dorsal view +A +, lateral view +B +, frons +C +. + + +Male similar to female except anterior margin of pronotum with only two serrations, eyes greatly reduced in size, antennal club smaller, more slender. + + + +Material examined: + +New +record: +India +: +3 ♀ +′s. +Himachal Pradesh +, +Tanda Palampur +( +32° 06.141′ N +, +076° 32.036′ E +, + +4008 ft. + +), +A.A. Buhroo +, + +25.09.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: Andaman Islands, +Himachal Pradesh +(new record), +Madhya Pradesh +, +Uttarakhand +. South +East Asia +, +Australia +, +Micronesia +, Hawaii, Africa and Central and North America + + + + +Hosts: +Collected from unknown wood, and many other Leguminosae hosts as reported by +Browne (1961) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFAF2D152DE9FE9190334BDC.xml b/data/03/DE/8F/03DE8F5DFFAF2D152DE9FE9190334BDC.xml new file mode 100644 index 00000000000..17177e2b703 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFAF2D152DE9FE9190334BDC.xml @@ -0,0 +1,165 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +50. + +Scolytoplatypus raja +Blandford, 1893b + +( +Figure 63 +) + + + + + + += +himalayensis +Stebbing, 1914 + + + +This species is diagnosed by the following morphological characters: +♂ +frons strongly concave up to vertex; surface reticulate, roughened and with sparse bent hairs more distinct on upper half; the upper margin of frontal cavity with uniform curled hairs; eyes elongate and weakly convex; antennal club large and lanceolate, slightly longer than scape and funicle combined together; pronotum nearly as long as wide and widest at the middle; basal margin strongly bisinuate, lateral sides with basal emargination and ridged beyond middle; postero-lateral corners rather acute and projected outwards; surface opaque and reticulate with close large punctures, except longitudinal impunctate area; hairs inconspicuous; prosternum with two tubercles anteriorly, anterior to them a pair of widely diverging processes, with sharply in-turned and hooked tips; scutellum submerged, not distinctly visible; elytra 1.10× longer than pronotum and 0.97× as long as its own width; basal margins truncated and somewhat weakly carinate; lateral sides substraight, but very weakly diverging posteriorly; postero-lateral margins feebly carinate and confluent with interstria 9; striae strongly impressed on disc, with elongate confluent punctures; interstriae 1, 3, 5 and 7 gradually distinctly ridged posteriorly and each terminating into a spine with a few tufts of long hairs at commencement of declivity; interstrial surface reticulate with small irregular punctures; declivity rather abrupt with uneven face; striae impressed and obsolete at middle of declivity; striae 1 and 2 confluent, 4 and 5 forming loop, 3 and 6 running up to posterior half of declivity; interstriae 1 and 3 strongly ridged, terminating slightly above the posterior margin, forming a blunt projection; interstria 2 obsolete, 4 depressed and narrowed, 5 broad; interstrial surface with fine, irregular granules; color blackish brown; body length: +3.09 mm +, 2.06× as long as wide. + + + + +FIGURE 63. + +Scolytoplatypus raja + +. Male: dorsal view +A +, lateral view +B +, frons +C +; female: dorsal view +D +. + + + + +Females are very similar to males, but frons convex, pronotal surface finely reticulate with minute punctures and sparse bent hairs; mycangium at about anterior third of pronotum; interstriae convex, surface finely reticulate without any spine at commencement of declivity; body length: +3.15 mm +. + + + + +Material examined: + +New +record: +India +: +1 ♂ +, +1 ♀ +. +Himachal Pradesh +, +Palampur +, +Tanda +( +32° 06.141′ N +, +076° 32.036′ E +, + +4008 ft. + +), +A.A. Buhroo +, + +25.09.2018 + +( +KUIC +) + +. + + + + +Distribution: +Himachal Pradesh, Kashmir, Uttar Pradesh, West Bengal, Assam. +China +, +Nepal +, +Vietnam +Hosts: + +Grevillea robusta + +( +Proteaceae +) and + +Albizia chinensis + +( +Fabaceae +) (new host records) and many different hosts recorded by +Beeson (1941) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFB22D092DE9FD4D90794CA8.xml b/data/03/DE/8F/03DE8F5DFFB22D092DE9FD4D90794CA8.xml new file mode 100644 index 00000000000..bd88e3ca49f --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFB22D092DE9FD4D90794CA8.xml @@ -0,0 +1,167 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +26. + +Xylechinus padus +Wood, 1988a + + + + + + +( +Figure 34 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons broadly convex, a feeble median impression on lower half, pre-epistomal margin rather abrupt on median two-thirds; surface smooth and shining, feeble reticulation becoming slightly stronger laterally, much stronger towards vertex; punctures rather small, distinct, moderately coarse; vestiture of sparse, fine, rather short hairs; pronotum 1.24× wider than long; sides on basal half almost parallel, very weakly constricted on anterior half; surface smooth, shining, punctures moderately large, very close, rather deep; vestiture of moderately abundant, fine, rather short hairs; elytra 1.95× as long as pronotum, 1.6× as long as wide; striae slightly impressed, with moderately impressed close punctures, usually with small tubercles arising from interior; interstriae nearly 1.5× wider than striae, distinctly convex, 1 +st +and 3 +rd +interstriae slightly more strongly elevated on posterior half of disc and on declivity; 1 +st +and 3 +rd +interstriae each with a row of small, subcrenulate tuberculations throughout, others usually with smaller tuberculations near base; declivity convex, steep; odd-numbered interstriae distinctly elevated, 3 and 9 elevations join and then continue almost to 1 +st +interstria; odd-numbered interstriae each with a few to many small tubercules, others unarmed; vestiture of moderately abundant, short, almost hair-like setae throughout elytra; body length: +2.60–2.75 mm +, 2.19× as long as wide. + + + +FIGURE 34 +. + +Xylechinus padus + +. Female: dorsal view +A +, fronto-lateral view +B +. + + +Male similar to female, except the frons is without median impression. + +Remarks: This species is larger than other Indian + +Xylechinus +species + +, it has a very different vestiture, and declivital interstriae 1 and 3 are distinctly elevated. + + + + +Material examined: + +New +record: +India +: +2 ♀ +′s. +Kashmir +, +Ganderbal +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +03.09.2019 + +( +KUIC +) + +. + + + + +Distribution: +India +: Kashmir, +Himachal Pradesh +, +Uttarakhand +. +China +: +Yunnan + + + + +Hosts: + +Prunus cornuta + +( +Rosaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFB32D092DE9FE0093DD4944.xml b/data/03/DE/8F/03DE8F5DFFB32D092DE9FE0093DD4944.xml new file mode 100644 index 00000000000..3ab40f5a434 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFB32D092DE9FE0093DD4944.xml @@ -0,0 +1,164 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +25. + +Hylurgus indicus +Wood, 1985 + + + + + + +( +Figure 33 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons strongly convex, coarsely tuberculate and without transverse impression just below middle; epistoma with medium carina of uniform height; vestiture of long, abundant hairs, and a fringe of hairs on the epistomal margin; eyes entire, elongately oval; antennal funicle with six segments, club ovate with three recurved sutures; pronotum rather quadrate, 1.05× as long as wide; sides somewhat parallel, slightly narrowing anteriorly; surface dull, with small, close, deeper punctures and a median longitudinal raised line; vestiture of moderately abundant long hairs; elytra 1.7× as long as pronotum, 1.8× as long as wide; elytral base substraight equal in width to pronotal base, sides parallel up to basal three-fourths with evenly rounded apex, elytral surface dull rather transversely wrinkled; striae weakly impressed, strial punctures moderately large, distinct, set apart about a diameter of a puncture; interstriae slightly wider than striae, with very small, close, punctures; interstrial vestiture of erect setae mostly in rows both disc and declivity; body dull reddish brown; body length: +3.2 mm +, 2.96× as long as wide. + + + +FIGURE 33. + +Hylurgus indicus + +. Paratype female: dorsal view +A +, lateral view +B +, frons +C +. + + +Male: Not studied. + +Remarks: This species strongly resembles + +H. micklitzi +Watchl, 1881 + +but differs from it by smaller size and absence of a frontal tubercle. + +Hylurgus indicus + +also differs both from + +H. ligniperda + +and + +H. micklitzi + +by absence of tuft of hair-like setae on elytral declivity in female. + + + + +Material examined: + +Paratype +♀ +in FRI Dehradun. Type locality: +Kumaon Hills, W +. Almora, +Uttarakhand +, +India + + + + + +Distribution: +India +: Kumaon Hills, W. Almora ( +Uttarakhand +) + + + + +Hosts: + +Pinus roxburghii + +( +Pinaceae +) + + + +Genus + +Xylechinus +Chapuis, 1869 + + + + + +Xylechinus +species + +are diagnosed by the following morphological features: body length: +1.5–3.5 mm +; antennal funicle with five segments; club with three sutures; anterior margin of eye slightly emarginate or sinuate; frons usually with median carina above the epistoma; pronotum usually wider than long, unarmed; pronotum with recumbent, filliform setae; scutellum small; metepisternal setae scale-like; elytral basal margin armed by a row of coarse crenulations; filliform setae of 1 +st +interstria lighter, and more closely distributed than other interstriae; declivity convex, with small granules and vestiture of small scale-like setae and sparse long, light, semi-erect, thick bristles; host: deciduous trees. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFB52D0F2DE9FC8590614BF0.xml b/data/03/DE/8F/03DE8F5DFFB52D0F2DE9FC8590614BF0.xml new file mode 100644 index 00000000000..0883b48b22a --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFB52D0F2DE9FC8590614BF0.xml @@ -0,0 +1,209 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +27. + +Ips longifolia +( +Stebbing, 1909 +) + + + + + + +( +Figure 35 +) + + + + += + +Tomicus longifolia +Stebbing, 1909 + + + +This species is diagnosed by the following characters: +♂ +frons feebly roughened with small granules intermixed fine erect hairs and with a small blunt tubercle placed at the middle of vertex; pronotum uniformly convex 1.2× as long as wide, lateral margins feebly outcurved, more prominent anteriorly; summit indistinct placed almost at middle, anterior slope of pronotum with concentric rows of asperities becoming smaller and indistinct postero-laterally, posterior-discal half shiny with small punctures; scutellum depressed and tongue-shaped; elytra 1.48× as long as pronotum, 1.41× as long as wide; elytral surface distinctly convex, basal margin, fairly concave; lateral sides subparallel upto posterior fourth converging posteriorly; striae distinct with shallow punctures devoid of any micro-hairs; interstriae 3–4× wider than striae with a few small widely spaced punctures; all striae and interstriae running almost upto commencement of declivity; declivity commencing almost on the middle of elytra, each margin of declivity with 4–5 spines, spine 2 and 3 connected by a tumescent base, 3 the largest but not elongated as in other species, its apex enlarged into a spade-like club with a constriction at its base, 4 smaller and always placed midway between 3 and the lower margin; frons and entire lateral margins of body with dense long erect setae; body length: +4.51–4.72 mm +, 2.64× as long as wide. + + + + +FIGURE 35 +. + +Ips longifolia + +. Male: dorsal view +A +, lateral view +B +. + + + + +Material examined: + +New +records: +India +: +3 ♂ +′s. +Jammu +, +Ramsu +, +Sarbagni +( +33° 19.806′ N +, +075° 11.984′ E +, + +3880 ft. + +), +A.A. Buhroo +, + +20.05.2017 + +( +KUIC +) + +. + +Jammu +, +Ramban +, +Batricheshma +( +33° 17.545′ N +, +075° 10.597′ E +, + +3640 ft. + +), +A.A. Buhroo +, + +20.05.2017 + +( +KUIC +) + +. + +Himachal Pradesh +, +Sanwara Solan +(30° 88.677′ N, 076° 99.854′ E, + +4065 ft. + +), +A.A. Buhroo +, + +20.02.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, +Punjab +, Jammu, +Uttarakhand +. +Pakistan +, +Nepal +, +Bhutan +, +China + + + + +Hosts: + +Pinus roxburghii + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFB62D022DE9F98F91F84D76.xml b/data/03/DE/8F/03DE8F5DFFB62D022DE9F98F91F84D76.xml new file mode 100644 index 00000000000..e438f741756 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFB62D022DE9F98F91F84D76.xml @@ -0,0 +1,309 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +30. + +Pityogenes spessivtsevi +Lebedev, 1926 + + + + + + +( +Figure 39 +) + + +This species is diagnosed by the following characters: +♂ +with flat frons, somewhat shiny at the middle with scattered minute granules and small hairs, vertex more densely granulate with micro hairs, hairs denser towards epistomal margin; pronotum slightly longer than wide (1.03×), anterior margin with distinct carina bearing few asperities prominent at the middle, lateral sides feebly outcurved, gradually narrowing into a rounded anterior margin; summit distinct placed almost at middle, anterior slope with 6 or 7 crescentric rows of asperities, asperities gradually becoming larger towards anterior margin; a shining median ridge running from summit to posterior margin; discal half of pronotum shining with fine granules and small punctures; elytra 1.5× as long as pronotum, 1.5× as long as wide, basal margin substraight and devoid of carina, discal surface glabrous, sutural line depressed; striae marked with fine shallow punctures more prominent towards declivity; interstriae much wider than striae, flat with scattered fine punctures and some hairs prominent laterally; declivity commencing on posterior third with three prominent seteferous tubercles of unequal size on both margins, the 1 +st +tubercle at the level of 2 +nd +interstria, smallest in size, almost straight; 2 +nd +one biggest, hooked inward, placed at the level of 3 +rd +and 4 +th +interstriae; 3 +rd +one medium in size and placed at the postero-lateral margin of elytra; body chestnut brown; body length: +2.48–2.54 mm +, 2.54× as long as wide. + + + +FIGURE 39. + +Pityogenes spessivtsevi + +. Male: dorsal view +A +, lateral view +B +; female: dorsal view +C +, frons +D +. + + + +In females, frons bears a single cavity with a central round operature and declivital margin lined by smaller tubercles; body length: +2.31–2.40 mm +. + + + + +Material examined: + +New +records: +India +: +4 ♂ +′s, +2 ♀ +′s. +Kashmir +, +Baramulla +, +Check +post +Gulmarg +( +34° 03.797′ N +, +074° 24.948′ E +, + +7552 ft. + +), +A.A. Buhroo +, + +25.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Thajwas Sonamarg +( +34° 18.222′ N +, +075° 16.388′ E +, + +9105 ft. + +), +A.A. Buhroo +, + +30.08.2018 + +( +KUIC +) + +. + +Kashmir +, +Budgam +, +Tosamaidan +( +33° 54′09.89′′ N +, +074° 33′12.70′′ E +, + +8746 ft. + +), +A.A. Buhroo +, + +31.07.2019 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Kashmir, +Uttarakhand +. +China +, +Kazakhstan +, +Kyrgyzstan +, +Tajikistan + + + + +Hosts: + +Picea schrenkiana + +, + +P. smithiana + +, + +Pinus gerardiana + +, + +P. roxburghii + +, + +P. wallichiana + +( +Pinaceae +) + + +Phylogenetic assessment: + + +A phylogenetic analysis of the Himalayan species + +Pityogenes scitus + +and + +P. spessivtsevi + +was performed using the COX-1 genes to determine their evolutionary relationship with other similar species of the genus ( +Fig. 40 +). The NJ tree showed that the Himalayan species ( + +P. scitus + +and + +P. spessivtsevi + +) formed distinct clades and there was a more than 16% interspecific nucleotide difference between the two species. + +Pityogenes scitus + +, + +P. quadridens +( +Hartig, 1834 +) + +, + +P. bistridentatus +( +Eichhoff, 1878b +) + +, and + +P. bidentatus +( +Herbst, 1784 +) + +belonged to the same monophyletic group. However, + +P. spessivtsevi + +, was separately monophyletic in the present anylysis. + +Pityogenes scitus + +diverged from the European + +P. quadridens + +and + +P. bistridentatus + +by 12.5–13.5% in interspecific nucleotide divergence. Haplotypes of + +P. spessivtsevi + +displayed an intraspecific nucleotide divergence of 1.66%. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFB72D0D2DE9F9E5912A4D3B.xml b/data/03/DE/8F/03DE8F5DFFB72D0D2DE9F9E5912A4D3B.xml new file mode 100644 index 00000000000..47bc4ef3b41 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFB72D0D2DE9F9E5912A4D3B.xml @@ -0,0 +1,447 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +29. + +Pityogenes scitus +Blandford, 1893a + + + + + + +( +Figure 38 +) + + + + += + +Pityophthorus coniferae +Stebbing, 1909 + + + +This species is easily diagnosed by the following morphological characters: +♂ +frons broadly convex, surface shining, punctures rather small and dense, feebly granulate and with fine sparse hairs; epistomal margin convex with rows of minute hairs; pronotum slightly longer than wide (1.09×), anterior margin uniformly round with weak carina bearing small asperities in a row; lateral sides feebly convex; summit indistinct, placed almost at the middle; anterior slope of pronotum with crescentric rows of asperities, asperities gradually becoming smaller postero-laterally; a distinct shining median line running from summit to posterior margin; disc smooth, shining with small punctures; elytra elongate, 1.4× as long as pronotum and 1.7× as long as wide, anterior margin substraight, lateral sides subparallel, weakly converging posteriorly terminating into convex posterior margin; elytral disc convex, glabrous, striae feebly marked with small shallow punctures in rows, sutural striae depressed, distinctly marked upto posterior margin, other striae running upto declivity; interstriae flat with scattered punctures; elytral declivity with three almost equal sized, broad based tubercles on both margins, more prominent than in females; head and pronotum blackish brown, elytra light brown; body length: +2.02–2.16 mm +, 2.66× as long as wide. + + + + +FIGURE 38 +. + +Pityogenes scitus + +. Male: dorsal view +A +; female: dorsal view +B +; frons +C +. + + + + +Females are somewhat smaller than males, frons with three deep cavities in triangular position larger one on vertex, other two are smaller on either side at lower level on the vertex; elytral declivity less broadly impressed, lateral tubercles smaller and almost of equal size; body length: 2.0– +2.07 mm +. + + + + +Material examined: + +New +records: +India +: +14 ♂ +′s, +6 ♀ +′s. +Kashmir +, +Budgam +, +Yousmarg +( +33° 50.015′ N +, +074° 40.131′ E +, + +7955 ft. + +), +A.A. Buhroo +, + +29.06.2011 + +( +KUIC +) + +. + +Himachal Pradesh +, +Shimla +, +Summer Hill +( +31° 06.720′ N +, +077° 08.355′ E +, + +6877 ft. + +), +A.A. Buhroo +, + +20.07.2011 + +( +KUIC +) + +. + +Jammu +, +Batote +, +Shampa +( +33° 07.952′ N +, +075° 18.453′ E +, + +4225 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Marsary +( +34° 27.264′ N +, +074° 00.987′ E +, + +6750 ft. + +), +A.A. Buhroo +, + +09.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Kupwara +, +Tangdhar +( +34° 23.527′ N +, +073° 51.894′ E +, + +6525 ft. + +), +A.A. Buhroo +, + +10.07.2017 + +( +KUIC +) + +. + +Kashmir +, +Anantnag +, +Daksum +( +33° 36.120′ N +, +075° 27.595′ E +, + +8975 ft. + +), +A.A. Buhroo +, + +08.09.2017 + +( +KUIC +) + +. + +Jammu +, +Kishtwar +, +Padder +( +33° 18.820′ N +, +076° 04.492′ E +, + +7000 ft. + +), +A.A. Buhroo +, + +09.09.2017 + +( +KUIC +) + +. + +Kashmir +, +Baramulla +, +Boniyar +( +34° 07.405′ N +, +074° 10.717′ E +, + +5715 ft. + +), +A.A. Buhroo +, + +30.09.2017 + +( +KUIC +) + +. + +Kashmir +, +Bandipora +, +Mastan Gurez +( +34° 37.728′ N +, +074° 50.378′ E +, + +8410 ft. + +), +A.A. Buhroo +, + +17.08.2018 + +( +KUIC +) + +. + +Kashmir +, +Srinagar +, +Hazratbal +( +University Campus +), ( +34° 07′51.10 ′′ N +, +074° 50′ 01.09′′ E +, + +5220 ft. + +), +A.A. Buhroo +, + +30.06.2018 + +( +KUIC +) + +. + +Kashmir +, +Ganderbal +, +Baltal Sonamarg +( +34° 16.018′ N +, +075° 23.794′ E +, + +10080 ft. + +), +A.A. Buhroo +, + +31.08.2018 + +( +KUIC +) + + + + + +Distribution: +India +: +Himachal Pradesh +, Kashmir, Punjab, +Uttarakhand +. +China +, +Nepal +, +Pakistan + + + + +Hosts: + +Abies pindrow + +and + +Pinus halepensis + +( +Pinaceae +) (new host records). + +Cedrus deodara + +, + +Picea smithiana + +, + +Pinus bungeana + +, + +P. gerardiana + +, + +P. wallichiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFB82D002DE9FD4392C14830.xml b/data/03/DE/8F/03DE8F5DFFB82D002DE9FD4392C14830.xml new file mode 100644 index 00000000000..63261f7e66a --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFB82D002DE9FD4392C14830.xml @@ -0,0 +1,193 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +31. + +Pseudothysanoes kashmirica +Buhroo and Knížek, 2020 + + + + + + +( +Figure 41 +) + + +This species is diagnosed by the following morphological characters: +♂ +frons flattened with dense erect golden hair-like setae, vertex finely granulated with minute punctures; eyes elongate-oval; antennal scape elongate with few pale hair like setae, funicle with six segments and few pale hair-like setae; antennal club elongate-oval, flattened, sutures 1 and 2 slightly procurved, marked by pale setae; few longish pale setae on its apex; pronotum 1.21× wider than long; widest at base, sides strongly arcuate, very strongly constricted on anterior half, anterior margin from dorsal view narrowly rounded and armed by four protruding serrations bent backwards; summit behind middle; stronger, wide tubercles on anterior slope; posterior part weakly shining, reticulate and punctate; surface of anterior half covered by flattened setae along with thin, erect hair-like setae, somewhat short pubescence in posterior half; scutellum large, rounded, with minute punctures and few setae; elytral surface finely punctured, 1.4× as long as wide, 1.7× as long as pronotum; lateral sides sub-parallel from base to posterior third of the elytra, posterior third evenly rounded to apex, elytral declivity rounded; striae with microscopic hair-like setae; interstriae with erect short flattened setae, on interstriae 1 and on declivital part of interstriae 3 and 9 setae biseriate, on even-numbered interstriae setae biseriate on elytral base, uniseriate on elytral disc and declivity; body length: 1.0– +1.4 mm +, 2.2× as long as wide. + + + +FIGURE 41 +. + +Pseudothysanoes kashmirica + +. Holotype male: dorsal view +A +, lateral view +B +; allotype: lateral view +C +. + + +Female similar to male except the apex of the pronotum is less constricted; pubescence on the pronotum and frons longer and relatively sparse compared to male, where it is short, stout and dense; body length: 1.0 mm. + +Remarks: This species can be easily distinguished by the uniseriate scale-like setae in + +P. modestus +( +Murayama, 1940 +) + +, which are biseriate on the whole length of interstriae 1 and on declivital part of interstriae 3 and +9 in + +P. kashmirica +. + + + + + +Material examined: +Holotype +♂ +, + +Allotype +♀ +in KUIC. Type locality: +Kashmir +, +Srinagar +, +Dachigam National Park +, +India + +. +Paratypes +in KUIC: same data as HT + + + + +Distribution: +India +: Kashmir + + + + +Hosts: + +Ulmus villosa + +( +Ulmaceae +) + + +Phylogenetic assessment +: + + +Using information from the COX-1 gene, a phylogenetic analysis of the Kashmir Himalayan species + +Pseudothysanoes kashmirica + +and other similar species was carried out ( +Fig. 42 +). The NJ tree revealed that + +P. kashmirica + +formed a monophyletic cluster of its haplotypes. The populations of + +P. kashmirica + +are monophyletic with populations of + +P. yuccae +( +Wood, 1956 +) + +and + +P. cf. leechi +Wood, 1980 + +distributed in the +United States +. + +Pseudothysanoes kashmirica + +populations, however, vary from + +P. yuccae + +populations by an interspecific nucleotide divergence in the range of 20.64–21.77% and from + +P. cf. leechi + +populations by an interspecific nucleotide divergence in the range of 19.14– 22.34%. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFBA2D012DE9FF68933A4DC1.xml b/data/03/DE/8F/03DE8F5DFFBA2D012DE9FF68933A4DC1.xml new file mode 100644 index 00000000000..a2230441b35 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFBA2D012DE9FF68933A4DC1.xml @@ -0,0 +1,224 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +32. + +Carphoborus costatus +Wichmann, 1915 + + + + + + +( +Figure 43 +) + + +This species is diagnosed by the following morphological characters: +♀ +frons plano-convex, surface granuloreticulate with irregular small, dense punctures, a corona of moderately long pale hairs around the margin of frons, hairs somewhat longer towards epistoma, antero-median portion transversely weakly convex; anterior margin of eyes emarginate; antennal scape elongate, funicle with five segments; antennal club spatulate with three procurved sutures fringed with minute hairs on ventral surface; pronotum 1.42× wider than long, widest almost at middle and weakly converging posteriorly, strongly narrowing anteriorly towards rounded apex; a dorsal median short ridge visible; surface convex coarsely reticulate punctate, punctures shallow, small, closely placed and covered with short scale-like setae; elytra 1.34× as long as wide, 2.78× as long as pronotum, anterior margin convex with 10–11 crenulations, small granules on elytral base; striae well marked with large, shallow, close, punctures each with a setose granule becoming somewhat smaller on declivity; interstriae nearly 1.5× as wide as striae, surface convex with irregularly placed much smaller punctures; interstrial vestiture of short scales and erect bristles, more prominent on declivity; declivity short and steep marked with distinct tubercles on interstriae 1, 3, 5, 7 and 9; interstriae 3 and 9 much swollen and converge to meet before reaching apex; declivital margin roughened with denticles; body dark-brown, body length: +1.74–1.78 mm +, 2.14× as long as wide. + + + +FIGURE 43. + +Carphoborus costatus + +. Female: dorsal view +A +, lateral view +B, +frons +C +; male: frons +D +. + + + +Males slightly smaller than females, frons with sparse hairs not forming corona but a pair of minute, transversely placed, fused tubercles on the middle; body length: +1.49–1.70 mm +. + + + + +Material examined: + +New +records: +India +: +4 ♂ +′s, +6 ♀ +′s. +Himachal Pradesh +, +Shimla +, +Summer Hill +( +31° 06.927′ N +, +077° 08.503′ E +, + +6850 ft. + +), +A.A. Buhroo +, + +15.07.2011 + +( +KUIC +) + +. + +Jammu +, +Batote +, +Shampa +( +33° 07.952′ N +, +075° 18.453′ E +, + +4225 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +) + +. + +Kashmir +, +Srinagar +, +Shankerachariya +( +34° 04.678′ N +, +074° 50.789 E +, + +5875 ft. + +), +A.A. Buhroo +, + +29.09.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, +Jammu and Kashmir +, +Uttarakhand + + + + +Hosts: + +Pinus halepensis + +( +Pinaceae +) (new host record). + +Pinus greggii + +, + +P. ponderosa + +, + +P. roxburghii + +, + +P. wallichiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFBA2D072DE9F8CA97A84818.xml b/data/03/DE/8F/03DE8F5DFFBA2D072DE9F8CA97A84818.xml new file mode 100644 index 00000000000..af0ee357f76 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFBA2D072DE9F8CA97A84818.xml @@ -0,0 +1,317 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +33. + +Carphoborus zhobi +( +Stebbing, 1909 +) + + + + + + +( +Figure 44 +) + + + + += + +Phloeosinus zhobi +Stebbing, 1909 + +This species is diagnosed by the following morphological characters: +♀ +frons plano-convex, surface reticulopunctate with dense small punctures, a single large puncture visible at the middle of shining median area; a corona of moderately short hairs around the margin of frons, short erect bristles visible around the corona laterally; epistomal margin with a fringe of long, dense, pale hairs; eyes emarginate; antennae yellow, funicle five-segmented, club four-sutured; pronotum 1.47× as wide as long, widest at basal third, constricted anteriorly towards rounded apex; surface convex, reticulate punctate with small punctures, a median longitudinal raised line forming a distinct carina on basal half; surface with a mixture of short scales and erect bristles; elytra 1.49× as long as wide, 2.34× as long as pronotum, anterior margin convex with 10 or 11 crenulations, small granules on elytral base; striae deep with small, confused punctures each with a microhair; interstriae more than twice as wide as striae, surface convex, coarsely reticulate with irregular large punctures; interstrial surface with 2–3 irregular rows of short scales and some erect bristles, bristles more denser laterally and on declivity; declivity short and steep, interstriae 1, 3, 5, 7 and 9 raised and marked with distinct tubercles; interstriae 3 and 9 meet with each other before reaching apex; declivital margin roughened with denticles; body dark-brown, body length: +1.80–1.88 mm +, 2.2× as long as wide. + + + +FIGURE 44. + +Carphoborus zhobi + +. Female: dorsal view +A +, lateral view +B +; male: fronto-lateral view +C +. + + + +Males slightly larger than females, frons with moderately abundant scale-like setae not forming corona but with a pair of minute, transversely placed, fused tubercles on the middle; body length: 2.0– +2.05 mm +. + + + + +Material examined: + +New +records: +India +: +2 ♂ +′s, +4 ♀ +′s. +Jammu +, +Kishtwar +, +Kundhal Padder +( +33° 18.820′ N +, +076° 04.492′ E +, + +7000 ft. + +), +A.A. Buhroo +, + +09.09.2017 + +( +KUIC +). +Jammu +, +Kishtwar +, +Kijaye Padder +( +33° 16.144′ N +, +076° 07.680 E +, + +6145 ft. + +), +A.A. Buhroo +, + +09.09.2017 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Jammu (new record). +Pakistan + + + + +Hosts: + +Pinus gerardiana + +( +Pinaceae +) + + + +Genus + +Polygraphus +Erichson, 1836 + + + + + +Polygraphus +species + +are diagnosed by the following morphological characters: body length: +1.2–3.5 mm +; cylindrical body; bipartite eyes (completely divided into two); funicle five to six-segmented; club flat, leaf like and unsegmented (without sutures); pronotum wider than long, unarmed, smooth, finely, closely punctate; invisible scutellum; anterior elytral margin armed with coarse crenulations; 1 +st +ventrite as long as terminal ventrite; 2 +nd +, 3 +rd +, and 4 +th +ventrites small; presence of scaly short pubescence on elytra; frons sexually dimorphic: male frons rounded, with short, filliform setae and closely placed two medial tubercles at upper level of eyes; female frons with corona of short, filliform setae. + + + + + +Key to the species of Himalayan + +Polygraphus +Erichson, 1836 + + + + + + +1 Body length equal to or more than 3.00 mm................................................................ 2 + + +- Body length less than 3.00 mm.......................................................................... 4 + + + + + +2 Elytra three times longer than pronotum; antennal club with broader apex....................... + +P. aterrimus +Strohmeyer + + + + +- Elytra less than or two times longer than pronotum; antennal club with pointed apex................................ 3 + + + + + +3 Female +frons with two tufts of long hairs around the upper margin of concavity almost touching each other at the middle of frons.................................................................................. + +P. major +Stebbing + + + + + +- Female frons with two prominent, reddish-golden brushes of long hairs around the upper and lateral margins of frons, curled inwards and downwards not joining medially................................................. + +P. trenchi +Stebbing + + + + + + + +4 Female +frons with a pair of transverse tubercles............................................................. 5 + + + + +- Female frons without a pair of transverse tubercles; but with fringe of incurved, golden hairs along upper and lateral margins...................................................................................... + +P. difficilis +Wood + + + + + + + +5 Elytral interstriae with a row of widely spaced long, erect, scale-like setae and ground cover of very short blunt, feathery scales and fine hairs........................................................................... + +P. setosus +Schedl + + + + +- Elytral interstriae without a row of longer, erect setae; rather roughened with small granules; interstriae nearly 3× as wide as striae............................................................................................... 6 + + + + + +6 Male +frons shallowly concave with thick, curled tuft of hairs, touching each other at the middle of frons, covering frontal two-third portion; elytra 2.1× as long as pronotum; discal striae 1 and 2 distinctly impressed up to the commencement of declivity; interstria 2 terminating at the commencement of declivity......................................... + +P. pini +Stebbing + + + + + +- Male frons flattened with a distinct fringe of short curled golden yellowish hairs around the margin of vertex upto posterior margin of eyes; elytra 1.8× as long as pronotum; discal striae not impressed; declivity impressed along stria 1; declivital interstriae 1 and 3 elevated, marked by blunt scales.......................................... + +P. longifolia +Stebbing + + + + + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFBC2D042DE9FC7096404AD0.xml b/data/03/DE/8F/03DE8F5DFFBC2D042DE9FC7096404AD0.xml new file mode 100644 index 00000000000..a5b90782b8c --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFBC2D042DE9FC7096404AD0.xml @@ -0,0 +1,168 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +34. + +Polygraphus aterrimus +Strohmeyer, 1908b + + + + + + +( +Figure 45 +) + + + +FIGURE 45. + +Polygraphus aterrimus + +. Male: dorsal view +A +, lateral view +B +; female: dorsal view +C +, frons +D +. + + + +This species is diagnosed by the following morphological characters: +♂ +frons plano-concave, entire surface with close dense punctures and erect hairs denser on margin forming a ring, hairs not touching each other at tips; eyes completely divided into two parts; antennal scape long; funicle with five segments; club obtuse with fine pubescence; pronotum 1.3× wider than long, median line distinct, basal margin substraight, lateral sides outcurved and suddenly narrowing before emarginate anterior margin; surface shining with distinct dense punctures and small scale-like setae; scutellum depressed; elytra 1.47× as long as its width, three times longer than pronotum, basal margin somewhat substraight with weak crenulations, lateral sides subparallel upto basal three fourth, thence broadly rounded posteriorly; discal striae marked by punctures, each with a microhair; striae 1 and 2 more impressed than others; interstriae nearly three times wider than striae with small irregular punctures intermixed with short, blunt setae; interstriae toward basal margin more roughened and granulate; declivity commencing on posterior fourth, face convex and steep, stria 1 impressed; head pitchy black, pronotum and elytra dark brown; body length: +3.48 mm +, 2.43× as long as wide. + + +Females are armed with a pair of frontal tubercles and slightly larger than males; body length: +3.52 mm +. + + + + +Material examined: + +New +record: +India +: +1 ♂ +, +1 ♀ +. +Himachal Pradesh +, +Shimla +, +Tharoch +( +30° 56′53.67′′ N +, +77° 36′33.58′′ E +, + +6338 ft. + +), +A.A. Buhroo +, + +15.07.2011 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, +Uttarakhand +, +Thailand + + + + +Hosts: + +Abies pindrow + +, + +Cedrus deodara + +, + +Pinus roxburghii + +, + +P. wallichiana + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFBE2D052DE9FF6890614C72.xml b/data/03/DE/8F/03DE8F5DFFBE2D052DE9FF6890614C72.xml new file mode 100644 index 00000000000..04e33ebf530 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFBE2D052DE9FF6890614C72.xml @@ -0,0 +1,261 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +36. + +Polygraphus longifolia +Stebbing, 1903 + + + + + + +( +Figure 47 +) + + + + + += +himalayensis +Stebbing, 1908 + + + +This species is diagnosed by the following morphological characters: +♂ +body elongated and cylindrical; frons flattened, with minute round punctures each with a microhair, hairs moderately dense and longer towards epistomal margin; a distinct fringe of short curled golden yellowish hairs around the margin of vertex upto posterior margin of eyes; a distinct impunctate, broad area at the middle of the fringe extending as a longitudinal line on the vertex; antennal club ovate with rounded apex; pronotum 1.3× wider than long, widest at base, lateral sides rather constricted just before substraight anterior margin; pronotal surface smooth, shinning with small distinct punctures each with a microhair, a short longitudinal impunctate line at the middle of the pronotal disc; scutellum depressed; elytra 1.37× as long as its width, 1.8× as long as pronotum, basal margin weakly outcurved with weak crenulations extending upto interstria 7; elytral disc and declivity roughened; striae not impressed, punctures obscure; interstriae 2–3× as wide as striae, punctures close, confused, with some irregular granules; declivity gradually sloping, surface plano-convex, but impressed along stria 1; interstriae 1 and 3 elevated at declivital surface, marked by blunt scales; interstriae roughened with small granules; elytral surface covered with vestiture of small scales; body redish brown, body length: +2.33–2.71 mm +, 2.40× as long as wide. + + + + +FIGURE 47. + +Polygraphus longifolia + +. Male: dorsal view +A +, lateral view +B +, frons +C +; female: dorso-lateral view +D +. + + + + +Females lack fringe of curled hairs on frons but have a pair of median tubercles; elytral interstriae with more distinct granules; body length: +2.53–2.60 mm +. + + + + +Material examined: + +New +records: +India +: +5 ♂ +′s, +3 ♀ +′s. +Jammu +, +Ramsu +, +Sarbagni +( +33° 19.806′ N +, +075° 11.984′ E +, + +3880 ft. + +), +A.A. Buhroo +, + +20.05.2017 + +( +KUIC +) + +. + +Jammu +, +Ramban +, +Batricheshma +( +33° 17.545′ N +, +075° 10.597′ E +, + +3640 ft. + +), +A.A. Buhroo +, + +20.05.2017 + +( +KUIC +) + +. + +Jammu +, +Batote +, +Shampa +( +33° 07.952′ N +, +075° 18.453′ E +, + +4225 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +) + +. + +Himachal Pradesh +, +Sanwara +, +Solan +(30° 88.677′ N, 076° 99.854′ E, + +4065 ft. + +), +A.A. Buhroo +, + +20.02.2018 + +( +KUIC +) + +. + +Himachal Pradesh +, +Dalhousie +, +Banikhet +( +32° 32.939 N +, +075° 57.027′ E +, + +5490 ft. + +), +A.A. Buhroo +, + +27.09.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Jammu, +Uttarakhand + + + + +Hosts: + +Pinus roxburghii + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFBF2D042DE9FDB990614C94.xml b/data/03/DE/8F/03DE8F5DFFBF2D042DE9FDB990614C94.xml new file mode 100644 index 00000000000..4e29a6e0c50 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFBF2D042DE9FDB990614C94.xml @@ -0,0 +1,170 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +35. + +Polygraphus difficilis +Wood, 1988b + + + + + + +( +Figure 46 +) + + +This species is diagnosed by the following morphological characters: +♀ +body not so elongated; frons moderately concave on central half, concave area with fringe of incurved, golden hairs along upper and lateral margins, longest setae on vertex could extend two-thirds of distance to epistoma; eyes rather large, two-thirds divided by deep emargination; antennal funicle six-segmented; club rather small, ovate, with acute apex; pronotum 1.3× as wide as long; widest on basal third, lateral sides arcuate with broadly rounded anterior margin and a strong constriction just in front of it; surface smooth, shining with dense, small punctures and covered with short, fine hairs; scutellum indistinct; elytra 1.45× as long as its width, 1.9× as long as pronotum, lateral sides almost parallel upto basal three fourth, broadly rounded posteriorly; striae not impressed, punctures in obscure rows; interstriae more than three times as wide as striae, punctures slightly smaller than those of striae, close, confused; declivity steep, convex except shallowly sulcate on interstria 2; striae not indicated; interstriae 1 weakly elevated, 1 and 3 each armed by a row of small tubercles; vestiture of small rather sparse, pale interstrial scales; body reddish-brown, body length: +2.04–2.18 mm +, 2.36× as long as wide. + + + +FIGURE 46. + +Polygraphus difficilis + +. Female: dorsal view +A +, lateral view +B +; male: dorsal view +C +. + + + +Males differ from females in their frons being transversely impressed on lower third, convex above, armed by a transverse pair of rather widely spaced tubercles at upper level of eyes; body length: +1.76–1.93 mm +. + + + + +Material examined: + +New Records +: +India +: +2 ♂ +′s, +3 ♀ +′s. +Jammu +, +Batote +, +Shampa +( +33° 07.952′ N +, +075° 18.453′ E +, + +4225 ft. + +), +A.A. Buhroo +, + +21.05.2017 + +( +KUIC +). +Himachal Pradesh +, +Sanwara +, +Solan +(30° 88.677′ N, 076° 99.854′ E, + +4065 ft. + +), +A.A. Buhroo +, + +20.02.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +, Jammu, +Uttarakhand + + + + +Hosts: + +Pinus roxburghii + +( +Pinaceae +) + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFD12D6B2DE9FAF391F34C2A.xml b/data/03/DE/8F/03DE8F5DFFD12D6B2DE9FAF391F34C2A.xml new file mode 100644 index 00000000000..7f649b19f25 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFD12D6B2DE9FAF391F34C2A.xml @@ -0,0 +1,317 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +52. + +Hypothenemus ficivorus + +sp. nov. + + + + + +( +Figure 65 +) + + + + +Diagnosis: +The new species is distinct by sculpture of frons with longitudinal rugose reticulations from vertex to below the lower level of eyes, being stronger on sides of the short longitudinal carina between the eyes and by the transversely reticulate elytral surface with small strial punctures. The interstrial scales are about 2–3× as long as wide and nearly equal in length to the distance between the rows. + + + +Hypothenemus ficivorus + + +sp. nov. + +is closely related to + +H. eruditus +( +Westwood, 1834 +) + +and + +H. crudiae + +but can be distinguished by a short longitudinal carina between eyes in + +H. ficivorus + + +sp. nov. + +versus a median tubercle between the eyes in + +H. crudiae +( +Panzer, 1791 +) + +and absence of median tubercle or longitudinal carina in + +H. eruditus + +. The new species also differs in having longitudinal rugose reticulations from vertex to below the lower level of eyes, stronger on the sides of short longitudinal carina versus surface rugose-reticulate from vertex to upper level of eyes, more finely rugose below the upper level of eyes in + +H. eruditus + +and surface rugose-reticulate above median tubercle with reticulate area below the tubercle in + +H. crudiae +. + +The interstriae are more than twice as wide as striae in + +H. ficivorus + + +sp. nov. + +versus twice as wide as striae in + +H. eruditus + +and as wide as striae in + +H. crudiae + +. The declivital interstrial scales are about 3× as long as wide in + +H. ficivorus + + +sp. nov. + +versus scales varying from about 3–8× as long as wide in + +H. eruditus + +and scales about 4–5× as long as wide in + +H. crudiae + +. + + + + +Description: +This species is new by the following morphological characters: +♀ +frons broadly convex; surface with distinct longitudinal rugosities extending up to vertex; a weak, longitudinal short carina between eyes (visible on fronto-lateral view), with strong rugose-reticulations on either side of carina; narrow impunctate area below the carina up to epistoma; vestiture of rather short, sparse hair on frons, moderately abundant below eyes, longer and more abundant on epistoma; eyes large with weak emargination; antennal funicle with four segments, club oval, somewhat flattened with three weakly procurved sutures marked by hair, suture 1 with an indistinct septum; pronotum 1.17× as wide as long, widest at middle, sides feebly arcuate on basal half, rather broadly rounded towards apex; anterior margin armed by six serrations, median pair somewhat closely placed; anterior slope with approximately thirty large, chisel-like asperities, areas between asperities smooth, shining; summit at middle, posterior and lateral areas shinning, reticulate punctate; vestiture of ground cover of short hair, intermixed with a few longer dagger like setae on anterior slope; sparse, short, flattened, blunt scales with micro hair posteriorly and on lateral sides; scutellum somewhat triangular; elytra 1.72× as long as wide and 1.98× as long as pronotum; lateral sides subparallel upto basal two-thirds, narrowing posteriorly with rounded apex; elytral surface weakly reticulate, strial punctures small on disc and declivity; interstriae more than twice as wide as striae, shining on disc and declivity, interstriae 1 and 2 somewhat narrowed towards apex; erect interstrial setae scale-like, blunt and wider apically, about 2–3× as long as wide and about equal in length to distance between rows, uniseriate but with a few out-of-line setae; strial setae small, semi-recumbent, hair-like; declivity evenly convex; sculpture as on disc; erect interstrial setae slightly longer than on disc; strial setae similar to those on disc; body color dark-brown to black; body length: +1.23–1.26 mm +, 2.57× as long as wide. + + + +FIGURE 65. + +Hypothenemus ficivorus + + +sp. nov. + +Holotype female: dorsal view +A +, lateral view +B +, frons +C +; Allotype male: dorsal view +D +, lateral view +E +. + + + +Male similar to female but much smaller than female with smaller eyes; body length: +0.92 mm +. + + + + +Material examined: + +Holotype +: +♀ +India +: +Kashmir +, +Srinagar +, +Hazratbal +(University Campus), ( +34° 07′51.10 ′′ N +, +074° 50′ 01.09′′ E +, + +5220 ft. + +), +A.A. Buhroo +, + +10.08.2017 + +( +KUIC +) + +; +Allotype +, +♂ +: the same site and date as HT; + +Paratypes +: the same data as HT ( +1 ♀ +); HT, AT and 1 PT deposited at KUIC; 2 PTs NHMW + +. + + + + +Type +locality: + +India +: +Kashmir +: +Hazratbal Srinagar +(University Campus) + + + + + +Hosts: + +Ficus palmata + +( +Moraceae +) + + + + +Etymology: +The species epithet + +ficivorus + +refers to the + +Ficus + +eating. + + +Phylogenetic assessment: + + +A phylogenetic analysis of the temperate Himalayan + +Hypothenemus +species + +and several similar species, most of which are found in the tropics and subtropics was performed using the COX-1 gene to detemine their monophyly and evolutionary relations ( +Fig. 66 +). The NJ tree showed that + +Hypothenemus +sp. + +of +Panama +(MK769333) and Himalayan + +H. ficivorus + + +sp. nov. + +were monophyletic with low-supported bootstrap values and with an interspecific nucleotide difference of 13.84% between the two clades. The tree further demonstrated the monophyly of + +H. birmanus + +and + +H. hampei +( +Ferrari, 1867 +) + +, with an interspecific nucleotide difference of 16.53%. The interspecific nucleotide difference between + +H. birmanus + +and + +H. eruditus + +was 17.23%. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFD22D6E2DE9FC8290B54FA7.xml b/data/03/DE/8F/03DE8F5DFFD22D6E2DE9FC8290B54FA7.xml new file mode 100644 index 00000000000..16a53c54308 --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFD22D6E2DE9FC8290B54FA7.xml @@ -0,0 +1,247 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +54. + +Diuncus corpulentus +( +Eggers, 1930 +) + + + + + + +( +Figure 68 +) + + + + += + +Xyleborus corpulentus +Eggers, 1930 + + + +This species is diagnosed by the following morphological characters: +♀ +frons plano-convex, surface finely reticulate with distinct shallow sparse punctures, vestiture of very sparse fine hairs distinct on lateral areas near eyes, longer and relatively denser on epistomal margin; antennal club obliquely truncate ( +type +1), segment 1 corneous and dominant on both sides; pronotum from lateral view rounded ( +type +5), dorsal view rounded ( +type +1); postero-lateral angles broadly rounded; sides bulging out and converging anteriorly terminating into an angular projection, anterior margin armed with six asperities, larger pair at middle; summit distinct almost at middle; anterior declivous portion armed with distinct triangular asperities in concentric rows, gradually increasing in size anteriorly; posterior half shiny, finely reticulate and punctate, vestiture of sparse hairs anteriorly and postero-laterally; scutellum triangular flushed with elytra; elytra 1.58× as long as pronotum,1.27× as long as wide; basal margin substraight; lateral sides sub-parallel up to basal two-thirds, converging posteriorly into an angular apex; postero-lateral margins of elytra strongly carinate and confluent with interstria 7; striae marked by close fine punctures; interstriae 4–5× as wide as striae, surface flat with irregular punctures and inconspicuous hairs; declivity commencing from slightly above the middle, interstriae 2 armed by three denticles at commencement of declivity; declivital interstriae 3, 5, and 6 with a uniseriate row of denticles along its length; vestiture of minute, confused, recumbent interstrial hairs and a few long hairs along lateral sides; elytra and pronotum dark colored, basal half of pronotum yellowish-brown; body length: +2.62 mm +, 2.15× as long as wide. + + + +Male is very similar to female except small in size; eyes feebly emarginate; anterior pronotal margin weakly produced but unarmed; hairs inconspicuous. + + + +Material examined: + +Holotype +♀ +in FRI +Dehradun +( + +Xyleborus corpulentus +Eggers, 1930 + +). Type locality: +Upper Dihing Reserve +, +Lakhimpur +, +Assam +, +India + + + + +New +record: +India +: +1 ♀ +. +Himachal Pradesh +, +Palampur +, +Tanda +( +32° 06.141′ N +, +076° 32.036′ E +, + +4008 ft. + +), +A.A. Buhroo +, + +25.09.2018 + +( +KUIC +) + +. + + + + +Distribution: +India +: +Himachal Pradesh +(Tanda Palampur) (new record), +Assam +, Andaman Islands, +West Bengal +. +Nepal +, +China +: +Xizang + + + + +Hosts: + +Grevillea robusta + +( +Proteaceae +) (new host record). + +Acrocarpus fraxinifollius + +( +Fabaceae +), + +Artocarpus chama + +( +Moraceae +), + +Cryptocarya wightiana + +( +Lauraceae +), + +Sterculia villosa + +( +Malvaceae +), + +Vatica lanceifolia + +( +Dipterocarpaceae +). + + + +FIGURE 68 +. + +Diuncus corpulentus + +. Female: dorsal view +A +, lateral view +B +, frons +C +. + + + + +Genus + +Xyleborinus +Reitter, 1913 + + + + + +Xyleborinus +species + +are diagnosed by the following combination of characters: body length: +1.4–3.5 mm +(male dwarf, deformed and flightless); anterior margin of the compound eyes emarginated; antennal funicle five-segmented; the antennal club is obliquely truncate with segment 1 corneous and dominant on both sides of the club ( +type +1); pronotum longer than wide ( +type +8); anterior slope of pronotum convex, anterior margin armed by weak to moderate serrations; scutellum depressed, conical, not fitting in the scutellar notch, the cavity around the scutellum bears distinctive short tuft of hairs;elytra striate, punctures in rows; declivity usually armed by tubercles or spines; procoxae contiguous; host: deciduous trees. + + + + \ No newline at end of file diff --git a/data/03/DE/8F/03DE8F5DFFD32D692DE9FB9090274809.xml b/data/03/DE/8F/03DE8F5DFFD32D692DE9FB9090274809.xml new file mode 100644 index 00000000000..671a6df88df --- /dev/null +++ b/data/03/DE/8F/03DE8F5DFFD32D692DE9FB9090274809.xml @@ -0,0 +1,208 @@ + + + +A taxonomic monograph of subfamily Scolytinae (Coleoptera: Curculionidae) in the Western Himalaya + + + +Author + +Buhroo, Abdul Ahad +0000-0002-9576-1165 +Section of Entomology, Department of Zoology, School of Biological Sciences, University of Kashmir, Srinagar- 190006 India abuhroo @ yahoo. com; https: // orcid. org / 0000 - 0002 - 9576 - 1165 +abuhroo@yahoo.com + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5533 + + +1 + + +1 +82 + + + + +http://dx.doi.org/10.11646/zootaxa.5533.1.1 + +journal article +10.11646/zootaxa.5533.1.1 +1175-5334 +14023339 +F48DF7EE-7DED-49D3-96A5-620881E3AB36 + + + + + +53. + +Cyclorhipidion inarmatum +( +Eggers, 1923 +) + + + + + + +( +Figure 67 +) + + + + += + +Xyleborus inarmatus +Eggers, 1923 + + + += + +Xyleborus vagans +Schedl, 1977 + + + +This species is diagnosed by the combination of following morphological characters: +♀ +frons weakly convex and devoid of any median lines; surface finely reticulate, upper half with irregular deep punctures and lower half with minute granules and fine hairs; eyes elongately oval and nearly half of its width emarginated; antennal scape short; club flat ( +type +3); pronotum longer than wide, rounded ( +type +7) from dorsal view and from lateral view as well; anterior margin broadly rounded and unarmed; anterior two-thirds with small asperities; posterior portion finely reticulate with distinct punctures; scutellum large, shiny and tongue-shaped; +type +3; pronotum scutellum visible; elytra 1.5× as long as pronotum and 1.6× as long as wide; basal margin substraight, lateral sides subparallel nearly upto two-thirds, converging posteriorly with rounded apex; discal striae feebly impressed, marked by shallow punctures, each with a microhair; interstriae flat somewhat wider than striae with irregular granules and fine hairs; declivity commencing on posterior third, face steeply rounded; striae distinctly impressed with distinct small punctures, each with a microhair; interstriae 1 and 3 feebly elevated armed with large tubercles; interstriae 2 always unarmed; postero-lateral margins rounded; setae on interstriae +1 in +two confused rows, interstriae 2 with uniseriate setae; body color yellowish brown, elytra comparatively darker; body length: 2.8–3.0 mm, 2.8× as long as wide. + + + + +Material examined: + +Lectotype +in NMNH (image), +Smithsonian Institution +, +Washington +, D.C. +USA + + + + + +Distribution: +India +: +Himachal Pradesh +, +West Bengal +. +Bhutan +, +China +: +Yunnan +, +Indonesia +: +Sumatra +, +Laos +, +Myanmar +, +Thailand +, +Vietnam +. + + + + +Hosts: +Recorded from + +Castanopsis + +and + +Quercus + +( +Fagaceae +), and probably with a close association with + +Fagaceae ( + +Beaver +et al. +2014 + +) + +. + + + +FIGURE 67 +. + +Cyclorhipidion inarmatum + +. Lectotype female: dorsal view +A +, lateral view +B +. ( + +Smith +et al +. 2020 + +). + + + + +Genus + +Diuncus +Hulcr & Cognato, 2009 + + + + + +Diuncus +species + +are distinguished by the following combination of morphological characters: body length: 1.5–3.0 mm; antennal club truncate, segment 1 corneous and dominant on both sides; pronotum stout, with 4–6 serrations on anterior margin; pronotum from lateral view rounded, robust ( +type +5), from dorsal view rounded ( +type +1), rarely conical and angulate ( +type +6); declivity flat and broad, margins broadened and distinctly carinate, declivital base often armed with one or two pairs of denticles; protibiae obliquely triangular, with 3–5 large denticles, denticles distinctly longer than wide; scutellum visible and flush with the elytra; mycangial tufts absent; and procoxae contiguous; host: deciduous trees. + + + + \ No newline at end of file diff --git a/data/03/EF/87/03EF8798FFA9FF8666E8FCDCF5DBFD6B.xml b/data/03/EF/87/03EF8798FFA9FF8666E8FCDCF5DBFD6B.xml index ee852043354..7e0c309ce65 100644 --- a/data/03/EF/87/03EF8798FFA9FF8666E8FCDCF5DBFD6B.xml +++ b/data/03/EF/87/03EF8798FFA9FF8666E8FCDCF5DBFD6B.xml @@ -1,84 +1,85 @@ - - - -A new species of Coelidiana Oman (Hemiptera: Cicadellidae: Neocoelidiinae) from Brazil with key to Brazilian species, description of immature stages, and notes about parasitoids and host plant + + + +A new species of Coelidiana Oman (Hemiptera: Cicadellidae: Neocoelidiinae) from Brazil with key to Brazilian species, description of immature stages, and notes about parasitoids and host plant - - -Author + + +Author -Gonçalves, Clayton Corrêa -0000-0003-3045-3425 -Laboratório de Entomologia, Departamento de Zoologia, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil. -clayton.correa.goncalves@gmail.com +Gonçalves, Clayton Corrêa +0000-0003-3045-3425 +Laboratório de Entomologia, Departamento de Zoologia, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil. +clayton.correa.goncalves@gmail.com - - -Author + + +Author -Silva, Jean Francisco Souza Da -0009-0000-6528-9835 -Departamento de Zoologia, Setor de Ciências Biológicas, Universidade Federal do Paraná, Curitiba, PR, Brasil. -jeanfco99@gmail.com +Silva, Jean Francisco Souza Da +0009-0000-6528-9835 +Departamento de Zoologia, Setor de Ciências Biológicas, Universidade Federal do Paraná, Curitiba, PR, Brasil. +jeanfco99@gmail.com - - -Author + + +Author -Domahovski, Alexandre Cruz -0000-0003-4588-4236 -Laboratório de Entomologia, Departamento de Zoologia, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil. -domahovskiac@yahoo.com.br +Domahovski, Alexandre Cruz +0000-0003-4588-4236 +Laboratório de Entomologia, Departamento de Zoologia, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil. +domahovskiac@yahoo.com.br - - -Author + + +Author -Alasmar, Luísa -0000-0001-8210-1080 -Departamento de Zoologia, Setor de Ciências Biológicas, Universidade Federal do Paraná, Curitiba, PR, Brasil. -lualasmar@gmail.com +Alasmar, Luísa +0000-0001-8210-1080 +Departamento de Zoologia, Setor de Ciências Biológicas, Universidade Federal do Paraná, Curitiba, PR, Brasil. +lualasmar@gmail.com - - -Author + + +Author -Paladini, Andressa -0000-0001-8894-6092 -Departamento de Zoologia, Setor de Ciências Biológicas, Universidade Federal do Paraná, Curitiba, PR, Brasil. -andri.paladini@gmail.com +Paladini, Andressa +0000-0001-8894-6092 +Departamento de Zoologia, Setor de Ciências Biológicas, Universidade Federal do Paraná, Curitiba, PR, Brasil. +andri.paladini@gmail.com -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -359 -372 + +359 +372 - -http://dx.doi.org/10.11646/zootaxa.5529.2.7 + +http://dx.doi.org/10.11646/zootaxa.5529.2.7 -journal article -10.11646/zootaxa.5529.2.7 -1175-5326 -32D3A3D6-7CAC-4098-BBBE-A932CB9FC8A6 +journal article +10.11646/zootaxa.5529.2.7 +1175-5326 +14022520 +32D3A3D6-7CAC-4098-BBBE-A932CB9FC8A6 - + @@ -94,7 +95,7 @@ ( -Figs 1–5 +Figs 1–5 ) @@ -102,23 +103,23 @@ Diagnosis. Crown ( -Fig. 3A, C +Fig. 3A, C ) with four orange stripes, three longitudinal and one transverse forming E-shaped macula. Forewing ( -Fig. 3A–D +Fig. 3A–D ) yellow with a brown stripe along the entire anal margin and appendix. Male pygofer ( -Fig. 1F +Fig. 1F ) dorsal margin with an elongated, narrow and acute process, contiguous to the margin, slightly surpassing pygofer apex; ventral margin with a small dentiform apical process. Subgenital plates, in lateral view ( -Fig. 1E, H +Fig. 1E, H ) surpassing the pygofer apex, narrow at base and widened on apical half; in ventral view ( -Fig. 1G +Fig. 1G ) plates fused together along their entire length, except apically. Connective ( -Fig. 1I +Fig. 1I ) Y-shaped.Aedeagus ( -Fig. 1K +Fig. 1K ) in lateral view with atrium broad bearing an acute, slightly recurved ventral process nearly same size and shape as shaft, fused basally to shaft, expanded subapically in posterior view ( -Fig. 1L +Fig. 1L ); shaft tubular, elongated and narrow, with apex subacute. Female sternite VII ( -Fig. 2A, C +Fig. 2A, C ) wider than long; posterior margin with median third deeply and roundly excavated. @@ -137,31 +138,31 @@ male: total length 5.7. Coloration. Green, in life ( -Fig. 3E +Fig. 3E ), pale yellow, preserved ( -Fig 3A–D +Fig 3A–D ). Crown ( -Fig. 3A +Fig. 3A ) with four orange stripes, three longitudinal and one transverse forming E-shaped macula, longitudinal strips extending to mesonotum. Forewing ( -Fig. 3A–D +Fig. 3A–D ) yellow with a brown stripe along the entire anal margin and appendix. Description. Head, in dorsal view ( -Fig. 1A +Fig. 1A ), moderately produced anteriorly, median length of crown approximately equal to or slightly less than interocular width; transocular width about six-sevenths of humeral width of pronotum; crown subpentagonal, anterior margin bluntly angled, surface flat and smooth; ocellus on anterior margin of head, distant from eye margin, not visible in dorsal view; coronal suture indistinct. Head, in frontal view ( -Fig. 1B +Fig. 1B ), with face approximately as high as wide; frontogenal suture reaching to ocelli; antennal ledge oblique and carinate; frons approximately 1.5 times longer than wide; muscle impressions indistinct; epistomal suture distinct, complete and slightly arched; clypeus approximately 1.6 times longer than maximum width, lateral margins parallel, apex straight; maxillary plate produced ventrally, slightly surpassing the clypeus apex; lorum ellipse-shaped, apical margin not reaching apex of clypeus; gena incompletely covering episternum. Head, in lateral view ( -Fig. 1C +Fig. 1C ), with crown-face transition subacute, with marginal carina; lateral margins of crown, adjacent to eyes, raised and not carinated; antenna with long flagellum, exceeding half-length of forewing; frons convex. Pronotum ( -Fig. 1A +Fig. 1A ) with slightly transverse superficial striae on disc; lateral margins rounded, convergent anterad, as long as eye; posterior margin acutely excavated; in lateral view ( -Fig. 1C +Fig. 1C ), slightly declivous; dorsopleural carina present and slightly arched. Mesonotum ( -Fig. 1A +Fig. 1A ) as long as wide. Forewing ( -Fig. 1D +Fig. 1D ) semi-hyaline, approximately 3.3 times longer than maximum width; venation distinct apically; three anteapical and four apical cells, bases of second and fourth apical cells approximately equidistant, base of third apical cell more distal than basis of second and fourth apical cells; alar appendix narrow; apex rounded. Hind wing with vein R 4+5 and M @@ -173,47 +174,47 @@ setae between macrosetae; PD, AD, and PV rows with 15–16, 9–11, and 38–42 Male terminalia. Pygofer, in lateral view ( -Fig. 1E, F +Fig. 1E, F ), subtriangular, wide at the base and progressively narrowing towards the apex; dorsal and ventral margins strongly sclerotized; dorsal margin with an elongated, narrow and acute process, contiguous to the margin, slightly surpassing pygofer apex; ventral margin broadly rounded on basal half, apical portion with a small dentiform process; apex subtruncate. Anal tube ( -Fig. 1E +Fig. 1E ) cylindrical; tergite X four times longer than wide; without processes. Subgenital plates, in lateral view ( -Fig. 1E, H +Fig. 1E, H ) surpassing the pygofer apex, approximately 2.3 times longer than maximum height; narrow at base and widened on apical half; dorsal margin excavated on basal half and rounded on apical half, with a tuft of small setae; apex rounded; in ventral view ( -Fig. 1G +Fig. 1G ) oval, plates fused together along their entire length, except apically; anterior margin deeply excavated; lateral margins rounded and convergent anteriorly and posteriorly; apex of each plate rounded. Connective ( -Fig. 1I +Fig. 1I ) Y-shaped, arms slightly longer than stem; approximately two-thirds length of style; slender dorsal keel present and projected anteriorly between arms. Style ( -Fig. 1E, I, J +Fig. 1E, I, J ) with apophysis moderately stout, slightly expanded apically; preapical lobe reduced and rounded, with some elongated setae; apex curved ventrally, hook-shaped. Aedeagus, in lateral view ( -Fig. 1E, K +Fig. 1E, K ), with dorsal apodeme membranous and narrow; preatrium well developed; atrium broad bearing a ventral process fused basally to shaft, elongated, about half length of shaft; shaft tubular, elongated and narrow, apex subacute; gonopore subapical ventral; in posterior view ( -Fig. 1L +Fig. 1L ), ventral process expanded subapically in posterior view. Female terminalia. Sternite VII ( -Fig. 2A, C +Fig. 2A, C ) U-shaped, 1.4 times wider than long; lateral margins slightly rounded; posterior margin with median third deeply and roundly excavated. ʻInternalʼ sternite VIII ( -Fig. 2C +Fig. 2C ) sclerotized, medially narrow and lateral region expanded in a semicircular shape. Pygofer ( -Fig. 2B, D +Fig. 2B, D ) elongate, 1.6 times as long as maximum height; dorsal margin straight; ventral margin broadly rounded; macrosetae distributed near apex and ventral margin; apex truncated. Ovipositor ( -Fig. 2B +Fig. 2B ) slightly exceeding apex of pygofer, slightly curved dorsally. First valvifer ( -Fig. 2E +Fig. 2E ) subrectangular oblique, higher than long; margins straight, angles rounded. First valvula of ovipositor ( -Fig. 2E, F +Fig. 2E, F ) elongated, height approximately constant throughout the length; dorsal sculptured area submarginal, present throughout apical half, expanded to the ventral region only in the apical portion, sculptured area approximately bacilliform near dorsal margin and strigate near median region; apex subacute. Second valvifer ( -Fig. 2G +Fig. 2G ) higher than long. Second valvula of ovipositor ( -Fig. 2G, H +Fig. 2G, H ) elongated, fused to each on median portion; apical portion slightly expanded, dorsal margin with several irregular small teeth and with two larger teeth, one basal and one median. Gonoplac ( -Fig. 2I, J +Fig. 2I, J ) gradually expanded over most of length, evenly tapered in apical third; external surface along ventral margin and apex with dentiform cuticular projections and few short and robust setae; apex rounded or acutely rounded. - + FIGURE 1. @@ -249,7 +250,7 @@ Sternite VII ( , aedeagus, posterior view. Scale bars in mm. - + FIGURE 2. @@ -500,7 +501,7 @@ and Coelidiana diminuta due to the presence of a single ventral process on the aedeagus but the former differs in having the ventral process of the aedeagus basally fused to the shaft ( -Fig. 1K +Fig. 1K ). diff --git a/data/03/F0/29/03F029281E01FF91FF215606FAEAFF39.xml b/data/03/F0/29/03F029281E01FF91FF215606FAEAFF39.xml new file mode 100644 index 00000000000..c7a34640092 --- /dev/null +++ b/data/03/F0/29/03F029281E01FF91FF215606FAEAFF39.xml @@ -0,0 +1,335 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Ulivellia pseudinsolita +Kameneva & V. Korneyev + +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +F2BE9A18-8FAA-4FB2-9D3C-37489BFC0066 + + + + + +Figs 4 G +, +55–56 + + + + +Material examined. Type. + +Holotype +♂ +: + +Brazil + +: “Corupa [Corupá], +S. Cath. +[ +Santa Catarina +] / (Hansa Humbolt) / + +II 1945 + +”, “ +A. Maler +, Coll. / Frank Johnson / Donor” (abdomen dissected and attached in a plastic tube with glycerin under specimen) ( +AMNH +). + + + + + +Diagnosis +. + +Ulivellia pseudinsolita + +differs from other species of the genus + +Ulivellia + +in having a wing pattern with oblique discal crossband, prescutellar acrostichal setae present, halter and legs entirely black; it most closely resembles + +U. tenoris + +in having wing pattern with four narrow brown crossbands, of which discal and preapical are oblique and clearly diverging posteriorly, differing from it by the wider wing and the hyaline interspace between discal and preapical crossbands narrower, colouration of legs and halters and presence / absence of acrostichal setae (see the key). Both species have a wing pattern similar to that of + +Euxesta insolita +Hendel 1909 + +( +Fig. 4 I +), clearly differing by the at least partly hyaline or yellow wing base (in + +E. insolita + +completely black); as well as by the almost twice larger size (in + +E. insolita + +wing length = 3.0– +3.5 mm +), and the epistome / clypeus sizes. + + + + +Description +. Male. Head ( +Figs 55 C–D +) ratio (length: height: width) = 1: 1.4: 1.7, frons, parafacial, and gena yellowish brown, face and occiput black. Frons shiny brown, narrowed posteriorly ( +Fig. 55 C +), 1.2× as long (from the lunule to inner vertical seta) as wide at lunule and 1.5× longer than wide at vertex or 0.85× as long (from the lunule to anterior ocellus) as wide at lunule and 1.1× longer than wide at vertex, with metallic shining, brown or black ocellar triangle and vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.3× broader than postpedicel, sparsely white microtrichose. Frontal plates with 6–8 proclinate parafrontal setulae and 6–7 moderately strong, frontal setae and the frontal vitta with 3 interfrontal setae on each side, anteriormost crossing, longer than other setulae and half as long as outer vertical seta; 1 very long orbital seta 1.2× longer than ocellar seta, 0.8× longer than inner vertical seta and twice as long as outer vertical seta and 1 reclinate anterior orbital seta as long as longest frontal setae; postocellar seta long, 0.7× longer than inner vertical seta; outer vertical seta short, 0.4× longer than inner vertical seta and twice as long as postocular setae forming one row, allied by 15–20 dorsal and 18–25 ventral occipital setae. Lunule indistinguishable. Eye 1.6× higher than long. Face above transverse fold 0.6× higher than wide at fold, brown, white microtrichose; epistome entirely black or dark brown, sparsely white microtrichose, with metallic cyan sheen, strongly produced anteriorly. Clypeus shiny brown, sparsely white microtrichose, 0.3× higher than epistome. Gena brownish yellow, with long genal seta and 4–5 peristomal setae anterior of it, 0.4–0.5× longer than genal seta. Occiput black, except postgena partly brown, with cyan metallic sheen, greyish microtrichose; ventral part of occiput (postgena) with 5–7 setae almost as long as genal seta. + +Antenna brown; scape and pedicel with black setulae; postpedicel brown, whitish microtrichose, twice as long as wide, apically rounded; arista black to brown at base, almost bare. Mouthparts black, prementum black, with steel sheen. Palp brown, moderately wide crescent, apically rounded, with 9–12 long black setulae, of them medial setulae longer than others. + +Thorax +( +Fig. 55 E +) brown to black, with bluish sheen and sparse white microtrichia not obscuring underlying cuticle. Mesonotal scutum 1.1×as long as wide; with brown microtrichia posterolateral to transverse suture, black setulose, with 12–16 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar setae present; prescutellar area setulose behind anterior dorsocentral setae to acrostichal seta. Scutellum dorsally very slightly convex, black, almost matt, sparsely microtrichose, without setulae, laterally with bluish sheen. Subscutellum and mediotergite black, grey microtrichose. Other setae as described for the genus. All the setae and setulae black. + + +Wing +( +Figs 4 G +, +55 A, B, F +) +5.5 mm +( +♂ +) long, 3× longer than wide; basicostal cell hyaline or yellowish; costal cell 5× longer than wide, slightly widened apically, brown in basal half, with costa very slightly curved posteriorly, but forming neither lobe nor cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, 4.4× longer than wide, vein R +1 +with 15–17 setulae dorsal to Sc apex, terminating at level of crossvein dm-m; vein R +2+3 +weakly arcuate, subparallel to costa, turning towards it before very apex. Crossvein r-m distal to center of cell dm. Cell r +4+5 +5.8× longer than wide, widened distally of crossvein dm-m, narrowed apically. Cell m +1 +narrowly triangular; the ultimate section of M +1 +3.7× longer than crossvein dm-m and 2.8× longer than penultimate section, markedly deepened posteriorly at middle. Vein CuA Z-shaped, forming moderately long posteroapical lobe of cell cua along vein CuP, 1.3× longer than its anterior shoulder. Wing pattern with subbasal crossband from basal half of costal cell through cell cua into alula, wide oblique brown discal crossband from pterostigma to base of cell m +4 +except its very base and apex; narrow and oblique preapical crossband from cell r +1 +through crossvein dm-m merging with apical crossband in cell r +1 +reaching apex of cell m +1 +; hyaline interspace between discal and preapical crossband 1.3–1.6 as wide as discal crossband in cell dm ( +Fig. 4 G +, +55 A +). Cell cup and anal lobe pale grey, narrower than cell cua. Alula 3× longer than wide, grey in apical 0.5–0.6. Calypters white, with white cilia. Halter dark brown to black. + + + +FIGURE 55. + +Ulivellia pseudinsolita + + +sp. nov. + +holotype ♂. +A +, habitus, left and dorsal; +B +, same, dorsal; +C +, head, anterior; +D +, same, left; +E +, mesonotum, dorsal; +F +, wing, anterobasal part; +G +, labels. Scale bar 2 mm. + + + +Legs +( +Fig. 55 A +) with yellow or brownish yellow coxae and trochanters, femora and tibiae entirely black, except coxae and knees narrowly brown, with bluish sheen; tarsi entirely brownish yellow, black setose and setulose. Fore femur with 2 rows of posterodorsal and posterior setae slightly shorter than femur width, and 4–5 strong posteroventral setae in apical half. Mid femur anteriorly with row of short suberect setulae; mid tibia with one strong medioventral seta 2.1× longer than tibia width. + + +Abdomen +moderately elongate ( +Figs 55 A, B +, +56 F +), black, sparsely whitish microtrichose, with cyan metallic sheen. Tergite 5 not microtrichose, somewhat shagreened, dull. + + +Cerci wide oval, moderately developed, partly fused at bases elongate, sack-like; setulose ( +Figs 56 A–D +). Epandrium ovoid, dorsally short, moderately setulose; surstyli basally wide, outer surstylus flattened, posteroventrally directed, apically oval with single trichoid sensillum; inner surstylus with four very strong claw-like mesally directed prensisetae ( +Figs 56 A, C, D +). Pregonites symmetrical, almost flat, with 5 moderately developed setulae ventro-mesally, conspicuously anterior to postgonites ( +Figs 56 C, E +). Postgonites on laterobasal part of the phallic guide lobes, with 4–5 small trichoid sensilla ( +Figs 56 C, E +). Phallus moderately short and narrow, about 2.5–3× longer than epandrium high, thin and bare ( +Figs 56 A–E +). + + + +FIGURE 56. + +Ulivellia pseudinsolita + + +sp. nov. + +holotype ♂. +A +, postabdomen, posterior; +B C +, same, ventral; +D +, same, ventrolateral; +E +, surstyli and hypandrium, ventral; +F +, preabdomen, ventral. Abbreviations: cerc—cerci; ej apod—ejaculatory apodeme; epand—epandrium; ph g—phallic guide; ph—phallus; pregt—pregonite; p l sur—posterior lobe of surstylus; v l sur—ventral lobe of surstylus; st 2— second sternite; st 3—third sternite; st 4—fourth sternite; st 5—fifth sternite. + + + +Female +unknown. + + + + +Etymology. +The species name is an adjective and is composed of the Greek “pseud-” (“false”) and the species name +“insolita +”, reflecting the superficial similarity of the wing pattern to + +Euxesta insolita +Hendel, 1909 + +. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E05FF9EFF215007FEBAFB99.xml b/data/03/F0/29/03F029281E05FF9EFF215007FEBAFB99.xml new file mode 100644 index 00000000000..3218e9c0452 --- /dev/null +++ b/data/03/F0/29/03F029281E05FF9EFF215007FEBAFB99.xml @@ -0,0 +1,530 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Ulivellia tenoris +Kovac & Kameneva + +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +99D46D24-8AA7-4683-AFF4-0F7D4A2A55E0 + + + + + +Figs 4 F +, +7 D +, +8 +, +9 C, H +, +57 +, +59–60 +. + + + + +Material examined. Type. + +Holotype +♀ +: “ + +Bolivia + +: +Santa Cruz +, near +Buena Vista +( +El Cairo +) [ +17.4734S +, +63.6922W +], larva in bamboo internodium ( + +Guadua chacoensis + +, last year), emerged on + +05.ii.2011 + +, Bol Z15/4/11, leg. +D. Kovac +” ( +SMF +). + + + +Larvae. + + +Bolivia + +: +Buena Vista +, + +6.ii.2011 + +, BolZ32/11, +5 larvae +( +D. Kovac +leg.) ( +SMF +) + +. + + + + +Diagnosis +. + +Ulivellia tenoris + +differs from other species of the genus in the combination of non-lobed costal cell, the presence of prescutellar acrostichal setae, a completely black halter and legs; it is most similar to + +U. pseudinsolita + +in having a wing pattern with four narrow brown crossbands, of which the discal and preapical are oblique and clearly diverging posteriorly, and differs from it in having a narrower wing and a wider hyaline interspace between discal and preapical crossbands, in the partly yellow colouration of legs and halter, and in the absence of the acrostichal setae (see the key). Both species have the wing pattern similar to that of + +Euxesta insolita + +, clearly differing by the at least partly hyaline or yellow wing base (in + +E. insolita + +entirely black); as well as by the almost twice larger size (in + +E. insolita + +wing length =3.0– +3.5 mm +). + + + + +Description +. Female. +Head +( +Figs 57 C–D +) ratio (length: height: width) = 1: 1.3: 1.7, frons, vertex, parafacial, and gena brownish yellowish brown, face and occiput mostly brown. Frons subshining yellowish-brown, narrowed posteriorly ( +Fig. 57 C +), 1.17× as long (from the lunule to inner vertical seta) as wide at lunule and 1.4× longer than wide at vertex or 0.9 × as long (from the lunule to anterior ocellus) as wide at lunule and as long as wide at vertex; with metallic shining, brown ocellar triangle and vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.2× broader than postpedicel, sparsely white microtrichose. Frontal plates with 8–10 proclinate parafrontal setulae and 8–9 frontal setae, forming 1–3 irregular rows; frontal vitta with 6–7 interfrontal setae at each side, anteriormost submedial setulae crossing, longer than other setulae and half as long as outer vertical seta; 1 reclinate anterior orbital setula (as long as longest frontal setae) and 1 very long posterior orbital seta as long as ocellar seta, 0.56× longer than inner vertical seta and 1.5× longer than outer vertical seta; postocellar seta long, 0.56× longer than inner vertical seta; outer vertical seta short, 0.4× longer than inner vertical seta and twice as long as postocular setae forming one row, allied by 8–10 dorsal and 10–12 ventral occipital setae. Lunule narrow, indistinct, orange. Eye 1.5× higher than long. Face (above suture) 0.65× higher than wide at transverse fold, yellowish brown, white microtrichose; epistome dark brown, sparsely white microtrichose, with metallic cyan sheen, strongly produced anteriorly and separated from upper part of face by deep fold. Clypeus shiny brown, sparsely white microtrichose, 0.5× higher than epistome. Gena brownish yellow, with moderately long genal seta and 4–5 peristomal setae anterior of it, 0.4–0.5× longer than genal seta. Occiput brown, medially yellow, with cyan metallic sheen, greyish microtrichose; ventral part of occiput (postgena) with 8–10 setae as long as genal seta. + +Antenna brownish yellow; scape and pedicel with black setulae; postpedicel brown, whitish microtrichose, twice as long as wide, apically rounded; arista brown, almost bare. Mouthparts brown, prementum dark brown, with steel sheen. Palp brown, moderately wide crescent, apically rounded, with 7–8 long black setulae, of which 3–4 apico-medial ones longer than other setulae. + +Thorax +( +Fig. 57 E +) brown to black, with greenish sheen and sparse white microtrichia not obscuring underlying cuticle. Mesonotal scutum 1.2× longer than wide; with brown microtrichia posterolateral to transverse suture, black setulose, with 10–12 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar setae absent; prescutellar area setulose to posterior dorsocentral seta. Scutellum dorsally very slightly convex, brown, subshining, sparsely microtrichose, without setulae, laterally yellow, with greenish sheen. Subscutellum and mediotergite black, grey microtrichose. Other setae as described for the genus. All the setae and setulae black. + + + +FIGURE 57. + +Ulivellia tenoris + + +sp. nov. + +holotype ♀. +A +, habitus, left; +B +, same, dorsal; +C +, head, anterior; +D +, same, left; +E +, mesonotum, dorsal; +F +, abdomen, dorsal; +G +, labels. Scale bar 2 mm. + + + +Wing +( +Fig. 4 F +) +6.4 mm +( +♀ +) long, 3.2× longer than wide; basicostal cell yellowish; costal cell 7× longer than wide, brown in basal half, with costa almost straight, forming neither lobe nor cleft; pterostigma entirely brown, narrow triangular, 6× longer than wide, vein R +1 +with 13–15 setulae dorsally after Sc apex, ending at level of crossvein dm-m; vein R +2+3 +weakly arcuate, subparallel to costa, turning towards it before very apex. Crossvein r-m distal to middle of cell dm. Cell r +4+5 +7× longer than wide, widened distal to crossvein dm-m, narrowed apically. Cell m +1 +narrowly triangular; the ultimate section of M +1 +4.8× longer than crossvein dm-m and 1.9× longer than penultimate section, conspicuously deepening posteriorly. Vein CuA Z-shaped, forming moderately long posteroapical lobe of cell cua along vein CuP, 1.2× longer than its anterior shoulder. Wing pattern with subbasal crossband from basal half of costal cell through cell cua into alula, wide oblique brown discal crossband from pterostigma to base of cell m +4 +except its very base and apex; narrow and oblique preapical crossband from cell r +1 +through crossvein dm-m merging with apical crossband in cell r +1 +to apex of cell m1; hyaline space between discal and preapical crossband 2.7–2.8 times as wide as discal crossband in cell dm ( +Fig 4 F +, +57 A +). Cell cup and anal lobe grey in apical half, narrower than cell cua. Alula 3× longer than wide, grey in apical 0.5–0.6. Calypters white, with white cilia. Halter brownish yellow. + + +Legs ( +Fig. 57 A +) with yellow or brownish yellow coxae and trochanters, femora and tibiae entirely black, except knees narrowly brown, with bluish sheen; tarsi entirely brownish yellow, black setose and setulose. Fore femur with 2 rows of posterodorsal and posterior setae slightly shorter than femur width, and 4–5 strong posteroventral setae in apical half. Mid femur anteriorly with row of short suberect setulae; mid tibia ventrally with one subequal spur-like seta 2–2.1× longer than tibia width. + + +Abdomen +moderately elongate ( +Fig. 57 F +), black, sparsely whitish microtrichose, with greenish metallic sheen; syntergite 1+2 sometimes brown. Tergites 4–5 subequally long; tergite 6 of +♀ +short, completely hidden beneath tergite 5. + + +Larva. General structure +: As in + +A. duo + +, body length +7.6–12.7 mm +(median: +9.45 mm +; n = 10), width +2.5–2.9 mm +(median: +2.65 mm +; n = 10). + + + +FIGURE 58. + +Ulivellia arcuata + + +sp. nov. + +, SEM views of mouthooks and abdominal creeping welts ( +CW +), posterior spiracle and puparium +A +, mouthhooks; +B +, CW1 on abdominal segment I, ventral view; +C +, CW2 on abdominal segment II, ventral view; +D +, CW4 on abdominal segment IV, ventral view; +E +, CW8 on abdominal (caudal) segment VIII, ventral view; +F +, left posterior spiracle; +G +, dorsal view of anterior portion of empty puparial integument. Abbreviations: a–e—creeping welt rows a-e. (All photographs by Damir Kovac.) + + + +Pseudocephalon. +As in + +A.duo + +( +Figs 59 A–F +). Second antennal segment retracted, not visible, 25 and 28 oral ridges adjacent to oral cavity, identical on both sides of the body (n = +2 larvae +). + + + +FIGURE 59. + +Ulivellia tenoris + + +sp. nov. + +, SEM views of pseudocephalon. +A +, pseudocephalon, ventral view; +B +, thoracic segment I, lateral view; +C +, oral cavity with mouth hooks and oral ridges; +D +, labial lobe; +E +, sensory pits (labial organ) on labial lobe; +F +, pit-sensilla in left posterior corner of oral ridge area. Abbreviations: ant—antenna, ant spir—anterior spiracle, ceph l—cephalic lobe, lal—labial lobe, la org—labial organ, max org—maxillary organ, mh—mouthhook, mol—median oral lobe, or rg—oral ridges, pit-s—pit sensillum, s1–s14—cuticular sensilla s1–s14 on right side of the body, prot spn—prothoracic spinules. (All photographs by Damir Kovac.) + + + +Cephalopharyngeal skeleton +( +Fig. 7 D +). As in + +Aspistomella duo + +. Total length +1.6–1.7 mm +(n = 3). Indentation between tips of apical tooth and ventral apodeme 0.59–0.68× as deep as wide; +one specimen +with one small, +one specimen +with very small, and +one specimen +without preapical tooth. Hypopharyngeal sclerite 3.6–5.2× longer than high. Parastomal bars curved. + + + +FIGURE 60. + +Ulivellia tenoris + + +sp. nov. + +, SEM views of ventral abdominal creeping welts ( +CW +) and caudal segment +A +, CW1 on abdominal segment I, ventral view; +B +, CW2 on abdominal segment II, ventral view; +C +, CW4 on abdominal segment IV, ventral view; +D +, CW8 on abdominal (caudal) segment VIII, ventral view; +E +, anal slit; +F +, posterior spiracles on caudal segment, dorsal view; +G +, left posterior spiracle. Abbreviations: a–e—creeping welt rows a–e. (All photographs by Damir Kovac.) + + + +Thoracic segments I–III. +As in + +Aspistomella duo + +. Anterior spiracles on thoracic segment I consist of 18–24 tubules (median = 21, n = 20 tubule rows, +10 larvae +). The number of tubules on the left and right side of the same larva often differs by up to three tubules. The first thoracic segment bears 14 cuticular sensilla on each body side, the second and third thoracic segments bear 13 cuticular sensilla, +type +and location of sensilla are shown in +Fig. 8 +). + + +Abdominal segments I–VII. +Abdominal segments I–VII bear 13 cuticular sensilla on each side of the body and a pair of rudimentary lateral spiracles ( +Fig. 8 +). Ventrally, the creeping welts on abdominal segments I-VII arranged as follows: CW1 ( +Fig. 60 A +): Five more or less continuous rows of spinules, third row short, spinules in second row somewhat larger, all spinules acute and directed posteriorly. CW2 ( +Fig. 60 B +): Anteriorly about 5 discontinuous rows of small spinules, row portions short and sometimes curved, forming a reticulate structure (rows b), central row discontinuous, more pronounced laterally (row c), followed by rows of large spinules (row d) arranged as follows five short horizontal central row portions containing groups of five to seven large spinules, laterally flanked by five inclined curved rows angled to the midline, more or less connected to rows of small spinules, last row continuous, consisting of small acute spinules (row e). All spinules directed posteriorly. CW3 +– +CW7 ( +Fig. 60 C +): similar to CW2, but two additional discontinuous rows anterior to the mesh-like structure, one of them with large and one with small spinules, all directed anteriorly (rows a); central row with groups of large spinules similar to CW2, but the five central horizontal row portions as well as 1–2 adjacent inclined row portions have a double row of spinules, the anterior ones directed anteriorly and the posterior ones directed posteriorly. + + +Caudal segment +( +Figs 60 D–G +). Caudal segment bears 13 cuticular sensilla on each side of body ( +Figs 8 B, C +). Caudal creeping welt CW8 similar in structure to CW3 +– +CW7, but large spinules simpler, sometimes forming only one row; last row e arranged along anterior margin of perianal pad with anteriorly directed spinules ( +Fig. 60 D +). + + +Posterior spiracles ( +Figs 9 C +, +60 F, G +) oval, length +0.59–0.69 mm +(median = 0.6, n = 26), width +0.46–0.53 mm +, (median = 0.50, n = 26), shortest distance between spiracles +0.09–0.15 mm +(n = 15). There is a tendency for usually one of the two anterior spiracles to show a slight upward curvature. Spiracular slits with about 8–11 turns, central part of spiracular slits 1 and 3 rather flat with a small turn, spiracular slit 2 with large central loop, yellow meandering line of approximately constant width, central part between spiracular slits usually brownish, but in some specimens also black. Spiracular hairs Hair group 1: 13–16 hair trunks, Hair group 2: 1 hair trunk, Hair group 3: 9–10 hair trunks and Hair group 4: 14–16 hair trunks (n = 4 spiracles). Anal complex and anal slit as + +in +A. duo + +( +Figs 60 D, E +). + + +Puparium +( +Fig. 9 H +). Length +8.7 mm +; maximum width at the 7th abdominal segment, +2.7 mm +(n = 1); dark brown, anterior spiracles, posterior spiracles and creeping welts as in third instar larva. + + + + +Etymology. +The species name is a Latin adjective meaning “thin” or “narrow”, referring to its wing shape. + + + + +Biology +. Larvae inhabit water-filled bamboo internode cavities of + +Guadua angustifolia + +, biology as in + +Aspistomella duo + +. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E21FFB7FF2155E7FDDDF991.xml b/data/03/F0/29/03F029281E21FFB7FF2155E7FDDDF991.xml new file mode 100644 index 00000000000..16852057bf5 --- /dev/null +++ b/data/03/F0/29/03F029281E21FFB7FF2155E7FDDDF991.xml @@ -0,0 +1,351 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella schnusei +Kameneva & V. Korneyev + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +3ECD6B29-E8F2-4965-9F22-0AA92A637A76 + + + + + +Figs 6 B +, +39 + + + + +Material examined. Type. + +Holotype +♀ +: “ + +Peru + +— +Mapiri +/ 16.I.03 / +Sarampioni + +700 m + +” [ +Schnuse +leg.], “ +Paraphyola +”, “Euxestinae / Präp. 3” [ +W. Hennig’s +handwritten labels] ( +SMTD +). + + + + + +Diagnosis +. + +Aspistomella schnusei + +distantly reminds + +A. angustifrons + +, + +A. crucifera + +, + +A. garleppi + +, + +A. obliqua + +, and + +A. terezae + +in its narrow wings, and + +A. angustifrons + +, + +A. garleppi + +, and + +A. pachitea + +in its narrow frons, but it differs from all of them in that the epistome is conspicuously produced anteriorly and the wing is widely hyaline with narrow bands apically (in the epistome is only weakly developed anteriorly and the wing is widely brown with hyaline incisions apically). It also differs from the other species of the + +Aspistomella + +group of genera by its matt, finely and densely microtrichose abdominal tergites. + + + + +Description +. Female. +Head +( +Figs 39 A–D +) ratio (length: height: width) = 1: 1.46: 1.85; frons, face above transverse fold, parafacial, and gena reddish to yellowish brown, epistome and occiput mostly black. Frons narrow, slightly narrowed posteriorly, 1.05× as long (from lunule to anterior ocellus) or 1.65× (from lunule to inner vertical seta) as wide (at lunule), with almost matt brown or black ocellar triangle and brown vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, reddish-yellow, sparsely white microtrichose. Frontal plates with 9–10 parafrontal setulae, 6–8 frontal setae on each side; frontal vitta sparsely whitish microtrichose, with 3–5 interfrontal setae on each side ( +Fig. 39 C +). Eye 2× higher than long, its posterior margin distinctly concave ( +Fig. 39 D +). Face white microtrichose (above epistome); epistome brown, sparsely white microtrichose, with metallic bluish sheen. Clypeus yellow, white microtrichose, subshining, less than 1/3 as high as epistome. Gena brownish yellow, with long genal seta and 4–5 additional long peristomal setae anterior of it, as long as genal seta. Occiput black, with cyan metallic sheen, greyish microtrichose. + + + +FIGURE 39. + +Aspistomella schnusei + + +sp. nov. + +, holotype ♀ (SDEI). +A +, habitus, right; +B +, same, left; +C +, head, anterior; +D +, same, left; +E +, mesonotum, dorsal; +F +, abdominal tergites 1–3, dorsal; +G +, abdominal tergites 4–7, dorsal; +H +, labels. + + + +Antenna yellow; scape and pedicel with black setulae; postpedicel and arista missing in the +holotype +. + + +Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow, as described for + +A. angustifrons + +. Most setae missing in the +holotype +, except one very long inner vertical seta 17× longer than outer vertical seta; the latter 2× longer than postocular setae and 0.5× longer than postocellar seta. Alveolae of posterior orbital and ocellar setae almost as big as alveola of inner vertical seta, so these setae are supposed to be subequal to the latter one. Alveolae of ocellar setae strongly approxamated and touching. + + +Thorax +( +Figs 39 A, B, E +) brown to black, silvery subshining, on pleura with suberect white microtrichia not hiding underlying cuticle. Mesonotal scutum 1.4–1.5× longer than wide; matt, shagreened and covered with curled white microtrichia; black setulose, with 7–8 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta absent. Other setae as described for the genus, black. Scutellum dorsally rather flattened, brown, silvery subshining, microtrichose, without setulae. Subscutellum and mediotergite black, subshining, sparsely microtrichose. Pleura smooth, shining, sparsely white microtrichose, with cyan sheen. + + +Wing +( +Fig. 6 B +) +3.9 mm +long ( +♀ +), 3.8× longer than wide; basicostal cell hyaline; costal cell straight, 5.1× longer than wide, brown in basal 1/6 of its length; pterostigma entirely brown, narrowly triangular, 3.5× longer than wide, vein R +1 +bare, ending proximally of crossvein r-m level; vein R +2+3 +slightly arcuate in basal half, straight at apex. Crossvein r-m distal to mid-length of cell dm. Cell r +4+5 +5.7× longer than wide. Cell m +1 +narrowly triangular; ultimate section of M +1 +3.3× longer than crossvein dm-m and 1.8× longer than penultimate section, posteriorly conspicuously dipping at middle. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.2× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula, entirely brown pterostigma, narrow brown band crossing cell r +1 +posterior of it and very large brown mark posterior of it in cell br and basal halves of cells dm and cua +1 +proximally of crossvein r-m, leaving bases of these cells and cell r +2+3 +at radial fork hyaline; inconspicuous dark mark in cells r +1 +and r +2+3 +distally or r-m level; apical half of wing mostly hyaline, with oblique narrow brown band from subapical part of cell r +2+3 +through oblique vein dm-m and faint band along apical parts of cells r +4+5 +and m +1 +leaving very apex of wing hyaline ( +Fig. 6 B +). Cell cup and anal lobe half as wide as cell cua. Alula 4× longer than wide, grey. Calypters white, with white cilia. Halter yellow. + + +Legs +( +Fig. 12 +) with fore coxa mostly black, except yellow mesal and distal 1/6, densely white microtrichose; mid and hind coxae yellow, as well as all trochaners and tarsi; femora black in basal 0.8–0.9, tibiae black in basal 0.6–0.8, apically yellow, black setose and setulose. Fore femur uniformly setulose, without strong erected setae. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single spur-like seta 3.8× longer than tibia width. Hind femur without dorsal setae. + + +Abdomen +matt black, tergites fine shagreened, black setulose; tergite 5 shagreened, subshining; oviscape sparsely white microtrichose and black setulose, shining. + +Male: not known. + +Female terminalia +(not dissected): aculeus with ovoid, long-setulose cercal unit (partly exposed). + + + + +Etymology +. The species is named in honour of Karl August Wilhelm Schnuse (1850–1909), a German entomologist, who collected the +type +specimen and many other specimens of the species mentioned in this paper. + + + + +Remarks +. The left wing of the +holotype +has been removed (obviously by W. Hennig in the late 1930s during the preparation of the volumes of “Die Fliegen der Palaearktischen Region). At that time he was working with the picture-winged flies and illustrated most of his monographs with wing photographs; only a few slides were in the MNKB, but certainly not of the South American +Ulidiidae +. He has never described this specimen or used the photograph of its wing elsewhere. Several specimens, apparently borrowed from the Schnuse collection, were found among unsorted material at the SDEI, where Hennig worked in the late 1930s. + + +We tentatively place this species in + +Aspistomella + +, based on distant similarity to the species previously assigned to + +Paraphyola + +, and transferred here. As the male genitalia are unknown, its relationships to the other taxa in this group of genera remain rather unclear. It differs from all the species assigned here in that the abdominal tergites are matt and densely covered with dense rows of very fine and short microtrichia (shiny and sparsely microtrichose in most other species of the group). + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E23FFB0FF2157EFFCC7F81D.xml b/data/03/F0/29/03F029281E23FFB0FF2157EFFCC7F81D.xml new file mode 100644 index 00000000000..b6dee71dd57 --- /dev/null +++ b/data/03/F0/29/03F029281E23FFB0FF2157EFFCC7F81D.xml @@ -0,0 +1,509 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella steyskali +Kameneva & S. Korneyev + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +DF48CB4F-3710-4FC5-97E7-13DD96619F2A + + + + + +Figs 5 F +, +40–41 + + + + +Material examined. Type. + +Holotype +♂ +: “ + +Ecuador + +: +Napo Province +/ Huahua Sumaco, km 45, on Hollin-Loreto rd / Mal.[aise] trap, XII-14-[19]89 / +M. J. Wasbauer +, +H. Real +” [leg.] ( +CSCA +) + +. + + +Paratypes + +: + +Ecuador + +: +Napo Province +, +Huahua Sumaco +, km 45, on +Hollin-Loreto +rd +Mal. +[aise] trap, + +13.12.1989 + +, +1♀ +, + +14.12.1989 + +, +8♀ +, + +15.12.1989 + +, +1♂ +[dissected], +7♀ +, + +16.12.1989 + +, +3♀ +, + +17.12.1989 + +, +1♂ +, +10♀ +, + +18.12.1989 + +, +2♂ +, +7♀ +, + +20.12.1989 + +, +6♂ +, +12♀ +, + +21.12.1989 + +, +1♂ +, +3♀ +, + +22.12.1989 + +, +3♀ +[ +1♀ +dissected] ( +M. & J. Wasbauer +, +H. Real +leg.) ( +CSCA +, +SIZK +, +MNKB +) + +; + +Past Province +, +Puyo +, + +18.05.1977 + +, +1♀ + +; + +Napo Province +, +Tena +, + +24.05.1977 + +, +2 ♀ +( +D. & S.S Vincent +) ( +USNM +) + +. + + +Bolivia + +: +Province + + +La Paz +, +Mapiri +, +Arroyo Tuhuri +, + +508 m + +, -15.290556 (S), -68.262778 (W), + +10.IV.2004 + +, +1♀ +( +S.D. Gaimari +) ( +CSCA +) + +. + + +Brazil + +: +Mato Grosso +, base camp, +12º50'S +, +51º45'W +, gallery forest, 10– + +27.03.1968 + +, +1♂ +, +1♀ +(dissected) ( +B.E.Freeman +) ( +BMNH +) + +. + + + + +Diagnosis +. + +Aspistomella steyskali + +is similar to + +A. enderleini + +, + +A. lobioptera + +, and + +A. lunata + +in having wing wide oval with similar pattern (hyaline base, widely dark wing disc and apex with long crescent-shaped incision extending from cell r +1 +into cell m +1 +; cell r +1 +with cuneiform hyaline incision distally or apex of vein R +1 +. It differs from + +A. lunata + +by the first incision extending posteriorly only into cell r +2+3 +( + +A. lunata + +, into base of cell r +4+5 +), from + +A. lobioptera + +by hyaline subapical mark in cell dm (in + +A. lobioptera + +, cell dm entirely dark) and non-modified, moderately developed phallus (in + +A. lobioptera + +, phallus is extremely long and densely trichose). + +Aspistomella steyskali + +is most similar to + +A. enderleini + +in the wing shape and pattern: apex with long crescent incision extending into cell r +1 +, differing from it by the slightly shorter pterostigma and structure of male genitalia: outer surstylus with elongate anteroventral lobe and wide rounded posterior lobe, inner surstylus with 3–4 thick prensisetae (in + +A. enderleini + +, surstyli ventrally blunt, with posterior margin short dentate, without expressed lobes and with slightly thickened setae, but no prensisetae). + + + + +Description +. Male. +Head +( +Figs 40 A, B +) ratio (length: height: width) = 1: 1.6: 1.9, colouration as described for + +A. lobioptera + +. Frons slightly narrowed posteriorly, 1.4–1.5× longer than wide at lunule and 1.5–1.6× longer than wide at vertex; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.2–0.4× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates at each side with 4–6 parafrontal setulae and 2–3 inclinate frontal setae as long as outer vertical seta, frontal vitta whitish microtrichose, with 2–8 shorter, proclinate or inclinate interfrontal setae ( +Fig. 40 A +). Lunule very narrow. Eye 1.36–1.46× higher than long. Face as in + +A. lobioptera + +. Gena with long genal seta and 4–5 additional long peristomal setae anterior of it, 0.5–0.8× longer than genal seta. Occiput with cyan metallic sheen, greyish microtrichose. Antenna: postpedicel twice as long as wide, apically rounded; arista almost bare. Palp narrowly crescent-shaped, apically rounded, as in + +A. lobioptera + +. + + +Thorax +( +Figs 40 B, C +) colouration as described for + +A. lobioptera + +, with bluish sheen and sparse white and brown microtrichia not hiding underlying cuticle. Mesonotal scutum 1.25–1.3× longer than wide; black setulose, with 10– 14 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present, strong; prescutellar area with 4 rows of setulae between posterior dorsocentral setae. Scutellum dorsally slightly convex, subshining, sparsely microtrichose, without setulae, with silver or bluish sheen. Subscutellum shining. Mediotergite shining, non-microtrichose medially. + + +Wing +( +Figs 5 F +, +40 F +) +2.95–3.36 mm +long, 2.6–2.9× longer than wide; basicostal cell hyaline; costal cell lobate, 4× longer than wide, brown in basal and apical quarters of length, with costa conspicuously curved, posteriorly covered with longer setulae and forming conspicuous cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, 0.3–0.6× longer than wide and 0.25–0.5× longer than costal cell width, vein R +1 +bare, ending far proximally of crossvein r-m level in both sexes; vein R +2+3 +sinuate, at apex bent anteriorly to costa. Crossvein r-m distally of middle of cell dm. Cell r +4+5 +5.5–7× longer than wide, apically narrowed. Cell m +1 +subtriangular; ultimate section of M +1 +2.5–3.5× longer than crossvein dm-m and 1.3–1.7× longer than penultimate section. Vein CuA Zshaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.1–1.2× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula, and large dark brown mark from apical lobe of costal cell to wing apex, with 4 hyaline marks: incision from cell r +1 +through cell into cell r +2+3 +basally of crossvein r-m, two oval spots in base of cell r +4+5 +and in apex of cell m +4 +and long and narrow crescent or arcuate incision from apex of cell m +1 +into cell r +1 +parallel to wing apex ( +Fig. 5 F +). Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe as wide as cell cua. Alula, calypters and halter as in + +A. lobioptera + +. + + +Legs as in + +A. lobioptera + +. + + +Abdomen +brown to black, sparsely black setulose. + + +Male genitalia +( +Figs 41 A–F +) with short, non-projecting cerci, trilobate surstyli having short, bidentate antero-ventral, narrow elongate meso-ventral and thin, wide, rounded posterior lobes and one to three thick dentate prensiseta on mesal surface. Phallus moderately long and thick, at most 3 times as long as epandrium high, sparsely trichose. Hypandrium with phallic guide forming pair of partly sclerotised, blade-like posteriorly directed projections exceeding level of surstyli, pair of postgonites with 5 trichoid sensilla on lateral surface of phallic guide and pregonites with 3–5 trichoid sensillae at antero-medial side ( +Figs 41 D, E +). + + +Female terminalia +: aculeus with ovoid, long-setulose cercal unit ( +Fig. 41 H +); 2 globose spermathecae ( +Fig. 41 I +). + + + + +Etymology +. Named in honour of George Constance Steyskal (1909–1996), the American dipterist, who first recognised it as a separate species in his manuscript keys. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E27FFBDFF2151DAFF36F8EE.xml b/data/03/F0/29/03F029281E27FFBDFF2151DAFF36F8EE.xml new file mode 100644 index 00000000000..133c14385ab --- /dev/null +++ b/data/03/F0/29/03F029281E27FFBDFF2151DAFF36F8EE.xml @@ -0,0 +1,366 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella teresensis +Araújo, V. Korneyev & Savaris + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +694DF8E9-372A-4A05-9CEE-9B574EBFCCA8 + + + + + +Figs 6 G +, +42–43 + + + + +Material examined.Type. + +Holotype +♀ +: + +Brazil + +:“ES[ +Espírito Santo +], +Brasil +, + +IV.1969 + +, +N.Papavero +col.”“ +HOLOTYPE +♀ + +Aspistomella teresensis +Araújo, V. Korneyev & Savaris + +” (red label) (genitalia dissected) ( +MZUSP +). + + + + + +Diagnosis. + +Aspistomella teresensis + +shares with + +A. angustifrons + +, + +A.crucifera + +, and + +A. quinquincis +a + +acomparatively short headand narrow wings, wing pattern widely dark in apical half, wing venation and chaetotaxy and differs from + +A. angustifrons + +by the coxae, femora and tarsi yellow (in + +A. angustifrons + +widely black) and wing cell m +4 +with hyaline area at posterior margin (in + +A. angustifrons + +entirely black). It differs from + +A. crucifera + +and + +A. quinquincisa + +by having cell r +1 +with 1 marginal hyaline mark reaching anterior half of cell dm, instead of two incisions, as well as other characters indicated in the key. It also differs from + +A. schnusei + +by having a short epistome and a largely dark apical half of the wing (in + +A. schnusei + +, the epistome is strongly developed anteriorly and the wing is largely hyaline with narrow bands apically). + + + + +Description. +Female. +Head +( +Figs 42 C–F +) ratio (length: height: width) = 1.19: 1.22: 1.71; frons, face above transverse fold, parafacial, and gena reddish to yellowish brown, epistome and occiput mostly dark brown with metallic blue tingue. Frons moderately wide ( +Fig. 42 F +), 0.7× as long (from lunule to anterior ocellus) or 1.37× (from lunule to inner vertical seta) as wide at lunule, with subshining, black ocellar triangle and brown vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, reddish-yellow, sparsely white microtrichose. Frontal plate with 5 short lateroclinate parafrontal setulae, frontal vitta sparsely whitish microtrichose, with 5 short frontal and 3 interfrontal setae ( +Fig. 42 F +). Eye 1.15× higher than long, conspicuously incised posteroventrally. Face white microtrichose above epistome; epistome laterally brown, sparsely white microtrichose, with metallic bluish sheen. Clypeus yellow, sparsely white microtrichose, subshining. Gena brownish yellow, with long genal seta and 4additional long peristomal setae anterior of it, as long as genal seta. Occiput brownish, with cyan metallic sheen, greyish microtrichose. + + +Antenna yellow; scape with black setulae; pospedicel and arista missing in the +holotype +. Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow, as described for + +A. angustifrons + +. + + +Thorax +( +Fig. 42 C +) brown to black, with bluish sheen and sparse white microtrichia not hiding underlying cuticle. Mesonotal scutum 1.75× longer than wide; black setulose, with 8 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present, 0.6× longer than posterior dorsocentral seta; prescutellar area with 4 setulae between posterior dorsocentral setae. Scutellum dorsally very slightly convex, entirely brown, subshining, sparsely microtrichose, devoid of setulae, with bronze sheen. Subscutellum bluish shining, sparsely microtrichose. Mediotergite bluish shining, non-microtrichose. Other setae as described for the genus. All the setae and setulae black. + + +Wing +( +Figs 6 G +, +42 G +) +5.9 mm +( +♀ +) long, 3.25× longer than wide; basicostal cell hyaline; costal cell straight, 5.2× longer than wide, brown in basal and apical 1/5 of length, with costa straight and forming very inconspicuous cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, 1.75× longer than wide, vein R +1 +bare, ending slightly proximal to crossvein r-m level; vein R +2+3 +slightly arcuate in basal half, straight at apex. Crossvein r-m proximal to mid-length of cell dm. Cell r +4+5 +5.8× longer than wide. Cell m +1 +narrow triangular; ultimate section of M +1 +3.9× longer than crossvein dm-m and 1.4× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.14× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula; wing with brown mark from apical part of costal cell to wing apex, with 1 triangular marginal hyaline mark from cell r +1 +through base of cell r4+5 extending into middle of cell dm distally of crossvein r-m. One cuneiform hyaline incision from medial portion of cell m1 through cell r +4+5 +extending into cell r +2+3 +. Cell cua with longer posterior projection, at least as longer as width of cell. Cell m4 subhyaline with a hyaline ovoid portion apically crossing vein M4, reaching cell dm-m. Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe half as wide as cell cua. Calypters white, with white cilia. Halter yellow. + + + +FIGURE 42. + +Aspistomella teresensis + + +sp. nov. + +, holotype ♀ (MZUSP). +A +, habitus, right; +B +, same, left (abdomen detached); +C +, head mesonotum, dorsal; +D +, head left and fore leg; +E +, head right and anterior; +F +, same, anterior; +G +, wing, anterobasal part; +H +, labels. Scale bars: 1 mm. (All photographs by Alexandre Araújo.) + + + + +FIGURE 43. + +Aspistomella teresensis + + +sp. nov. + +, holotype ♀ (MZUSP). +A +, oviscape; +B +, eversible membrane; +C +, aculeus; +D +, aculeus apex and cercal unit; +E +, spermatheca (one of the two). Scale bars: 0.2 mm. (All photographs by Alexandre Araújo) + + + +Legs +( +Figs 42 A, B +) with yellowish coxae; femora brown except apices and bases yellow; tibiae brown; tarsi brownish yellow; black setose and setulose. Fore femur uniformly setulose, with 3 longer ventral setae. Mid tibia with two strong and ventroapical seta 1.19× longer than tibia width. + + +Abdomen +brown to black, sparse, with faint purplish or greenish metallic sheen. + + +Male +: not known. + + +Female terminalia +( +Fig. 43 +). Oviscape: +0.81 mm +long, narrower than abdomen, 1.43× long as wide, tapered, truncated at apex. Eversible membrane +1.11 mm +long. Aculeus +0.96 mm +long, 1.18× longer than oviscape, not widened basally, strongly widened in a pre-apical region, weakly sclerotised. Two subspherical spermathecae 1.1× longer than wide. + + + + +Etymology +. The name of the species is an adjective that refers to the +type +locality (Santa Teresa, +Espírito Santo +, +Brazil +). + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E30FFA6FF215097FD1CFD45.xml b/data/03/F0/29/03F029281E30FFA6FF215097FD1CFD45.xml new file mode 100644 index 00000000000..9f5b3881023 --- /dev/null +++ b/data/03/F0/29/03F029281E30FFA6FF215097FD1CFD45.xml @@ -0,0 +1,277 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Polyteloptera +Hendel, 1909 + + + + + + + + + + +Polyteloptera +Hendel 1909b: 263 + + +. + + + + + +Type +species: + +Polyteloptera apotropa +Hendel, 1909 + +, by monotypy. + + + + + + +Polyteloptera + +: + +Hendel 1910: 11 + +, 44, 45; +Steyskal 1968 +: 54.22. + + + + + +Diagnosis. +As in most other +Lipsanini +, head and thorax with greenish or bluish metallic sheen, ocellar setae strong; + +phallus bare or covered with fine microtrichia, apically without glans; hypandrium symmetrical, with deep phallic guide, two areas of trichoid sensilla (corresponding to the pregonites and postgonites), female abdominal tergites + +4–6 without anteromedial apodemes, and only two spermathecae present. Within the tribe +Lipsanini +, + +Polyteloptera + +belongs to the + +Aspistomella + +group of genera described above because of the combination of short parafrontal setulae, long frontal and interfrontal setae, elongated epistome and low clypeus. Species of + +Polyteloptera + +can be distinguished by the combination of the ultimate section of the vein M +1 +being shorter than the penultimate, club-like outline of the wing and the almost claw-like pointed postpedicel. + + + + +Description + + +Adult. +Body mostly dark brown or black, with faint cyan metallic sheen, partly hidden by sparse whitish or silvery microtrichia ( +Figs 48 A, B +). + + +Head +conspicuously higher than long. Frons ( +Fig. 48 C +) as in + +Aspistomella + +; frontal vitta finely and sparsely microtrichose, frontal plates with short pro- or lateroclinate parafrontal setulae on each side, one row of frontal setae and usually one pair of interfrontal setae; vertex and orbits with dense white microtrichia. Vertical plates with 1 long orbital seta, and second vestigial reclinate seta anterior of it; ocellar triangle with ocelli forming elongate acute triangle and a pair of very long ocellar setae. Outer vertical setae ca. 0.3× longer than inner vertical seta. Face in dorsal portion flat, covered with white microtrichia, and with ventral portion moderately produced antero-ventrally, forming high metallic shining epistome covered with sparse, thin, erect whitish microtrichia. Parafacial brownish yellow, densely white microtrichose. Gena widened posteriorly, brownish, sparsely white microtrichose, bearing 1–2 strong genal setae and 4–6 moderately long, pro- or partly lateroclinate peristomal setulae. Occiput black or dorsomedially and lateroventrally brown to yellow, densely white microtrichose. Antenna with stipe very short, pedicel normal, with strong setulae; postpedicel twice as long as wide, dorsally concave, strongly convex ventrally, claw-like apically pointed; arista bare, somewhat thickened at base; in profile, antenna inserted below middle of eye; palp widened, ventrally setulose. Clypeus 0.3–0.4× higher than epistome, convex, densely microtrichose. Proboscis as described for + +Aspistomella + +. + + +Thorax +shining black or brown, with faint cyan sheen and moderately dense, thin, semierect white microtrichia not hiding entirely shining cuticle. Postpronotal lobe with 1 seta and 7–11 setulae; proepisternum with 1 short proepiesternal seta (sometimes indistinct) and 4–7 fine subequal setulae on proepiesternal ridge. Prosternum not examined. Mesonotal scutum setulose, including prescutellar area posterior of dorsocentral setae; dorsocentral setulae forming distinct row, with 10–12 rows of setulae between them; 1 postpronotal, 2 notopleural, 1 postsutural supra-alar, 1 intra-alar and 1 postalar, 2 dorsocentral setae present; acrostichal prescutellar seta absent.Anepisternum, katepisternum, scutellum, subscutellum and mediotergite as in + +Aspistomella + +. + + + +FIGURE 48. + +Polyteloptera apotropa +Hendel. +A + +, ♂ habitus, left; +B +, ♀, same; +C +, head, anterior; +D +, head and mesonotum, dorsal; +E +, head, left; +F +, head and mesonotum, left; +G +, wing, basal part. Scale bars: 1 mm. ( +A–D +photographs by Marcoandre Savaris; +E +—redrawn from +Hendel, 1910 +.) + + + +Wing +moderately wide oval, widest in apical third, narrowing towards base. +Costa +almost straight up to middle, then strongly curved. Vein R +1 +bare, reaching costa basally from middle of wing, gradually curved towards costa. Venation as in +Fig. 4 H +. Cell r +4+5 +slightly widened and then tapering to tip; crossvein r-m shorter than crossvein dm-m, distal to cell dm mid; latter straight, very long and narrow. Ultimate section of vein M +1 +shorter than its penultimate section and only almost twice as long as crossvein dm-m. Postero-apical lobe of cell cup conspicuous, but shorter than width of cell. Vein CuA+CuP bent away from posterior wing margin and not reaching it even as a fold. Alula at least twice as long as wide and calypters normal. + + +Legs. +Fore femur dorsally with 2 posterodorsal rows of setae, without posteroventral setae. Mid femur anteriorly in middle part with suberect setae. Mid tibia apicoventrally with strong spur-like seta. Hind femur with usual subapical setae on dorsal surface. + + +Abdomen +subshining brown to black, with metallic blue sheen ( +Fig. 48 B +). Male and female abdomen with 5 visible tergites, of which tergites 3–5 subequal in length; female tergite 6 hidden underneath posterior margin of tergite 5. Sternites 3–5 unmodified, subrectangular, tergite 5 of +♂ +slightly elongated. + + +Postabdomen +: see description of the species. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E32FFA0FF21539BFEEDFD31.xml b/data/03/F0/29/03F029281E32FFA0FF21539BFEEDFD31.xml new file mode 100644 index 00000000000..6575c0c1d1e --- /dev/null +++ b/data/03/F0/29/03F029281E32FFA0FF21539BFEEDFD31.xml @@ -0,0 +1,398 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Polyteloptera apotropa +Hendel, 1909 + + + + + + + +Figs 4 H +, +48–49 + + + + + + + +Polyteloptera apotropa +Hendel 1909b: 263 + + +, + +1910: 11 + +, 44, 45; +Steyskal 1968 +: 54.22. + + + + + +Material examined. Type. + +Syntypes +5 ♂ +♀ + +Brazil +: + +“aus Brasi1ien ( +S. Paulo +), gesammelt von +A. A. Barbiellini +” (not located, possibly lost) + +. + + +Non-type. + + +Brazil +: + +Barueri + +, + +São Paulo +, + +21.02.1955 + +, +1♀ +( +K. Lenko +) ( +MZUSP +) + +; + +idem, “3420”, + +18.10.1955 + +, +1 ♂ +[ +K. Lenko +leg.] ( +MELQ +ESALQENT001786 +) + +, + +“3530”, + +26.10.1955 + +, +1 ex. +[abdomen missing], “223”, + +15.11.1954 + +, +1 ex. +[genitalia missing] [ +K. Lenko +leg.]; +Est. +S.[ão] +Paulo, S. +[ão] +Paulo +, +Cid. +[ade] +Jardim +, 01.1945, +1♀ +( +Barretto +) ( +MZUSP +) + +; + +São Paulo +, + +26.11.1971 + +, +1♂ +( +V. Alin +leg.) ( +SIZK +) + +; + +Minas Gerais +: +Cambuquira +, 02.1942, +1 ex. +[abdomen missing] ( +H. S. Lopes +leg.) ( +MZUSP +) + +. + + + + +Diagnosis +. This species can be distinguished by the combination of a dorsally incised, apically pointed claw-like postpedicel and an apically broadened wing with a short apical section of vein M +1 +and a characteristic wing pattern. + + +Wing with four brown crossbands: narrow subbasal, extremely wide subtriangular discal, and subapical and apical crossbands separated by two oblique hyaline interspaces; the first oblique hyaline marginal interspace distal to vein R +1 +crossing the wing, reaching the posterior margin at end cell m +4 +; the second, submarginal oblique hyaline interspace from cell r +1 +to posterior margin of wing at cell m +1. +The ultimate section of the vein M +1 +shorter than the penultimate. + + + + +Description. Head +ratio (length: height: width) = 1: 1.43: 1.55; frons, face above transverse fold, parafacial, and gena reddish to yellowish brown, epistome and occiput mostly dark brown with metallic blue tingue. Frons moderately narrow, 0.9–1× as long (from lunule to anterior ocellus) or 1.4× (from lunule to inner vertical seta) as width at lunule, with subshining black ocellar triangle and vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, reddish-yellow, white microtrichose. Frontal plate with 6–8 short lateroclinate parafrontal setulae, frontal vitta sparsely whitish microtrichose, with 4–6 frontal and 1 (rarely 2) interfrontal setae on each side ( +Fig. 4C +). Eye 1.5× higher than long. Face white microtrichose above epistome; epistome black to brown, sparsely white microtrichose, with metallic bluish sheen, 2.2× higher than clypeus. Clypeus black, sparsely white microtrichose, with steel blue sheen ( +Fig. 48 C +). Gena brownish yellow, narrowly white microtrichose along orbit, with 1–2 long genal seta and 6–7 additional long peristomal setae anterior of it, slightly shorter than genal seta. Occiput brown, with slight metallic sheen, greyish microtrichose. + + +Antenna yellow to reddish brown, inserted below the middle of the eye; scape with black setulae; postpedicel moderately long, apically pointed and incised dorsally. Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow to reddish brown ( +Figs 48 A, E, F +). + + +Thorax +brown to black, sparsely whitish microtrichose with blue sheen, more prononced on pleura; scutellum dark brown, somewhat flattened dorsally ( +Fig. 48 D +). + + + +FIGURE 49. + +Polyteloptera apotropa +Hendel + +, ♂ ( +A–F +) and ♀ ( +G +, +H +). +A +, postabdomen, posterior, left; +B +, same, left; +C +, cerci and epandrium, posterior; +D +, same, lateral; +E +, same, anterior; +F +, phallus; +G +, aculeus; +H, +cercal unit. (All photographs by Alexandre Araujo and Marcoandre Savaris.) Abbreviations: cerc—cerci; ej apod—ejaculatory apodeme; epand—epandrium; hypd—hypandrium; ph—phallus; s—seta; sur—surstylus. Scale bars: 0.2 mm. + + + +Wing +4.0– +5.2 mm +long, 2.5–2.6× longer than wide, black to brown with four hyaline interspaces ( +Figs 4 H +, +48 G +). Wing base with basicostal cell hyaline, costal cell brown in basal 1/4 and apical 1/10, with costa slightly curved and forming inconspicuous cleft before apex of vein Sc; pterostigma entirely brown, narrowly triangular, 2.0–2.2× longer than wide, vein R +1 +bare, ending proximally of crossvein r-m level; vein R +2+3 +slightly arcuate in basal half, almost straight at apex. Crossvein r-m distal to middle of cell dm, almost at 2/3 of its length. Cell r +4+5 +4.1–4.2× longer than wide. Cell m +1 +narrow triangular; ultimate section of M +1 +1.9× longer than crossvein dm-m and 0.89× longer than penultimate section. Subbasal crossband narrow, reaching alula; discal crossband subtriangular or trapezoid, extremely wide posteriorly, separated from subapical crossband by oblique interspace from apex of R +1 +distally of r-m into apex of cell dm; subapical crossband oblique narrow, 0.5–0.8× longer than surrounding interspaces; apical crossband narrowly touching subapical crossband at costa and reaching posteriorly through the apex ov vein M +1 +into the very apex of cell m +1 +. Alula pale grey in apical half. Calypters yellowish. Halter with yellowish knob and reddish brown stalk. + + +Legs +( +Figs 48 A, B +) with brown coxae and black, bluish tinged femora; tibiae dark brown; fore tarsus blackish, mid and hind tarsi brownish yellow to reddish brown, apical segments blackish; black setose and setulose. Fore femur uniformly setulose, with 2 posterodorsal rows of setae, but no posteroventral row. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single long apicoventral seta 1.1× longer than tibia width. + + +Abdomen +brown to black, with dull blue sheen, sparse setulose. + + +Male genitalia +: epandrium globular, setulose; outer surstylus wide and short, mesally incised, with short and wide mesally directed ventral lobe bearing short triangular process; inner surstylus without thickened setulae or prensisetaev ( +Figs 49 D, E +); cerci well developed, elongate, subparallel, narrowly separated ( +Figs 49 C, D +). Phallus moderately long, bare, strongly coiled, 2–3 times as long as epandrium height ( +Figs 49 A, B, F +). + + +Female terminalia +( +Fig. 49 G +): Oviscape +0.35 mm +long, narrower than abdomen, as long as wide; aculeus +0.59 mm +long, 7.2× longer than wide basally, cercal unit elongate, apically narrowed but blunt ( +Fig. 49 H +). Spermathecae not examined. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E37FFADFF2155BFFA42FD45.xml b/data/03/F0/29/03F029281E37FFADFF2155BFFA42FD45.xml new file mode 100644 index 00000000000..9578c4b7822 --- /dev/null +++ b/data/03/F0/29/03F029281E37FFADFF2155BFFA42FD45.xml @@ -0,0 +1,292 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Ulivellia amnoni +Smit + +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +CF5318F1-8249-4D49-9324-E445CC913CAF + + + + + +Figs 4 A +, +50 + + + + +Material examined. Type. + +Holotype +♀ +: “ + +Peru + +: +Cuzco +: +Paucartambo +/ +Puente San Pedro +( + +50 km +NW Pilcopata + +) / +13.1468W +71.6159S +/ + +1600 m + +, + +3 Sep. 1988 + +/ leg. +A. Freidberg +”. +The +holotype +is in good condition and is to be deposited in the collection of TAUI. + + + + + +Diagnosis +. + +Ulivellia amnoni + +differs from all the other species of the genus by having the subbasal and discal bands in the wing connected, and therefore cell br entirely brown and crossvein dm-m bent basally in the apical fifth ( +Fig. 4 A +). + + + + +Description +. Female. +Head +( +Figs 50 B, C +) ratio (length: height: width) 1: 1.36: 1.56, mostly black, except frons, gena and parafacial brown. Frons 0.9× longer than wide (from lunule to anterior ocellus), orange brown with black ocellar triangle and vertical plates; orbits silver-white microtrichose, brown. Parafacial narrow, 0.2– 0.3× broader than postpedicel, slightly white microtrichose. Frontal plates with 6–7 parafrontal setulae and 5–7 frontal setae, frontal vitta with 4–6 interfrotal setae on each side, anterior ones the longest, about 1/3 as long as ocellar seta; 2 orbital setae, posterior longer than anterior, about 0.5–0.6× longer than inner vertical seta and 3–4× longer than outer vertical seta; postocellar long, 0.5× longer than inner vertical setae; outer vertical seta short, 0.2–0.25× longer than inner vertical seta and hardly distinguishable from postocular setae forming one row allied by 8–10 dorsal and 10–15 ventral occipital setae. Lunule very narrow, indistinguishable, orange-yellow. Eye 1.5× higher than long. Face (above suture) as high as wide at transverse fold, brown, obscured ventrally, densely white microtrichose; epistome brown to black, sparsely white microtrichose, metallic shining, often with greenish or cyan sheen, strongly produced anteriorly and separated from upper part of face by deep suture. Clypeus brown to black, sparsely white microtrichose, metallic shining, often with cyan sheen, 0.3–0.4× higher than epistome. Gena brownish yellow, with long genal seta and 3–4 peristomal setae anterior of it, 0.5–0.8× longer than genal seta. Occiput black, except postgena brown, with silver to cyan metallic sheen, moderate densely covered with white microtrichia partly hiding underlying cuticle; ventral part of occiput (postgena) with 4–5 setae almost as long as genal seta. Antenna brownish yellow; scape and pedicel with black setulae; postpedicel brown, blackish antero-dorsally, whitish microtrichose, 1.8× longer than wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shining. Palp brown, yellowish apicoventrally with long black setulae, except for basal 1/4, with shorter setulae, about 0.3–0.5× longer than apical setulae. + + + +FIGURE 50. + +Ulivellia amnoni + + +sp. nov. + +holotype ♀. +A +, habitus, left; +B +, head, anterior; +C +, head and mesonotum, lateral; +D +, fore leg; +E +, mesonotum, dorsal; +F +, abdomen, dorsal; +G +, label. Scale bar: 1 mm. + + + +Thorax +( +Fig. 50 E +) black, metallic shining with yellowish-green in apical half or cyan sheen and sparse yellow microtrichia not hiding underlying cuticle. Mesonotal scutum 1.46× longer than wide; presutural area with silvery cyan sheen and without inconspicuous yellowish-green vittae, postsutural area with yellowish-green sheen, black setulose, with 8–10 rows of setulae between dorsocentral setulae; 1 pair of acrostichal setae; prescutellar area devoid of setulae. Scutellum dorsally flattened, black or brownish posteriorly, finely shagreened, sparsely microtrichose, devoid of setulae. Subscutellum subshining, black with metallic silvery cyan sheen. Mediotergite shining black with metallic silvery cyan sheen, sparsely microtrichose. Anepisternum, anepimeron as well as katepisternum with only metallic silvery cyan sheen. All the setae and setulae black. + + +Wing +( +Fig. 4 A +) +5.6 mm +( +♀ +) long: 2.7× longer than wide, basicostal cell hyaline; costal cell very long, 8.2× longer than wide, brown in basal fifth, with costa almost straight, forming neither lobe nor cleft; pterostigma entirely brown, narrow triangular, 8× longer than wide, vein R +1 +setulose dorsally at pterostigma level, ending at level of crossvein dm-m; vein R +2+3 +at apex bent anteriorly and then subparallel to costa, turning towards it before very apex; vein R +4+5 +arcuate, first upwards from crossvein r-m and downwards distally, ending just shy of wing apex; vein M +1 +curved similarly but in opposite direction, ending well beyond apex of wing; crossvein r-m at basal ¼ of cell dm; crossvein dm-m bent basally in the apical fifth. Cell r +4+5 +5.5–6× longer than wide, broadest just beyond the middle and apically narrowed; Cell m1 narrow triangular; ultimate section of M +1 +3×. as long as crossvein dm-m and 1.5x as long as penultimate section. Vein CuA slightly convex in upper part, cell cua with short posteroapical lobe along vein CuP. Wing pattern similar to + +U. inversa + +and + +U. laetitiae + +, subbasal band broader and more or less oblique, not continued on alula, and connected with discal band therefore cell br entirely dark, discal band strongly arched, stronger than in + +U. inversa + +and + +U. laetitiae + +, broader at cell br and clearly narrowed at posterior end, preapical band slightly less arched than in +U. inversa +. Calypters white, with white ciliae. Halter light with light knob. + + +Legs +( +Figs 50 A, D +) all entirely black bluish cyan sheen, except trochanters yellow-brown and knees narrowly brown, all sparse with microtrichia except for coxae of fore legs. Mid tibia ventrally with one spur-like seta 3× longer than tibia width. + + +Abdomen +( +Fig. 50 F +) entirely black, tergites very finely shagreened and sparsely microtrichose, with metallic bluish cyan sheen, less shiny than pleura; setulae and setae black. + + +Male +. Unknown. + + + + +Etymology +. This species is named in honor of the late Dr. Amnon Freidberg, a renowned scientist with a huge knowledge on +Tephritoidea +, who collected the specimen. See +Friedman (2019) +for an account of his life and work. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E39FFA8FF21539BFEBAF88D.xml b/data/03/F0/29/03F029281E39FFA8FF21539BFEBAF88D.xml new file mode 100644 index 00000000000..3c21f9d75f4 --- /dev/null +++ b/data/03/F0/29/03F029281E39FFA8FF21539BFEBAF88D.xml @@ -0,0 +1,620 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Ulivellia arcuata +Kovac & Kameneva + +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +ED4AA956-CA63-4B5F-8B77-24B896D29846 + + + + + +Figs 4 D, E +, +7 C +, +9 D, E +, +51–52 +, +58 +. + + + + +Material examined. Type. + +Holotype +♂ +: “ + +Bolivia + +: +Santa Cruz +, near +Buena +/ +Vista +(near hotel Flora & Fauna) [ +17.5009S +, +63.6743W +], larva in the internode of felled bamboo ( + +Guadua chacoensis + +, last year), emerged on + +16.ii.2011 + +, / Bol Z30/6/11 leg. +D. Kovac +” ( +SMF +). + + + + + +Paratypes + +: +2♂ +, + +Bolivia + +: +Santa Cruz +, near +Buena Vista +(near hotel +Flora +& +Fauna +) [ +17.5009S +, +63.6743W +], larva in the internode of felled bamboo ( + +Guadua chacoensis + +, last year), emerged on + +18.ii.2011 + +, +Bol +Z30/7/11 (leg. +D. Kovac +) + +; + +2 ♂ +, +1♀ +( +1♂ +, +1♀ +dissected), idem [ +17.5009S +, +63.6743W +], labels as in +holotype +, except emerged on + +18.ii.2011 + +, +Bol Z +31/2/11 + +; +1♂ +[ +17.5009S +, +63.6743W +], emerged on +16.ii.2011 +, Bol Z30/6/11; +2♀ +[ +17.4734S +, +63.6922W +], emerged on +25.ii.2011 +, Bol Z32/4/11 (leg. D. Kovac); + +idem [ +17.4734S +, +63.6922W +], ( +El Cairo +), larva in bamboo culm ( + +Guadua chacoensis + +, last year), emerged on + +February 2011 + +, +Bol Z +22/2/11 + +, +1♀ +(leg. D. Kovac). + + +Larvae. + + +Bolivia + +: +Buena Vista +, + +29.i.2011 + +, BolZ22/11, +2 larvae +( +D. Kovac +leg.) ( +SMF +); idem + +6.ii.2011 + +, BolZ30/2/11, +5 larvae +( +D. Kovac +leg.) ( +SMF +) + +. + + + + +Diagnosis +. + +Ulivellia arcuata + +differs from all the other species of the genus by having wing with costal vein clearly bent at the level of pterostigma ( +Figs 4 D, E +), as well as by the vein R +1 +at pterostigma slightly dipping downwards, thickened and setulose, ending at level of crossvein dm-m; basal two-thirds of costal cell brown in both sexes; vein R +2+3 +at apex close and subparallel to costa, turning towards it before very apex, sexually dimorphic wing pattern. + + + + +Description +. Male. +Head +( +Figs 51 D, E +) ratio (length: height: width) = 1: 1.46: 1.5, mostly black, except frons, gena, and parafacial brownish yellow. Frons ( +Fig. 51 E +) 2.1× longer than wide, brownish yellow with black ocellar triangle and vertical plates; orbits silver-white microtrichose, brownish yellow; parafacial narrow, 0.2–0.3× broader than postpedicel, white microtrichose. Frontal plates with 7–8 thin proclinate parafrontal setulae and 6–8 inclinate and partly proclinate frontal setae 0.3–0.5× longer than ocellar seta, frontal vitta with 5–7 interfrontal setae at each side; 1 very long orbital seta, as long as ocellar seta and 0.8× longer than inner vertical seta and 2–3× longer than outer vertical seta; postocellar seta very long, 0.6× longer than inner vertical seta; outer vertical seta short, 0.3–0.5× longer than inner vertical seta and hardly distinguishable from postocular setae forming one row, allied by 6–7 dorsal and 10–15 ventral occipital setae. Lunule very narrow, indistinguishable, orange. Eye = 1.4× higher than long. Face (above suture) as high as wide at transverse fold, brown to brownish orange, densely white microtrichose; epistome brown to black, sparsely white microtrichose, metallic shining, often with greenish or cyan sheen, conspicuously produced anteriorly and separated from upper part of face by deep suture. Clypeus brown to black, sparsely white microtrichose, metallic shining, often with cyan sheen, 0.7–0.8× higher than epistome. Gena brownish yellow, with long genal seta and 3–4 additional setae anterior of it, 0.6–0.8× longer than genal seta. Occiput black, except postgena brownish-yellow, with yellowish to cyan metallic sheen, moderate densely covered with greyish microtrichia partly hiding underlying cuticle; ventral part of occiput (postgena) with 3–4 setae almost as long as genal seta. Antenna brownish yellow; scape and pedicel with black setulae; postpedicel brown, often blackish antero-dorsally, whitish microtrichose, 1.7–1.9× longer than wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shining. Palp yellow, brown in basal 1/6, with sparse and short black setulae, except 2–3 subapical setulae 2–3× longer than other setulae. + + + +FIGURE 51. + +Ulivellia arcuata + + +sp. nov. + +holotype ♂ ( +A–B +, +D–H +) and paratype ♀ ( +C +). +A +, habitus, dorsal; +B +, same, left; +C +, same, anterolateral; +D +, head left; +E +, same, dorsal; +F +, mesonotum, dorsal; +G +, abdomen; +H +, label. Scale bar: 1 mm. + + + +Thorax +( +Figs 51 B, F +) black, with yellowish-green sheen and sparse yellow microtrichia not hiding underlying cuticle. Mesonotal scutum 1.3× longer than wide; with 3 almost inconspicuous vittae of lightly denser microtrichia, slightly brownish laterally in postsutural area, black setulose, with 8–10 rows of setulae between dorsocentral setulae; acrostichal setae absent; prescutellar area devoid of setulae. Scutellum dorsally flattened, black or brownish posteriorly, finely shagreened, sparsely microtrichose, devoid of setulae. Subscutellum subshining, dark brown. Mediotergite shining black, sparsely microtrichose. All the setae and setulae black. + + +Wing +( +Fig. 18 +) +4.2–5.1 mm +( +♂ +) +3.7–4.8 mm +( +♀ +) long; 2.8–2.9× longer than wide, with costal vein clearly bent at the level of pterostigma; basicostal cell partly hyaline; costal cell very long, 9–11× longer than wide, brown in basal 0.8 of length, with costa straight and uniformly covered with short setulae; pterostigma entirely brown, rhomboid, vein R +1 +setulose dorsally at pterostigma level, thickened and slightly dipping downwards at pterostigma, ending at level of crossvein dm-m in +♂ +or between r-m and dm-m in +♀ +; vein R +2+3 +at apex bent anteriorly and then subparallel to costa, turning towards it before very apex. Crossvein r-m slightly distally ( +♂ +) or slightly proximally ( +♀ +) of middle of cell dm. Cell r +4+5 +4.5–6× longer than wide, apically narrowed. Cell m1 narrow triangular; ultimate section of M +1 +4× longer than crossvein dm-m and 3× (in +♂ +) or 1.9 (in +♀ +) as long as penultimate section. Vein CuA Z-shaped, cell cua with moderately long posteroapical lobe along vein CuP. Wing pattern with almost entirely brown cell br; sexually dimorphic, conspicuously darker in +♂ +, with 2 pairs of connected crossbands in +♀ +( +Fig. 4 E +) or widely brown in anterior half in +♂ +( +Fig. 4 D +). Calypters white, with white cilia. Halter brown with black knob. + + + +FIGURE 52. + +Ulivellia arcuata + + +sp. nov. + +paratype ♂ (SIZK) +A +, preabdomen; +B +, postabdomen, ventral; +C +, same, posterior; +D +, same, lateral +E +, same, dorsal +F +, hypandrium, ventral; +G +, surstyli, posterior; +H +, phallus. Abbreviations: cerc—cerci; epand— epandrium; ej apod—ejaculatory apodeme; hypd—hypandrium; ph g—phallic guide; ph—phallus; phapd—phallapodeme; pstg—postgonite. + + + +Legs +( +Figs 51 B, D +) with black coxae, trochanters, femora and tibiae, yellow tarsi, and usually ventrally yellowish fore coxa, fore femur, and mid knee; femora and tibiae usually with metallic greenish sheen and sparse white microtrichia, black setae and setulae. Mid femur anteriorly and posteriorly with short setulae, but without long erect setae; mid tibia ventrally with one spur-like seta 3× longer than tibia width. + + +Abdomen +( +Figs 51 G +, +52A +) entirely brown or black, tergites very finely shagreened and sparsely microtrichose, with yellowish-green metallic sheen, except tergite 5 of +♂ +black with blue or violet sheen; setulae and setae black. + + +Male postabdomen +. Cerci flat and joined by subtriangular proctiger ( +Figs 52 B, C, E +). Epandrium ovoid, dorsally short, moderately setulose ( +Figs 52 B–E +). Surstyli basally wide, mesally directed ventral lobe short and without pimple-like process, but with single sclerotised prensiseta at base; inner surstylus with row of 6–8 gradually enlarging prensisetae ( +Figs 52 B–D +). Pregonites symmetrical, somewhat lobate, with 2 setulae ventro-mesally, anterior of postgonites ( +Figs 52 B, F +). Postgonites on laterobasal part of the phallic guide lobes, with 5–6 small trichoid sensilla ( +Figs 52 C, F +). Phallus short and wide, bowed to the right side of abdomen, neither coiled, nor hidden in the rest, apically with pair of denticles at both sides of gonopore ( +Figs 52 B–D, H +). + + +Female postabdomen +not dissected. + + +Larva +. +General structure +: As in + +Aspistomella duo + +, body length +7.1–7.7 mm +(median = 6.95, n = 8), width +1.8–2.1 mm +(median = +2 mm +, n = 8). + + +Pseudocephalon. +As in + +A. duo + +. Second antennal segment retracted, not visible. Mouthhooks tapering at apices ( +Fig. 7C +). Twenty-nine oral ridges adjacent to oral cavity, identical on both sides of the body (n = 1). + + +Cephalopharyngeal skeleton +( +Fig. 7 C +). As in + +Aspistomella duo + +. Total length +1.2–1.3 mm +(n = 3). Indentation between tips of apical tooth and ventral apodeme 0.67–0.85× as deep as wide; +one specimen +with one small preapical tooth, +two specimens +lack preapical tooth. Hypopharyngeal sclerite 3.8–5.3× longer than high. Hypopharyngeal bridge midway along the length of the hypopharyngeal sclerite. Parastomal bars curved, 1.1–1.2x as long as hypopharyngeal sclerite. + + +Thoracic segments I–III. +As in + +A.duo + +. Anterior spiracles on thoracic segment I consist of 16–19 tubules (median = 17, n = 16 tubule rows from +8 larvae +). The number of tubules on the left or right side of the same larva often differs by up to three tubules. The first thoracic segment bears 14 cuticular sensilla on each side of the body, the second and third thoracic segments bear 13 cuticular sensilla, +type +and position of sensilla as in +Fig. 8 +. + + +Abdominal segments I–VII. +Abdominal segments I–VII bear 13 cuticular sensilla on each side of the body and possess a pair of rudimentary lateral spiracles (see +Fig. 8 +). Ventrally, the creeping welts on abdominal segments I–VII are arranged as follows: CW1 ( +Fig. 58 B +): Five relatively continuous rows of spinules, third row short, spinules in second row slightly larger, all spinules acute and directed posteriorly. CW2 ( +Fig. 58 C +). Two relatively continuous rows with acute spinules (rows b), followed by a central continuous row with larger spinules (row c), followed by a row with large spinules (row d) consisting of five horizontal sub-rows of five to eight large spinules each, laterally flanked by five transverse rows, caudal ends of transverse portions merging into slightly curved rows of smaller acute spinules; last row continuous with small acute bristles (row e). All spinules directed posteriorly. CW3 +– +CW7 ( +Fig. 58 D +): similar to CW2, but two additional anterior rows (rows a), one of them with large spinules and the anterior one with small spinules, spinules in both rows directed anteriorly, other rows directed posteriorly. + + +Caudal segment. +Caudal segment bears 13 cuticular sensilla on each body side (see +Fig. 8 +). Caudal creeping welt CW8 similar in structure to W3 +– +CW7, but last row arranged along the anterior margin of perianal pad with anteriorly directed spinules. + + +Posterior spiracles ( +Figs 9 D +, +58 F +) oval, length +0.38–0.48 mm +(median = 0.4, n = 18), width +0.29–0.37 mm +(median = 0.33, n = 18), shortest distance between spiracles +0.72–0.95 mm +(n = 10). Spiracular slits similar to those of + +U. tenoris + +, but with only 5–6 smooth turns ending in a roundish hook, shape of spiracular slits resembling the silhouette of a bowing person, yellow line above spiracular slit widening from base to margin of spiracular plate, spiracular plate mostly black, central area between spiracular slits often brown. Spiracular hair group 1: 5–7 hairs, hair group: 2 1 hair, hair group 3: 4–6 hairs and hair group 4: 9–15 hairs (n = 6 spiracles). Anal complex as in + +A. duo + +. + + +Puparium +( +Figs 9 E +, +58 G +). Length 5.3 and +5.5 mm +; maximum width at 7th abdominal segment, 1.6 and +1.7 mm +(n = 2); pale brown, darker at both ends; strongly tapering towards anterior end, broad towards the posterior end; posterior spiracles ( +Fig. 9 E +) and creeping welts as in third instar. + + + + +Etymology +. The species name + +“ +arcuata + +” reflects an uncommom wing shape, with conspicuously bowed costal vein on its anterior margin. + + + + +Biology +. Larvae inhabit water-filled bamboo internode cavities of + +Guadua angustifolia + +, biology as in + +Aspistomella duo + +. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E3DFFAAFF2151DAFA85FAB9.xml b/data/03/F0/29/03F029281E3DFFAAFF2151DAFA85FAB9.xml new file mode 100644 index 00000000000..e0662b447a7 --- /dev/null +++ b/data/03/F0/29/03F029281E3DFFAAFF2151DAFA85FAB9.xml @@ -0,0 +1,228 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Ulivellia inversa +Speiser, 1929 + + + + + + + +Fig. 4 B + + +Speiser 1929: 30 +; +Steyskal 1968 +: 54.22. + + + + +Material examined. Type. + +Syntypes +2♀ +: + +Brazil + +: “ +Jaragua +[ +Jaraguá +] im Staate Sta. Catharina” [ +Santa Catarina +], + +12.v.1928 + +(leg. +F. Hoffmann +) ( +P. Speiser’s +private collection, +Königsberg +; assumed lost) + +. + + + + +Description +(after Speiser, translated). [Body length up to the beginning of the ovipositor +5 mm +. Ground colour a shiny metallic, somewhat yellowish greenish blue, wings peculiarly banded. + + +The head has a dark brown-red velvety frontal vitta, with silver-rimmed rather broad orbits, the vertical plates and the ocellar triangle blue-green with also silvery stripes. Face next to the antennae, cheeks, the outermost sides of the clypeus including its fine margin reddish yellow, dull on the blackish antennae, the base of the 3rd joint, especially on the inside, is also reddish yellow. The palpi are blackish with a reddish-yellow tip, with black hairs or bristles below; the rather thick and clumsy proboscis is also leathery yellow. The entire back of the head is blue-green, with a slight whitish coating. Basic colour of the thorax and especially the scutellum yellowish green-blue, the bristles regular, pleurae unicoloured, barely the humeral corners slightly reddish behind. All femora reddish leathery yellow, those of the fore legs darkened metallic blue-black in the centre (front). The entire legs are also metallic blue-black in colour, and only the knee joints are a fine leathery yellow, only very finely visible on the hind legs, somewhat more pronounced on the middle legs and very distinct on the fore legs. The tarsi are all deep black. The fore legs are covered above and outside with groups of longer setae along almost the entire length, individual similarly longer setae also on the underside in front of the knee, the fore tibiae somewhat laterally flattened, which is particularly emphasised by the fine, rowed pubescence of the front and rear edges, as the lateral surfaces are quite bare; all metatarsi as long as the other tarsomeres together.—The posterior two pairs of legs without special markings. - The wings are light in colour with 4 crossbands. Their root is light-coloured, behind it there is a rather broad transverse band reaching into the anal cell, there shortened, 1½ times as long as wide, which runs from the anterior margin over the root transverse vein and the fork of the radius; it is deep black-brown. The second band is, in contrast to most related species, strongly convex towards the wing root. It begins deep black at the anterior margin, filling the space between sc and the strongly bristled r +1 +, both deeply blackening, its proximal border then curves slightly to the root of the discal cell, of which it leaves the inner lower corner glassy bright, in order to turn, thus now bent over towards the tip, crossing cu to the posterior margin, which it reaches opposite the centre of the beginning of the band at the anterior margin. It is on the whole just as wide as the first (half) crossband standing towards the root; its apical boundary accompanies the small transverse vein. The third crossband runs, very slightly concave towards the tip, exactly over the posterior crossvein, which it grasps in its centre. The fourth band is a lace border which joins the third band at the front edge and lines the tip as far as the media, with a faint glimmer just beyond its mouth. In the marginal cell, a narrow segment below the junction of the 8th and 4th setae remains clear. The wing veins are otherwise yellowish, but black within the band, and this colouring has r +1 +and, as a finer line, r +4+5 +along their entire length. The essential information about the course of the veins has already been given in the genus description, the first posterior marginal cell is so narrowed by considerable oscillation of the media that it is not even half as wide at the wing tip as at the widest point, slightly apically from the 3rd transverse vein. Towards the tip of the small transverse vein the media is slightly curved forwards, which widens the discal cell even more here than is only due to the oscillation of the cubitus towards the posterior margin. The posterior transverse vein is slightly bent in an S-shape.—Halter with black-brown knob and lighter coloured stalk.—Abdomen unicoloured blackish greenish blue with light yellowish white stripes. Ovipositor with trapezoidal basal segment, tapering to its apex.] + + +“Körperlänge bis zum Anfang des Legebohrers +5 mm +. Grundfarbe ein metallisch glänzendes, etwas gelbliches Grünblau, Flügel eigenartig bandiert. + +Der Kopf weist eine dunkel braunrote samtene Stirnstrieme auf,mit silberbereiften ziemlich breitenAugenrändern, die Scheitelplatten und das Ocellendreieck blaugrün mit ebenfalls silbriger Bereifung. Gesicht neben den Fühlern, Wangen, die äussersten Seiten des Clypeus samt dessen feinem Rande rötlichgelb, matt. An den schwärzlichen Fühlern ist die Wurzel des 3. Gliedes, namentlich innen, ebenso rötlichgelb. Die Taster sind schwärzlich mit rötlichgelber Spitze, unten schwarz behaart oder beborstet; auch der recht dicke und plumpe Saugrüssel ledergelb. Der ganze Hinterkopf blaugrün, leicht weisslich bereift. Grundfarbe des Thorax und insbesondere des Scutellum gelblich grünblau, die Beborstung regelrecht, Pleuren einfarbig, kaum die Schulterecken hinten etwas rötlich gefärbt. Alle Hüften rötlich ledergelb, diejenigen der Vorderbeine auf der Mitte (der Vorderseite) metallisch blauschwarz verdunkelt. Ebenso sind die ganzen Beine metallisch blauschwarz, und nur die Kniegelenke fein ledergelb und zwar an den Hinterbeinen nur ganz fein, eben sichtbar, an den mittleren etwas ausgesprochener, an den vorderen sehr deutlich. Die Tarsen sämtlich tief schwarz. Die Vorderschenkel oben und aussen mit Gruppen längerer Borsten fast der ganzen Länge nach besetzt, einzelne gleichartig längere Borsten auch auf der Unterseite vor dem Knie, +die Vordertibien etwas seitlich abgeflacht, was durch feine, gereihte Behaarung der Vorder- und Hinterkante noch besonders hervortritt, da die Seitenflächen ziemlich kahl sind; alle Metatarsen so lang wie die übrigen Glieder zusammen.—Die hinteren beiden Beinpaare ohne besondere Auszeichnungen.—Die Flügel (Fig. l) sind glashell mit 4 Querbinden. Ihre Wurzel ist hell, dahinter steht eine ziemlich breite, bis in die Analzelle reichende, dort abgekürzte Querbinde, die l 1/2 mal so lang wie breit ist, welche vom Vorderrande über die Wurzelquerader und die Gabelung des Radius verläuft; sie ist tief schwarzbraun. Die zweite Binde ist, abweichend gegenüber den allermeisten verwandten Arten, gegen die Flügelwurzel stark convex. Sie beginnt tiefschwarz am Vorderrande, den + +Raum zwischen sc und dem stark beborsteten r +1 +ausfüllend, beide tief schwärzend, ihre wurzelwärtige Begrenzung geht dann leicht geschwungen zur Wurzel der Discoidalzelle, von der sie die innere untere Ecke glashell lässt, um sich, also nun spitzenwärts umgebogen, cu überschreitend zum Hinterrande zu wenden, den sie gegenüber der Mitte des Bindenbeginns am Vorderrande erreicht. Sie ist im ganzen ebenso breit wie die wurzelwärts stehende erste + +(Halb-) Binde; ihre spitzenwärtige Begrenzung begleitet die kleine-Querader. Die dritte Querbinde verläuft, ein ganz klein wenig spitzenwärts konkav, genau über die hintere Querader, die sie in ihre Mitte fasst. Die vierte Binde ist ein Spitzensaum, der sich am Vorderrande an die 3. Binde anschliesst und die Spitze bis zur Media säumt, mit einem schwachen Schimmer noch gerade über deren Mündung hinausreichend. In der Randzelle bleibt ein schmales + +Segment unterhalb des Zusammenhanges der Binden 8 und 4 glashell. Die Flügeladern sind sonst gelblich, innerhalb der Binden aber schwarz und diese Färbung hat insbesondere auch ihrer ganzen Länge nach r +1 +und, als feinerer Strich, r +4+5 +. Die wesentlichen Angaben über den Aderverlauf sind bereits in der Gattungskennzeichnung gemacht, die l. Hinterrandzelle ist, durch erhebliche Schwingung der Media soweit verengt, dass sie an der Flügelspitze nicht einmal halb so breit ist, wie an der breitesten Stelle, etwas spitzenwärts von der 3. Querbinde. Spitzenwärts von der kleinen Querader ist die Media etwas vorwärts geschwungen, was die Discoidalzelle hier noch etwas mehr verbreitert, als nur durch die Schwingung des Cubitus dem Hinterrande zu zustande kommt. Die hintere Querader ist leicht S-förmig gebogen.—Schwinger mit schwarzbraunem Knopf und hellerem Stiel.—Hinterleib einfarbig schwärzlich grünblau mit leichter gelblichweisser Bereifung. Legebohrer mit trapezförmigem Grundglied, spitz zulaufend.” + + + + +Remarks. +Despite the +syntypes +of this species are lost during the World War II, its description is sufficiently complete and illustrated to distinguish it from the two similar species, + +U. amnoni + + +sp. nov. + +and + +U. laetitiae + + +sp. nov. + + + +as in the key to species. It is originated from +Santa Catarina +, a region of +Brazil +, zoogeographically different from the sub-Amazonian lowland territories of +Peru +and +Bolivia +, so their differences in wing shape and pattern are believed to be taxonomically valuable to consider them distinct species rather than intraspecific morphs or subspecies. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E3EFF95FF2154F0FE94F8C1.xml b/data/03/F0/29/03F029281E3EFF95FF2154F0FE94F8C1.xml new file mode 100644 index 00000000000..4e765cc4816 --- /dev/null +++ b/data/03/F0/29/03F029281E3EFF95FF2154F0FE94F8C1.xml @@ -0,0 +1,514 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Ulivellia laetitiae +Smit + +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +FD0E1874-D701-4A4F-B6A3-E18026AB89CC + + + + + +Figs 2 E, F +, +4 C +, +53–54 + + + + +Material examined. Type. + +Holotype +♀ +: “ + +Peru + +: +Madre de Dios +, +Rio Tambopata +/ +Sachavacayoc +lodge / +12°51’S +, +69°22’W +/ + +29 October 2008 + +leg. +J.T. Smit +” “RMNH.INS.555078 [including QR-code]”, “on bamboo + +Guadua weberbaueri +” (RMNH) + +. +The +holotype +is in good condition. + + + + + +Paratypes + +: +1♀ +, + +Peru + +: +Madre de Dios +, +Manu +, +Pantiacolla +lodge, +12°39'23''S +, +71°13'52''W +, + + +350 m + + + +., on bamboo + +Guadua weberbaueri + +, +22 May 2008 +, leg. J.T. Smit, RMNH.INS.555079; + +10♂ +, +9♀ +, +Madre de Dios +, +Rio Tambopata +, +Sachavacayoc +centre, +Bridge Condonado Trail +, +12°51'25.7''S +, +69°22'23.1''W +, + + +184 m + + + +., on bamboo + +Guadua weberbaueri + +, +5–9 June 2010 +, leg. J.T. Smit; + +1♂ +, +1♀ +, +Madre de Dios +, +Rio Tambopata +, +Sachavacayoc +centre, +Chacra +other side of +Quebrada +, +12°50'59.9''S +, +69°22'08.3''W +, + + +182 m + + + +., on bamboo + +Guadua weberbaueri + +, +14–20 October 2010 +, Malaise trap, leg. J.T. Smit; + +2♂ +, +1♀ +, +Madre de Dios +, +Rio Tambopata +, +Sachavacayoc +centre, +Main Trail +, +12°51’46.4’’S +, +69°21’46.6’’W +, + +22 November 2010 + +, on bamboo + +Guadua weberbaueri + +, leg. +J.T. Smit + +; + +2♀ +, +Madre de Dios +, +Rio Tambopata +, +Sachavacayoc +centre, old +Chacra +, S +12°51’15.5’’ W +69°21’56.6’’ + + +200 m + + + + +., + +20–29 November 2010 + +, +Malaise trap +, leg. +J.T. Smit +( +RMNH +) + +. + + + + +FIGURE 53. + +Ulivellia laetitiae + + +sp. nov. + +holotype ♀ ( +A +, +C–E +) and paratype ♂ ( +B +, +F, G +). +A +, habitus, left; +B +, same, dorsal; +C +, head, mesonotum and fore leg, lateral; +D +, head, anterior; +E +, mesonotum, dorsal; +F +, wing, anterobasal part; +G +, labels. ( +A +— photograph by John T. Smit) + + + + +Diagnosis +. + +Ulivellia laetitiae + +differs from all the other species of the genus in that the subbasal band does not continue on the alula, the discal band is more arched than in + +U. inversa + +and crossvein dm-m is basally bent in the apical fourth ( +Figs 4 C +, +53 A, B, F +). + + + + +Description +. Female. Head ( +Figs 53 E, F +) ratio (length: height: width) 1: 1.4: 1.5, mostly black, except lower half of frons, gena and parafacial brownish brown. Frons 0.7× longer than wide (measured from ptilinale fissure to fore ocellus), orange brown with black ocellar triangle and vertical plates; orbits silver-white microtrichose, brown. Parafacial narrow, 0.2–0.3× broader than postpedicel, slightly white microtrichose. Frontal setulae relatively short, black, inclinate and partly proclinate, forming two irregular rows of 3–6 setulae on each side, all more than ⅓ and up to ½ the length of ocellar setae; 2 orbital setae, posterior longer than anterior, about 0.5–0.6× longer than inner vertical seta and 3–4× longer than outer vertical seta; postocellar 0.3× longer than inner vertical setae; outer vertical seta short, 0.2–0.25× longer than inner vertical seta and barely distinguishable from postoculair setae forming one row allied by 9–12 dorsal and 10–15 ventral occipital setae. Lunule very narrow, indisctinct, orange-yellow. Eye 1.6× higher than long. Face (above suture) as high as wide at transverse fold, brown, obscured ventrally, densely white microtrichose; epistome brown to black, sparsely white microtrichose, metallic shiny, often with greenish or cyan shine, strongly produced anteriorly and separated from upper part of face by deep suture. Clypeus brown to black, sparsely white microtrichose, metallic shining, often with cyan sheen, 0.3–0.4× higher than epistome. Gena brownish yellow, with long genal seta and 3–4 additional setae anterior of it, 0.5–0.8× longer than genal seta. Occiput black, except postgena brown, with silvery to cyan metallic sheen, moderately densely covered with white microtrichia partly hiding underlying cuticle; ventral part of occiput (postgena) with 4–5 setae almost as long as genal seta. Antenna brownish yellow; scape and pedicel with black setulae; postpedicel brown, blackish antero-dorsally, whitish microtrichose, 1.9× longer than wide, narrowed in apical half and rounded; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shiny. Palp yellowish-brown, with black setulae, ventrally and subapically with setulae 2–3 times longer. + + +Thorax +( +Fig. 53 F +) black, metallically shiny with yellowish-green or cyan sheen and sparse yellow microtrichia not obscuring underlying cuticle. Mesonotal scutum 1.4× longer than wide; with 3 almost inconspicuous yellowish-green vittae in otherwise silvery cyan sheen in the presutural area, postsutural area with yellowish-green shine, black setulose, with 8–10 rows of setulae between dorsocentral setulae; 1 pair of acrostichal setae; prescutellar area without setulae. Scutellum dorsally flattened, posteriorly black or brownish, finely shagreened, sparsely microtrichose, without setulae. Subscutellum subshining, black with yellowish -green metallic sheen. Mediotergite shining black with metallic yellowish-green sheen, sparsely microtrichose. Set of setae normal for the genus. All the setae and setulae black. Anepisternum apicoventrally with yellowish-green sheen, as well as anepimeron ventrally and katepisternum nearly entirely, pleurae otherwise with metallic silvery cyan sheen. + + +Wing +( +Figs 4 C +, +53 F +) +5.8–6.6 mm +( +♂ +) +6.2–6.8 mm +( +♀ +) long: 2.3–2.5× longer than wide, basicostal cell hyaline; costal cell long, 4.8× longer than wide, brown in basal third, with costa almost straight, forming neither lobe nor cleft; pterostigma entirely brown, narrow triangular, 5.1× longer than wide, vein R +1 +setulose dorsally at pterostigma level, ending at level of crossvein dm-m; vein R +2+3 +at apex bent anteriorly and then subparallel to costa, turning towards it before very apex; vein R +4+5 +arcuate, first upward from crossvein r-m and downward distally, terminating just shortof wing apex; vein M +1+2 +similarly curved but in opposite direction, terminating well beyond wing apex; crossvein r-m at basal ¼ of cell dm; crossvein dm-m bent basally in the apical fourth. Cell r +4+5 +4.5–5.5× longer than wide, broadest just beyond the middle and narrowed apically; Cell m1 narrowly triangular; ultimate section of M +1 +2.4×. as long as crossvein dm-m and 1.9× longer than penultimate section. Vein CuA slightly convex in upper part, cell cua with short posteroapical lobe along vein CuP. Wing pattern similar to + +U. inversa + +and + +U. amnoni + +, subbasal band broader and more or less oblique, not continued on alula, discal band strongly arched, stronger than in + +U. inversa + +and + +U. amnoni + +, broader at cell br and clearly narrowed at posterior end, preapical band slightly less arched than in + +U. inversa + +. Calypters white, with white ciliae. Halter creamy with yellow knob. + + +Legs +( +Figs 53 A–C +) all entirely black bluish cyan sheen, femora partially with yellowish-green metallic sheen, except coxae ventrally and trochanters entirely yellow-brown and knees narrowly brown, all sparse with microtrichia except for coxae of prolegs. Mid tibia ventrally with one spur-like seta 3× longer than tibia width. + + +Abdomen +( +Figs 53 A–B +) entirely black, tergites very finely shagreened and sparsely microtrichose, with metallic yellowish-green metallic sheen, less shiny than pleurae; setulae and setae black. + + +Male postabdomen +. Sternite 8 setulose, with 2 longer setae. Cerci short oval, setulose ( +Figs 54 A–D +). Epandrium ovoid, dorsally short, moderately setulose. Surstyli basally wide, inner surstylus with 10–11 prensisetae, outer surstylus simple with narrow, elongated, mesally directed ventral lobe apically bearing dorsally directed pimple-like process, but without distinct antero-ventral and postero-ventral lobes; inner surstylus with 12–15 thickened prensisetae ( +Fig. 54 D +). Pregonites symmetrical, with 8–9 setulae ventro-mesally, conspicuously anterior of postgonites. Postgonites on laterobasal part of the phallic guide lobes, with 4–6 small trichoid sensilla. Phallus moderately short and narrow, about 3–4 times as long as epandrium high, almost bare, in rest coiled at right side of abdomen ( +Fig. 54 B +). Ejaculatory apodeme short, bar-like, with relatively small sperm pump ( +Figs 52 D +, +56 B +). + + + + +Etymology +. This species is named in honor of Laetitia Martina, the author’s girlfriend and mother of his children. The specific epithet should be treated as a noun in the genitive case. + + + + +FIGURE 54. + +Ulivellia laetitiae + + +sp. nov. + +paratype ♂ (SIZK) +A +, postabdomen, lateral; +B +, same, anteroventral; +C +, same, ventral; +D +, epandrium, with cerci and surstyli, posterolateral; +E +, surstyli and hypandrium, ventral. Abbreviations: cerc—cerci; epand— epandrium; ph g—phallic guide; ph—phallus; phapd—phallapodeme; pi p—pimple-like process; pregt—pregonite; sur— surstylus; v l sur—ventral lobe of surstylus. + + + + +Biology +. All specimens were collected and many additional specimens were observed on mature stems of the bamboo + +Guadua weberbaueri + +, in contrast to many other species that were specifically attracted to freshly cut young shoots of the same bamboo species. This species appears to develop in the internodes of damaged mature stems of + +G. weberbaueri + +. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E46FFDDFF21536FFA43FD09.xml b/data/03/F0/29/03F029281E46FFDDFF21536FFA43FD09.xml new file mode 100644 index 00000000000..ec607c63a79 --- /dev/null +++ b/data/03/F0/29/03F029281E46FFDDFF21536FFA43FD09.xml @@ -0,0 +1,430 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella enderleini +Kameneva & V. Korneyev + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +95BFDD08-B74D-4CA1-93AF-021E86C2E16D + + + + + +Figs 5 H +, +22–23 + + + + +Material examined. Type. + +Holotype +♂ +: + +Colombia + +: “Cordill.[eren] v.[on] Columbien / terra temporada / Thieme S.” ( +MNKB +) + +. + + +Paratype + +: +1♀ +: same label as in +holotype +, “69”, “ +Euxesta lunata Enderlein +det.” ( +MNKB +) + +. + + + + +Diagnosis. + +Aspistomella enderleini + +is similar to + +A. lobioptera + +, + +A. lunata + +, and + +A. steyskali + +in that the wing apex has a long, narrow and oblique preapical hyaline incision from the apical half of cell r +1 +into cell m, usually reaching the anterior margin of the wing and separating a narrow crescent-shaped brown apical band from the rest of the dark pattern, with the base of cell m completely dark ( +Fig. 5 H +), vein R +1 +bare, prescutellar acrostichal setae present and halter yellow; it is similar to + +A. lobioptera + +and + +A. steyskali + +in that the costal vein is bent anteriorly before the apex of vein Sc, the costal cell is lobed (though less than in the compared species), the costal vein is slightly thickened before the apex of the subcostal vein, forming a more or less conspicuous cleft, and differs from them in that the pterostigma is only moderately short, almost as long as the width of the costal cell ( +Figs 5 H +, +22 F +). It shares the wing pattern very similar to + +A. steyskali + +: both differ from + +A. lobioptera + +by the cell dm apically of r-m with hyaline spot connected to the hyaline spot in cell m +4 +and by the phallus not modified, moderately developed (in + +A. lobioptera + +cell dm entirely dark and phallus very long and trichose). It can be distinguished from + +A. steyskali + +only by the structure of surstyli, which are ventrally blunt, with short denticles on the posterior margin, but without expressed lobes and prensisetae, only with slightly thickened setae (in + +A. steyskali + +, outer surstylus with two well developed lobes, inner surstylus with 3–4 thick prensisetae); it also differs from + +A. steyskali + +by a pterostigma almost as long as wide (in + +A. steyskali + +, pterostigma very narrow); but the variability of this character has not been studied. + +Aspistomella enderleini + +is similar to + +A. lunata + +in having pterostigma almost as long as wide, but differs from it in that the hyaline incision distal to the pterostigma is short, extending at most into cell r +2+3 +and isolated from the round hyaline spot at the base of cell r +4+5 +(in + +A. lunata + +, it extends into cell r +4+5 +distally from crossvein r-m). + + + + +Description +. Male. +Head +( +Figs 22 D–E +) ratio (length: height: width) = 1: 1.5: 1.9; frons, face above transverse fold, parafacial, and gena reddish or yellowish brown, epistome and occiput mostly black. Frons moderately wide, slightly narrowed posteriorly ( +Fig. 22 E +), as long (from lunule to anterior ocellus) or 1.4× (from lunule to inner vertical seta) as wide at lunule; vertex black, steel shining, sparsely microtrichose; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.2–0.3× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates with 8–9 pairs of parafrontal setulae, 3–5 pairs of inclinate frontal setae slightly shorter than outer vertical seta, frontal vitta whitish microtrichose, with 2–4 shorter, proclinate or inclinate interfrontal setulae ( +Fig. 22 E +). Lunule very narrow, indistinct, reddish-yellow. Eye 1.4× higher than long. Epistome widely black medially, reddish brown laterally and anteroventrally, sparsely white microtrichose, with metallic bluish sheen, strongly produced anteriorly and separated from upper part of face by deep fold; face above epistome brownish yellow, white microtrichose. Clypeus yellow to brown, sparsely white microtrichose, subshiny, 0.38× higher than epistome. Gena brownish yellow, with long genal seta and 5–7 additional long peristomal setae anterior of it, 0.3–0.8× longer than genal seta. Occiput black, except postgena partly brown, with cyan metallic sheen, greyish microtrichose. + + + +FIGURE 22. + +Aspistomella enderleini + + +sp. nov. + +holotype ♂ ( +A +, +C–G +) and paratype ♀ ( +B +). +A +, +B +, habitus, left; +C +, head and thorax, dorsal; +D +, head left; +E +, same, anterior; +F +, wing, anterobasal part; +G +, labels. Abbreviations: c—costal cell; ptstg—pterostigma; r +1 +—first radial cell; r +2+3 +—second + third radial cell; r —fourth + fifth radial cell. Scale bar: 1 mm (same for +C +, +D +, and +E) +. + + + +4+5 + +Antenna brown; scape and pedicel with black setulae; postpedicel yellowish brown, 1.6× longer than wide, darker apico-dorsally, whitish microtrichose, twice as long as wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shiny. Palp yellow or yellowish brown, narrowly crescent-shaped, apically rounded, with 10–12 strong black setulae, of which 3–4 subapical setulae 1.6–2× longer than other setulae. + +Thorax +( +Fig. 22 C +) brown to black, with bluish sheen and sparse white and brown microtrichia not obscuring underlying cuticle. Mesonotal scutum 1.2× longer than wide; black setulose, with 6–12 irregular rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present; prescutellar area with 4–6 rows of setulae between posterior dorsocentral setae. Scutellum dorsally very slightly convex, brown to black, subshining, sparsely microtrichose, without setulae, with golden, silver or bluish sheen. Subscutellum shiny, dark brown to black. Mediotergite shiny black, medially not microtrichose. Other setae as described for the genus. All the setae and setulae black. + + + +FIGURE 23. + +Aspistomella enderleini + + +sp. nov. + +♂ genitalia. +A +, postabdomen and part of abdomen, ventral; +B +, postabdomen, posterior; +C +, same, lateral; +D +, same, ventral; +E +, surstylus and hypandrium, posterior; +F +, cerci, surstylus, and hypandrium, ventral. Abbreviations: bph—basiphallus; cerc—cerci; ej apod—ejaculatory apodeme; epand—epandrium; hypd—hypandrium; pgt—postgonite; ph g—phallic guide; ph—phallus; phapod—phallapodeme; pregt—pregonite; s—seta; st 4— fourth sternite; st 5— fifth sternite; st 6— sixth sternite; st 7— seventh sternite; st 8—eighth sternite; sur—surstylus; tg5—fifth tergite. + + + +Wing +( +Figs 5 H +, +22 A, B, F +) +3.5–4.2 mm +( +♀ +) long, 2.4–2.5× longer than wide; basicostal cell hyaline; costal cell lobed, 5× longer than wide, brown in basal and apical quarter of length, with costa conspicuously curved, posteriorly covered with longer setulae and forming conspicuous cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, 1.3–1.4× longer than wide and as long as costal cell width, vein R +1 +bare, ending proximally of crossvein r-m level in both sexes; vein R +2+3 +slightly sinuate. Crossvein r-m distally of middle (at 0.6) of cell dm width. Cell r +4+5 +5× longer than wide, apically narrowed. Cell m +1 +subtriangular; ultimate section of M +1 += 2.4–2.8× longer than crossvein dm-m and 1.5× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.7–1.9× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula, and large dark brown mark from apical part of costal cell to wing apex, with 4 hyaline marks: incision from cell r +1 +into cell r +2+3 +basal to of crossvein r-m, oval spot in base of cell r +4+5 +and hyaline incision in apex of cell m +4 +extending into apical half of cell dm, and long and narrow crescent-shaped or arcuate incision from apex of cell m +1 +into cell r +1 +parallel to wing apex ( +Fig. 5 H +). Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe as wide as cell cua. Alula twice as long as wide, uniformly pale grey or darkened in apical half. Calypters white, with white ciliae. Halter yellow. + + +Legs +( +Figs 22 B, C +): coxae and trochanters, apices of femora and tibiae brown, fore femur yellowish brown, otherwise black; tibiae mostly black; tarsi brown, black setose and setulose. Fore femur with row of 6–7 posterodorsal and 4–5 posteroventral setae. Mid femur anteriorly with short suberect setulae; mid tibia apically not visible, hidden by glue. + + +Abdomen +brown to black, sparsely black setulose, metallic sheen inconspicuous in +type +specimens. + + +Male genitalia ( +Figs 23 A–F +) with short non-projecting cerci, wide ventrally blunt surstyli, with two short denticles on posterior margin, without expressed lobes and prensisetae, 3–5 unmodified setulae (one on inner surstylus, of which one twice as long and thick as the others; phallus moderately large, at most twice as long as epandrium height, short and sparsely trichose ( +Figs 23 B–D +). Hypandrium: phallic guide with laterally triangular and moderately sclerotised lobes ( +Figs 23 D–F +) forming conspicuous posterior projections, bearing pair of oval postgonites just anterior to basiphallus ring, and symmetrical pregonites anterolateral to them ( +Figs 23 D, F +). + + +Female terminalia +: oviscape 1.3× longer than tergite 5; aculeus with ovoid, long-setulose cercal unit; not dissected. + + + + +Etymology +. The species is named after the German entomologist and microbiologist Prof. Günter Enderlein, curator of the +Diptera +collection of the Humboldt University of +Berlin +in 1907–1942. + + + + +Remarks +. The +type +specimens were misidentified by Enderlein as + +“ +Euxesta lunata +” + +in the MNKB collection. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E49FFDFFF215257FD77FBF5.xml b/data/03/F0/29/03F029281E49FFDFFF215257FD77FBF5.xml new file mode 100644 index 00000000000..6966083b708 --- /dev/null +++ b/data/03/F0/29/03F029281E49FFDFFF215257FD77FBF5.xml @@ -0,0 +1,311 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella garleppi +V. Korneyev & Kameneva + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +539952F5-EBD0-4671-828B-92BB1BF92327 + + + + + +Figs 6 D +, +24 + + + + +Material examined. Type. + + +Holotype + +♂ +: +“ +Peru +/ +Madre De Dios +/ +O. Garlepp +c.”, “ +Coll. W. Schnuse +/ 1911-3”, “ +Euxesta +s. (nova)” [pencil hadwritten label of +W. Hennig +]; (right antenna, left wing and left mid leg missing; abdominal segments 4–5 missing, apparently removed by +W. Hennig +for preparation in 1938–1939 and lost) ( +SDEI +) + +. +Paratypes +: +1 specimen +[sex unknown] (both antennae, hind legs, mouthparts and abdomen missing), + +1 ♂ +(both antennae, mouthparts and ventral part of abdomen including all sternites, pleural membrane and genitalia missing), same labels as in +holotype +( +SMTD +) + +. + + + + +Diagnosis +. + +Aspistomella garleppi + +are moderately large flies (WL> 6.0– +6.4 mm +), differing from all other species of the group of genera by the combination of the very long pterostigma, straight costal cell, vein R +1 +dorsoapically setulose, crossvein r-m slightly proximal to the level of R +1 +apex but far distal from Sc apex, head with narrow frons, face uniformly grey or silvery microtrichose, epistome strongly developed, ocellar and outer vertical seta short, 0.2–0.3× longer than orbital and inner vertical seta, prescutellar acrostichal seta absent, wing extremely elongated, 3.8–4× longer than wide; with pattern of narrow subbasal and wide discal crossband separated from the entirely dark apex by hyaline interspace covering the entire area of cell dm between crossveins r-m and dm-m; and mid tibia ventroapically with 1 long spine. + + + + +Description +. Male. +Head +( +Figs 3 C +, +24 B–D +) ratio (length: height: width) = 1: 1.1–1.2: 1.6; frons, parafacial, and gena reddish brown, most of epistome and occiput dark brown to black; face below lunule white microtrichose. Frons moderately wide, slightly narrowed posteriorly ( +Fig. 24 C +), 1–1.1× as long (from lunule to anterior ocellus) or 1.6–2× (from lunule to inner vertical seta) as wide (at lunule), with black, steel shining, sparsely microtrichose vertex; orbits in posterior half, parafacial, narrow transverse band on face above fold, gena and occiput silver-white microtrichose; parafacial less than half as wide as postpedicel. Vertical plates with 1 strong and 1 setula-like orbital setae. Frontal plate with 10–12 short lateroclinate parafrontal setulae, frontal vitta sparsely whitish microtrichose, with 6–7 moderately developed frontal and 3–5 stronger interfrontal setae on each side ( +Fig. 24 C +). Eye 1.3× higher than long. Face white microtrichose above epistome; epistome black to brown, sparsely white microtrichose, with metallic bluish sheen. Clypeus black, sparsely white microtrichose, with metallic sheen, 0.3× higher than epistome. Gena brownish yellow, narrowly white microtrichose along orbit, with 1–2 long genal setae and 4–6 additional long peristomal setae anterior to it, shorter than genal seta. Occiput brown to black, silver-grey microtrichose. + +Antenna yellow to reddish brown, inserted below the middle of the eye; scape with black setulae; postpedicel moderately long, rounded, 1.8–2.0× longer than wide; arista brown apically, yellow in basal 1/4, 2-segmented, bare. Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow to reddish brown, apically rounded, with 10–15 black setulae, of which 5–6 subapical setulae twice as long as other setulae. + + +FIGURE 24. + +Aspistomella garleppi + + +sp. nov. + +holotype ♂ ( +A–E +, +H +) and paratype (sex unknown) ( +F–H +). +A +, habitus, left; +B +, head and thorax, dorsal; +C +, head, antero-dorsal; +D +, head left; +E +, thorax and fore femur, left; +F +, thorax and base of abdomen, dorsal; +G +, abdominal syntergite 1+2, setae and microtrichia; +H +, labels. + + + +Thorax +( +Figs 24 E, F +) black, on pleura with silvery sheen and sparse grey and brown (posterior of transverse suture and in supraalar area) microtrichia not hiding underlying cuticle. Mesonotal scutum ( +Fig. 24 F +) 1.6–1.7× longer than wide; black setulose, with 12–14 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta absent; prescutellar area with 2–4 rows of setulae between posterior dorsocentral setae. Scutellum dorsally slightly convex, black, subshining, very sparsely white microtrichose, apically shagreened, without setulae. Subscutellum and mediotergite shining black. All the setae and setulae black. + + +Wing +( +Fig. 6 D +) +6.5–6.7 mm +long, 3.8–4× longer than wide; basicostal cell hyaline; costal cell straight, 5–6× longer than wide, pale brownish or yellowish at base and apex; pterostigma entirely brown, triangular, 6–8× longer than wide, vein R +1 +with 12–14 setulae dorsally, ending slightly distal to level of crossvein r-m level; costal vein between apices of R +1 +and R +2+3 +slightly arcuate; vein R +2+3 +inconspicuously undulate. Crossvein r-m at proximal 2/5 of cell dm. Cell r +4+5 +4.0–4.5× longer than wide, apically narrowed. Cell m +1 +narrow triangular, with pointed apex; ultimate section of M +1 +3.6× longer than crossvein dm-m and 1.2–1.4× longer than penultimate section. Vein CuA Z-shaped, forming moderately long posteroapical lobe of cell cua along vein CuP, 1.8× longer than its anterior shoulder. Wing pattern with short pale brown subbasal crossband from humeral vein through cell cua into alula, wide discal crossband from apex of costal cell and pterostigma into basal half of cell dm, with wide hyaline interspace covering the entire area of cell dm between crossveins r-m and dm-m separating entirely dark apex by hyaline; cell m +1 +entirely pale brown ( +Fig. 6 D +). Cell cup and anal lobe 0.7–0.8× broader than cell cua +1 +. Alula 2.4× longer than wide, grey. Calypters white, with long white cilia. Halter yellow. + + +Legs +( +Figs 24 A, E +) long and narrow, mostly black, except tarsi brown; femora with metallic sheen, sparsely grey microtrichose. Fore femur with 2 rows of posterodorsal and posterior setae 0.6× longer than femur width, and 2–4 moderately strong posteroventral setulae in apical half. Mid femur anteriorly with short suberect setulae; mid tibia moderately thickened, ventrally with one spur-like setae 2× longer than tibia width. + + +Abdomen +black, short black setulose, with rows of whitish microtrichia (as on +Fig. 24 G +). + +Genitalia missing in all specimens. + + + +Etymology +. The species is named after its collector, Otto Garlepp (1864–1959). + + + + +Remarks +. The +holotype +and +paratypes +are damaged: abdominal segments 4–5 of the +holotype +were detached by Willi Hennig in 1938–1939, but no slides can be found either in SDEI, or in MNKB. The +paratype +specimens are partially eaten by psocids and the abdomens are partly postabdomens completely or completely missing. The generic position of the species is provisional, as it requires more detailed analysis of the male genitalia, morphology- and / or molecular-based phylogenetic analysis. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E4BFFDAFF2155CBFBBBFAB9.xml b/data/03/F0/29/03F029281E4BFFDAFF2155CBFBBBFAB9.xml new file mode 100644 index 00000000000..ca061832e12 --- /dev/null +++ b/data/03/F0/29/03F029281E4BFFDAFF2155CBFBBBFAB9.xml @@ -0,0 +1,572 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella heteroptera +Hendel, 1909 + + + + + + + +Figs 5 B +, +25–26 + + + + + + + +Aspistomella heteroptera +Hendel 1909b: 266 + + +, + +1910: 49 + +; +Steyskal 1968 +: 54.14. + + + + + +Material examined. Type. + + +Lectotype + +[here designated] +♀ +: “ +Peru +- Meshagua / 13.10.03 / Urubambafl.” [ +Schnuse +leg.] “ +Aspistomella +\ heteroptera H. / det. +Hendel +” [one wing missing] ( +SMTD +) + +. + + +Paralectotype + +: +1♀ +: “ +Peru +- Meshagua / Urubamba/ 11.X.03” [ +Schnuse +leg.] ( +NHMW +) + +. + + +Non-type +. + + +Bolivia + +: +Santa Cruz +, near +Buena Vista +( +El Cairo +), on cut culm of + +Gineurium sagittatum + +, + +18.i.2011 + +, +Bol B +42/11, +5♀ +(leg. +D. Kovac +) + +, + +idem, near on freshly cut culm of + +Gineurium sagittatum + +, + +21.i.2011 + +, +Bol G +28/11, +1♂ +(leg. +D. Kovac +) (dissected) ( +SMF +; +SIZK +) + +; + +Mapiri +, +Sarampioni +, + +700 m + +, + +4.01.1903 + +, +1♀ + +, + +idem, + +13.02.1903 + +, +1♀ +( +Schnuse +) ( +SMTD +) + +. + + +Peru + +: +Meshagua +, +Urubambafl +[uss], + +150 m + +, + +28.09.1903 + +, +1♀ + +, + +idem, + +30.09.1903 + +, +2♂ +; +Pachitea +, + +23.11.1903 + +, +1 ♀ +[headless]; +Pamchamayo +, + +15.01.1904 + +( +Schnuse +), +“heteroptera +/ det. +F.Hendel +\ +Aspistomella +” ( +SMTD +) + +. + + + + +Diagnosis +. + +Aspistomella heteroptera + +differs from the species of the genus in the combination of the face between the antennae pitchy black (also in + +A. sachavaca + +) and the costal vein bent anteriorly before the apex of vein Sc, the costal cell is conspicuously lobate, and the pterostigma very short, shorter than the width of the costal cell (also in + +A. duo + +, + +A. lobioptera + +, + +A. steyskali + +, and + +A. tres + +), differing from them by details of the wing pattern: the apical quarter of cell r +4+5 +with triangular incision extending only into cell r +2+3 +(in + +A. lobioptera + +and + +A. steyskali + +it extends into cell r +1 +, whereas in + +A. duo + +and + +A. tres + +it is entirely dark); differing from + +A. duo + +, + +A. sachavaca + +, and + +A. tres + +by the bare vein R +1 +. The male genitalia are similar to those of + +A. duo + +and + +A. tres + +(surstylus directed mesally, with the pimple-like apical projection and cerci moderately elongate), differing mainly by the cerci fused only at the base. + + + + +FIGURE 25. + +Aspistomella heteroptera +Hendel + +, ♀. +A +, habitus, left; +B +, same, dorsal; +C +, head and thorax, left; +D +, head anterior. + + + + +Description +. Male. +Head +( +Figs 25 C–D +) ratio (length: height: width) = 1: 1.3: 1.5, frons, parafacial, and gena reddish or yellowish brown, face and occiput mostly black. Frons conspicuously narrowed posteriorly ( +Figs 25 B, D +), 1.5–1.7× longer than wide at lunule and 2.3–2.5× longer than wide at vertex, with subshiny, partly brown or black ocellar triangle and brown vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.2–0.4× broader than postpedicel, sparsely white microtrichose. Frontal setulae short, moderately strong, black, proclinate and partly inclinate, forming three irregular rows of 4–6 setulae on each side; 3 interfrontal setae, anteriormost crossing, longer than other setae and as long as outer vertical seta; 1 very long orbital seta, 1.1–1.2× longer than ocellar seta, 0.8× longer than inner vertical seta and 4× longer than outer vertical seta; postocellar seta long, 0.4× longer than inner vertical seta; outer vertical seta short, 0.4× longer than inner vertical seta and as long as postocular setae, forming one row, allied by 4–5 dorsal and 5–6 ventral occipital setae. Lunule very narrow, indistinct, orange. Eye 1.5–1.6× higher than long. Face (above epistome) 0.8× higher than wide at transverse fold, black, densely black microtrichose; epistome dark brown to black, sparsely white microtrichose, with metallic greenish sheen, strongly produced anteriorly and separated from upper part of face by deep suture. Clypeus brown, sparsely white microtrichose, subshiny, 0.2–0.25× higher than epistome. Gena brownish yellow, with long genal seta and 3–4 additional setae anterior to it, 0.4–0.6× longer than genal seta. Occiput black, except postgena partly brown, with cyan metallic sheen, greyish microtrichose; ventral part of occiput (postgena) with 5–7 setae almost 0.5–0.6× longer than genal seta. + +Antenna brown to black; scape and pedicel with black setulae; postpedicel brown, whitish microtrichose, 2– 2.2× longer than wide, apically conspicuously narrowed; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shiny. Palp brown to black, narrowly crescent-shaped, apically rounded, with 10–12 strong black setulae, of which 2–3 subapical setulae 1.5–2× longer than other setulae. + + +FIGURE 26. + +Aspistomella heteroptera +Hendel + +, ♂ genitalia. +A +, postabdomen, posterior; +B +, same, lateral; +C +, same, ventral; +D +, same, dorsal; +E +, surstylus, posterior; +F +, part of hypandrium and pregonite, ventral; +G +, ejaculatory apodeme. Abbreviations: cerc—cerci; ej apod—ejaculatory apodeme; hypd—hypandrium; ph—phallus; pi p—pimple-like process; pregt—pregonite; s—seta; sur—surstylus; v l sur—ventral lobe of surstylus. + + + +Thorax +( +Figs 25A–C +) brown to black (in teneral specimens with brownish-yellow postpronotal lobe, notopleural triangle and scutellum), with bluish sheen and sparse white microtrichia not obscuring underlying cuticle. Mesonotal scutum 1.3×as long as wide; setulose black, with 6–8 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar setae absent in all specimens examined; prescutellar area without setulae behind anterior dorsocentral setae. Scutellum dorsally very slightly convex, orange to black, subshiny, sparsely microtrichose, without setulae, laterally with silver or bluish sheen. Subscutellum subshiny, dark brown to black. Mediotergite shiny black, not microtrichose. Other setae as described for the genus. All the setae and setulae black. + + +Wing +( +Fig. 5 B +) +5.5 mm +( +♂ +), +4.8–5.7 mm +( +♀ +) long, 2.9–3.5× longer than wide; basicostal cell hyaline; costal cell lobed, 4× longer than wide, brown in basal and apical quarter of length, with costa conspicuously curved posteriorly and covered with slightly longer setulae before apex of vein Sc; pterostigma entirely brown, narrowly triangular, 0.4–0.5× longer than wide, vein R +1 +bare dorsally, ending slightly proximally of crossvein dm-m level in both sexes; vein R +2+3 +almost straight, subparallel to costa to very apex. Crossvein r-m at middle (in +♂ +) or slightly proximal to middle of cell dm (in +♀ +). Cell r +4+5 +5.5–7× longer than wide, apically narrowed. Cell m +1 +narrowly triangular and strongly narrowed in apical half, as ultimate section of M +1 +sinuate subapically; the latter 3–4× longer than crossvein dm-m and 2–2.5× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.2–1.5× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula, and large dark brown mark from apical lobe of costal cell to whole cell m +4 +except its very base, and 3 wide triangular incisions: from cell r +1 +through cell dm distally from crossvein r-m to vein M +4 +, in base of cell m +1 +and from apex of cell m +1 +into cell r +2+3 +. Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe narrower than cell cua. Alula 2× longer than wide, darkened in apical half. Calypters white, with white cilia. Halter yellow. + + +Legs +( +Fig. 25 A +) with yellow or brownish-yellow coxae and trochanters, femora entirely yellow in Bolivian specimens to largely black in Peruvian +syntypes +(then greenish subshining with sparse microtrichia) except anterior surface of fore tibiae and all knees yellow; tibiae either mostly dark brown to entirely yellow (in teneral or discoloured specimens) and tarsi entirely yellow, black setose and setulose. Fore femur with 2 rows of posterodorsal and posterior setae slightly shorter than femur width, and short and thin posteroventral setulae. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single spur-like seta 1.5–2× longer than tibia width. Hind femur in apical 0.6–0.7 of its length with 2 suberect dorsal setae. + + +Abdomen +moderately elongate ( +Figs 25A, B +) brown to black, syntergite 1+2 broadly yellow, tergite 3 sometimes yellow basally; tergites 3–4 sparsely microtrichose, appearing less microtrichose in apical third, with faint cyan or greenish metallic sheen, except tergite 5 of both +♂ +and +♀ +, which shines brown to black without metallic sheen; setulae and setae black; tergite 6 of +♀ +short, completely hidden beneath tergite 5. Tergites 4, 5 and 6 of +♂ +subequally long. + + +Male genitalia +. Cerci wide oval, fused at base, short setulose, moderately flattened dorso-ventrally, bilobate posteriorly ( +Figs 26 A–D +). Epandrium short setulose, with setulae 3–6× shorter than base of surstylus ( +Fig. 26 A +). Each surstylus broad basally, gradually narrowing without additional lobes and curved mesally, with a row of five shortened setulae on its mesal surface, two of which are conspicuously thickened, but not strongly sclerotised ( +Figs 26 A, E +). Pregonites symmetrical, slightly lobed, with 5 setulae ventro-mesally, conspicuously anterior to the postgonites ( +Figs 26 C, E +). Postgonites rounded, with 5–6 small trichoid sensilla. Phallus moderately long and narrow, about about 3–3.5× longer than epandrium high, basally short microtrichose ( +Figs 26 A, B +), apically with numerous lamellar cuticular sclerotisations, in rest coiled on right side of abdomen. + + +Female terminalia +: taeniae 0.66 as long as eversible membrane; aculeus not flattened, with cercal unit oval and long setulose, +1.9 mm +long; 2 subglobose spermathecae. + + + + +Remarks +. Originally +Hendel (1909b: 266) +mentioned +8♀ +from +Peru +(Meshagua, October and January), which were the +syntypes +; in fact only 2 of the +4 specimens +in SMTD and NHMW collected in January and October fully correspond to the original locality data,; we also considered them all as +syntypes +(except +1♀ +collected on +15.01.1904 +is from Pamchamayo) and here designate them as +lectotype +and +paralectotype +. The other +2♂ +and +4♀ +specimens from SMTD were collected by Schnuse in February, September and November in +Peru +—Pachitea and +Bolivia +and were not included in the type series. We suspect in this case that Hendel’s list of localities may have been based on a few specimens from the whole series, and that Hendel merely read only a few labels. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E4EFFC7FF215487FEE5FC09.xml b/data/03/F0/29/03F029281E4EFFC7FF215487FEE5FC09.xml new file mode 100644 index 00000000000..42a96ac047d --- /dev/null +++ b/data/03/F0/29/03F029281E4EFFC7FF215487FEE5FC09.xml @@ -0,0 +1,753 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella lobioptera +Hendel, 1909 + + + + + + + +Figs 2 A–C +, +5 E +, +27–29 + + + + + + + +Aspistomella lobioptera +Hendel 1909b: 264 + + +, + +1910: 47 + +, 49; +Steyskal 1968 +: 54.14. + + + + + +Material examined. Type. + + +Lectotype + +♀ +: + +Bolivia + +: “ +Bolivia-Mapiri +/ 17.I.03 / +Chimate + +650 m + +”, “ +Coll. W. Schnuse +/ 1911-03”, “ +Aspistomella +\ lobioptera H. / det. +Hendel +” ( +SMTD +) + +[here designated]; + + +Paralectotypes + +: +1♀ +: “ +Bolivia Mapiri +/ 2.IV.03 / +Sarampioni + + +700 m + +. + +” [ +Schnuse +leg.], “ +Aspistomella +\ lobioptera H. / det. +Hendel +” [one wing missing; abdomen dissected and attached in microvial] ( +SMTD +) + +; + +1♀ +: + +Peru + +: “Peru-Ukayali-fl. / +Unini +21.X.03” [ +Schnuse +leg.] “ +Aspistomella +\ lobioptera H. / det. +Hendel +”, “Type” [dark red paper], “coll. +Hendel +” ( +NHMW +) + +. + + +Non-type +: + + +Bolivia + +: +La Paz +, near +Mapiri Arroyo Tuhiri +, + +9–12.IV.2004 + +, +15.2805ºS +, +68.25ºW +, + +500 m + +Malaise +trap, +1♀ +(B. +Brown +) ( +CSCA +) + +; + + +Ecuador + +: +Napo Province +, +Huahua Sumaco +, km 45, on +Hollin-Loreto +rd +Mal. +[aise] trap, + +20.12.1989 + +, +1♀ +[head detached and glued separately] ( +M. & J. Wasbauer +, +H. Real +leg.) ( +CSCA +) + +. + + +Peru + +: “ +Meshagua +, +Urubambafl. +”, + +3.10.1903 + +, +1♀ +[ +W. Schnuse +leg.] (“ +Aspistomella +/ lobioptera H. / det. +Hendel +); idem, + +27.09.1903 + +; “ +Pachitea-Münd + +150 m + +”, + +7.11.1903 + +, +1♂ +[abdomen dissected], +1♀ +; idem, + +26.11.1903 + +, +1♀ +[ +O. Garlepp +leg.] ( +SMTD +) + +; + +Madre de Dios +, +Rio Tambopata Sachavacayoc +centre, + +162 m + +, +Malaise trap +, +12º50’59.6”S +69º22’07.7”W +, 18.06.– + +23.07.2009 + +, +1♀ +(J.T. +Smit +) ( +CSCA +) + +; + +Madre de Dios +, +Rio Tambapata +, +Sachavacayoc Centre +, +New Chacra +, +12º50’59.9”S +69º22’08.3”W +, + +182 m +a.s.l. + +, +Malaise trap +, 2– + +10.06.2010 + +, +1♀ +(J.T. +Smit +);idem, +Old Chacra +, +12º51’15.5”S +69º21’56.6”W +, + +195 m +a.s.l. + +, + +28.04.2010 + +, +1♀ +(dissected: +Fig. 30 +), idem, +12º51’10.7”S +69º22’02.4”W +, + +195 m +a.s.l. + +, + +28.04.2010 + +, +1♀ +(J.T. +Smit +) ( +RMNH +) + +. + + + + +FIGURE 27. + +Aspistomella lobioptera +Hendel + +, paralectotype ♀ (NHMW). +A +, habitus, left; +B +, head, anterior; +C +, head and thorax, + + +left; +D +, wing; +E +, wing, anterobasal part; +F +, labels. Abbreviations: ptstg—pterostigma; m +1 +—first medial cell; m +4 +—fourth + fifth medial cell. Scale bars: 1 mm. + + + + +Diagnosis +. + +Aspistomella lobioptera + +resembles + +A. duo + +, + +A. enderleini + +, + +A. heteroptera + +, + +A. steyskali + +, and + +A. tres + +in that the costal vein is bent anteriorly before the apex of vein Sc, the costal cell is lobed, the costal vein is thickened before the apex of the subcostal vein, forming a conspicuous cleft, and the pterostigma is very short, shorter than the width of the costal cell ( +Figs 5 B–F +, +27 E +, +28 D +), and differs from them in details of the wing pattern: The apical quarter of cell r +4+5 +is crossed by a long crescent-shaped incision extending into cell r +1 +(in + +A. duo + +and + +A. tres + +the apical quarter of cell r +4+5 +completely dark; in + +A. heteroptera + +the triangular incision extends only into cell r +2+3 +). In addition, + +A. lobioptera + +is similar to + +A. enderleini + +, + +A. lunata + +and + +A. steyskali + +in having a wide oval wing shape (2.5–2.9× longer than wide) and in the similar pattern: apex with long crescent-shaped incision extending into cell r +1 +, differing from them by the cell dm apically of r-m entirely dark (in + +A. enderleini + +and + +A. steyskali + +, with hyaline spot connected to the hyaline area in cell m +4 +); furthermore, + +A. lobioptera + +is similar to + +A. enderleini + +and + +A. steyskali + +in having an epandrium with short nonprojecting cerci on both sides of the anus, differing in having moderately narrowed, simple surstyli with short but distinct antero-ventral and postero-ventral lobes and a row of 4–5 thin setulae on the mesal surface, the 2 ventralmost longer than dorsal (in + +A. enderleini + +, single ventral lobe blunt triangular, and in + +A. steyskali + +two very conspicuous lobes, and in addition, an inner surstylus with strongly sclerotised prensisetae). + + + + +FIGURE 28. + +Aspistomella lobioptera +Hendel + +, non-type specimens ♂ ( +A +, +B +, +E +, +F +) and ♀ ( +C +, +D +, +G +) (SMTD). +A +, habitus, left; +B +, head and thorax, left; +C +, head, anterior; +D +, wing, anterobasal part; +E +, abdomen, left; +F +, +G +, labels. + + + + +Description +. Male. +Head +( +Figs 27 B, C +, +28 B, C +) ratio (length: height: width) = 1: 1.4: 1.9, frons, face above transverse fold, parafacial, and gena reddish or yellowish brown, face and occiput mostly black. Frons slightly narrowed posteriorly ( +Figs 27 C +, +28 B +), 1.25–1.5× longer than wide at lunule and 1.3–1.6× longer than wide at vertex, with subshiny, brown or black ocellar triangle and brown vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.2–0.3× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates with 5–7 parafrontal setulae and 2–5 frontal setae on each side as long as outer vertical seta, frontal vitta whitish microtrichose, with 2–5 shorter, proclinate or inclinate interfrontal setae ( +Fig. 28 C +). Lunule very narrow, indistinct, orange. Eye 1.3–1.45× higher than long. Upper part of face yellow, white microtrichose (above epistome); epistome strongly produced anteriorly, reddish brown laterally and anteroventrally to black medially, sparsely white microtrichose, with metallic bluish sheen. Clypeus yellow to brown, sparsely white microtrichose, subshiny, 0.4–0.5× higher than epistome. Gena brownish yellow, with long genal seta and 3–5 long peristomal setae anterior of it, 0.4–0.8× longer than genal seta. Occiput black, except postgena partly brown, with metallic cyan sheen, greyish microtrichose. + + + +FIGURE 29. + +Aspistomella lobioptera +Hendel + +, ♂ genitalia (SMTD). +A +, epandrium; +B +, ejaculatory apodeme; +C +, phallus; +D +, postabdomen, posteriorly; +E +, same, lateral; +F +, same, ventral; +G +, same, lateroventral. Abbreviations: bph—basiphallus; cerc— cerci; ph g—phallic guide; ph—phallus; phapod—phallapodeme; pregt—pregonite; p l sur—posterior lobe of surstylus; s— seta; v l sur—ventral lobe of surstylus. + + +Antenna brown to yellow; scape and pedicel with black setulae; postpedicel yellowish brown, blackish apico-dorsally, whitish microtrichose, twice as long as wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shining. Palp yellow or yellowish brown, narrowly crescent-shaped, apically rounded, with 7–10 strong black setulae, of which 4–5 subapical setulae 1.5–2× longer than other setulae. + + +FIGURE 30. + +Aspistomella lobioptera +Hendel + +, ♀ abdomen and genitalia (RMNH). +A +, abdomen, ventral; +B +, spermathecae; +C +, egg; +D +, vagina and ventral receptacle; +E +, cercal unit of the aculeus, enlarged. Scale bar: 0.5 mm. + + + +Thorax +( +Fig. 27 C +) brown to black, with bluish sheen and sparse white and brown microtrichia not hiding underlying cuticle. Mesonotal scutum 1.3× longer than wide; black setulose, with 8–14 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present; prescutellar area with 4 rows of setulae between posterior dorsocentral setae. Scutellum dorsally very slightly convex, brown to black, subshining, sparsely microtrichose, devoid of setulae, with golden, silver or bluish sheen. Subscutellum shining, dark brown to black. Mediotergite shining black, non-microtrichose medially. Other setae as described for the genus. All the setae and setulae black. + + +Wing +( +Figs 5 E +, +27 D, E +, +28 A, D +) +2.9–3.4 mm +( +♀ +) long, 2.5–2.9× longer than wide; basicostal cell hyaline; costal cell lobate, 4× longer than wide, brown in basal and apical quarter of length, with costa conspicuously curved, posteriorly covered with longer setulae and forming conspicuous cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, 0.3–0.5× longer than wide and 0.3× longer than costal cell width, vein R +1 +bare, ending far proximally of crossvein r-m level in both sexes; vein R +2+3 +sinuate, at apex bent anteriorly to costa. Crossvein r-m distally of middle of cell dm. Cell r +4+5 +6–7× longer than wide, apically narrowed. Cell m +1 +subtriangular; ultimate section of M +1 +2.5–2.6× longer than crossvein dm-m and 1.2× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1–1.2× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula, and large dark brown mark from apical lobe of costal cell to wing apex, with 4 hyaline marks: incision from cell r +1 +into cell r +2+3 +basally of crossvein r-m, two oval spots in base of cell r +4+5 +and in apex of cell m +4 +and long and narrow crescent or arcuate incision from apex of cell m +1 +into cell r +1 +parallel to wing apex. Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe as wide as cell cua. Alula 1.7–2× longer than wide, uniformly pale grey or darkened in apical half. Calypters white, with white ciliae. Halter yellow. + + +Legs +( +Figs 27 A +, +28 A, E +): coxae and trochanters, apices of femora and tibiae yellow, fore femur brownish-yellow, otherwise black; tibiae mostly black; tarsi yellowish brown; black setose and setulose. Fore femur with row of 6–7 posterodorsal and 4–5 posteroventral setae. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single spur-like seta 1.6–1.8× longer than tibia width. + + +Abdomen +brown to black, sparsely black setulose, sometimes with faint purplish or greenish metallic sheen. + + +Male genitalia +( +Figs 29 A–G +) with short cerci, moderately narrowed, simple surstyli having short antero-ventral and postero-ventral lobes and one row of 4–5 thin setulae on mesal surface, with 2 ventralmost longer than dorsal ( +Figs 29 D, E, G +). Phallus extremely large, thickened, 8–9 times as long as epandrium high, densely trichose ( +Fig. 29 C +). Hypandrium: phallic guide with suboval lobes forming conspicuous posterior projections, bearing pair of oval postgonites just anterior of basiphallus ring, and symmetrical pregonites anterolateral of them ( +Fig. 29 F +). + + +Female terminalia +( +Figs 30 A, B, D, E +): oviscape 1.5–1.7× longer than tergite 5; aculeus with ovoid, long-setulose cercal unit; ventral receptacle simple, finger-like, apically enlarged; 2 subglobose, slightly elongated spermathecae. + + +Preimaginal stages +unknown except for egg as on the +Fig. 30 C +. + + + + +Remarks +. Originally, +Hendel (1909b) +mentioned +3 syntypes +, 2 of them in SMTD (one of which is here designated as +lectotype +for the stability) and one in NHMW. The other specimens in SMTD were not mentioned in the type series. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E53FFC1FF215557FBC3FB23.xml b/data/03/F0/29/03F029281E53FFC1FF215557FBC3FB23.xml new file mode 100644 index 00000000000..3e15813baf2 --- /dev/null +++ b/data/03/F0/29/03F029281E53FFC1FF215557FBC3FB23.xml @@ -0,0 +1,398 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella lunata +(Hendel, 1909) + +comb. n. + + + + + + +Figs 5 G +, +31 + + + + + + + +Euxesta lunata +Hendel 1909a: 157 + + +, + +1910: 47 + +, 49; +Steyskal 1968 +: 54.18. + + + + + +Material examined. Type. + + +Holotype + +♀ +: “Peru-Meshagua, 27.9.[19]03 Urubambafl.”, [ +W. Schnuse +leg.], “ +Euxesta +\ lunata H. / det. +F. Hendel +”, “coll. +W. Schnuse +, 1911-3”, “ +HOLOTYPUS +♀ +/ +Euxesta +/ +lunata Hendel +/ +E. Kameneva +des. 2022” (left wing detached by Hendel for slide apparently missing; right wing re-attached after photography) ( +SMTD +). + + + +Non-type +. + + +Peru + +: labels as in +holotype +, +1 ♂ +(antennae, one wing, abdominal sternites and terminalia missing) ( +SMTD +) + +. + + + + +Diagnosis +. + +Aspistomella lunata + +is similar to + +A. enderleini + +, + +A. lobioptera + +and + +A. steyskali + +, in having wing wide oval and similar wing pattern (dark pattern with hyaline base and a few hyaline marks: apex with long crescent incision extending into cell r +1 +; cell r +1 +with cuneiform hyaline incision distally or apex of vein R +1 +; cell m +4 +with hyaline spot apically, differing from all of them by the first incision extending posteriorly into the base of cell r +4+5 +( + +A. enderleini + +, + +A. lobioptera + +and + +A. steyskali + +the cuneiform incision is well separated from the round hyaline spot at the base of cell r +4+5 +); from + +A. lobioptera + +(which has dm apically of r-m entirely dark), it differs by dm with subapical hyaline spot connected to the hyaline area in cell m +4 +, as in + +A. enderleini + +and + +A. steyskali + +; from all other species of + +Aspistomella + +, which have a very short pterostigma (only in + +A. enderleini + +moderately short), it differs by a pterostigma slightly longer than the width of the costal cell ( +Figs 5 G +, +31 F +). + + + + +Redescription +. Male. +Head +( +Figs 31 B–D +) ratio (length: height: width) = 1: 1.5: 1.9; frons, face above transverse fold, parafacial, and gena reddish or yellowish brown, epistome and occiput mostly black. Frons moderately wide, slightly narrowed posteriorly ( +Fig. 31 C +), 0.7× as long (from lunule to anterior ocellus) or 1.1× (from lunule to inner vertical seta) as wide at lunule; vertex black, steel shining, sparsely microtrichose; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.1–0.3× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates with 5–6 pairs of parafrontal setulae, 2–3 pairs of inclinate frontal setae slightly shorter than outer vertical seta, frontal vitta sparsely whitish microtrichose, with 2–3 shorter, proclinate or inclinate interfrontal setulae ( +Fig. 31 C +). Lunule indistinct. Eye 1.5–2× higher than long. Epistome black medially, reddish brown laterally and anteroventrally, sparsely white microtrichose, with metallic bluish sheen, strongly produced anteriorly and separated from upper part of face by deep fold; face above epistome brownish yellow, white microtrichose. Clypeus brown, sparsely white microtrichose, 0.2× higher than epistome. Gena brownish yellow, with long genal seta and 4–5 additional long peristomal setae anterior of it, 0.3–0.9× longer than genal seta. Occiput black, except postgena partly brown, with cyan metallic sheen, greyish microtrichose. + + + +FIGURE 31. + +Aspistomella lunata +(Hendel) + +, holotype ♀ ( +A–D +, +H +) and non-type ♂ ( +E +, +F +) (SMTD). +A +, habitus, left; +B +, head, right, and thorax, dorsal; +C +, head, anterior; +D +, same, dorsal; +E +, head and thorax, dorsolateral; +F +, wing, anterobasal part; +G +, labels. Abbreviations: ptstg—pterostigma. Scale bars: 1 mm. + + +Antenna brown; scape and pedicel with black setulae; postpedicel brownish yellow, darkened apico-dorsally, whitish microtrichose, twice as long as wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts black, prementum black, shining. Palp yellow or yellowish brown, narrowly crescent, apically rounded, with 9–12 black setulae, of which 3–4 subapical setulae 2–3× longer than other setulae. + +Thorax ( +Figs 31 B, E +) brown to black, with bluish sheen and sparse white and brown microtrichia not hiding underlying cuticle. Mesonotal scutum 1.3× longer than wide; black setulose, with 8–10 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present; prescutellar area with 4–5 rows of setulae between posterior dorsocentral setae. Scutellum dorsally very slightly convex, brown to black, subshining, sparsely shagreened, devoid of setulae. Subscutellum shining, dark brown to black. Mediotergite shining black, non-microtrichose medially. Other setae as described for the genus. All the setae and setulae black. + + +Wing +( +Fig. 5 G +) 2.9 ( +♂ +)– +3.1 mm +( +♀ +) long, 2.5× longer than wide; generally as described for + +A. enderleini + +, costal cell 5× longer than wide, with costa very slightly curved, forming shallow cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, as long as wide and 0.25× longer than costal cell width, vein R +1 +bare, ending at level of crossvein r-m level; vein R +2+3 +sinuate, at apex bent anteriorly to costa. Crossvein r-m distally of middle of cell dm. Cell r +4+5 +6.5× longer than wide, apically slightly narrowed. Cell m +1 +subtriangular; ultimate section of M +1 +3.5× longer than crossvein dm-m and 1.4× longer than penultimate section. Vein CuA Z-shaped, posteroapical lobe of cell cua along vein CuP 2.5× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula, and large dark brown mark from apical lobe of costal cell to wing apex, with 3 hyaline marks: incision from cell r +1 +into cell r +4+5 +distal to crossvein r-m, oval spot in apex of cells dm and m +4 +and long and narrow crescent or arcuate incision from apex of cell m +1 +into cell r +1 +subparallel to wing apex. Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe slightly narrower than cell cua. Calypters white, with white ciliae. Halter yellow. + + +Legs +( +Fig. 31 A +): coxae and trochanters, apices of femora and tibiae yellow, fore femora brownish-yellow ventrally, otherwise black; tibiae mostly dark brown; tarsi yellowish brown; black setose and setulose. Otherwise legs as described for + +A. enderleini + +. + + +Male and female terminalia +not examined; partly exposed aculeus with ovoid, long-setulose cercal unit. + + + + +Remarks +. +Hendel (1909a) +originally placed this species in the genus + +Euxesta + +because it has a non-shortened pterostigma, like in all the species he placed in that genus. However, it has an epistome more than twice as long as the height of the clypeus, like all species of + +Aspistomella + +, which is the diagnostic character of all the genera considered in this article. It shares a similar wing pattern with + +A. lobioptera + +, the +type +species of the latter genus and some other species. For this reason, we transfer it from + +Euxesta + +to + +Aspistomella + +. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E55FFCDFF215479FCCDFF15.xml b/data/03/F0/29/03F029281E55FFCDFF215479FCCDFF15.xml new file mode 100644 index 00000000000..9ace1449417 --- /dev/null +++ b/data/03/F0/29/03F029281E55FFCDFF215479FCCDFF15.xml @@ -0,0 +1,457 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella obliqua +Kameneva, V. Korneyev & Savaris + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +F8A1EC81-94CD-4816-AE96-B8FE9984C8CD + + + + + +Figs 6 H +, +32–33 + + + + +Material examined. Type. + +Holotype +: +♂ +: + +Brazil + +: [ +Rio de Janeiro +:] “ +Therezopolis +, Soberbo. 1000 metr. + +22.1.1939 + +. Trayassos & Oiticica”, “Otitoidea ( +Ulidiidae +)”, “ +HOLOTYPE +♂ +/ +Aspistomella obliqua Kameneva, V. Korneyev & Savaris +” [red label] ( +MZUSP +) + +. + +Paratypes +: + +Brazil + +: +Santa Catarina +: +2♂ +, +1♀ +: “ +Corupa +( +Corupá +) / ( +Hansa Humboldt +) / +S. Cath. +( +Santa Catarina +), +Brazil +/ + +XII-1945 + +”, “ +A. Maller +, coll. / +Frank Johnson +/ +Donor +”, idem, “ + +II 1945 + +” and “ + +XII-1945 + +”, respectively ( +AMNH +); +1♀ + +: + +Rio de Janeiro +: “Itatiya / + +20. Jan. 1927 + +/ +Zikán +leg.”, “Lichtfang” ( +ZFMK +); +1♂ +: “Itatiaia, Est. do Rio, +Brasil +(Estr. Agulhas Negras, K. + +6 - 2000 m + +) Tra. & Pearson 5/6 - 2 - [1] 951 ( +MELQ +ESALQENT001784 +); +1♀ +: “Itatiaia, +Est. do Rio +, +Brasil +(Macieira- + +1830 m + +). 9/10 - 3 - [1] 951. +D. Albuquerque +col.” ( +MZUSP +); +1♂ +: “Therezopolis, +Est. do Rio +, XII - [19] 39 Freitas [col.]” ( +MZUSP +); +1♀ +: “ +Est. do Rio +, Itatiaia, Faz. Serra. 2 - [1] 945. +Barretto +col.” ( +MELQ +ESALQENT001785 +); +1♀ +: Itatiaia. 800 ms. 12 - [1] 933, +S. Lopes +ET R. +Cunha +[col.]” ( +MZUSP +); +1♀ +: “Angra-Jussaral. 2 - [1] 935, Trayassos & Oiticica F [col.]” ( +MZUSP +) + +. + + + + +Diagnosis +. + +Aspistomella obliqua + +is the largest known species in this group of genera, with a wing length of almost +10 mm +. It also differs from all other species of the group by the combination of the elongated pterostigma, vein R +1 +dorso-apically setulose, crossvein r-m distally from R +1 +apex, head with moderately wide frons, strongly developed epistome and outer vertical seta well expressed, 0.4–0.5× longer than inner vertical seta, prescutellar acrostichal seta present, wing narrow, more than 3× longer than wide; oblique hyaline interspace crossing whole wing from apex of R +1 +to apex of CuA, dark subapical crossband uniformly narrow, cell m +1 +with hyaline area in basal half; face below lunule with moderately small, rhomboid black microtrichose area not reaching bases of antennae, mid tibia ventroapically with 2 long spines and hypandrium with pregonites displaced postero-laterally from postgonites. + + + + +FIGURE 32. + +Aspistomella obliqua + + +sp. nov. + +, holotype ♂ ( +A–D +) (MZUSP) and paratype ♂ ( +E–G +) (AMNH). +A +, +E, +habitus, left; +B +, +F +, same, dorsal; +C +, head and thorax, left; +D +, labels; +G +, head, anterior; +H +, head, left; +I +, wing, anterobasal part; +J +, fore femur. ( +A–D +by Alexandre Araújo and Marcoandre Savaris.) Abbreviations: C—costal vein; c—costal cell; cua—anterior cubital cell; ptstg—pterostigma; R +1 +—anterior branch of radius. + + + + +FIGURE 33. + +Aspistomella obliqua + + +sp. nov. + +, paratype ♂ genitalia (AMNH). +A +, postabdomen, posterior; +B +, same, lateral; +C +, same, anterior; +D +, same, ventral; +E +, hypandrium, anterodorsal; +F +, same, posteroventral; +G +, same, dorsal. Abbreviations: bph—basiphallus; cerc—cerci; ph g—phallic guide; ph—phallus; phapod—phallapodeme; pgt—postgonite; pregt—pregonite; sur —surstylus. + + + + +Description +. Male. +Head +( +Figs 32 C, G, H +) ratio (length: height: width) = 1: 1.56: 1.8; frons, parafacial and gena reddish or yellowish brown, epistome medially and occiput mostly brown to black; face above transverse fold brown, white microtrichose, with black rhomboid or trapezoid spot at lunule not touching antennal sockets; epistome brown to brownish yellow laterally. Frons moderately wide, slightly narrowed posteriorly ( +Fig. 32 G +), 0.9× as long (from lunule to anterior ocellus) or 1.46× (from lunule to inner vertical seta) as wide (at lunule), with brown or black, shining, sparsely silver microtrichose vertex; orbits, gena and occiput silver-white microtrichose; parafacial narrow, snow white microtrichose. Frontal plates with 8–9 short, fine parafrontal setulae and 4–7 frontal setae on each side; frontal vitta matt brown to yellowish brown, with 1–4 interfrontal setae. Eye 1.5× higher than long. Face densely white microtrichose (above epistome) except black spot at lunule black microtrichose; epistome sparsely white microtrichose, with steel or metallic cyan sheen. Clypeus brown to yellow, sparsely white microtrichose, subshining, 0.3× higher than epistome. Gena high, 0.34× higher than eye, brownish yellow, with moderately long genal seta and 4–5 additional long peristomal setae anterior of it, 0.5–0.7× longer than genal seta. Occiput with densely steel grey to white microtrichose. + +Antenna yellowish to dark brown; scape and pedicel with numerous black setulae; postpedicel yellow, apico-dorsally dark brown or blackish, white microtrichose, 1.9–2× longer than wide, apically rounded; arista entirely black, 2-segmented, bare. Mouthparts black, prementum black, shining. Palp yellowish brown, widely crescent, apically rounded, with 18–25 strong black setulae, of them 3–4 subapical setulae 1.5–2× longer than other setulae. + +Thorax +( +Figs 32 A–C, F +) brown to black, with silvery, golden or purple sheen and sparse white and brown (posterior of transverse suture and in supraalar area) microtrichia not hiding underlying cuticle. Mesonotal scutum 1.3× longer than wide; black setulose, with 14–18 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta strong; prescutellar area with 8 rows of setulae between posterior dorsocentral setae. Scutellum dorsally very slightly convex, brown to black, with strong silver or golden sheen, sparsely microtrichose, devoid of setulae. Subscutellum and mediotergite black, silver microtrichose. All the setae and setulae black. + + +Wing +( +Fig. 6 H +) +9.2–10.2 mm +long, 3.1–3.3× longer than wide; basicostal cell hyaline; costal cell straight, 8–10× longer than wide, brown in basal and apical quarters of length, with costa slightly thickened and covered with longer setulae before apex of vein Sc; pterostigma entirely brown, triangular, 2.0–2.5× longer than wide, vein R +1 +with 10–12 setulae dorsally ( +Fig. 32 I +), ending proximal to crossvein r-m level in both sexes; vein R +2+3 +arcuate, at apex bent anteriorly to costa. Crossvein r-m in distal third of cell dm or slightly proximally. Cell r +4+5 +5.4–5.5× longer than wide, apically narrowed. Cell m +1 +narrow triangular; ultimate section of M +1 +2.9–3× longer than crossvein dm-m and 1.4–1.5× longer than penultimate section. Vein CuA Z-shaped, forming long posteroapical lobe of cell cua along vein CuP, 3× longer than its anterior shoulder ( +Fig. 32 I +). Wing pattern with short but rather wide subbasal crossband from humeral vein through cell cua into alula, and large dark brown mark from apical quarter of costal cell and pterostigma into cell cua +1 +, with narrow and oblique hyaline crossband from apex of vein R +1 +through base of cell r +4+5 +and apex of cell dm into apex of cell cua +1 +; middle of cell r +4+5 +above dm-m and middle of cell m +1 +with oblique hyaline incision ( +Figs 6 H +, +32 A, B, E, F +). Cell cup and anal lobe as wide as cell cua ( +Fig. 32 I +). Alula 3× longer than wide, grey, darkened in apical half. Calypters white, with very long white cilia, some almost as long as calypters. Halter yellow. + + +Legs +mostly black, except coxae, trochanters and bases of femora brownish yellow; tibiae brown to black, fore and mid tarsus brown, hind tarsus brownish yellow; femora with metallic sheen, silvery microtrichose. Fore femur with 2 rows of posterodorsal and posterior setae half as long as femur width, and 6–8 moderately strong posteroventral setulae in apical half ( +Fig. 32 J +). Mid femur anteriorly with short suberect setulae; mid tibia ventrally with two subequal spur-like setae 1–1.3× longer than tibia width. + + +Abdomen +black, with tergites 5–6 brown to black, black setose and setulose, with faint golden, steel or greenish metallic sheen. + + +Male genitalia +( +Fig. 33 +) with moderately large, subovoid, mostly separated cerci ( +Figs 33 A, B, D +); epandrium densely setulose, wide ovoid, with narrow, mesally directed surstyli having no lobes, and bearing only a few setulae on medial surface, and also one thicker pimple-like apical process ( +Fig. 33 D +). Phallus rather short, bare, 1.5–2 times as long as epandrium high ( +Fig. 33 B +). Hypandrium with very wide phallic guide forming long laterally directed lobes connected with pair of long, posteriorly projected pregonites posterior of basiphallus ring; pair of suboval postgonites laterally of basiphallus, both with groups of 5–7 trichoid sensilla, on pregonites almost twice longer than on postgonites ( +Figs 33 E–G +). + + +Female terminalia +: aculeus with ovoid, long-setulose cercal unit; 2 globose spermathecae. + + + + +Etymology +. The species name is the Latin adjective, reflecting the presence of an oblique medial hyaline crossband, which is an essential character of this species. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E59FFC8FF21506BFE62FF39.xml b/data/03/F0/29/03F029281E59FFC8FF21506BFE62FF39.xml new file mode 100644 index 00000000000..55031e28bb4 --- /dev/null +++ b/data/03/F0/29/03F029281E59FFC8FF21506BFE62FF39.xml @@ -0,0 +1,369 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella pachitea +Kameneva & V. Korneyev + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +87F9EAAA-F2E1-4AFE-ADC0-01AA95ADD57A + + + + + +Figs 5 A +, +34–35 + + + + +Material examined. Type. + +Holotype +♀ +: “ + +Peru + +— + +150 m + +/ 26.11.[19]03 / Pachitea-Münd [ +8.76S +, +74.53W +] ” [ +Schnuse +leg.] ( +SMTD +) (left wing and apical half or right wing missing) + +. + + +Paratype + +: +1♂ +: “ + +Peru + +— + +150 m + +/ 19.11.[19]03 / Pachitea-Münd” [ +Schnuse +leg.] [head missing; abdomen dissected and attached in microvial] ( +SMTD +) + +. + + + + +FIGURE 34. + +Aspistomella pachitea + + +sp. nov. + +, holotype ♀ ( +B–E +, +G +) and paratype ♂ ( +A +, +F +) (SDEI). +A +, +B +, habitus, left; +C +, head and thorax left; +D +, head, anterior; +E +, head and thorax, dorsal; +F, G +, labels. + + + + +Diagnosis +. + +Aspistomella pachitea + +is similar to other species of the genus in that the epistome is high, the costal vein forms a conspicuous cleft before the apex of the subcostal vein, and the pterostigma is very short, shorter than the width of the costal cell ( +Figs 34 C–D +, +5 A +), but differs from them in that the costal vein is straight, costal cell is not lobed, the vein r-m distally from the R +1 +apex, and in the details of the wing pattern: wing disk gradually darkening from pale grey at anterior margin to brown at posterior margin, without any hyaline incisions, spots or bands (in other species of the genus, the costal vein is conspicuously arcuate proximally to the apex of the subcostal vein, and the wing pattern is predominantly brownish-yellow to dark brown, with hyaline triangular incisions and rounded spots). It is most similar to + +A. duo + +, + +A. heteroptera + +and + +A. tres + +in having very short pterostigma, brown halter, no acrostichal setae, male genitalia with the outer surstyli with narrow mesally directed ventral process ending by a tiny pimple-like process and moderately large projected cerci, differing by the narrowest frons in the group, straight, non-lobed costal cell, bare vein R +1 +and different +type +of with pattern and venation. It also differs from the other species of + +Aspistomella + +by the distinctly curved apical section of vein M +1 +sharing this character only with + +A. heteroptera + +and several species here assigned to + +Ulivellia + +and other genera of this group. + + + + +Description +. Male. +Head +( +Figs 34 C–E +) ratio (length: height: width) = 1: 1.43: 1.62, frons, parafacial, and gena yellow to yellowish brown, face and occiput mostly dark brown to black. Frons slightly narrowed posteriorly ( +Figs 34 D, E +), 1.06× longer than wide at lunule and 1.46× longer than wide at vertex, with subshining, brown ocellar triangle and brownish yellow vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.2× broader than postpedicel, yellow, sparsely white microtrichose. Frontal plates with 5 pairs of inclinate frontal and interfrontal setae as long as outer vertical seta, and one submarginal row of 5 very short parafrontal setulae; frontal vitta sparsely whitish microtrichose, with 3 shorter, frontal setulae above lunule ( +Fig. 34 D +). Lunule indistinguishable. Eye 1.55× higher than long. Face strongly produced anteriorly, brown, densely white microtrichose (above epistome); epistome brown, sparsely white microtrichose, with metallic bluish sheen. Clypeus low, yellowish brown, sparsely white microtrichose. Gena brownish yellow, with long genal seta and 6–7 additional long peristomal setae anterior of it, 0.4–0.6× longer than genal seta. Occiput black, white to greyish microtrichose. + + +Antenna yellow; scape and pedicel with black setulae; postpedicel yellow, whitish microtrichose, twice as long as wide, apically rounded; arista black except basal 0.15 yellow, almost bare. Mouthparts black, prementum black, shining. Palp yellow, as in + +A. lobioptera + +. + + +Thorax +( +Figs 34 A–C +) black, with bluish sheen and sparse white and brown microtrichia not hiding underlying cuticle. Mesonotal scutum 1.25× longer than wide; black setulose, with 5–6 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta absent; prescutellar area without setulae between posterior dorsocentral setae. Other setae as described for the genus. All the setae and setulae black. Scutellum dorsally flattened, yellowish brown to brown, subshining, sparsely microtrichose, devoid of setulae, with bluish sheen. Subscutellum subshining, black. Mediotergite shining black, non-microtrichose medially. + + +Wing +( +Fig. 5 A +) +4.3 mm +( +♂ +) long, 2.55× longer than wide; basicostal cell hyaline; costal cell straight, 5× longer than wide, pale grey, brownish in basal 0.16 of length, with costa straight, almost uniformly setulose, slightly thickened and forming cleft before apex of vein Sc; pterostigma entirely brown, linear, vein R +1 +bare, ending proximally of crossvein r-m level in both sexes; vein R +2+3 +straight. Crossvein r-m basally of middle of cell dm. Cell r +4+5 +5× longer than wide, apically narrowed. Cell m +1 +subtriangular; ultimate section of M +1 +conspicuously upcurved, 2.35× longer than crossvein dm-m and 1.1× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, as long as its anterior shoulder. Wing uniformly grey microtrichose, subhyaline at anterior margin and apex and brown in posterior half. Cell cup (anal cell sensu +Kameneva & Korneyev 2010 +) and anal lobe brown as wide as cell cua. Alula 2.6× longer than wide, uniformly dark grey. Calypters brownish, with pale brown ciliae. Halter brownish yellow, with brown knob. + + +Legs +( +Figs 34 A–B +): coxae and trochanters, apices of femora yellow, fore femur anteriorly brownish-yellow, otherwise black; tibiae and tarsi yellow; black setose and setulose. Fore femur with 2 rows of 4–6 posterodorsal, but without strong posteroventral setae. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single spur-like seta 3× longer than tibia width. + + +Abdomen +brown to black, sparsely black setulose. + + +Male genitalia +( +Figs 35 B–G +) with short, but projected, separate cerci, moderately narrowed; surstyli simple with narrow, mesally directed ventral lobe apically bearing dorsally directed pimple-like process, but without distinct antero-ventral and postero-ventral lobes; one row of 4–5 short setulae on mesal surface of inner surstylus ( +Figs 35 C, F +). Phallus moderately short, 2× longer than epandrium height, bare ( +Fig. 35 D +). Hypandrium: phallic guide with suboval lobes forming no conspicuous posterior projections, bearing pair of oval postgonites anterior to basiphallus ring, and symmetrical pregonites anterolateral to them, both with groups of 5–6 trichoid sensillae ( +Fig. 35 G +). + + + +FIGURE 35. + +Aspistomella pachitea + + +sp. nov. + +, paratype ♂ genitalia (SDEI). +A +, abdomen, ventral; +B +, postabdomen and apical part of preabdomen; +C +, postabdomen, posterior; +D +, same, lateral; +E +, ejaculatory apodeme; +F +, postabdomen, ventral; +G +, hypandrium, ventral. + + + +Female terminalia +: not examined. + + + + +Etymology +. The name of the species is a noun in apposition derived from its +type +locality, the Pachitea River, a tributary of the +Ucayali +. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E5CFFCBFF215007FC87FDD9.xml b/data/03/F0/29/03F029281E5CFFCBFF215007FC87FDD9.xml new file mode 100644 index 00000000000..2872085db1e --- /dev/null +++ b/data/03/F0/29/03F029281E5CFFCBFF215007FC87FDD9.xml @@ -0,0 +1,360 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella quinquincisa +Kameneva & V. Korneyev + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +ADC8FC31-03E6-4F57-83B3-198A102D8CF0 + + + + + +Figs 6 F +, +36–37 + + + + +Material examined. Type. + +Holotype +♂ +: + +Brazil +: + +“Brasilien / +St. Cath. +[arina], Joinville / Schmalz S. V.” (cyan paper label, no date”, “Zool. Mus. Berl.” (yellow label) (left wing missing, right wing detached and glued after photographing; abdomen dissected and mounted in microvial with glycerine) ( +NKMB +). + + + + + +Diagnosis +. + +Aspistomella quinquincisa + +is most similar to + +A. crucifera + +in comparatively short head and less produced epistome, narrow frons and wings, as well as in wing venation, wing pattern widely dark with large subbasal and four incisions in apical dark area, differing from it by the cell r +1 +with 2 marginal hyaline marks cuneiform, narrowed posteriorly, of which the second incision extends only into cell r +2+3 +(in + +A. crucifera + +, into cell r +4+5 +) and the hyaline mark in cell m +1 +crossing vein M +1 +to the middle of cell r +4+5 +(in + +A. crucifera + +, only reaching vein M +1 +). It differs from the other species of the genus as indicated in the key to species. + + + + +Description. +Male. +Head +( +Figs 36 C, D +) ratio (length: height: width) = 1: 1.4: 1.7, frons, face above transverse fold, parafacial, and gena reddish or yellowish brown, epistome and occiput mostly black. Frons ( +Fig. 36 C +) slightly narrowed posteriorly, 0.7× as long (from lunule to anterior ocellus) or 1.2× (from lunule to inner vertical seta) as wide (at lunule), with subshining black ocellar triangle and vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.25–0.3× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates with 4–5 fine parafrontal setulae and 3–4 frontal setae on each side, frontal vitta with shallow wrinkles, sparsely and very short microtrichose; with 1–2 pro- or inclinate interfrontal setae ( +Fig. 36 C +). Eye 1.3× higher than long. Face yellowish brown, white microtrichose above epistome; epistome moderately produced anteriorly and separated from upper part of face by shallow fold, brown, sparsely white microtrichose, with metallic bluish sheen. Clypeus brown, sparsely white microtrichose, subshining, 0.4× higher than epistome height. Gena brownish yellow, with long genal seta and 4–5 additional long peristomal setae anterior of it, 0.4–0.6× longer than genal seta. Occiput black, with cyan metallic sheen, greyish microtrichose. + + +Antenna yellow; scape and pedicel with black setulae; postpedicel yellow, whitish microtrichose, 1.6× longer than wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow to brown, as described for + +A. angustifrons + +. + + +Thorax +( +Figs 36 A, B, E +) brown to black, silvery subshining, with sparse white microtrichia not hiding underlying cuticle. Mesonotal scutum 1.3× longer than wide; black setulose, with 2 pairs of dorsocentral setae; rows of setulae between them broken off and indistinguishable, but not more than 4; acrostichal prescutellar seta present, 0.8× longer than posterior dorsocentral seta (prescutellar area partly destroyed with pin). Other setae as described for the genus, black. Scutellum dorsally slightly convex, brown, subshining, finely chagreened, sparsely microtrichose, without setulae. Subscutellum and mediotergite as in + +A. angustifrons + +. + + +Wing +( +Figs 6 F +, +36 F +) +3.2 mm +long, 2.8× longer than wide; basicostal cell hyaline; costal cell straight, 6× longer than wide, brown in basal 1/3 and 1/5 of its length; pterostigma entirely brown, narrow triangular, 2.5× longer than wide; vein R +1 +bare, ending proximally of crossvein r-m level; vein R +2+3 +slightly arcuate in basal half, straight at apex. Crossvein r-m at middle of cell dm. Cell r +4+5 +9× longer than wide. Cell m +1 +narrow triangular; ultimate section of M +1 +3.4× longer than crossvein dm-m and 1.9× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 2× longer than its anterior shoulder. Wing pattern with subbasal crossband from humeral vein through cell cua into alula; wing distally of cells c, bm, cua and radial fork dark brown with 4 large hyaline areas: 2 hyaline incisions at anterior margin from cell r +1 +: proximal one through cell r +2+3 +into base of cell r +4+5 +distally of crossvein r-m and distal to middle of cell r +2+3; +and at posterior margin into apical part of cell dm (part of wing in apical part of cell m +4 +missing in the +holotype +) and from basal part of cell m +1 +ending at middle of cell r +4+5 +( +Fig. 6 F +). Calypters white, with white cilia. Halter yellow. + + + +FIGURE 36. + +Aspistomella quinquincisa + + +sp. nov. + +, holotype ♂ (MNKB). +A +, habitus, left; +B +, same, dorsal (wings detached); +C +, head, anterior; +D +, same, left; +E +, mesonotum, dorsal; +F +, wing, anterobasal part; +G +, abdomen, dorsal; +H +, third abdominal tergite, vestiture; +I +, labels. Scale bar: 1 mm. + + + + +FIGURE 37. + +Aspistomella quinquincisa + + +sp. nov. + +, holotype ♂ genitalia (MNKB). +A +, abdomen, ventral; +B +, postabdomen, lateral; +C +, same, ventral; +D +, same, postero-dorsal; +E +, same, posterior; +F +, same, ventral. Abbreviations: bph—basiphallus; cerc—cerci; epand—epandrium; hypd—hypandrium; ph g—phallic guide; ph—phallus; pgt—postgonite; pregt—pregonite; s—seta; sur — surstylus. + + + +Legs +( +Fig. 36 A +): fore coxa yellow, fore trochanters, femora, tibiae, and tarsi missing in +holotype +. Mid and hind leg brownish yellow, except hind coxa blackish brown and tarsi yellow. Mid femur anteriorly with of 8 and posteroapically with 3 suberect setulae; mid tibia ventrally with single spur-like seta 2.5× longer than tibia width. Hind femur with 2 long subapical setae dorsally. + + +Abdomen +( +Figs 36 A, B, G +) subshining black, sparsely black setulose, cuticle very shallowly rugulose ( +Figs 36 G, H +), only syntergite 1+2 and lateral margins of tergites 3–5 and sternites with sparse whitish setulae. Sternites 3–5 sparsely microtrichose, black setulose, as on +Fig. 37 A +. Pregenital sternite 8 microtrichose and short setulose, with 2 thicker and longer setae ( +Fig. 37 A +). + + +Male genitalia +( +Figs 37 B–F +) with short cerci, moderately narrowed, simple, blunt surstyli without lobes or serrations and one row of 3 moderately thickened setulae on mesal surface ( +Fig. 37 E +). Phallus narrow, 2.5–3 times as long as epandrium high, bare ( +Figs 37 B, C +). Hypandrium: phallic guide with suboval lobes forming conspicuous posterior projections, bearing pair of oval postgonites just anterior of basiphallus ring ( +Figs 37 D, E +); pregonites symmetrical, with 2–3 setulae ( +Fig. 37 F +). + + +Female terminalia +: not examined. + + + + +Remarks +. The specimen is in fair condition: right postpedicel, both fore legs (except fore coxae), left mid and hind leg, left wing and most mesonotal setulae missing. Right wing detached and glued to the specimen after taking picture. Abdomen dissected and kept in a microvial pinned together with specimen. + + + + +Etymology +. The species name is a Latin adjective, reflecting the presence of five hyaline marginal incisions in the wing pattern, which is an essential character of this species. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E5FFFB5FF215327FC12FB99.xml b/data/03/F0/29/03F029281E5FFFB5FF215327FC12FB99.xml new file mode 100644 index 00000000000..25b931d1eac --- /dev/null +++ b/data/03/F0/29/03F029281E5FFFB5FF215327FC12FB99.xml @@ -0,0 +1,347 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella sachavaca +Smit & Kameneva + +, +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +7B262B5F-3A13-42C0-BA6C-4FBD097754FF + + + + +GenBank accession number PQ331196 + +Figs 2 D +, +6 A +, +38 + + + + +Material examined.Type. + +Holotype +: +1♀ +: “ + +Peru + +, +Madre de Dios +Rio Tambopata +/ +Sachavacayoc +centre / +12º51’10.7”S +69º22’02.4”W +[ +12.8530S +, +69.3673W +] / + + +29.x. +2008 + + +, 195 m a.s.l., leg. +J.T.Smit +” ( +RMNH 556517 +) (both midlegs missing) + +. + +Paratypes +: +1♀ +, “ +Peru +, +Madre de Dios +/ +Rio Tambopata Picaflor +concession / +12º46’26.3”S +69º24’36.3”W +[ +12.7740S +, +69.4101W +] / + +16.iv.2009 + +Leg. J.T.Smit +” + +, +1♀ +, 05– +10.06.2010 +, +1♀ +, 07– +22.11.2010 +[leg. J.T.Smit]. + + + + +Diagnosis +. + +Aspistomella sachavaca + +are smaller flies (WL < +5 mm +), differing from all other species of the group of genera also by the combination of the moderately developed pterostigma, vein R +1 +apically setulose, crossvein r-m at the level of R +1 +apex, head with moderately wide anteriorly shining frons, face below lunule with sooty black microtrichose area extending far beyond bases of antennae, moderately produced epistome and outer vertical seta well expressed, 0.4–0.5× longer than inner vertical seta, prescutellar acrostichal seta present, wing wide, 2.3–2.4× longer than wide; almost straight perpendicular or slightly arcuate hyaline interspace crossing whole wing from apex of R +1 +to apex of cell m +4 +, dark subapical crossband widened posteriorly, ultimate section of vein M +1 +sinuate; cell m +1 +with hyaline area in apical half; and mid tibia with 1 long ventroapical seta. + + + + +Description +. Male. +Head +( +Figs 38 B, C +) ratio (length: height: width) = 1: 1.3–1.4: 1.95; frons, parafacial, and gena reddish brown, most of epistome and occiput dark brown to black; face below lunule almost with sooty black microtrichose area expanded ventrolaterally far beyond bases of antennae ( +Fig. 38 C +). Frons moderately wide, slightly narrowed posteriorly ( +Fig. 38 B +), 0.65× as long (from lunule to anterior ocellus) or 1.3× (from lunule to inner vertical seta) as wide (at lunule); vertex black, steel shining, sparsely microtrichose; orbits in posterior half, parafacial, narrow transverse band on face above fold, gena and occiput silver-white microtrichose; parafacial half as wide as postpedicel. Vertical plates with 2 orbital setae (anterior half as long as posterior). Frontal plates and anterior half of frontal vitta convex and shining, devoid of any microtrichia; with 3 white microtrichose elongate areas: 2 on orbits anterior of vertical plate and one anterior of ocellar triangle; 3–5 parafrontal setulae, 5–6 pro- and lateroclinate frontal setae in sublateral row and 2–3 long interfrontal setae on each side, on shining part of dark brown or orange frontal vitta ( +Figs 38 B, C +). Eye 1.5× higher than long. Face above transverse fold with white microtrichose crossband. Epistome sparsely white microtrichose, with metallic cyan sheen. Clypeus brownish-yellow, laterally brown or black, densely snowy-white microtrichose, matt, 0.3× higher than epistome. Gena high, 0.33× higher than eye, dark brown to black, densely microtrichose, with moderately long genal seta and 3–4 additional long peristomal setae anterior of it, 0.3–0.8× longer than genal seta. Occiput densely grey to white microtrichose. + +Antenna brown; scape and pedicel with numerous black setulae; postpedicel brown, grey microtrichose, 1.3– 1.4× longer than wide, apically rounded; arista entirely black, 2-segmented, bare. Mouthparts black, prementum black, shining. Palp yellowish brown, crescent-shaped, apically rounded, with 18–25 strong black setulae, of them 3–4 subapical setulae 1.5–2× longer than other setulae. + + +FIGURE 38. + +Aspistomella sachavaca + + +sp. nov. + +, holotype ♀ (RMNL). +A +, habitus, left; +B +, head, dorsal; +C +, head, anterior; +D +, mesonotum, dorsal; +E +, fore legs; +F +, wing, anterobasal part; +G +, labels. Scale bar: 1 mm. + + + +Thorax +( +Figs 38 A, D +) brown to black, on pleura with silvery sheen and sparse grey and brown (posterior of transverse suture and in supra-alar area) microtrichia not hiding underlying cuticle. Mesonotal scutum 1.25× longer than wide; black setulose, with 12–14 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta strong; prescutellar area with 2–4 rows of setulae between posterior dorsocentral setae. Scutellum dorsally slightly convex, dark brown to black, subshining, very short and sparsely microtrichose, without setulae. Subscutellum and mediotergite shining black. All the setae and setulae black. + + +Wing +( +Figs 6 A +, +38 F +) +5.4–5.6 mm +long, 2.6–2.7× longer than wide; basicostal cell hyaline; costal cell straight, 5–6× longer than wide, brown in basal and apical quarters of length, with costa slightly thickened and covered with longer setulae before apex of vein Sc; pterostigma entirely brown, triangular, 1.6–1.8× longer than wide, vein R +1 +with 8–10 setulae dorsally, ending at level of crossvein r-m level in both sexes; costal vein between apices of R +1 +and R +2+3 +conspicuously arcuate; vein R +2+3 +slightly undulate. Crossvein r-m at proximal 2/5 of cell dm. Cell r +4+5 +4.0–4.5× longer than wide, apically narrowed. Cell m +1 +narrow triangular, with pointed apex; ultimate section of M +1 +2.7× longer than crossvein dm-m and 1.2–1.4× longer than penultimate section. Vein CuA Z-shaped, forming moderately long posteroapical lobe of cell cua along vein CuP, 1.7× longer than its anterior shoulder. Wing pattern with short but rather wide subbasal crossband from humeral vein through cell cua into alula, wide discal crossband from apical quarter of costal cell and pterostigma into basal half of cell cua +1 +, with moderately wide, somewhat arcuate, but not oblique hyaline interspace from apex of vein R +1 +through base of cell r +4+5 +and apex of cell dm into apex of cell cua +1 +; apex of cell m +1 +with oblique triangular hyaline incision reaching cell r +1 +anterior of crossvein dm-m ( +Fig. 6 A +). Cell cup and anal lobe 1.3× broader than cell cua +1 +. Alula 2.2× longer than wide, grey, darkened in apical half. Calypters white, with long white cilia, some almost as long as calypters. Halter yellow with knob basally brown. + + +Legs +( +Figs 38 A, E +) mostly black, except fore coxa, fore trochanter and apices of femora and whole tarsi brownish yellow; femora with metallic sheen, sparsely grey microtrichose. Fore femur with 2 rows of posterodorsal and posterior setae half as long as femur width, and 3–4 moderately strong posteroventral setulae in apical half. Mid femur anteriorly with short suberect setulae; mid tibia moderately thickened, ventrally with one spur-like setae 1.2× longer than tibia width. + + +Abdomen +black, with syntergite 1+2 silvery microtrichose, other tergites shining and very sparsely grey microtrichose, black setose and setulose. + +Male unknown. + +Female terminalia +: not dissected; aculeus with ovoid, long-setulose cercal unit (exposed). + + + + +Etymology +. The species is named after its +type +locality, Sachavacayoc, +Madre de Dios +, +Peru +. The name is considered to be a noun in apposition (the placename) with “yoc” elided. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E74FFE3FF215477FBB2F808.xml b/data/03/F0/29/03F029281E74FFE3FF215477FBB2F808.xml new file mode 100644 index 00000000000..de595a63770 --- /dev/null +++ b/data/03/F0/29/03F029281E74FFE3FF215477FBB2F808.xml @@ -0,0 +1,478 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella angustifrons +(Hendel, 1909) + +comb. nov. + + + + + + +Figs 6 C +, +10–12 +. + + + + + + + +Paraphyola angustifrons +Hendel 1909b: 261 + + +; + +Hendel 1910: 46 + +, 47; +Steyskal 1968 +: 54.20. + + + + + +Material examined. Type. + +Lectotype +♀ +: + +Peru + +: “ +Peru +Meshagua / 11.X.03 / Urubamba fl.” [ +Schnuse +leg.] “ +Paraphyola +\ angustifrons H. / det. +Hendel +” “Type” [dark red paper], “coll. +Hendel +” ( +NHMW +) + +. + + +Paralectotypes + +: + +Peru + +: +1 ♂ +[1 wing missing], “ +Peru +Meshagua / 11.X.03 / Urubamba fl.” [ +Schnuse +leg.] “ +Paraphyola +\ angustifrons H. / det. +Hendel +”, “coll. +Hendel +” ( +NHMW +) + +; + +1♀ +: “ +Peru +—Pichis / XII.03 / Pto. Bermudes” [ +Schnuse +leg.] “ +Paraphyola +\ angustifrons H. / det. +Hendel +” ( +SMTD +) + +. + + +Non-type. + + +Peru +: + +“Peru- + +150 m + +/ 12.11.[19]03 / Pachitea-Münd”, +1♀ +(dissected), idem, 26.11.[19]03, +1♂ +[dissected] ( +SMTD +); +Huanuco +, +Tingo Maria +, + +800 m + +, 21– + +23.08.1971 + +, +1♀ +( +C. & M. Vardy +) (BMNH: BM 1971-533) + +; + + +Bolivia + +: +Mapiri +, +Sarampioni +, + +700 m + +, 01.1903, +1♀ +( +Schnuse +) ( +SMTD +) + +. + + + + +Diagnosis +. + +Aspistomella angustifrons + +differs from most species of the genus by the combination of its wing venation (costal vein almost straight, pterostigma moderately long) and wing pattern (wing posterior margin mostly dark, except for a crescent-shaped subapical hyaline area in cell m +1 +). It shares with + +A. crucifera + +and + +A. teresensis + +a comparatively short head, narrow frons and wings, as well as chaetotaxy and wing venation, but differs in coxae, femora and tarsi, which are mostly black (entirely yellow in + +A. crucifera + +and + +A. teresensis + +) and wing pattern with subapical crescentic hyaline incision and otherwise dark posterior half (in + +A. crucifera + +, + +A. quinquincisa + +, and + +A. teresensis + +, with entirely dark subapical area and marginal hyaline spot in cell m +4 +). It differs from + +A. schnusei + +by having a shorter epistome and a wing widely dark in the apical half (in + +A. schnusei + +, epistome strongly produced anteriorly and wing widely hyaline with narrow bands apically). It also differs from all the species of the + +Aspistomella + +group for which the male genitalia have been examined by the long and narrow, posteroventrally curved surstyli. + + + + +FIGURE 10. + +Aspistomella angustifrons +(Hendel) + +lectotype ♂ (A–C, E, F) and non-type ♀, BMNH (D, G, H). +A +, habitus, left; +B +, head left; +C +, head, dorsal; +D +, frons, dorsal; +E +, mesonotum, dorsal; +F +, pterostigma; +G +, abdomen, dorsal; +H +, labels. + + + + +Description +. Male. +Head +( +Figs 10 B–D +) ratio (length: height: width) = 1: 1.4: 1.6, frons, face above transverse fold, parafacial, and gena reddish or yellowish brown, face and occiput mostly black. Frons very narrow, slightly narrowed posteriorly ( +Figs 10 C, D +), 0.85× as long (from lunule to anterior ocellus) or 2× (from lunule to inner vertical seta) as wide (at lunule), with subshining, brown or black ocellar triangle and brown vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.25–0.3× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates with 6–7 pairs of short proclinate parafrontal setulae and 6–8 frontal seta on each side, frontal vitta whitish microtrichose, with 2–3 proclinate or inclinate interfrontal setae ( +Fig. 10 D +). Eye 1.4–1.6× higher than long. Face with upper part separated from epistome by shallow fold; yellow, white microtrichose; epistome moderately produced anteriorly, brown laterally and anteroventrally to black medially, sparsely white microtrichose, with metallic bluish sheen. Clypeus brown to black, sparsely white microtrichose, subshining, 0.25–0.3× higher than epistome. Gena brownish yellow, with long genal seta and 6–8 additional long peristomal setae anterior to genal seta, 0.6–0.8× longer than the latter one. Occiput black, except postgena partly brown, with cyan metallic sheen, greyish microtrichose. + +Antenna yellow; scape and pedicel with black setulae; postpedicel yellow, whitish microtrichose, twice as long as wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow, narrowly crescent, apically rounded, with 8–12 moderately strong black setulae, of them 4–5 subapical setulae 1.5–2× longer than other setulae. + +Thorax +( +Fig. 10 E +) brown to black, with bluish sheen and sparse white and brown microtrichia not hiding underlying cuticle. Mesonotal scutum 1.3–1.4× longer than wide; black setulose, with 6–8 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present, 0.4–0.5× longer than posterior dorsocentral seta; prescutellar area with 2 setulae between posterior dorsocentral setae. Scutellum dorsally very slightly convex, brown, apically yellow, subshining, sparsely microtrichose, devoid of setulae, with silver or bronze sheen. Subscutellum shining, black, sparsely microtrichose. Mediotergite shining black, non-microtrichose medially. All the setae and setulae black. + + +Wing +( +Fig. 6 C +) +3.6–4.7 mm +( +♀ +) long, 3.0–3.4× longer than wide; basicostal cell hyaline; costal cell 6–6.5× longer than wide, brown in basal and apical 1/8 of length, with costa straight, forming very inconspicuous cleft before apex of vein Sc; pterostigma entirely brown, narrow triangular, 1.6–1.9× longer than wide, vein R +1 +bare, ending slightly proximally of crossvein r-m level in both sexes; vein R +2+3 +slightly arcuate in basal half, almost straight at apex. Crossvein r-m proximally of middle of cell dm. Cell r +4+5 +5.5–6.5× longer than wide. Cell m +1 +narrowly triangular; ultimate section of M +1 +3.0× longer than crossvein dm-m and 0.9–1.0× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.25× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula joined with large dark brown mark from apical part of costal cell to wing subapical portion, with 2 hyaline triangular incisions: from costal cell into cell cua and from cell r +1 +through cell into base of cell r +4+5 +distally of crossvein r-m, and entirely dark from anal cell to base of cell m +1 +and narrow crescent incision from apex of cell m +1 +into cell r +1 +parallel to wing apex and a narrow brown crescent band along apex ( +Figs 6 C +, +10 A +). Cell cup and anal lobe half as wide as cell cua. Alula 4× longer than wide, grey, darkened in apical half. Calypters white, with white cilia. Halter yellow. + + +Legs +( +Fig. 10 A +) with black coxae and femora except apices and bases of femora yellow; tibiae brown; tarsi brownish yellow; black setose and setulose. Fore femur uniformly setulose, with subapical row of 2–4 posteroventral setae as long as femur width. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single spur-like seta 5–7× longer than tibia width. + + +Abdomen +brown to black, sparse black setulose, with faint purplish or greenish metallic sheen. + + +Male genitalia +( +Figs 11 A–H +) with short hemispherical, separated cerci ( +Fig. 11 E +); epandrium densely setulose, wide ovoid, with narrow, posteromesally directed surstyli having no lobes, and bearing 2 groups of 2–3 setulae on postero-medial surface at base and apex, and also one thicker, pimple-like apical process ( +Figs 11 B–D, G, H +). Phallus rather short, 2–3 times as long as epandrium high, sparsely trichose ( +Figs 11 B, C +). Hypandrium with phallic guide somewhat bilobate, with short suboval lobes projecting posteriorly, pair of oval, anteriorly directed postgonites just anterior to basiphallus ring, and symmetrical pregonites anterolateral to them, both with groups of 5–6 trichoid sensilla. + + + +FIGURE 11. + +Aspistomella angustifrons +(Hendel) + +♂. +A +, abdomen ventral; +B +, postabdomen; +C +, genitalia, postero-ventral; +D +, same, anteroventral; +E +, cerci; +F +, surstylus, latero-ventral; +G +, genitalia, ventral; +H +, hypandrium, ventral. + + + +Female terminalia +: aculeus with ovoid, long-setulose cercal unit ( +Figs 12 A, B +); 2 globose spermathecae ( +Fig. 12 C +). + + + + +Remarks +. +Hendel (1909b) +mentioned +9♂ +♀ +from “ +Peru +(Meshagua, Oktober; Pichis, Dezember)”, but only +three specimens +matching this record were found in the SMTD and NHMW collections. We suspect in this case that Hendel’s list of +type +localities may be based on a few specimens from the whole series. + + + + \ No newline at end of file diff --git a/data/03/F0/29/03F029281E78FFEEFF2157B3FD9EF988.xml b/data/03/F0/29/03F029281E78FFEEFF2157B3FD9EF988.xml new file mode 100644 index 00000000000..b09ad5dfd25 --- /dev/null +++ b/data/03/F0/29/03F029281E78FFEEFF2157B3FD9EF988.xml @@ -0,0 +1,359 @@ + + + +Revision of the Aspistomella group of genera (Diptera: Ulidiidae: Pterocallinae: Lipsanini) + + + +Author + +Kovac, Damir +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Kameneva, Elena P. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Severyn V. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & University of California, Davis, Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, One Shields Avenue, Davis, California, 95616 USA https: // orcid. org / 0000 - 0001 - 8599 - 7695 & California Department of Food and Agriculture, Plant Pest Diagnostics Branch, 3294 Meadowview Road, Sacramento, California, 95832 - 1448 USA + + + +Author + +Araújo, Alexandre Santos +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Savaris, Marcoandre +University of São Paulo, “ Luiz de Queiroz ” College of Agriculture, Av. Pádua Dias, 11, Piracicaba, São Paulo, Brazil https: // orcid. org / 0000 - 0003 - 0245 - 763 X https: // orcid. org / 0000 - 0002 - 9145 - 6059 + + + +Author + +Smit, John T. +EIS Kenniscentrum Insecten en andere ongewervelden p / a Naturalis Biodiversity Center Postbus 9517 2300 RA Leiden, The Netherlands https: // orcid. org / 0000 - 0002 - 1568 - 5183 + + + +Author + +Schneider, Alexander +Forschungsinstitut Senckenberg, Senckenberganlage 25, Frankfurt am Main, 60325 Germany https: // orcid. org / 0009 - 0000 - 2202 - 4052 https: // orcid. org / 0000 - 0001 - 8451 - 5500 + + + +Author + +Schreiber, Robert +Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + + + +Author + +Korneyev, Valery A. +I. I. Schmalhausen Institute of Zoology National Academy of Sciences of Ukraine, Bogdan Chmielnicki St. 15, 01054 Kyiv, Ukraine https: // orcid. org / 0000 - 0002 - 7986 - 9942 & Museum für Naturkunde, Invalidenstr. 43, Berlin, 10115 Germany Corresponding author: valery. korneyev @ gmail. com; https: // orcid. org / 0000 - 0001 - 9631 - 1038 +valery.korneyev@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-30 + + +5530 + + +1 + + +1 +117 + + + + +http://dx.doi.org/10.11646/zootaxa.5530.1.1 + +journal article +10.11646/zootaxa.5530.1.1 +1175-5334 +14023149 +41376D87-B401-4301-9DDC-54606653881F + + + + + + + +Aspistomella crucifera +(Hendel, 1909) + +comb. nov. + + + + + + +Figs 6 E +, +13 +. + + + + + + + +Paraphyola crucifera +Hendel 1909b: 262 + + +, + +1910: 47 + +; +Steyskal 1968 +: 54.20. + + + + + +Material examined. Type. + +Holotype +♀ +: + +Peru + +: “Peru—Meshagua / 29.9.03 / Urubambafl.” [ +Schnuse +leg.], “ +Paraphyola +\ crucifera H. / det. +F. Hendel +” ( +SMTD +). + + + + + +Diagnosis +. + +Paraphyola crucifera + +shares with + +P. angustifrons + +, + +P. quinquincisa + +, and + +P. teresensis + +a comparatively short head, narrow frons and wings, a wing pattern with a widely dark apical half, as well as wing venation, and chaetotaxy, It differs from + +P. angustifrons + +in having yellow coxae, femora and tarsi (in + +P. angustifrons + +, largely black) and hyaline spot in posterior margin of cell m +4 +. It is most similar to + +P. quinquincisa + +in having wing pattern with apical dark, differing from it by having 4 hyaline incisions: cell r +1 +with 2 marginal hyaline marks narrowed posteriorly, and the hyaline mark in cell m +1 +only reaching vein M +1 +(in, + +P. quinquincisa + +, crossing vein M +1 +to the middle of cell r +4+5 +). It differs from + +P. teresensis + +by cell r +1 +with 2 marginal hyaline marks, the first one reaching vein M +1, +the second one reaching the anterior half of cell r +4+5 +and cell m +1 +with submarginal hyaline mark reaching only vein M +1 +(in + +P. teresensis + +, cell r +1 +with one cuneiform hyaline incision extending into cell dm and cell m +1 +with cuneiform hyaline incision extending at least to vein R +4+5 +or even into cell r +2+3 +). + + +It also differs from + +P. schnusei + +by short epistome and wing apical half widely dark (in + +P. schnusei + +, epistome strongly produced anteriorly and wing widely hyaline with narrow bands apically). + + + + +Description. +Male. +Head +( +Figs 13 B–C +) ratio (length: height: width) = 1: 1.5: 2, frons, face above transverse fold, parafacial, and gena reddish or yellowish brown, epistome and occiput mostly black. Frons very narrow, slightly narrowed posteriorly, 0.95× as long (from lunule to anterior ocellus) or 1.8× (from lunule to inner vertical seta) as wide (at lunule), with subshining, brown or black ocellar triangle and brown vertical plates; orbits, vertex, gena and occiput silver-white microtrichose; parafacial narrow, 0.25–0.3× broader than postpedicel, reddish-yellow, sparsely white microtrichose. Frontal plates with 8–9 tiny parafrontal setulae and 5–7 frontal setae on each side, frontal vitta sparsely whitish microtrichose, with 2–4 pro- or inclinate interfrontal setae ( +Fig. 13 C +). Eye 1.5× higher than long. Face; yellow, white microtrichose above epistome; epistome moderately produced anteriorly and separated from upper part of face by shallow fold, brown, sparsely white microtrichose, with metallic bluish sheen. Clypeus brown, sparsely white microtrichose, subshining, 0.2× higher than epistome height. Gena brownish yellow, with long genal seta and 6–7 additional long peristomal setae anterior of it, 0.5–0.7× longer than genal seta ( +Fig. 13 B +). Occiput black, with cyan metallic sheen, greyish microtrichose. Antenna yellow; scape and pedicel with black setulae; postpedicel yellow, whitish microtrichose, 1.9× longer than wide, apically rounded; arista black except yellow at base, almost bare. Mouthparts brown to black, prementum black, sparsely microtrichose. Palp yellow to brown, as described for + +P. angustifrons + +. + + +Thorax +brown to black, silvery subshining, with sparse white microtrichia not hiding underlying cuticle. Mesonotal scutum ( +Fig. 13 D +) 1.4–1.5× longer than wide; black setulose, with 6–7 rows of setulae between rows of dorsocentral setulae; acrostichal prescutellar seta present, 0.4–0.5× longer than posterior dorsocentral seta (prescutellar area partly destroyed with pin). Other setae as described for the genus, black. Scutellum dorsally very flattened, brown, subshining, sparsely microtrichose, devoid of setulae, with silver sheen. Subscutellum and mediotergite as in + +P. angustifrons + +. + + +Wing +( +Fig. 6 E +) about +4 mm +( +♀ +) long ( +holotype +with both wings broken off), 3.3× longer than wide; basicostal cell hyaline; costal cell straight, 5.2× longer than wide, brown in basal 1/8 of length; pterostigma entirely brown, narrow triangular, 2.7–3× longer than wide, vein R +1 +bare, ending proximally of crossvein dm-m level; vein R +2+3 +slightly arcuate in basal half, straight at apex. Crossvein r-m distally of middle of cell dm. Cell r +4+5 +6.5× longer than wide. Cell m +1 +narrow triangular; ultimate section of M +1 +4.7× longer than crossvein dm-m and 3.2× longer than penultimate section. Vein CuA Z-shaped, forming moderately short posteroapical lobe of cell cua along vein CuP, 1.25× longer than its anterior shoulder. Wing pattern with short subbasal crossband from humeral vein through cell cua into alula; wing distally of cells c, bm, cua and radial fork dark brown with 4 large hyaline areas: 2 hyaline subtriangular incisions at anterior margin from cell r +1 +through cell r +2+3 +into base of cell r +4+5 +distally of crossvein r-m and 2 rounded or subrectangular hyaline spots in apical parts of cells dm and cua +1 +and basal part of cell m +1 +; dark pattern separating these hyaline areas having shape of cross; wing apex dark without hyaline marks. Calypters white, with white cilia. Halter yellow. + + +Legs +( +Fig. 13 A +) yellow; black setose and setulose. Fore femur uniformly setulose, with subapical row of 2–4 posteroventral setae as long as femur width. Mid femur anteriorly with short suberect setulae; mid tibia ventrally with single spur-like seta 3–5× longer than tibia width. + + +Abdomen +brown to black, sparsely setulose. + +Male: not known. + +Female terminalia +(not dissected): aculeus with ovoid, long-setulose cercal unit (partly exposed). + + + + +FIGURE 13. + +Aspistomella crucifera +(Hendel) + +holotype ♀. +A +, habitus, left; +B +, head left; +C +, head, dorsal; +D +, mesonotum, dorsal; +E +, labels. + + + + +Remarks +. The specimen is partially damaged: both wings are broken off. A pencil sketch of the wing pattern was drawn by VK in 2001, before the curator glued it back to the thorax with fish glue as in the photo ( +Figs 13 A, D +); it was later redrawn as in +Fig. 6 E +. + + + + \ No newline at end of file diff --git a/data/03/F2/8B/03F28B2BFF8E2D74FF3AFB66FC62F973.xml b/data/03/F2/8B/03F28B2BFF8E2D74FF3AFB66FC62F973.xml new file mode 100644 index 00000000000..cb16af9c24b --- /dev/null +++ b/data/03/F2/8B/03F28B2BFF8E2D74FF3AFB66FC62F973.xml @@ -0,0 +1,148 @@ + + + +Nadus overlaeti (Navás, 1931) redescribed-new to the fauna of Mozambique, Namibia and Tanzania (Neuroptera: Myrmeleontidae) + + + +Author + +Dobosz, Roland +Upper Silesian Museum, Sobieskiego 2, PL- 41 - 902 Bytom, Poland + + + +Author + +Ábrahám, Levente +Rippl-Rónai Museum H- 7400 Kaposvár, Hungary + + + +Author + +Bąkowski, Marek +0000-0002-9662-7347 +bakowski@amu.edu.pl + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +583 +592 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.9 + +journal article +10.11646/zootaxa.5529.3.9 +1175-5326 +14022888 +21152D9C-51E9-4FB2-A36E-92D8283AF008 + + + + + + + + + +Nadus +Navás, 1935: 43 + + + + + + + + + + + +Nadus + +— + +Hölzel 1969: 318 + +(Com), + +Stange 2004: 294 + +(Mon), + +Oswald & Penny 1991: 39 + +(Mon). + + + + + +Type +species: + +Nadus sudanensis +Navás, 1935 + + + +Diagnosis +: Medium-sized species. Fore wing slightly longer than hind wing. In wings, basal part of costal area tapering, wing tips subacute, apical margin slightly convex below tip. Anal area blunt in fore wing. Costal area of fore wing narrow with only simple cross-veins basally, then widens, cross-veins interconnected with veins or bifurcated distally. In hind wing, costal region only with simple cross-veins. Origin of radial sector well beyond cubital fork. Venation dense, legs long and slender. Tibial spurs shorter than tarsal segment 1. Abdomen shorter than wings. Caudal margin of sternite 7 slightly modified in female. + + +There are only three genera in the tribe +Nesoleontini +. Both the genera + +Cueta +Navás, 1911 + +and + +Nesoleon +Banks, 1909 + +are easily separated from the genus + +Nadus + +by the costal area. The costal area of + +Nadus + +is irregularly bifurcated or partially divided, whereas that of + +Cueta + +and + +Nesoleon + +is simple. + + +Distribution: +Monotypic genus restricted to sub-Saharan Africa. + + + + \ No newline at end of file diff --git a/data/03/F2/8B/03F28B2BFF8E2D7DFF3AF8CFFB59FDFC.xml b/data/03/F2/8B/03F28B2BFF8E2D7DFF3AF8CFFB59FDFC.xml new file mode 100644 index 00000000000..6d5be626f86 --- /dev/null +++ b/data/03/F2/8B/03F28B2BFF8E2D7DFF3AF8CFFB59FDFC.xml @@ -0,0 +1,694 @@ + + + +Nadus overlaeti (Navás, 1931) redescribed-new to the fauna of Mozambique, Namibia and Tanzania (Neuroptera: Myrmeleontidae) + + + +Author + +Dobosz, Roland +Upper Silesian Museum, Sobieskiego 2, PL- 41 - 902 Bytom, Poland + + + +Author + +Ábrahám, Levente +Rippl-Rónai Museum H- 7400 Kaposvár, Hungary + + + +Author + +Bąkowski, Marek +0000-0002-9662-7347 +bakowski@amu.edu.pl + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +583 +592 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.9 + +journal article +10.11646/zootaxa.5529.3.9 +1175-5326 +14022888 +21152D9C-51E9-4FB2-A36E-92D8283AF008 + + + + + + + +Nadus overlaeti +( +Navás, 1931 +) + + + + + + + + + + +Nesoleon overlaeti +Navás, 1931: 125 + + + + + + + +Nadus overlaeti +( +Navás, 1931 +) + +— + +Stange 2004: 294 + +(Mon, Comb). + + + + + + +Nadus sudanensis +Navás, 1935: 43 + + +—Odescr, + +Whittington 2002: 384 + +(Dist), + +Stange 2004: 295 + +. (Mon), +Syn. n. + + + + + + + +Type +locality: + +The Democratic Republic of the Congo +( +DRC +): +Katanga +, +Kafakumba + +. + + + +FIGURE 1. +Habitus of holotype of + +Nadus overlaeti +( +Navás, 1931 +) + +(photo: Mervin Mansell) (A) and + +Nadus sudanensis +Navás, 1935 + +(photo: Yuchen Zheng) (B) + + + + +Type +material examined + +: + + + +MRAC +// + +Holotype + +// +Typus +// +Museé +do +Congo +/ +Katanga +: +Kafakumba +/ + +iii 1929 + +/ +G.F. Overlaet +// +Nesoleon +/ +Overlaeti +/ + +P. +Navás + +S. J. det // MRAC-Tervuren / +Database No + +. / + +MRAC 00032 +// ( +Fig 1A +) + +. + + + + +MNHN: // Type // Museum Paris / +Soudan +franc / Koulouba / Waterlot 1929 // +Nadus +/ +sudanensis Nav. +/ det Navás S.J. // +Lectotype +// +Nadus sudanensis +/ +Navás, 1935 +/ +Lectotype +/ J. Legrand dét 1992 //( +Fig 1B +) + + +Additional material examined +: + + + + +SCMK + +: +1female +— +South Africa +Limpopo Prov. +68 km +NW of +Mokopane Palala river +23°57’32,22”S +28°22’38,64”E + +5–9.II.2019 + +leg: +S.A. Knyazev +(NeuMyr2341) + +; + +1male +— +RSA +Limpopo Prov. +Lephalale +envir. + +831m + +23°43,323’S +27°45,677’E + +05.XI.2013 + +, leg. +L. Prepsl +(NeuMyr537) + +; + +1male +— +Tanzania +, +11 km +NE +Bwawani + +30.12.2015 + +, leg. +S. Prepsl +(NeuMyr2891) + +. + + +USMB +: + +1male +—N +Malawi +, +Nkhorongo Mzuzu +, Mzimba distr., +11°23’S +33°59’E +, + +2.11.2008 + +, leg. +R.J. Murphy +( +USMB 5858 +/29115); +1female +— +Zimbabwe +, +Lukosi Mission +, + +15 km +S Hwange + +, + +3.12.1990 + +, leg. +R. Miller +& +L. Stange +( +USMB 5858 +/29187); +1female +— +Mozambique +, +Cabo Delgado +, +Prov. Ancuabe district +: +Quirimbas National Park +, +Taratibu Hills +12°48’58.4”S +; +39°41’43.5”E +, + +336 m +asl + +., + +04–08. 04. 2022 + +, leg. +Marek Bąkowski +( +USMB 5858 +/22081) + +. + + + +FIGURE 2. +Habitus of male from Malawi (A) and female from Mozambique (B) + +Nadus overlaeti +( +Navás, 1931 +) + +preserved in coll. USMB. Scale bar: 10 mm. + + + + + +EFMEA + +: +1male +1female +— +Namibia +, +Erongo +, +Uis +, +20 km +NW, +21°04’S +14°41’E +, + +530 m + +, + +24.03.2014 + +, leg. +J. Halada + + + +Diagnosis +: Sexual dimorphism insignificant, females usually larger than males. General colour brown to dark brown with yellow marks. Wing shape broadly oval. Hind wing with 7 cross-veins before origin of radial sector. Tarsal segment 1 as long as tarsal segments 2–4 combined. In males, ectoproct not longer than ventral margin in lateral view. In females, caudal margin of sternite 7 modified with two small processes laterally in ventral view. + + +Redescription +: ( +Fig. 2 +) + + +Measurements +: Males (4 exx.) Antenna length: +4 mm +, Fore wing length: +22–23 mm +, width: +4.5–6 mm +, Hind wing length: +19–20 mm +, width: +4–5 mm +, Body length: +18–19 mm +, Abdomen length: +13–14 mm +. + + +Females (4 exx.) Antenna length: +4–5 mm +, Fore wing length: +25–29 mm +, width: +6–8 mm +, Hind wing length: +22–26 mm +, width: +5–6.5 mm +, Body length: +20–24 mm +, Abdomen length: +13–17 mm +. + + +Head: +( +Figs. 3A–B +). Vertex arched in frontal view; yellow with two narrow parallel transversal black bands curving towards each other in middle and touching in dorsal view; triangular black spot in middle of vertex caudally. Short, sparse, black hairs on vertex. Frons shiny brown to black, gena shiny yellow on lower side and predominantly shiny brown near eye. Shiny brown to yellow clypeus with two lateral dark spots laterally, hairless. Labrum yellow with brown lower margin and short, dark brown hairs directed towards mandible on lower margin. Mandible predominantly yellow with dark brown apices and inner margin. Maxillary palps yellow basally, last two segments brown. Last segment of labial palps as long as width of clypeus, spindle-shaped, brownish, apical segment with slit-like sensory pit and acute apices. Eye large and shiny brown. Scape brownish, pedicel black, flagellar segments brown with yellow ring basally and completely dark brown distally, club black. Segments with very short black setae. + + + +FIGURE 3. + +Nadus overlaeti +( +Navás, 1931 +) + +Head in frontal view (A); Vertex and prothorax in dorsal view (B); Legs in lateral view (C). + + + +Thorax +: ( +Fig. 3B +). Pronotum slightly longer than wide, yellow with two narrow lateral, and wide central brown stripes; lateral stripes do not reach anterior margin; with short sparse, and black hairs dorsally. Small brown dots at origin of black hairs. Lateral margins with long, stiff, white hairs pointing anteriorly. Meso- and metanotum yellow with wide dark-brown marks and dense brown dots. Mesoprescutum with only moderately long black hairs; mesoscutum with short black hairs dorsally and white hairs laterally. Metascutum with large oval and reddish-brown spots on each side, almost bare. Thorax in lateral view, dark brown with longitudinal narrow, yellow line directly below wings, covered with short, sparse, white hairs. + + +Wings +: ( +Fig. 3D +and +Fig. 4A–D +). Fore wing, costal area narrow with simple cross-veins basally, then widening distally; beyond origin of radial sector, cross-veins become predominantly bifurcated. Longitudinal veins C, Sc, R, Mp, Cua, Cua +1 +, Cua +2 +and Anal veins pale, alternating with dark brown sections. Brown sections at ends of cross-veins. Membrane discoloured in subcostal area, another characteristic pattern in wing as in +Fig. 4A +. Pterostigma brown basally and yellowish white distally with 5–6 cross-veins. 9–10 usually simple or divided cross-veins (especially in females) before origin of radius sector. Forewing covered with conspicuously long microtrichia. + +Hind wing with characteristic brown discolouration at both ends of hypostigmatic cell and in rhegma area. Pterostigma brown basally and whitish yellow distally with 4–5 cross-veins. In subcostal area, faint brown colouration in some places. With 9–10 cross-veins before origin of radius sector. + +Legs +: ( +Fig. 3C +). Long and slender. Coxae dark brown with sparse white hairs. Trochanters yellow. Fore femur predominantly dark brown with short white hairs on basal surface, and stiff black or white bristles on ventral surface. Femur longer than tibia. Tibia with short black hairs and sparse, erect, stiff, black bristles. Middle and hind femora entirely dark brown with short black hairs, and sparse upright black bristles. Femora as long as tibiae. Hind femur without row of upright bristles. Tibial spurs always shorter than tarsal segment 1. Tarsal segment 1 yellow, as long as tarsal segments 2–4 combined and equal in length to tarsal segment 5. Segments 2–5 dark brown. Tarsi with black hairs and short, sparse, stiff bristles. Claws slightly curved, conspicuously short. + + + +FIGURE 4. +Variability of forewing venation, male from Malawi (A), females: from Zimbabwe (B), from Mozambique (C), male from RSA (D). +Abbreviations +: +C +— +Costa +, +Sc +— +Subcosta +, +R +— +Radius +, +Mp1 +— + +Media +posterior 1 + +, +Cua +— +Cubitus anterior +, +Cup+A1 +— +Cubitus posterior+Anal 1 +, +ps +— +pterostigma +, +hsc +— +hypostigmatic cell +, +rgv +— +radial gradate veins +. + + + +Abdomen +: Tergites brown with indistinct broad yellow bands laterally, but pattern occasionally variegated with only small yellow distal spots. Caudal margins of segments with narrow yellow rings. Intersegmental membrane also with yellow spots. Sternites predominantly brown with narrow longitudinal yellow stripe and with yellow rings on caudal margins in ventral view. Abdomen densely covered with short white hairs. + + +Male terminalia and genitalia +( +Fig. 5A and B +): Ectoproct long, oval-like, with blunt postventral lobe, dark brown proximally, yellow distally covering black bristles and small brown spots at origin of bristles, not extending beyond margin of sternite +9 in +lateral view. Sternite 9 pentagonal, brown with indistinct yellow median band and yellow caudal margin. In ventral view, caudal margin with long brown setae. Gonocoxites 9+11 as in +Figs. 5C +(lateral view) and +Fig. 5D +(ventral view). + + +Female terminalia +: ( +Fig. 5E and F +). In lateral view, ectoproct oval with brown hairs distally. In ventral view, caudal margin of sternite 7 with two small lateral processes as in +Fig. 5F +; Gonocoxite 8 short, thumb-shaped, covered with long brown hairs. Gonocoxite 9 slightly protruded with stout curved digging setae. + + + +FIGURE 5. + +Nadus overlaeti +( +Navás, 1931 +) + +Male terminalia in lateral view (A); the same in ventral view (B); Male genitalia in lateral view (C); the same in caudal view (D); Female terminalia in lateral view (E); Female terminalia in ventral view (F). +Abbreviations +: +T8, T9 +— +tergites 8 & 9 +; +S7 +, +S8 +, +S9 +— +sternites 7, 8 & 9 +, +ep +— +ectoproct +, +gx +— +gonocoxites +, +gx9 +& +gx11 +— +gonarcusparameres complex +[in male], +gx8 +— +posterior gonopophysis +, +gx9 +— +lateral gonopophysis +[in female]. + + + + +FIGURE 6. + +Nadus overlaeti +( +Navás, 1931 +) + +distribution map. The new records are marked with blue asterisk. + + + + +FIGURE 7. +Habitat of + +Nadus overlaeti +( +Navás, 1931 +) + +in the Taratibu Hills (Quirimbas National Park, Mozambique) (Photo: M. Bąkowski). + + + +Morphological variability +: ( +Fig. 4A–D +). There is no significant sexual dimorphism within the species, the body length of females is slightly shorter than that of males. The wing venation can differ, even varying from +one specimen +to another. In the costal area, the cross-veins are not only bifurcated but also interconnected by additional veins. This feature can also be observed in the fore wing before the origin of the radial sector; these cells are mostly irregular. In this area, the number of cross-veins varies according to the +type +of vein connection. Fewer irregular cells are seen in males. There are also differences in the wing pattern. In males, the shaded radial gradate veins in the apical area are usually shorter and form a wider angle with the wing margin than in females, but this pattern is not always constant. + + +Distribution: +Mali +( +Navás 1935 +), +Democratic Republic of the Congo +( +Stange 2004 +), +Kenya +, +Zimbabwe +( +Whittington 2002 +), +Malawi +, +Zimbabwe +( +Dobosz 2021 +) +Republic of South Africa +, new to +Mozambique +, +Namibia +and +Tanzania +( +Fig. 6 +). + + +Habitat +: ( +Fig. 7 +). Its habitats are known from wet savannah areas or around river valleys. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB21FFBAFF41E3A5FD71FC97.xml b/data/1D/1A/87/1D1A87C2BB21FFBAFF41E3A5FD71FC97.xml new file mode 100644 index 00000000000..0b78866d5ca --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB21FFBAFF41E3A5FD71FC97.xml @@ -0,0 +1,330 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) insignis +Kraepelin, 1903 + + + + + + + +Type material examined: + +Syntypes +ZMH +, +3 males +, +Ecuador +, +Loja +, + +9.x.1899 + +, +E. Witt. +leg. + + + +Additional material examined: + + +Ecuador + +, +NMNH 31472 +, +2 males +and +6 females + +; + +NMNH 31472 +, +1 male + +, + +Tungurahua +, + +20.viii. 1937 + +, +Wm. Clarke + +; + +NMNH 31472 +, +1 male + +, + +Baños +, + +29.iv.1939 + +, +Wm. Clarke + +; + +NMNH 31472 +, +1 specimen + +, + +Baños +, + +19.x.1938 + +, +Wm. Clarke + +; + +NMNH 31472 +, +4 females + +, + +Prov. +Tungurahua +, +Rio Blanco +, + +15.ix.1937 + +, +Wm. Clarke + +; + +NMNH 03285 +, +1 female + +, + +Prov. +Tungurahua +, +Baños +, + +24.i.1976 + +, +P.J. Sparrylr + +. + + + + +FIGURES 16–19. + +Otostigmus + + +( +P +.) +calcanus +Chamberlin, 1944 + + +syn. nov. + +Paratype FMNH-INS 0000008 435. +16. +Cephalic plate and tergites 1 and 2, dorsally. +17. +Head, forcipular segment, and sternites 1 and 2, ventrally. +18. +Tergites 20 and 21, dorsally. +19. +Sternites 20 and 21, ventrally. + + + + + +Redescription of +syntypes +. + +Length: +60 mm +from anterior margin of cephalic plate to posterior margin of tergite 21. Antennae with 17 articles, first two and 1/3 of dorsal face of third glabrous; Coxosternal tooth-plates with 4+4 teeth; coxosternite with an angular suture at base of tooth-plates [not described]. Tergites 4–20 with complete paramedian sutures [from 6]; tergites 9(10)–21 margined [only in tergite 21]; tergites 6–20 with (slight) median longitudinal keel [last tergites]; tergite 21 with a slight short median longitudinal keel and a shallow rounded depression in posterior border (in +two types +) and +1 type +only with a slight short median longitudinal keel [in the anterior two-thirds with median keel, then a median longitudinal depression]. Sternites smooth, without sutures, but with depressions; a larger rounded depression in the center with two small weak rounded depressions arranged transversally at posterior border or three small rounded depression arranged as an inverted triangle [ventral plate with a large median pit deepened towards the front, often with shallow side impressions and 3 posterior pits without longitudinal furrow]; sternite 21 shorter than precedent, with a shallow median longitudinal depression; sternite 21 with posterior border slightly concave. Coxopleuron without spines, short and truncate. Legs 1–19 with one tarsal spur, 20 and 21 without [20 with or without]. Coxae +19 in +males with a very short appendix [not described]; coxae +20 in +males with a larger curved appendix posteriorly that overlies sternite 21. Prefemur of ultimate legs in males with a digitiform appendix, exceeding half length of prefemur; digitiform appendix slightly flattened dorsally and with a tuft of light brown hairs on the distal dorsal part. + + + + +Remarks. + +Otostigmus insignis + +was the second + +Otostigmus +species + +reported from +Ecuador +. It was described by +Kraepelin (1903) +together with two other + +Otostigmus + +also from +Ecuador +, + +O. silvestrii + +and + +O. silvestrii intermedius +. + +Verhoeff (1937) +proposed the subgenus + +Ecuadopleurus +Verhoeff, 1937 + +to include + +O. insignis + +and + +O. silvestrii +. + +The subgenus was based solely on sexually dimorphic characters, such as a very short appendix on the coxae 19, a very large, curved appendix posteriorly on the coxae 20, and the digitiform appendix in the prefemur of the ultimate legs. However, this subgenus is not available because no +type +has been designated. The larger curved appendix posterior to coxae 20 is present in males of three species group name, + +O. insignis +, +O. silvestrii intermedius +, + +and + +O. lavanus +. + +The same structure on coxae 20 is also present in the males of + +O. silvestrii +, +O. mesethus +, + +and + +O. parvior + +, but this structure is shorter than in + +O. insignis +, +O. lavanus +, + +and + +O. silvestrii intermedius +. + +Females of these taxa usually have a short appendix on the coxae of leg 20. Another sexually dimorphic feature present in the males of the five species and one subspecies of + +Otostigmus + +mentioned above is the digitiform appendage on the prefemur of leg 21. In these taxa, the digitiform appendix can vary in shape, length, and the presence and position of the tuft of hairs. The function of these dimorphic structures is still unknown in + +Otostigmus + +, and the curved appendage on the coxae of leg 20 is exclusive to Ecuadorian species. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB22FFB4FF41E064FE3FFFE6.xml b/data/1D/1A/87/1D1A87C2BB22FFB4FF41E064FE3FFFE6.xml new file mode 100644 index 00000000000..baf8559995d --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB22FFB4FF41E064FE3FFFE6.xml @@ -0,0 +1,212 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) calcanus +Chamberlin, 1944 + +syn. nov. + + + + + + +Figs 14–19 + + + + +Type material examined: + +Paratypes +( +2 specimens +) FMNH-INS 0000008 435, +Peru +, +Haciens Urco +, nr +Calca +, +Cuzco +, + +19.ix.1939 + + +, col. by K.P. Schmidt, under stones near water, Museum Magellanic Expedition, Rec’d. +12.xii.1939 +. + + + + + +Redescription of +paratypes +. + +Length: +30 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Figs 14, 15 +). In +one type +the right antenna with 17 articles and left with 13 (some articles are missing); other type with right antenna with 9 articles (some articles are missing) and left antenna with 19 [17 articles in the right antenna and 16 articles in the left, normally 17]; first two basal and basal part of the third glabrous. + + +Cephalic plate smooth, without sutures and depressions, but with anterior margin slightly concave between the antennae with very short sulcus [not described] ( +Fig. 16 +). Coxosternal tooth-plates wider than long, with 4+4 teeth and a long bristle; coxosternite with a short paired sutures at base of tooth-plates, this suture is bifurcate in the sides and a short median longitudinal suture [not described] ( +Fig. 17 +). Trochanteroprefemoral process moderately large, with the margin with one short tubercle and with tip pointed. + + +Tergites smooth; tergites 6–20 with complete paramedian sutures [from 5]; tergites 3–5 with very short incomplete paramedian sutures [not described]; only tergite 21 margined in +one specimen +, but in the other specimen tergites 15–21 with poorly-developed margins; posterior margin of tergite 21 very slightly angulate in +one specimen +( +Fig. 18 +), but in the other slightly convex. Sternites 3–19 with incomplete paramedian sutures; the incomplete paramedian sutures from anterior and posterior part of trunk shorter than the sutures at middle of body that reach ¾ of the sternite. Sternite 21 with posterior border straight, shorter than precedent, trapezoidal, without depression ( +Fig. 19 +). Coxopleuron without spines, but with the posterior part with a very short protuberance; pore-field covers almost entire coxopleuron, only the posterior end poreless. Left leg 1 with one femoral spur and one tibial spur; legs 1–2 with two tarsal spurs; legs 3–19 with one, and legs 20 and 21 without. No sexual appendix. + + + + +Remarks. +The +paratypes +of + +O. calcanus + + +syn. nov. + +are severely damaged, with almost all legs and antennae missing. The legs are stored separately in a small vial within a vial containing the +paratypes +. In +one paratype +, tergites 15 to 21 are marginated, resembling + +O. muticus + +and + +O. amazonae + + +syn. nov. + +In the other +paratype +, only tergite 21 is marginated, as observed in + +O. leior + +and + +O. volcanus + + +syn. nov. + +The paramedian sutures, sutures on the sternites, and tarsal spurs on the legs of + +O. calcanus + + +syn. nov. + +correspond to the variation found in specimens identified as + +O. muticus + +. Therefore, the +paratype +of + +O. calcanus + + +syn. nov. + +with tergites marginated from 15–21 is considered a junior synonym of + +O. muticus + +and the +paratype +of + +O. calcanus + + +syn. nov. + +with only tergite 21 marginated is considered a junior synonym of + +O. leior +. + + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB24FFB7FF41E687FC2FFAAD.xml b/data/1D/1A/87/1D1A87C2BB24FFB7FF41E687FC2FFAAD.xml new file mode 100644 index 00000000000..06ecf429878 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB24FFB7FF41E687FC2FFAAD.xml @@ -0,0 +1,218 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) bürgeri monsonus +Chamberlin, 1957 + +syn. nov. + + + + + + +Figs 7–13 + + + + +Type material examined. + +Syntypes +CAS +( +2 specimens +), +Peru +, +Monson Valley +, +Tingo Maria +, + +9.xii.1954 + +, +E.I. Schlinger +& +E.S. Ross + +. + + + + +FIGURES 7–8. + +Otostigmus + + +( +P +.) +bürgeri + +monsonus +Chamberlin, 1957 +syn. nov +. Syntype CAS. 7. General view dorsally. 8. General view ventral. + + + + + +Redescription of +syntypes +. + +Length: +58 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Figs 7, 8 +). Antennae with 20 articles; two basal ones glabrous, the third one glabrous dorsally [three articles glabrous]. Other specimen with 19 articles in right antenna and +21 in +left (18 to 21). Cephalic plate smooth, without sutures and depressions, but with a very short slight median sulcus anteriorly [not described]. Cephalic plate wider than long [not described] ( +Fig. 9 +). Coxosternal tooth-plate wider than long with 4+4 teeth and a long bristle; coxosternite with a short paired sutures at base of tooth-plates [not described] ( +Fig. 10 +). Trochanteroprefemoral process large with the margin with 2 short tubercles and with tip pointed. Tergites smooth; tergites 5–20 [4–19] with complete paramedian sutures; +one specimen +with tergites 5–21 margined, other specimen from 9–21 [not described]; posterior margin of tergite 21 angled and with slight longitudinal depression posteriorly ( +Fig. 11 +). A pair of spiracles in seventh leg-bearing segment ( +Fig. 13 +). Sternites smooth. Sternites 2–19 with anterior incomplete short sutures. Sometimes the short sutures are overlapped by posterior border of the preceding sternite, well visible from sternites 5–18. Sternite 21 longer than wide, converging posteriorly, and with posterior border straight or slight concave. Sternites without depression [no described] ( +Fig. 12 +). Pores of the coxopleuron of different sizes, and numerous; pore-field covers almost entire coxopleuron, only the posterior end poreless; posterior border of coxopleuron with short protuberance bearing two short spines. +One specimen +without terminal spines. Legs 1 with one femoral and one tibial spur (in the +two specimens +); legs 2–16 with two tarsal spurs (other specimen legs 2–19 with two tarsal spurs); sometimes some tarsi between legs 2–19 have one tarsal spur; legs 20 with one tarsal spur and 21 without (other specimen without legs 19, 20 and 21). + + + + +FIGURES 9–12. + +Otostigmus + + +( +P +.) +bürgeri + +monsonus +Chamberlin, 1957 +syn. nov +. Syntype CAS. 9. Cephalic plate and tergite 1. 10. Head and forcipular segment.11. Tergites 20 and 21, dorsally. 12. Sternites of 20 and 21, ventrally. + + + + +FIGURES 13. + +Otostigmus + + +( +P +.) +bürgeri + +monsonus +Chamberlin, 1957 +syn. nov. +Syntype CAS. +13. +Leg-bearing segments 7 and 8, showing the spiracles (lateral view). + + + + +Remarks. +The +syntypes +examined are the typical representatives of +Otostigminae +; however, the presence spiracles on the seventh leg-bearing segment and spines on the coxopleuron are characteristic for the genus + +Rhysida +Wood, 1862 + +. The antennae with 20 or 21 antennomeres, tergites 5–20 with complete paramedian sutures, tergites 5– 21 margined, sternites with anterior incomplete short sutures, legs 1–16 (19) with two tarsal spurs, and the prefemur of the ultimate legs without spines fit the diagnosis of + +Rhysida celeris +( +Humbert & Saussure, 1870 +) + +. Therefore, + +O. bürgueri monsonus + +syn. nov. +is considered a junior synonym of + +R. celeris + +. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB26FFB1FF41E1FBFA7EFDB6.xml b/data/1D/1A/87/1D1A87C2BB26FFB1FF41E1FBFA7EFDB6.xml new file mode 100644 index 00000000000..dfb39b19db8 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB26FFB1FF41E1FBFA7EFDB6.xml @@ -0,0 +1,212 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) amazonae +Chamberlin, 1914 + +syn. nov. + + + + + + +Figs 1–6 + + + +FIGURES 1–2. + +Otostigmus + + +( +P +.) +amazonae +Chamberlin, 1914 + + +syn. nov. + +Syntype MCZ IZ no.1475 (14232). +1. +Habitus, dorsal view. +2. +Habitus, ventral view. +Type material examined. +Syntype MCZ IZ no.1475 (14232), Brazil,Amazonas, Manaus Expedition, Stanford Expedition to Brazil, col. W.M. Mann, 1911. + + + + +FIGURES 3–6. + +Otostigmus + + +( +P +.) +amazonae +Chamberlin, 1914 + + +syn. nov. + +Syntype MCZ IZ no.1475 (14232). +3. +Cephalic plate and tergites 1 and 2, dorsal view. +4. +Head, forcipular segment and sternite 1, ventral view. +5. +Tergites 20 and 21, dorsal view. +6. +Sternites of penultimate and ultimate leg-bearing segments, ventral view. + + + + +Redescription of +syntype +. + +Length: +32 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Figs 1, 2 +). Antennae with 17 articles; first two basal articles glabrous. Cephalic plate smooth, without sutures and depression [two shallow longitudinal furrows in the caudal portion] ( +Fig. 3 +). Coxosternal tooth-plates wider than long, with 4+4 teeth, the three inner closer to each other than the external ones, without a bristle ( +Fig. 4 +). Coxosternite with a short paired sutures at base of tooth-plates [not described]. Trochanteroprefemoral process moderately large, with the margin with 2–3 short tubercles and tip pointed [not described]. Tergites smooth; tergites 5–20 with complete paramedian sutures [from 4–20]; tergites 3–4 with incomplete very short paramedian sutures in the anterior margin [not described]; tergites 12–21 with poorly developed lateral margination [only the 21st marginated]; tergite 21 with posterior margin gently convex [tergite 21 more or less angularly produced] and with a short median longitudinal depression ( +Fig. 5 +). Sternites 3–19 [from 2–20] with “complete” paramedian sutures {paramedian sutures do not reach the anterior and posterior part of the sternites}; sternites 3–20 with rounded depressions [a short pit-like, median, depression in front of the caudal margin and a less pronounced median depression farther cephalad]; sternite 21 shorter than sternite 20, with the posterior margin straight [caudal margin mesally excised], converging posteriorly ( +Fig. 6 +). Coxopleuron without spines; pore-field covers almost entire coxopleuron, only the posterior end poreless; terminal posterior margin of coxopleuron truncate. Legs 1 with two tarsal, one femoral and one tibial spur [legs 1–6 with two tarsal spurs]. Legs 5, 7, 18 and 19 [7–19] with one tarsal spur, legs 20 and 21 lacking spurs; Other legs were missed. + + + + +Remarks. + +Otostigmus amazonae + + +syn. nov. + +has been recorded from several localities in northern +Brazil +, including the states of +Amapá +, Amazonas and +Pará +. There are also records from the mid-western region, especially from the state of +Mato Grosso +(Bücherl 1974). There are numerous records for +Peru +( +Bücherl 1943 +, 1950; +Kraus 1954 +) and +Colombia +(Chagas-Jr. +et al. +2014). The description of + +O. amazonae + + +syn. nov. + +is very similar to + +O. muticus +, + +especially regarding the paramedian sutures in the tergites and the paramedian sutures and rounded depressions in the sternites. The presence of two tarsal spurs, which may vary slightly, can be observed on legs 1–6. Bücherl (1974) noted that specimens of + +O. amazonae + + +syn. nov. + +from +Peru +closely resembled specimens of + +O. muticus +. + +Because most characters of both species are very similar, + +O. amazonae + + +syn. nov. + +is considered a junior synonym of + +O. muticus + +. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB28FFA2FF41E0E9FB1CFF52.xml b/data/1D/1A/87/1D1A87C2BB28FFA2FF41E0E9FB1CFF52.xml new file mode 100644 index 00000000000..465b9979a60 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB28FFA2FF41E0E9FB1CFF52.xml @@ -0,0 +1,174 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) muticus +Karsch, 1888 + + + + + + + +Type material examined: + +Syntypes +ZMB 435 (3169), +3 specimens +, +Peru + +. + + +Additional material examined: + +ZMH +(Mus. Paris), +2 specimens +, +Amancaes +, +Lima +Peru +, + +15-vii-1903 + +; ZMB, +2 specimens +, +Peru +, + +1.xii.1913 + +, +F. Beunaer + +. + + + + + +Redescription of +syntypes +. + +Length: +50 mm +from anterior margin of cephalic plate to posterior margin of tergite 21. Antennae with 17 articles; first two basal glabrous. Cephalic plate smooth, without sutures and depression. Coxosternal tooth-plates wider than long, with 4+4 teeth, and with a long bristle; coxosternite with a short paired sutures at base of tooth-plates. Trochanteroprefemoral process large, with the margin with two short tubercles and with the tip pointed. Tergites smooth; tergites 4(5)–20 with complete paramedian sutures; tergites 9–21 margined. Sternites 6–18(19) with paramedian sutures [almost complete, from the anterior to ¾ of the sternite]; sternites with shallow median longitudinal depression in the center. Sternite 21 without sutures, but with a shallow rounded depression, and with posterior margin slightly concave. Coxopleuron without spines. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior part of coxopleuron truncate. Posterior part of coxopleuron without protuberance. Leg 1 with a prefemoral and femoral spur; legs 1(2)–6 with two tarsal spurs; legs 7–19 with one tarsal spur, and 20 and 21 without. In +one specimen +, leg 20 has one tarsal spur, but in other leg 20 without. Prefemur of ultimate legs without spines; ultimate legs long and slender. + + + + +Remarks. +The +syntypes +are labeled as “ + +Scolopendra +Otostigmus mutica + +”. The two additional specimens examined at the ZMB were labeled as + +O. amazonae + + +syn. nov. + + +Otostigmus muticus + +is one of the most widespread species in the Andes and other regions of South America and exhibits considerable morphological variation. Nevertheless, features of the tergites, sternites, and walking legs are common to + +O. amazonae + + +syn. nov. + +, + +O. calcanus + + +syn. nov. + +, + +O +. +volcanus + + +syn. nov. + +, and + +O. leior + +, with slight variations in some of them (see +Table 2 +). + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB2BFFBDFF41E5FCFB02FB23.xml b/data/1D/1A/87/1D1A87C2BB2BFFBDFF41E5FCFB02FB23.xml new file mode 100644 index 00000000000..ecb5ea57161 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB2BFFBDFF41E5FCFB02FB23.xml @@ -0,0 +1,370 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) mesethus +Chamberlin, 1957 + + + + + + + +Figs 31–40 + + + + +Type material examined: + +Lectotype +male (here designated) and +paralectotype +female +CAS 15216 +(12-164), +Ecuador +, +6-12 mi. +SW. +Baños, N. +slope Mt. +Tungurahua +, + +13.ii.1955 + +. + + + +Additional material examined: + + +Ecuador + +, +NMNH 31472 +, +2 males + +; + +FSCA +, +1 specimen +, +Limoncocha +, + +xi.1964 + +, PW. +Hermann + +; + +MCZ 02138 +, +1 male +and +5 females +, 10 +Km +N. +Alausi +, + +2700 m + +, + +22.xi.1965 + + +; + +NMNH 31472 +, +2 specimen +, +Prov. Tungunrahua +, +Rio Blanco +, + +15.ix.1937 + +, +Wm. Clarke + +. + + + + +FIGURES 31–32. + +Otostigmus + + +( +P +.) +mesethus +Chamberlin, 1957 + +. Lectotype CAS 15216 (12-164), male. +31. +General view dorsally. +32. +Allotype CAS 15216 (12-164), General views dorsal and ventral. + + + + + +Redescription of +lectotype +male. + +Length: +45 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Fig. 31 +). Antennae with 17 articles (left) and 13 (right); first two basal and basal part of third glabrous [not described]. Cephalic plate smooth, without sutures and depressions, but with median sulcus [very short] in anterior part (almost slightly concave) [not described] ( +Fig. 33 +). Coxosternal tooth-plates wider than long, with 4+4 teeth, and a long bristle [not described] ( +Fig. 34 +); coxosternite with a short paired sutures at base of tooth-plates, this suture is bifurcate in the sides and with a short median longitudinal suture [not described). Trochanteroprefemoral process large, with the margin with two or three short tubercles and its tip pointed [not described]. Tergites 6–20 with complete paramedian sutures; tergites 3–5 with very short incomplete paramedian sutures in the anterior and posterior margin; tergite 5–21 with a shallow median longitudinal keel; tergites 1–3 smooth; tergites 4–21 rugose, the rugosity increasing from anterior to posterior tergites; tergites 7–21 margined; posterior margin of tergite 21 very slightly angulate, with a shallow median longitudinal depression in posterior margin ( +Fig. 35 +); tergite 21 with a short median longitudinal keel. Sternites 4–17 with incomplete paramedian sutures in the anterior margin; sternites 4–19 with two small rounded depressions arranged horizontally in the center; sternite 20 slightly concave in the sides, but straight in the middle; lateral distal side of sternite 20 very short pronounced. Sternite 21 with posterior margin straight, shorter than precedent ( +Fig. 36 +), converging posteriorly, with a shallow median longitudinal depression. Coxopleuron without spines. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior part of coxopleuron truncate, with a very short protuberance. Leg 1 with one femoral and one tibial spur; legs 1–3 with two tarsal spurs; legs 4–19 with one tarsal spur, 20 and 21 without [legs 4 and 5 missed]. Coxae 19 with a very short protuberance; coxae 20 with a short appendix positioned posteriorly ( +Fig. 36 +). Prefemur of ultimate pair of legs without spines, with a digitiform appendix almost the same length as the prefemur ( +Fig. 35 +); digitiform appendix dorsoventrally flattened and with a tuft of hair at its dorsal tip. + + + +FIGURES 33–36. + +Otostigmus + + +( +P +.) +mesethus +Chamberlin, 1957 + +. Lectotype CAS 15216 (12-164), male. +33. +Cephalic plate and tergites 1 and 2, dorsally. +34. +Head, forcipular segment, and sternites 1 and 2, ventrally. +35. +Tergites 20 and 21, dorsally. +36. +Sternites 20 and 21, ventrally. + + + + +FIGURES 37–40. + +Otostigmus + + +( +P +.) +mesethus +Chamberlin, 1957 + +. Paralectotype CAS 15216 (12-164), female. +37. +Cephalic plate and tergites 1 and 2, dorsally. +38. +Head, forcipular segment, and sternites 1 and 2, ventrally. +39. +Tergites 20 and 21, dorsally. +40. +Sternites 20 and 21, ventrally. + + + + +Redescription of +paralectotype +female. + +Length: +44 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Fig. 32 +). Antennae with 17 articles (right) and 10 (left); first two basal and the basal part of third glabrous. Cephalic plate smooth, without sutures and depressions, but with median sulcus [very short)] in anterior part (almost slightly concave) ( +Fig. 37 +). Coxosternal tooth plates with the same length and width, with 4+4 teeth, and a long bristle ( +Fig. 38 +); coxosternite with a short paired sutures at base of tooth-plates, this suture is bifurcate in the sides and a short median longitudinal suture [not described]. Trochanteroprefemoral process large, with the margin with two or three short tubercles and its tip pointed. Tergites 6–20 with complete paramedian sutures; tergites 3–5 with very short incomplete paramedian sutures in the anterior and posterior margin; tergite 9– 21 with a shallow median longitudinal keel; tergites 1–12 smooth; tergites 12–21 quite rugose, rugosity increasing in the posterior tergites, but less than in +holotype +; tergites 9–21 margined; posterior margin of tergite 21 very slightly angulate, without a shallow median longitudinal depression in the posterior margin ( +Fig. 39 +); tergite 21 with a short median longitudinal keel. Sternites 11–17 with incomplete paramedian sutures in the anterior margin; sternites 4–17 with two small, rounded depressions arranged horizontally in the center; posterior margin of sternite 20 straight. Sternite 21 with posterior margin straight, shorter than precedent, converging posteriorly, with a shallow median longitudinal depression ( +Fig. 40 +). Coxopleuron without spines. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior part of coxopleuron truncate. Leg 1 with one tibial spur; legs 1–4 with two tarsal spurs; legs 5–19 with one tarsal spur, 20 and 21 without. Coxae 19 without an appendix; coxae 20 with a very short appendix positioned posteriorly ( +Fig 40 +), shorter than in +holotype +. + +Prefemur of ultimate pair of legs without spines and any kind of sexual dimorphism (appendix). + + + +Remarks. +The description of the types of + +O. mesethus + +is very brief compared to the description of some other + +Otostigmus +species + +described by +Chamberlin (1957) +. He merely stated that the species is closely related to + +O. lavanus + + +syn. nov. + +and that + +O. mesethus + +differed from this species by the presence of two tarsal spurs on legs 1–3, the posterior margin of sternite 21 being straight in the +holotype +, and the mesocaudal corner of coxae 20 being rounded instead of angular. He also mentioned that due to the lack of a series of specimens, it was difficult to determine some differences in certain characters that could be related to the age of the specimen. He did not specify which character he was referring to, but given the description, it appears that he was referring to the appendages of coxae 19 and 20, and the digitiform appendix on the prefemur of the ultimate legs. The appendages of coxae 19 and +20 in + +O. mesethus + +are much shorter than the appendages of coxae 19 and +20 in + +O. insignis + +, + +O. lavanus + + +syn. nov. + +, and + +O. silvestrii intermedius + +. However, the length of the digitiform appendix on the prefemur of the ultimate legs of + +O. mesethus + +is almost as long as that of + +O. silvestrii + +and slightly longer than that of + +O. parvior + + +syn. nov. + +The shorter appendages on coxae 20 present in + +O. mesethus + +, + +O. silvestrii + +, and + +O. parvior + + +syn. nov. + +could be a characteristic of females of these three species. However, the appendages of female + +O. mesethus + +are much shorter, and the prefemur of leg 21 does not have a digitiform appendix. Therefore, + +O. mesethus + +is considered a valid species. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB2DFFB9FF41E790FB6FFCBA.xml b/data/1D/1A/87/1D1A87C2BB2DFFB9FF41E790FB6FFCBA.xml new file mode 100644 index 00000000000..f527f3d7c38 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB2DFFB9FF41E790FB6FFCBA.xml @@ -0,0 +1,154 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) leior +Chamberlin, 1955 + + + + + + + +Figs 26–30 + + + + +FIGURES 26–27. + +Otostigmus + + +( +P +.) +leior +Chamberlin, 1955 + +. Syntype CAS 9187 (48-728). 26. General view dorsally. 27. General view ventral. + + + + +Type material examined: + +Syntypes +CAS 9187 +(48-728), +14 specimens +, +Peru +, +20 mi. +S. +Cuzco +, + +2.iii.1951 + +, +Ross +and +Michelbacher +col. + + + + + + +Redescription of +syntypes +: + +Length: +55-60 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Figs 26, 27 +). Antennae with 17 articles; first two basal and basal part of third glabrous. Cephalic plate smooth, without sutures and depressions, but with median sulcus [very short] in the anterior part [almost slightly concave] ( +Fig. 28 +). The sides are rounded. Coxosternal tooth-plates wider than long, with 4+4 teeth and a long bristle [not described]; coxosternite with a transversal suture at base of tooth-plates, this suture is bifurcate in the sides and a very short median longitudinal suture. Trochanteroprefemoral process large, with the margin with short denticles and with the tip pointed [not described] ( +Fig. 29 +). Tergites 6–19 with complete paramedian sutures [6–18]; sutures of tergite 20 not extending to posterior border but reaching to ¾ of tergite. Tergites 3–5 with very short incomplete paramedian sutures in the anterior and posterior margin [not described]; tergites 3–8 with very short incomplete oblique sutures in lateral sides; Tergites smooth; only tergite 21 margined [not described]; posterior margin of tergite 21 very slightly angulate [not described], with a shallow median longitudinal depression in posterior margin. Sternites 5–19 with incomplete paramedian sutures in the anterior border, reaching to middle of sternites [without sutures]; sutures from anterior and posterior sternites shorter than sternites of middle of the body; sternites 7–17 with two short incomplete sutures in posterior margin. Sternite 21 with posterior margin straight [caudal margin widely and but gently convex], shorter than precedent, converging posteriorly, trapezoidal; with a longitudinal depression (not described). Coxopleuron without spines. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior poreless part of coxopleuron with a shallow longitudinal depression as a sulcus. Posterior part of coxopleuron truncate [not described]. Leg 1 with one femoral and tibial spur; legs 1–2 with two tarsal spurs [1–4]; legs 3–19 with one tarsal spur, 20 and 21 without. Prefemur of ultimate pair of legs without spines and without sexual dimorphism. Prefemur and other parts of ultimate leg pair short [stouter], a little clavate distally. + + + + +Remarks. +Chamberlin (1955) +considered the specimens to be males, but this information could not be confirmed because this species does not appear to exhibit external dimorphism with some of the species reviewed here. He also mentioned that the specimens lack sutures on the sternites and have paired sutures on tergites 6–18. The specimens have incomplete paramedian sutures on the anterior margin of sternites 5 through 19 and complete paramedian sutures on tergites 6 through 19. The margin of the tergites and the distribution of the spurs of the walking legs in + +O. leior + +are the same as those seen in + +O. volcanus + + +syn. nov. + +and fit the variation of + +O. muticus + +. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB2FFFB8FF41E7BCFE52FCBA.xml b/data/1D/1A/87/1D1A87C2BB2FFFB8FF41E7BCFE52FCBA.xml new file mode 100644 index 00000000000..a36d922e394 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB2FFFB8FF41E7BCFE52FCBA.xml @@ -0,0 +1,221 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) lavanus +Chamberlin, 1957 + +syn. nov. + + + + + + +Figs 20–25 + + + + +Type material examined: + +Holotype +male +CAS 15215 +(12-169), +Ecuador +, +6-12 mi. +SW. +Baños, N. +slope Mt. +Tungurahua +, + +13.ii.1955 + +, +E.I Schlinger +& +E.S. Ross. + + + + + + +Redescription of +holotype +. + +Length: +52 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Figs 20, 21 +). Antennae damaged; antennae with 11 articles (left) and 12 (right); first two basal and basal part of third glabrous [17 articles]. Cephalic plate smooth, without sutures and depressions [not described] ( +Fig. 22 +). + + + +FIGURES 20–21. + +Otostigmus + + +( +P +.) +lavanus +Chamberlin, 1957 + + +syn. nov. + +Holotype CAS 15215 (12-169), male. +20. +General view dorsally. +21. +General view ventral. + + + + +FIGURES 22–25. + +Otostigmus + + +( +P +.) +lavanus +Chamberlin, 1957 + + +syn. nov. + +Holotype CAS 15215 (12-169), male. +22. +Cephalic plate and tergite 1, dorsally. +23. +Head, forcipular segment, and sternites 1 and 2, ventrally. +24. +Tergites 20 and 21, dorsally. +25. +Sternites 20 and 21, ventrally. + + + +Coxosternal tooth-plates wider than long, with 4+4 teeth and a long bristle ( +Fig. 23 +); coxosternite with a short paired sutures at base of tooth-plates, this suture is bifurcate in the sides and a short median longitudinal suture [without sutures]. Trochanteroprefemoral process large, with the margin with three short tubercles and with tip pointed [not described]. Tergites 6–20 with complete paramedian sutures; tergites 9–21 with a very shallow median longitudinal keel [last tergites]; tergites 1–4 smooth; tergites 5–21 rugose on lateral sides, the rugosity increasing from the anterior to posterior tergites; tergites 9–21 margined [only tergite 21]. Posterior margin of tergite 21 very slightly angulate, with a shallow median longitudinal depression in the posterior border ( +Fig. 24 +); tergite 21 with a shallow short median longitudinal keel. Sternites 4–19 a small rounded depression in the center. Sternite 21 with posterior margin concave [triangular], shorter than precedent, converging posteriorly, with a shallow median longitudinal depression [without median sulcus]. Coxopleuron without spines. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior part of coxopleuron with a very short, angulate protuberance. Leg 1 without femoral and tibial spur; left leg 1 with two tarsal spurs and right leg with one; legs 1(2)–19 with one tarsal spur, 20 and 21 without. Coxae 19 with a short protuberance as a very short appendix [coxa with a mesocaudal corner] ( +Fig. 25 +); coxae 20 with a larger appendix curved posteriorly [coxae of the twentieth legs with a conspicuous process, curved distally and extending a little beyond the last sternite]. This appendix exceeds sternite 21 ( +Fig. 25 +). Prefemur of ultimate legs without spines, with a digitiform appendix almost the same length as the prefemur; the digitiform appendix is dorsoventrally flattened and with a tuft of hair at its tip. This tuft of hair is localized dorsally. + + + + +Remarks. + +Otostigmus lavanus + + +syn. nov. + +presents a series of characters of tergites, legs and external sexual characters like + +O. insignis + +and + +O. silvestrii intermedius +. + +The most peculiar character shared with them is the shape and length of the appendix on the coxae of leg +20 in +males. Furthermore, + +O. lavanus + + +syn. nov. + +and + +O. insignis + +share the marginal tergites 6 to 21 and legs 1 to 19 with a tarsal spur. Therefore, + +O. lavanus + + +syn. nov. + +is considered a junior synonym of + +O. insignis + +. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB34FFA6FF41E1A4FB55F948.xml b/data/1D/1A/87/1D1A87C2BB34FFA6FF41E1A4FB55F948.xml new file mode 100644 index 00000000000..d7271a619c2 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB34FFA6FF41E1A4FB55F948.xml @@ -0,0 +1,215 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) volcanus +Chamberlin, 1955 + +syn. nov. + + + + + + +Figs 47–51 + + + + +Type material examined: + +Holotype +CAS 9188 +(597-7770), +Argentina +, +Jujuy +, +3 mi. +S. Volcan +Jujuy +, + +16.ii.1911 + +, Ross and Michelbacher, + +2000 m + +. + + + + + + +Redescription of +holotype +. + +Length: +40 mm +from anterior margin of cephalic plate to posterior margin of tergite 21( +Figs 47, 48 +). Antennae with 12 articles (right, damaged) and 13 (left, damaged) [17 articles]; first two basal and basal part of third glabrous. Cephalic plate smooth, without sutures and depressions, but with median sulcus [very short] in the anterior part (almost slightly concave) [not described] ( +Fig. 49 +). Coxosternal tooth-plates wider than long, with 4+2 teeth (left plate is damaged), and a long bristle, not fused, only in the middle; coxosternite with a short paired sutures at base ( +Fig. 50 +), this suture is bifurcate in the sides and a short median longitudinal suture. Trochanteroprefemoral process moderately large, with the margin with one short denticle and with the tip pointed [not described]. Tergites smooth. Tergites 6–19 with complete paramedian sutures [tergites 5–14]; tergites 2–5 with very short incomplete paramedian sutures [not described]; only tergite 21 margined; Posterior margin of tergite 21 very slightly angulate [convex] [with a shallow depression in posterior margin]. Sternites 3–19 with incomplete paramedian sutures [without sutures]; incomplete paramedian sutures from anterior and posterior sternites shorter than the sternites of middle body that almost reach ¾ of the sternite. Sternite 21 with posterior margin straight, slightly concave, shorter than precedent, trapezoidal, without depression ( +Fig. 51 +). Coxopleuron without spines, with posterior part truncate with a very short protuberance. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Right leg 1 without femoral and tibial spur, but left leg 1 with femoral and tibial spur; legs 1–5 with two tarsal spurs; legs 6–19 with one tarsal spur, 20 and 21 without. Prefemur of ultimate legs without spines. No sexual appendix, normal in shape. + + + + +FIGURES 47–48. + +Otostigmus + + +( +P +.) +volcanus +Chamberlin, 1955 + + +syn. nov. + +Holotype CAS 9188 (597-7770). +47. +General view dorsally. +48. +General view ventrally. + + + + +Remarks. +The +holotype +of + +O. volcanus + + +syn. nov. + +is closely related with + +O. leior + +. Both + +O. volcanus + + +syn. nov. +and + + +O. leior + +have only tergite 21 marginated, two tarsal spurs on walking legs 1–2 and a tarsal spur on legs 3–19. In addition, they share similar tergite characters such as complete paramedian sutures (tergites +6–20 in + +O. volcanus + + +syn. nov. + +and +6–19 in + +O. leior + +). Although + +O. volcanus + + +syn. nov. + +and + +O. leior + +are closely related to + +O. muticus + +because the size of the body, the absence of a rounded depression on the sternites and the posterior margin of sternite, + +O. volcanus + + +syn. nov. + +is closer to + +O. leior + +, therefore is considered a junior synonym of + +O. leior + +. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB35FFA0FF41E4F8FC49F8F2.xml b/data/1D/1A/87/1D1A87C2BB35FFA0FF41E4F8FC49F8F2.xml new file mode 100644 index 00000000000..6267faa06ad --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB35FFA0FF41E4F8FC49F8F2.xml @@ -0,0 +1,293 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) pococki +Kraepelin, 1903 + + + + + + + +Type material examined: + +Holotype +male +MNHN +, +Guyana +, +Ht. Carsevenne +, 1897, +F. Gray. + + + +Additional material examined: + +NMNH 30456 +, +2 males +and +1 female +, +Panamá +, +San Jose Island +, + +23.viii.1944 + + +, JPE Morrinson; + +MNHN +, +1 specimen +, +French +Guyana +, Isla +de la Méres +, + +25.v.1977 + + +; + +NMNH 31475 +, +1 specimen +, +Guyana +, +Kartabo +, +Bartica District +, 1922 + +; + +NMNH 31475 +, +3 specimens +, +Guyana +, +Kartabo +, +Bartica District +, + +4.vi- 31.vii.1924 + + +, SC Crawford; + +MNHN 2205 +, +5 specimens +, +Venezuela +, +Mérida +, + +1630 m + +, +Rosemberg + +; + +NMNH 31482 +, +1 specimen +, +Colombia +, +Chocó +, +San Juan River +, 1965-1968, +Marte Lathan + +; + +NMNH 31482 +, +1 male +, +Colombia +, +Chocó +, +Andogoya +, + +19.v.1957 + + +, + +Marte Lathan +; AMHN, +1 female +, +Peru +, +Dept. +Loreto +, +Parinari +, Canyon +Rio Samiria +, + +xii.1912 + + +, B. Peyer; + +FSCA +, +1 female +, +Peru +, +Cuzco +, +Machu Pichu +, + +28.i.1965 + + +, + +Gene +H. +Lowery + +; + +NMNH 31468 +, +1 specimen +, +Peru +, +Dept. +Huanuco +, +Divisória +, + +23.ix-30.x.1946 + + +, F. Woytkowski. + + + + + +Redescription of +holotype +. + +Length: +70 mm +from anterior margin of cephalic plate to posterior margin of tergite 21. Antennae with 17 articles, first two basal and basal part of third glabrous. Cephalic plate without sutures and depressions [not described] but punctate. Coxosternal tooth-plates wider than long, with 4+4 teeth [4 or 5]. Tergite 1 smooth, the remain tergites rugous; roughness in the tergites gradual, increasing towards posterior portion of trunk; tergites 5–20 with complete paramedian sutures [not described]; tergites 12–20 with paramedian keels [tergites 11–20 have strong, fine-grained, rough, sharpened longitudinal keels]; tergites 13–20 with median longitudinal keel (from tergite 5); tergite 21 with three short incomplete keels; tergites 5–21 margined (tergite 5 furrowed and edged); tergite 21 straight or truncate. Sternites smooth, without sutures, but with depressions; a larger rounded depression in the center with three small weak rounded depressions arranged transversally at posterior margin [sternites of anterior segments with 3 elongated pits in front and 3 round dimples in front of posterior margin; the front pits flow together on the rear segments]. Sternite 21 longer than wider, with posterior margin slightly concave [with a shallow median sulcus]. Coxopleuron without spines; pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior part of the coxopleuron with a slight protuberance. Legs 1–19 with one tarsal spur [leg 1 with two tarsal spurs]; legs 20 and 21 without; prefemur of ultimate legs without spines; prefemur of ultimate legs in male with a digitiform appendix exceeding half length of prefemur [prefemur of ultimate legs in male with a slender appendix half the length of the prefemur]; tip of its appendix dilated and without tuft of hairs [a barely visible patch of yellow hair at the bulbous end]. + + + + +Remarks. +This species is widespread in the Andes and other parts of South America. + +Otostigmus pocoki + +is easily distinguished from other + +Otostigmus +species + +by its body size, the roughness of the tergites, and the depressions in the sternites. In addition, males of this species have a digitiform appendix on the prefemur of the ultimate legs. This appendage has a tuft of hair at its tip. However, +Chagas-Jr (2012) +noted that the tuft of hair at the tip of the digitiform appendix is absent in the +type +of + +O. pococki + +. Further examination of the +type +material showed that the digitiform appendage of the prefemur of the ultimate legs lacks the tuft of hair. +Kraepelin (1903) +mentions the presence of the tuft. The additional material examined here shows that the tuft of hair is present in the digitiform appendix of ultimate legs of male specimens identified as + +O. pococki + +. The absence of the tuft of hair on the digitiform appendage of the prefemur of the ultimate legs may have been due to handling wear on the specimen during its preservation, since the appendix itself was deformed in the position of the tuft of hair. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB35FFA1FF41E258FC9CFA6E.xml b/data/1D/1A/87/1D1A87C2BB35FFA1FF41E258FC9CFA6E.xml new file mode 100644 index 00000000000..a4825b206fd --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB35FFA1FF41E258FC9CFA6E.xml @@ -0,0 +1,246 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) silvestrii +Kraepelin, 1903 + + + + + + + +Type material examined: + +Syntypes +ZMH +, +1 male +and +1 female +, +Ecuador +, +Pifo, F. + +15.vii.1903 + +, +F. Silvestri + +. + + +Additional material examined: + +ZMUC +, +1 specimen +, +Ecuador +, Prov. +Imbabura +, 1 +Km W. Otavalo +, + +2600 m + +, + +17.vii.1990 + +, +Jonas Krat + +; + +ZMUC +, +1 specimen +, +Quito +, + +21.1.1920 + +, +H. Vorleck + +; + +ZMUC +, +6 specimens +( +3 males +and 3 + + + +females), Quito, H. Vorleck, +9.ix.1912 +; + +ZMUC +, +1 female +, +Quito +, + +15.1.1926 + + +, H. Vorleck; + +ZMUC +, +Ecuador +, +1 female +, H. +Vorleck + +; + +ZMUC +, +2 specimens +( +1 male +and +1 female +), +Quito +, + +27.vi.1913 + + +, Bangast. + + + + + +Redescription of +syntypes +. + +Length: +50 mm +from anterior margin of cephalic plate to posterior margin of tergite 21. Antennae with 17 articles, first two and 1/3 of the dorsal face of third glabrous. Cephalic plate without sutures and depressions. Coxosternal tooth-plates with 4+4 teeth; coxosternite with a short paired sutures at base of tooth-plates [not described]. Tergites 6–20 with complete paramedian sutures [7 or 8 tergites]; tergites 9(10)– 21 margined [only tergite 21]; tergites 6–20 with [slight] median longitudinal keel [last three tergites]; tergite 21 with a slight short median longitudinal keel and a shallow rounded depression in posterior margin. Sternites smooth, without sutures, but with depressions; a larger rounded depression in the center and three small, rounded depressions arranged at posterior margin as an inverted triangle [with 3 anterior longitudinal pits and 3 rounded pits in front of the rear margin]. Sternite 21 shorter than precedent, with a shallow median longitudinal depression [not described]; sternite 21 with posterior margin slightly concave [posterior margin truncated and rounded or indented]. Coxopleuron without spines, short and truncate. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Legs 1–19 with one tarsal spur, 20 and 21 without. Coxae +19 in +males and females with a shorter appendix [not described]; coxae +20 in +male with a curved appendix posteriorly, but that not overlying sternite 21; coxae +20 in +female with a shorter appendix. Prefemur of ultimate legs in male with a digitiform appendix ¾ length of prefemur; digitiform appendix slightly flattened dorsally and with a tuft of blond hairs in its dorsal tips; females without digitiform appendix. + + + + +Remarks. +In males, there is a claviform [digitiform] appendix on the prefemur of the ultimate legs. This appendix is absent in females. In addition, there is a larger appendix on the coxa of the 20th leg in males. In females this appendix is very short. In addition, males have a short appendix on the coxa of leg 19. + +Otostigmus silvestrii + +bears a strong resemblance to + +O. insignis + +, + +O. lavanus + +and + +O. silvestrii intermedius + +, including tergites, sternites and leg characters, as well as external sexual characters. However, it differs mainly in the shape and size [length] of the appendix on coxae 20. In + +O. silvestrii + +, the appendix is shorter and does not extend beyond sternite 21, and it lacks a hook shape. Conversely, in + +O. insignis + +, + +O. lavanus + +, and + +O. silvestrii intermedius + +, the appendix on coxae 20 is larger, exceeds sternite 21, and has a hook shape. The differences in shape and size of the digitiform appendage in + +O. silvestrii + +compared to other taxa mentioned above may be ontogenetic, but the +type +specimen appears to resemble an adult. Therefore, + +O. silvestrii + +is maintained as a valid species. + + + + \ No newline at end of file diff --git a/data/1D/1A/87/1D1A87C2BB37FFA0FF41E4F8FBD8FF52.xml b/data/1D/1A/87/1D1A87C2BB37FFA0FF41E4F8FBD8FF52.xml new file mode 100644 index 00000000000..504291af0a1 --- /dev/null +++ b/data/1D/1A/87/1D1A87C2BB37FFA0FF41E4F8FBD8FF52.xml @@ -0,0 +1,227 @@ + + + +A review of the types of some Otostigmus (Parotostigmus) (Scolopendromorpha, Scolopendridae, Otostigminae) of the Andes mountain range + + + +Author + +Chagas-Jr, Amazonas +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. + + + +Author + +Souza, Emerson Marques +0000-0002-4365-1669 +Laboratório de Sistemática e Taxonomia de Artrópodes Terrestres, Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso. Avenida Fernando Correa da Costa, 2367, Boa Esperança, CEP- 78060 - 900, Cuiabá, MT, Brasil. +emersonesem@gmail.com + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +436 +460 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.2 + +journal article +10.11646/zootaxa.5529.3.2 +1175-5326 +14022691 +FB3782DE-B583-45AC-BA3C-9418E2C50C0B + + + + + + + +Otostigmus (Parotostigmus) parvior +Chamberlin, 1957 + +syn. nov. + + + + + + +Figs 41–46 + + + + +Type material examined: + +Holotype +(male), +CAS 16670 +(48-733), +Ecuador +, +14 mi. +NE. +Ambato +, +Tungurahua +, + +8.11.1955 + +, +E.I. Schilinger +& +E.S. Ross. + + + + + + +Redescription of +holotype +. + +Length: +40 mm +from anterior margin of cephalic plate to posterior margin of tergite 21 ( +Figs 41, 42 +). Antennae with 17 articles (left) and 16 (right); first two basal and basal part of third glabrous. Cephalic plate smooth, without sutures and depressions, but with median sulcus [very short] in anterior part [almost slightly concave] ( +Fig. 43 +). Coxosternal tooth-plates wider than long, with 4+4 teeth, and a long bristle on each plate; coxosternite with a short paired sutures at base of tooth-plates, this suture is bifurcate in the sides and a short median longitudinal suture ( +Fig. 44 +). Trochanteroprefemoral process large, with the margin with one or two short tubercles and with the tip pointed. Tergites 6–20 with complete paramedian sutures; tergites 2–5 with very short incomplete paramedian sutures in the anterior and posterior margin; tergites 7–21 with a shallow median longitudinal keel; tergites 1–5 smooth; tergites 6-21 rugose, rugosity increasing from the anterior to posterior tergites; tergites 8-21 margined. Tergite 21 with posterior margin very slightly angulate, and with a shallow median longitudinal depression; tergite 21 with a shallow short median longitudinal keel ( +Fig. 45 +). Sternites 9–17 with incomplete paramedian sutures in anterior margin; sternites 4–19 with two small, rounded depressions arranged horizontally in the center; sternite 20 slightly concave. Sternite 21 with posterior margin straight, shorter than precedent, converging posteriorly ( +Fig. 46 +), with a shallow median longitudinal depression. Coxopleuron without spines. Pore-field covers almost entire coxopleuron, only the posterior end poreless. Posterior part of coxopleuron truncate, with a very short protuberance. Leg 1 with tibial spur; legs 1–5 with two tarsal spurs (in right legs 1–4); legs 6–19 with one tarsal spur, 20 and 21 without. Coxae 19 with a tiny protuberance; coxae 20 with a short appendix positioned posteriorly ( +Fig. 46 +). Prefemur of ultimate leg pair without spines, with a digitiform appendix somewhat exceeding half length of prefemur; digitiform appendix dorsoventrally flattened, with a tuft of hair at its dorsal tip. + + + + +FIGURES 41–42. + +Otostigmus + + +( +P +.) +parvior +Chamberlin, 1957 + + +syn. nov. + +Holotype CAS 16670 (48-733), male. 41. General view dorsally. 42. General views dorsal and ventral. + + + + +FIGURES 43–46. + +Otostigmus + + +( +P +.) +parvior +Chamberlin, 1957 + + +syn. nov. + +Holotype CAS 16670 (48-733), male. 43. Cephalic plate and tergites 1 and 2, dorsally. 44. Head, forcipular segment, and sternites 1-3, ventrally. 45. Tergites 20 and 21, dorsally. 46. Sternites 20 and 21, ventrally. + + + + +Remarks. +The +holotype +of + +O. parvior + + +syn. nov. + +was poorly described, like + +O. mesethus + +. However, examination of + +O. parvior + + +syn. nov. + +and comparison with + +O. mesethus + +suggests that the two species are very closely related. The main difference between the two species is the appendix of coxa 19, which is absent in + +O. parvior + + +syn. nov. + +and very short in + +O. mesethus + +. Nevertheless, we consider + +O. parvior + + +syn. nov. + +to be synonymous with + +O. mesethus + +. Next to the +holotype +, inside the vial, there is a label with the following statement “prob. not +holotype +rec. to CAS, +viii.1994 +”. However, by examining the characters of the specimen available with the original description, it is possible to affirm that it is the +holotype +(male) described by +Chamberlin (1957) +. Therefore, there is no doubt that the specimen redescribed above is the +holotype +designated by +Chamberlin (1957) +. + + + + \ No newline at end of file diff --git a/data/22/2E/87/222E87ABB572C44957C0B422880DFA66.xml b/data/22/2E/87/222E87ABB572C44957C0B422880DFA66.xml index 6fedb1d45c5..040bd862a9d 100644 --- a/data/22/2E/87/222E87ABB572C44957C0B422880DFA66.xml +++ b/data/22/2E/87/222E87ABB572C44957C0B422880DFA66.xml @@ -1,74 +1,74 @@ - - - -A twin of Polydora hoplura (Annelida: Spionidae) from the Arabian (Persian) Gulf, with review of primers used for barcoding of Spionidae + + + +A twin of Polydora hoplura (Annelida: Spionidae) from the Arabian (Persian) Gulf, with review of primers used for barcoding of Spionidae - - -Author + + +Author -Radashevsky, Vasily I. -0000-0003-1578-4904 -A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia -radashevsky@mail.ru +Radashevsky, Vasily I. +0000-0003-1578-4904 +A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia +radashevsky@mail.ru - - -Author + + +Author -Al-Kandari, Manal -0000-0003-0073-7929 -Kuwait Institute for Scientific Research, 22107, Salmiya, Kuwait -mkandari@kisr.edu.kw +Al-Kandari, Manal +0000-0003-0073-7929 +Kuwait Institute for Scientific Research, 22107, Salmiya, Kuwait +mkandari@kisr.edu.kw - - -Author + + +Author -Malyar, Vasily V. -0000-0003-3695-1783 -A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia -thebotkininc@gmail.com +Malyar, Vasily V. +0000-0003-3695-1783 +A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia +thebotkininc@gmail.com - - -Author + + +Author -Pankova, Victoria V. -0000-0003-4692-5079 -A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia & A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia & A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia -pankova.victoria@gmail.com +Pankova, Victoria V. +0000-0003-4692-5079 +A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia & A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia & A. V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky Street, Vladivostok 690041, Russia +pankova.victoria@gmail.com -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -245 -268 + +245 +268 - -http://dx.doi.org/10.11646/zootaxa.5529.2.2 + +http://dx.doi.org/10.11646/zootaxa.5529.2.2 -journal article -10.11646/zootaxa.5529.2.2 -1175-5326 -14022326 -CC6CCB19-15AE-4EB3-94B4-6D59DBB23E8E +journal article +10.11646/zootaxa.5529.2.2 +1175-5326 +14022326 +CC6CCB19-15AE-4EB3-94B4-6D59DBB23E8E @@ -92,7 +92,7 @@ urn:lsid:zoobank.org:act: -Figures 4–9 +Figures 4–9 @@ -315,7 +315,7 @@ wide for 140 chaetigers; holotype 26 mm long, 1.0 mm wide at chaetiger 7 for 132 chaetigers. Body pale to light tan in life; with numerous glandular cells on dorsal side from chaetigers 10–12 onwards giving dorsum whitish appearance in life ( -Fig. 4A +Fig. 4A ). A pair of rounded whitish spots (gatherings of glandular cells) present on ventral side of chaetiger 7. Up to 11 paired black bands ( 10 in holotype @@ -324,7 +324,7 @@ long, 1.0 mm wide at chaetiger 7 for 132 chaetigers. Body pale to light tan in l ); smaller worms without pigment on palps. Small spots of ochre pigment scattered on dorsal side of chaetigers 4 and 5 in individuals of all sizes in life ( -Figs 4B +Figs 4B , 6A ); a few spots present also on chaetigers 3 and @@ -344,7 +344,7 @@ Prostomium anteriorly rounded to blunt, with frontal margin entire to weakly inc Fig. 6C ). - + FIGURE 4. Adult morphology and reproduction of @@ -363,7 +363,7 @@ from the Arabian Gulf, Kuwait (in life). A, complete individual, dorsal view, sh Chaetiger 1 with short capillaries in neuropodia and small postchaetal lamellae in both rami; notochaetae absent. Notopodia of 7–20 posterior chaetigers with two kinds of heavy spines in addition to 2–6 slender capillaries. Those comprising slender, slightly curved awl-like spines, and larger, heavily recurved sickle-shaped spines ( -Figs 4C +Figs 4C , 6D, F–H ). Awl-like spines usually present in notopodia (from chaetiger @@ -381,7 +381,7 @@ Chaetiger 1 with short capillaries in neuropodia and small postchaetal lamellae Chaetiger 5 twice as large as chaetiger 4 or 6, dorsally overlapping chaetiger 6, with up to five dorsal superior winged geniculate capillaries, seven heavy falcate spines arranged in a slightly curved diagonal row and alternating with pennoned companion chaetae, and seven ventral winged capillaries ( -Figs 4B +Figs 4B , 5E–G , @@ -401,7 +401,7 @@ Hooded hooks in neuropodia from chaetiger 7, up to ten in a series, not accompan Branchiae from chaetiger 7 through most of body ( -Figs 4A +Figs 4A , 5C , @@ -411,7 +411,7 @@ Branchiae from chaetiger 7 through most of body ( Nototrochs from chaetiger 7 onwards, each composed of one row of short cilia in both sexes, on branchiate chaetigers extending onto branchiae. Pygidium cup-shaped to disc-like with dorsal gap to incision, white due to numerous fusiform glandular cells with striated content ( -Figs 4A, C +Figs 4A, C , 6D , @@ -608,7 +608,7 @@ Spermatogonia proliferate in testes; spermatogenesis occurs in the coelomic cavi Oogenesis is intraovarian. Developed oocytes accumulate in the coelomic cavity prior to spawning ( Fig. 9C ). Females lay eggs into thin transparent capsules joined to each other in a string and each attached by two thin stalks to the inner wall of the burrow ( -Figs 4D, E +Figs 4D, E , 9E ). Large females deposit up to diff --git a/data/2B/04/87/2B0487A23175FFE1FF1422F2FDCDFD50.xml b/data/2B/04/87/2B0487A23175FFE1FF1422F2FDCDFD50.xml new file mode 100644 index 00000000000..4423e112d53 --- /dev/null +++ b/data/2B/04/87/2B0487A23175FFE1FF1422F2FDCDFD50.xml @@ -0,0 +1,93 @@ + + + +On some Calcaronea (Porifera: Calcarea) from the Barents Sea and adjacent Polar Basin + + + +Author + +Morozov, Grigori +Zoological Institute of Russian Academy of Sciences, Saint-Petersburg, Russia & Kazan Federal University, Kazan, Russia + + + +Author + +Strelkova, Natalia +Polar branch of VNIRO (« PINRO » named after N. M. Knipovich), Murmansk, Russia + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +532 +550 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.6 + +journal article +10.11646/zootaxa.5529.3.6 +1175-5326 +14022853 +13B0E278-C561-48CB-8125-73DDF1F5986D + + + + + + +Genus + +Grantia +Fleming, 1828 + + + + + + + + +Type +species: + + +Spongia compressa +Fabricius, 1780 + +(by original designation). + + + + +Diagnosis: +“ +Grantiidae +with a syconoid organization. The cortex is composed of tangential triactines and/ or tetractines, occasionally with small perpendicular diactines. Longitudinal diactines, if present, are not found exclusively in the cortex, but cross obliquely, at least a part of the choanosome and protrude from the external surface” ( + +Borojević +et al. +2000 + +). + + + + \ No newline at end of file diff --git a/data/2B/04/87/2B0487A2317EFFEFFF1423BFFBCBFE30.xml b/data/2B/04/87/2B0487A2317EFFEFFF1423BFFBCBFE30.xml new file mode 100644 index 00000000000..1b9a9a614a4 --- /dev/null +++ b/data/2B/04/87/2B0487A2317EFFEFFF1423BFFBCBFE30.xml @@ -0,0 +1,391 @@ + + + +On some Calcaronea (Porifera: Calcarea) from the Barents Sea and adjacent Polar Basin + + + +Author + +Morozov, Grigori +Zoological Institute of Russian Academy of Sciences, Saint-Petersburg, Russia & Kazan Federal University, Kazan, Russia + + + +Author + +Strelkova, Natalia +Polar branch of VNIRO (« PINRO » named after N. M. Knipovich), Murmansk, Russia + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +532 +550 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.6 + +journal article +10.11646/zootaxa.5529.3.6 +1175-5326 +14022853 +13B0E278-C561-48CB-8125-73DDF1F5986D + + + + + + + +Sycandra rappi +Morozov + +sp. nov. + + + + + + +Etymology: +The species is named in honour of Dr Hans Tore Rapp (1972–2020), whose deep revision of the Arctic calcareous sponges made this work possible. + + + + +Material examined: + +Holotype +. Barents Sea, +PINRO +trawl survey 2003, st. 46 ( +68.9721N +, +37.9826E +), + +167 m + +, temperature 7 °C, salinity 34.02 psu, +1 specimen +, KFU-LH-2/022. + + + + +Paratype +. Barents Sea, +PINRO +trawl survey 2003, st. 47 ( +69.4883N +, +37.9818E +), + +141 m + +, temperature 1.98 °C, salinity 34.529 psu, +1 specimen +, KFU-LH-2/043 + +. + + + + +Description: +Morphology and anatomy +. Sponge tubular, slightly compressed laterally, +1.5 to 5 cm +height, gradually tapers toward the base, which embraces the substrate (e.g., bivalve shell). Colour dark brown in alcohol. External surface velvety, slightly hispid. Texture soft and delicate. Single naked apical osculum. Aquiferous system syconoid. Choanocyte chambers fused in their entire length. Distal cones are somewhat visible. + + +Skeleton +( +Fig 2 +). In the atrial cavity there is an additional tissue network, supported by bundles of small atrial diactines. This network can branch extensively, often with some foreign particles incorporated. + + + +FIGURE 2. + +Sycandra rappi +Morozov + + +sp. nov. + +Schematic diagram of skeleton organization. Abbreviations: ab = bundle of small atrial diactines, supported by apical actine of the tetractine at the base; as = atrial skeleton; ss = subatrial skeleton; ts = tubar skeleton; dc = skeleton of distal cones. + + +Atrial skeleton comprises tetractines with their basal actines lying tangentially and the apical actine projecting into the atrial lumen. The apical actine usually supports the bundles of atrial diactines at their base. +Subatrial skeleton composed of triactines arranged in several rows with their paired actines supporting the atrial skeleton, and the unpaired actine pointing towards the distal cones. +Tubar skeleton composed of parasagittal triactines. These spicules are also present at the distal ends of the choanocyte chambers, with unpaired actines forming the base of the distal cones. +Distal cones decorated with long diactines and trichoxeas protruding slightly through the external surface. Large diactines also cross obliquely the choanosome. +There is no well-defined cortex. + +Spicules +. Atrial diactines sinuous, one tip fusiform and the other lanceolated. Small spines present near the lanceolated tip ( +Figs 3B–B + +1 + +). Size: 121–244–350 × 3–4.5–6.3 µm (n = 30). + + +Distal cone diactines straight, with sharp tips ( +Fig 3C +). Size: 248–430–1265 × 7.5–10.5–15 µm (n = 20), maybe larger, often broken during preparation. + + +Trichoxeas ( +Fig 3D +), 250–350 × 1 µm, often broken. + + +Subatrial triactines sagittal, with straight basal actines and ~ 180° angle between the paired actines ( +Fig 3E +). Size: paired—68–100–141 × 6–7.2–8.7 µm (n = 35); unpaired—92–150–180.8 × 6.7–8.2–10.2 µm (n = 35). + + +Tubar triactines parasagittal, with slightly bent paired actines and straight unpaired actine ( +Fig 3F +). Size: paired—62.6–122–191 × 5–7–9 µm (n = 50); unpaired—113–184–338 × 4.3–8–10 µm (n = 50). + + + +FIGURE 3. + +Sycandra rappi +Morozov + + +sp. nov. +A. + +Holotype specimen KFU-LH-2/022, habitus. + +B–B +1 +. + +Atrial diactines. +C. +Distal cone diactines. +D. +Trichoxea. +E. +Subatrial triactine. +F. +Tubar triactine. + +G–G +1 +. + +Atrial tetractines. + +G +2 +. + +Apical actine of the tetractine. Abbreviations: p = paired actine; u = unpaired actine; a = apical actine. + + + +Atrial tetractines sagittal, with straight basal actines ( +Figs 3G–G + +2 + +). The apical actine is slightly sinuous and much thicker than the basal ones. Size: paired—116–156–185 × 6.5–8.3–10 (n = 10) µm; unpaired—207–268–306 × 7–8.3–9.4 (n = 10) µm; apical—180–236–286 × 7.8–11–16 µm (n = 10). + + + + +Remarks: +The genus + +Sycandra +Haeckel, 1872 + +is sufficiently sharply distinguished from the other Grantiid sponges by a complex network of tissue tracts in the atrial cavity, supported by bundles of diactines. However, the present placement of genus in the family +Grantiidae +is arguable, since there is no true cortex in + +Sycandra + +. In the examined specimens we found relatively well-defined distal cones decorated with tufts of long diactines. The same feature was mentioned for Greenlandic specimens of + +Sycandra utriculus +( +Schmidt, 1869 +) + +by +Lundbeck (1909) +and it is also quite obvious from description of + +S. utriculus + +given by +Rapp (2015) +. Distal cones decorated with long diactines and the absence of a cortex makes + +S. utriculus + +very closely related to representatives of the family +Syconidae Poléjaeff, 1883 +. However, according to a recent molecular phylogenetic study (Alvizu +et al. +2018) the latter is polyphyletic. Members of the family +Syconidae +, + +Sycetta +Haeckel, 1872 + +and + +Sycon +Risso, 1827 + +, were distributed amongst several distant clades in the phylogenetic tree built with the C-region of the 28S rRNA. On account of these facts it is not currently possible to relocate the genus + +Sycandra + +into the family +Syconidae +. + + + +Sycandra + +is a monotypic genus with + +Sycandra utriculus + +recorded for the Northern Hemisphere. + +Sycandra utriculus + +was originally described as + +Ute utriculus + +by +Schmidt (1869) +from the coasts of +Greenland +. Recently, +Rapp (2015) +re-described + +S. utriculus + +. In his material, there was a specimen previously identified as + +Ute utriculus + +by Schmidt, which led him to conclude that it was likely the +type +material of + +S. utriculus +( +Rapp 2015 +) + +. Thus, the description given by +Rapp (2015) +can be considered the description of + + +S. utriculus +sensu + +stricto + +. + + + +FIGURE 4. +Distribution of + +Sycandra +spp. + +in the North Atlantic and Arctic. Data from +Haeckel (1872) +is indicated by question marks since he did not specify exact sampling locations. + + + +According to the size of the spicules, the apical actine of the tetractines is on average only 156 by 6.1 µm in + +S. utriculus + +, almost twice as thin (and shorter) as in + +S +. +rappi + + +sp. nov. + +However, dimensions of spicules in calcareous sponges seem to be subjected to considerable intraspecific variation (see description of + +S. utriculus + +below). On the other hand, there is an additional kind of spicule in + +S. utriculus + +, a small sickle-shaped diactine found in the distal cones, which is absent in the new species. + + +Our specimens of + +Sycandra rappi + + +sp. nov. + +were found on several occasions in the southern Barents Sea, north off the Kola Peninsula. Apparently, + +S. rappi + + +sp. nov. + +and + +S. utriculus + +are sympatric, with partially overlapping geographical ranges ( +Fig 4 +). Thus, careful examination of spicules is required. + + + + \ No newline at end of file diff --git a/data/2B/04/87/2B0487A2317FFFEBFF14247EFE39F867.xml b/data/2B/04/87/2B0487A2317FFFEBFF14247EFE39F867.xml new file mode 100644 index 00000000000..4bfcf7c5e79 --- /dev/null +++ b/data/2B/04/87/2B0487A2317FFFEBFF14247EFE39F867.xml @@ -0,0 +1,89 @@ + + + +On some Calcaronea (Porifera: Calcarea) from the Barents Sea and adjacent Polar Basin + + + +Author + +Morozov, Grigori +Zoological Institute of Russian Academy of Sciences, Saint-Petersburg, Russia & Kazan Federal University, Kazan, Russia + + + +Author + +Strelkova, Natalia +Polar branch of VNIRO (« PINRO » named after N. M. Knipovich), Murmansk, Russia + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +532 +550 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.6 + +journal article +10.11646/zootaxa.5529.3.6 +1175-5326 +14022853 +13B0E278-C561-48CB-8125-73DDF1F5986D + + + + + + +Genus + +Sycandra +Haeckel, 1872 + + + + + + + + +Type +species: + + +Ute utriculus + +: +Schmidt, 1869 +(subsequent designation by +Dendy & Row 1913 +). + + + + +Diagnosis: +Grantiidae +with a large flattened body; the atrial cavity with a complex network of tissue tracts, supported by parallel diactines. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F0DA70B95FE552B1374FE2F.xml b/data/57/2E/87/572E87900F0DA70B95FE552B1374FE2F.xml new file mode 100644 index 00000000000..805b1846c42 --- /dev/null +++ b/data/57/2E/87/572E87900F0DA70B95FE552B1374FE2F.xml @@ -0,0 +1,252 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus wahli +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Figs. 6 +, +14 +, +20 +) + + +Diagnostic description +. +Female +. Fore wing length +5.5–5.6 mm +( +holotype +5.4 mm +). Malar space 1.0–1.1 × basal mandibular width; antenna with 24–25 flagellomeres, all except first and last segment transverse (wider than long). Genitalia: setae on ovipositor sheaths extending basally for a distance equal to or less than 0.3x the total length, setae constrained to ventral edge, sparse, setae thin and elongated; lower-anterior extension of quadrate plate elongated and thin, somewhat lobate at tip, setae on ventral edge of quadrate plate thin, normally large. +Coloration +. Scape yellow and brown; pedicel dark brown; flagellum dark brown to black. Tegula entirely yellow. Metasoma with metallic blue iridescence. Trochanters mostly light brown, front femur with basal 2/3 black and apical 1/3 yellow, mid femur similar but only extreme apex yellow, hind femur all black; front tibia yellow, mid and hind tibiae with basal half yellow and apical half black; fore tarsus pale yellow with last 3 segments more orangish, mid tarsus pale yellow with last 3 segments light brown, hind tarsus with first 2–3 segments mostly pale with dark apicies, last 2–3 segments all dark. + + +Male +. Similar to female in size and color; scape often entirely yellow. Antenna with 26–30 flagellomeres. Genitalia: digitus completely lobate at base; volsella medial area deep, volsella tip (in lateral view) mainly rounded but somewhat flat; phallus apex slender, phallus constriction elongate; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat thin, straight looking; distal third of gonoforceps normally setose, setae somewhat sparse. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0014018. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 04-SRNP-45922. Database information: Costa Rica, ACG, +Guanacaste Prov. +, Sector Cacao, Estación Gongora, +10.88700 +, +-85.47443 +, +570m +(Mariano Pereira), caterpillar feeding on + +Paspalum nutans + +( +Poaceae +) coll. +14.vi.2004 +wasp eclosed +23.vi.2004 +. + +Paratypes +. + +10 ♀ +, +2 ♂ +, ( +EMUS +, +MNCR +, +MZUCR +, +USNM +). +COSTA RICA +, ACG database codes: 10-SRNP-30927: DHJPAR0039538 ( +♂ +); 10-SRNP-31119: DHJPAR0039542 ( +♀ +); 10-SRNP-31091: DHJPAR0039543 ( +♀ +); 04-SRNP-45845: DHJPAR0028066 ( +♀ +); 04-SRNP-45874:DHJPAR0028067 ( +♀ +); 04-SRNP-45919:DHJPAR0029447 ( +♀ +); 04-SRNP-45894: DHJPAR0028068 ( +♀ +); 04-SRNP-45876:DHJPAR0014019 ( +♀ +); 10- SRNP-41191: DHJPAR0039547 ( +♀ +); 04-SRNP-45899: DHJPAR0028070 ( +♀ +); 04-SRNP-45895: DHJPAR0028069 ( +♂ +); 09-SRNP-5377: DHJPAR0038423 ( +♀ +); 12-SRNP-55938: DHJPAR0050005 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0014018 (660 bp): + +ATTTTATACTTCATTTTTGGAATTTGAGCAGGAATAATTGGTGCTTCACTTAGTATTATTATCCGT ATAGAATTAGGAACCCCCAGTTCCTTAATTAATAATGATCAAATTTATAATTCTATTGTCACTATACATGCCTTT ATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTATTCCTTTAATATTAGG AGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTCTGATTGTTACCCCCATCCTTATTTTTATTAA TTTCTGGTAGAATATTAAATCAAGGTGCAGGTACTGGTTGAACAGTTTACCCTCCTTTATCTTCTAATACAAATC ATGAAGGATTATCAGTTGATTTAAGAATTTTCTCTCTTCATTTAGCTGGTATATCTTCAATTATAGGTGCAATT AATTTTATTACAACAATTTTAAATATAAAAATTAAATTATTAACTTTAGATCAACTTTCATTATTTATTTGATCC ATTAAAATTACTACTATTTTACTTTTACTAGCAGTCCCTGTTTTAGCAGGAGCAATTACCATATTATTAACTG ACCGTAACTTAAATACCTCTTTTTTTGACCCTAGAGGAGGAGGGGATCCAATTTTATACCAACATTTATTTN + + + +Etymology +. This species is named in honor of David B. Wahl, formerly curator of the American Entomology Institute (Gainesville, +Florida +), presently curator at +Utah State +University, in recognition of his decades of study of ichneumonid systematics. + + + + +Comments. + +Leurus wahli + +is the only species having the combination of metallic blue metasoma and a completely yellow tegula. It is also the only + +Leurus + +encountered to date parasitizing a grass-feeding caterpillar. + + + + +Hosts +. + +Leurus wahli + +has been reared 15 times from a sample of 440 caterpillars of the rain forest + +Herpetogramma phaeopteralis +(Guenée) + +( +Crambidae +) feeding on three species of +Poaceae +( +Table 1 +). + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F0EA70A95FE53741523FE53.xml b/data/57/2E/87/572E87900F0EA70A95FE53741523FE53.xml new file mode 100644 index 00000000000..8ea3c5243f6 --- /dev/null +++ b/data/57/2E/87/572E87900F0EA70A95FE53741523FE53.xml @@ -0,0 +1,234 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus sondrawardae +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Fig. 11 +) + + +Diagnostic description +. +Female +. Fore wing length, +5.2−5.6 mm +( +holotype +5.2 mm +). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. +Coloration +. Antennal scape brown, pedicel brown, flagellum brownish; tegula predominantly black, light yellow anteriorly; metasoma black, with metallic blue iridescence or completely black. Trochanters pale to light brown; fore femora pale to light orange, hind femora entirely black; fore tibia pale yellow to brownish, mid and hind tibiae entirely black; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus pale with all dark apices dark. + + +Male +: Unknown. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. 1. DHJPAR0036739. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 09-SRNP-42662. Database information: Costa Rica, ACG, +Alajuela Prov. +, Sector Rincon Rain Forest, Quebrada Escondida, +10.89928 +, +-85.27486 +, +420m +(Anabelle Cordoba), + +Piletosoma thialis + +( +Crambidae +) caterpillar feeding on + +Doliocarpus multiflorus + +( +Dilleniaceae +) coll. +22.ix.2009 +, wasp eclosed +19.x.2009 +. + +Paratypes +. + +2 ♀ +, ( +EMUS +, +MNCR +). +COSTA RICA +, ACG database codes: 02-SRNP-720715, DHJPAR0014016 ( +♀ +); 09-SRNP-42108, DHJPAR0036732 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0036739 (636 bp): + +GGCCCTTTACTTTATTTTTGGCATTTGAGCTGGAATAATTGGAACCTCTCTAAGAATCATTATTCG AATAGAATTAGGAACCCCCGGCTCTTTAATTAATAATGACCAAATTTATAATTCTATCGTCACTATAC ATGCCTTTATCATAATTTTTTTTATAGTAATACCAATTATGATTGGGGGATTTGGTAATTGACTTGCTCCATT AATATTGGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATC ATTATTCTTATTAATTTCAGGAAGAATCCTAAATCAAGGGGCCGGAACTGGATGAACAGTATATCCACCTTTATC ATCTAATACTAATCATGAAGGATTATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCAGGCATGTCCTCAATT ATAGGGGCAATCAACTTCATTACAACTATTTTTAATATAAAAATTAAATTATTAACTTTAGACCAACTTTCATT ATTTATTTGATCTATTAAAATTACTACTATTCTTCTACTACTTGCAGTCCCTGTTTTAGCAGGGGCAATCACT ATATTATTAACAGATCGTAACTTAAA TACCTCTTTTTTTGACCCAAGAGGGGGCGGAGACCC + + + +Etymology: +This species is named in honor of the late Sondra Ward, formerly of the Natural History Museum in London, for her invaluable assistance in the study of +Ichneumonidae +. + + + + +Comments. +We were unable to distinguish + +L. sondrawardae + +morphologically from + +L. hugokonsi + +. Both species have metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, hind tarsomeres 1–2 with dark apices, and hind tibia with white base not extending more than 3.0 × length of tibia. However, + +L. sondrawardae + +has a very distinctive and different DNA barcode, and it parasitizes a very different species of caterpillar feeding on a different family of host plants. + + + + +Hosts. + +Leurus sondrawardae + +has been reared from + +Piletosoma thialis +Dyar + +( +Crambidae +) feeding on the rainforest liana, + +Doliocarpus multiflorus + +( +Dilleniaceae +). No other species of the + +L. caeruliventris + +complex in ACG utilizes this caterpillar genus or this host plant family. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F0FA70995FE511713EDFC61.xml b/data/57/2E/87/572E87900F0FA70995FE511713EDFC61.xml new file mode 100644 index 00000000000..d0f1c6ba11d --- /dev/null +++ b/data/57/2E/87/572E87900F0FA70995FE511713EDFC61.xml @@ -0,0 +1,226 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus pammitchellae +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Fig. 9 +) + + +Diagnostic description +. +Female +. Fore wing length, +5.2−5.6 mm +( +holotype +5.2 mm +). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. +Coloration +. Antennal scape black with apex white, pedicel yellowish to light brown, flagellum brownish; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence or black. Trochanters pale to light brown; fore and mid femora predominantly black, hind femora entirely black; fore tibia pale yellow to orangish, mid and hind tibiae predominantly black whit apex white; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark. + + +Male +: Unknown. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0039387. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 10-SRNP-2437. Database information: Costa Rica, ACG, +Alajuela Prov. +, Sector Rincon Rain Forest, Sendero Albergue Crater, +10.84886 +, +-85.328 +, +980m +(Osvaldo Espinoza), + +Microthyris prolongalis + +( +Crambidae +) caterpillar feeding on + +Ipomoea batatas + +( +Convolvulaceae +), coll. +16.v.2010 +, wasp eclosed +10.vi.2010 +. + +Paratypes +. + +2 ♀ +, ( +EMUS +, +MNCR +). +COSTA RICA +, ACG database codes: 10-SRNP-2938: DHJPAR0036264 ( +♀ +); 10-SRNP-2422: DHJPAR0039539 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0039387 (286 bp): + +TATATTTGGTGCATCAATTAGAATAATTATTCGTATAGAATTAGGAACCCCTAGTTCATTAATTAATAATGACC AAATTTATAACTCTATAGTTACTATACATGCTTTTATTATAATTTTTTTTATAGTGATACCAATTATAATTG GGGGATTCGGAAATTGACTTATTCCCTTAATATTAGGAGCCCCAGACATGGCCTTTCCACGATTAAATAATATAAG ATTTTGACTTTTACCCCCTTCATTATTTTTATTAATTTCAGGAAGCATTTTAAATCAAGGAGCT + + + +Etymology: +This species is named in honor of the late Pamela Mitchell, in recognition of her life of dedicated support of the study of Costa Rican +Ichneumonidae +by the Gauld and Mitchell team. + + + + +Comments. + +Leurus pammitchellae + +is distinctive not only for its morphology, but also for its very different barcode and its host specificity to a very common leaf roller of herbaceous convolvulaceous vines growing in full sun in the ACG rain forest. + + + + +Hosts. +While the three rearing records from 505 wild-caught caterpillars of + +Microthyris prolongalis + +make it appear to be exceptionally rare, it may not be when the taxonomy of the moth is fully worked out; in ACG, “ + +M. prolongalis + +” constitutes at least two different species of crambids feeding on seven species of +Convolvulaceae +, and we note that all + +three + +L. + + +pammitchellae were only from the 346 rearings on + +Ipomoea batatas + +. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F10A70895FE54A115DEFE2E.xml b/data/57/2E/87/572E87900F10A70895FE54A115DEFE2E.xml new file mode 100644 index 00000000000..b4547dd20fd --- /dev/null +++ b/data/57/2E/87/572E87900F10A70895FE54A115DEFE2E.xml @@ -0,0 +1,218 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus maryjanewestae +Zuñiga & Valerio + +, +sp. nov. + + + + +Diagnositc description +. +Female +. Fore wing length, +5.2−5.6 mm +( +holotype +5.2 mm +). Malar space 0.7−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. +Coloration +. Antennal scape pale yellow to brownish, pedicel yellowish to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence. Trochanters pale to light brown; fore and mid femora predominantly black, hind femora entirely black; fore and mid tibiae pale yellow to orangish, hind tibia predominantly white, black apically; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark. + + + + +Male +: Unknown. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0052171. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 13- SRNP-2266. Database information: Costa Rica, ACG, +Guanacaste Prov. +, Sector San Cristobal, Sendero Palo Alto, +10.88186 +, +-85.3822 +, +570m +(Carolina Cano), +Rhectocraspeda periusalis +( +Crambidae +) caterpillar feeding on + +Piper sancti-felicis + +( +Piperaceae +), coll. +30.x.2013 +. wasp eclosed +18.xi.2013 +. + +Paratypes +. + +6 ♀ +, ( +EMUS +, +MNCR +). +COSTA RICA +, ACG database codes: 10-SRNP-44150: DHJPAR0041461 ( +♀ +); 09-SRNP-5377: DHJPAR0038423 ( +♀ +); 02- SRNP-6303: DHJPAR0014020 ( +♀ +); 02-SRNP-1978: DHJPAR0014012 ( +♀ +); 12-SRNP-1713: DHJPAR0048898 ( +♀ +); 13-SRNP-69202: DHJPAR0051726 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0052171 (658 bp): + +AATTTTATACTTCATTTTTGGAATTTGGGCAGGAATAATTGGTGCTTCACTTAGTATTATTATCCG AATAGAATTAGGAACCCCCAGTTCCTTAATTAATAATGACCAAATTTATAATTCTATTGTCACTATACATGCCTTT ATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGACTTAATCCTTTAATATTAGG AGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTCTGATTATTACCCCCATCCTTATTTTTATTAA TTTCTGGTAGAATCTTAAATCAAGGGGCAGGAACTGGTTGAACAGTTTACCCTCCATTGTCTTCTAATACAAATC ATGAAGGATTATCAGTTGATTTAAGAATCTTCTCTCTCCATTTAGCTGGAATATCTTCAATTATAGGAGCAATT AACTTTATCACAACTATTTTAAATATAANAATTAAATTATTAACTTTAGATCAACTTTCATTATTTATTTGATCC ATTAAAATTACTACTATTTTACTTTTATTAGCAGTCCCTGTTTTAGCAGGAGCAATCACCATATTATTAACTG ACCGTAACTTAAATACCTCTTTTTTTGACCCTAGAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT + + + +Etymology. +This species is dedicated to Mary Jane West-Eberhard, in recogntion of her decades of research on the evolution of insects and their social behavior, with special emphasis on +Hymenoptera +. + + + + +Comments. + +Leurus maryjanewestae + +is morphologically indistinguishable from + +Leurus billeberhardi + +at the level of examination currently possible, and parasitizes the same species of caterpillar feeding on the same species of shrub ( +Table 1 +) in the same rain forest, but the two species have very different DNA barcodes ( +Fig. 2 +). + + + + +Hosts. +This species has been reared seven times from a sample of 490 caterpillars of + +Rhectocraspeda periusalis + +collected in the wild between 1997 and 2013. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F11A71795FE54711692FCDD.xml b/data/57/2E/87/572E87900F11A71795FE54711692FCDD.xml new file mode 100644 index 00000000000..3fb3bda92da --- /dev/null +++ b/data/57/2E/87/572E87900F11A71795FE54711692FCDD.xml @@ -0,0 +1,314 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus marjorietownesae +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Figs. 16 +, +22 +) + + +Diagnostic description +. +Female +. Fore wing length +5.1–5.5 mm +( +holotype +5.2 mm +). Malar space 0.8–1.1 × basal mandibular width; antenna with 26–27 flagellomeres, these being quadrate except for the first 2–3 and last 2–3. Genitalia: setae on ovipositor sheaths extending basally for a distance less than 0.3x the total length, more or less sparse throughout sheaths width, setae sparse, thin and elongated; lower-anterior extension of quadrate plate elongated and thin, somewhat lobate at tip, setae on ventral edge of quadrate plate thin, normally large. +Coloration +. Antennal scape and pedicel yellow; flagellum yellowish at base, brown at apex. Tegula whitish anteriorly, orange posteriorly. Metasoma black. Trochanters yellow; front femur yellow to orange, mid femur mostly black but yellow at apex, hind femur all black; front tibia yellow, mid and hind tibiae yellow at base, black at apex; front tarsus yellow with last segment orange, mid tarsus yellow with last 2 segments brown, hind tarsus with segments 1–3 yellow except light brown at apices, segments 4–5 light brown. + + +Male +. Similar to female in size and color. Antenna with 26 flagellomeres. Genitalia: digitus 2/3 lobate at base, otherwise elongate, somewhat acute; volsella medial area deep, volsella tip (in lateral view) clearly flat; phallus apex somewhat stout, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat thin, straight in appearance; distal third of gonoforceps conspicuously setose. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0036816. 2 Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservasion +Guanacaste +, Costa Rica, 09-SRNP-72684. Database information: Costa Rica, ACG, Prov., +Guanacaste +, Sector Pitilla, Estación Quica, +10.99697 +, +-85.39666 +, +470m +(Dinia Martinez) + +Ategumia matutinalis + +( +Crambidae +) caterpillar feeding on + +Miconia lacera + +( +Melastomataceae +) coll. +23.ix.2009 +, wasp eclosed 125. +x.2009 +. + +Paratypes +. + +20 ♀ +, +5 ♂ +, ( +EMUS +, +MNCR +, +MZUCR +, +USNM +). +COSTA RICA +, ACG database codes: 09-SRNP-40709: DHJPAR0035261 ( +♀ +); 09-SRNP-43588: DHJPAR003842 ( +♀ +); 02-SRNP-6303: DHJPAR0014020 ( +♀ +); 09-SRNP-69907: DHJPAR0037722 ( +♀ +); 10- SRNP-81107: DHJPAR0041095 ( +♂ +); 09-SRNP-69851: DHJPAR0037717 ( +♀ +); 10-SRNP-80312: DHJPAR0041281 ( +♀ +); 09-SRNP-69847: DHJPAR0037718 ( +♀ +); 09-SRNP-72785: DHJPAR0037788 ( +♀ +); 09-SRNP-80103: DHJPAR0037712 ( +♂ +); 09-SRNP-80261: DHJPAR0041284 ( +♀ +); 05-SRNP-6298: DHJPAR0028661 ( +♀ +); 07-SRNP-41144: DHJPAR0021655 ( +♀ +); 09-SRNP-73809: DHJPAR0038427 ( +♀ +); 05-SRNP-6297: DHJPAR0028652 ( +♀ +); 09- SRNP-32729: DHJPAR0037758 ( +♀ +); 08-SRNP-70147: DHJPAR0027735 ( +♂ +); 09-SRNP-69909: DHJPAR0037721 ( +♂ +); 09-SRNP-40709: DHJPAR0035261 ( +♀ +); 09-SRNP-69848: DHJPAR0037720 ( +♀ +); 11-SRNP-81170: DHJPAR0045775 ( +♀ +); 13-SRNP-75204: DHJPAR0050875 ( +♀ +); 13-SRNP-75114: DHJPAR0050878 ( +♀ +); 13- SRNP-70368: DHJPAR0052174 ( +♀ +); 12-SRNP-67267: DHJPAR0050376 ( +♀ +); 12-SRNP-69657: DHJPAR0048870 ( +♀ +); 13-SRNP-76776: DHJPAR0052751 ( +♀ +); 13-SRNP-75702, DHJPAR0051710 ( +♂ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0036816. (623bp): + +TAATTGGTGCTTCTTTAAGTATTATTATTCGAATAGAACTAGGAACCCCCGGGTCTCTAATTAATAA TGATCAAATTTATAATTCTATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAA TTGGGGGATTTGGAAATTGACTCACCCCCTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTATAA ATAATATAAGATTTTGATTATTACCTCCATCATTATTTTTATTAATTTCTGGAAGAATTTTAAATC AAGGGGCAGGAACTGGTTGAACAGTTTACCCTCCTTTATCATCTAATATTAACCATGAAGGACTATC AGTTGATTTAAGAATTTTTTCCCTTCATTTAGCGGGAATATCCTCAATTATAGGGGCAATTAATTTTATTACAACT ATTTTTAATATAAAAATTAAATTTTTAACCTTAGATCAACTTTCTTTATTTATTTGATCTATTAAAATTACT ACTATTTTACTTTTATTAGCAGTCCCTGTTTTGGCAGGAGCAATCACTATATTATTAACTGATCGTAACTTAA ATACTTCTTTTTTTGACCCAAGTGGGGGAGGTGACCCAATTTTATACCAACATTTATTT + + + +Etymology +. This species is named in honor of the late Marjorie Townes for her steadfast and high quality support of Henry Townes, and her role in the founding and development of the American Entomological Institute and its outstanding collection of +Hymenoptera +. + + + + +Comments. + +Leurus marjorietownesae + +, like + +L. iangauldi + +and + +L. pammmitchellae + +, has a black metasoma without metallic blue reflections. However, + +L. marjorietownesae + +differs by having the tegulae pale colored anteriorly and orange posteriorly (as opposed to dark brown posteriorly). + + + + +Hosts. +This species, like + +L. henrytownesi + +, parasitizes caterpillars of + +Ategumia lotanalis + +( +Crambidae +) feeding on rain forest +Melastomataceae +foliage. + +Leurus henrytownesi + +parasitizes caterpillars on melastomes with small and insolated leaves, while + +L. marjorietownesae + +parasitizes caterpillars on melastomes with large and often shaded leaves. + +L. marjorietownesae + +has been reared 29 times from + +Ategumia lotanalis + +and + +A. matutinalis + +feeding on +five spec +i +es of +Melastomataceae +. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F12A71695FE537817B9FD6C.xml b/data/57/2E/87/572E87900F12A71695FE537817B9FD6C.xml new file mode 100644 index 00000000000..d5f83b3374b --- /dev/null +++ b/data/57/2E/87/572E87900F12A71695FE537817B9FD6C.xml @@ -0,0 +1,239 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus jesusugaldei +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Figs. 10, 13 +) + + +Diagnostic description +. +Female +. Fore wing length, +5.2−5.6 mm +( +holotype +5.3 mm +). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. +Coloration +. Antennal scape brownish dorsally but lighter colored ventrally, pedicel yellowish to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence. Trochanters yellowish orange to light brown; fore and mid femora predominantly black, hind femora entirely black; fore and mid tibiae pale yellow to orangish, hind tibiae pale yellow basally, black apically; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark. + + +Male +: Unknown + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0045043. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 11-SRNP-2363. Database information: Costa Rica, ACG, +Alajuela Prov. +, Sector San Cristobal, Finca San Gabriel, +10.87766 +, +-85.39343 +, +645m +(Elda Araya) + +Diacme +BioLep + +02 ( +Crambidae +) caterpillar feeding on + +Thelypteris nicaraguensis + +( +Thelypteridaceae +), coll. +21.vi.2011 +wasp eclosed +17.vii.2011 +. + +Paratypes +. + +1 ♀ +, ( +MNCR +), +COSTA RICA +, ACG database code: 10-SRNP-44944: DHJPAR0041070 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHAJPAR0045043 (658 bp): + +GATTCTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGTGCCTCTTTAAGTATTATTATTCG AATAGAACTAGGGACCCCCGGAGCTCTAATTAACAACGATCAAATTTACAATTCTATTGTAACTATAC ATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTACCCCTTT AATATTAGGGGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGTTATTACCTCC ATCATTATTCTTATTAATTTCTGGAAGAATCTTAAATCAAGGGGCAGGGACTGGTTGAACAGTTTACCCTCCTTT ATCATCTAATATTAATCATGAAGGACTATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCTGGT ATTCCTCAATTATAGGGGCAATCAATTTTATTACAACTATTTTTAATATAAAAATTAAATTATTGGCCTT AGACCAACTTTCTTTATTTATCTGATCTATTAAAATTACTACTATTTTACTTTTACTAGCAGTCCCTG TTTTAGCGGGGGCAATCACTATATTATTAACTGATCGTAATTTAAATACTTCTTTTTTTGACCCAAGTGG AGGGGGGGACCCAATTTTATACCAACACTTA + + + +Etymology. +This species is named in recognition of Jesus Ugalde, formerly of the Instituto Nacional de Biodiversidad (INBio) of +Costa Rica +, in recognition of his many years of +Hymenoptera +curation and administration of the national biodiversity inventory. + + + + +Comments. +Like + +L. hugokonsi + +and + +L. sondrawardae + +, + +L. jesusugaldei + +has metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, and hind tarsomeres 1–2 with dark apices. However, + +L. jesusugaldei + +differs by having slightly more white at the base of the hind tibia, extending about 4.0 × length of tibia (as opposed to no more than 3.0 × length of tibia). It can also be distinguished by its barcode and hosts, being the only + +Leurus +species + +parasitizing a fern-feeding caterpillar. + + + + +Hosts. + +Leurus jesusugaldei + +appears to occur at a very low density, with just two reared specimens; however, the inventory has only been able to rear 173 of its distinctive fern-feeding crambid caterpillars, + +Diacme +biolep + +02. Both caterpillars were feeding on + +Thelypteris nicaraguensis + +, but the sample size is not large enough to hazard a guess as to whether the wasp is also specialized on this particular plant, of the many species of ferns utilized by + +Diacme +Solis + +02. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F13A71595FE543A1531FC65.xml b/data/57/2E/87/572E87900F13A71595FE543A1531FC65.xml new file mode 100644 index 00000000000..500907260fb --- /dev/null +++ b/data/57/2E/87/572E87900F13A71595FE543A1531FC65.xml @@ -0,0 +1,327 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus iangauldi +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Figs. 15 +, +21 +) + + +Diagnostic description. Female +. Fore wing length, +5.2−5.6 mm +( +holotype +5.2 mm +). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Genitalia: setae on ovipositor sheaths extending basally for a distance greater than 0.3x the total length, more or less sparse throughout sheath width; lower-anterior extension of quadrate plate short and broad, somewhat square at tip, setae on ventral edge of quadrate plate thin, normally large. +Coloration +. Antennal scape pale yellow to orangish, pedicel yellowish orange to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, without any metallic blue iridescence. Trochanters yellowish orange to light brown; fore and mid femora predominantly orange, hind femora predominantly black; fore tibia pale yellow to orangish, mid and hind tibiae pale yellow basally, black apically; fore tarsus pale yellow with last segment more orangish, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark. + + +Male +. Similar to female in size and color. Antenna with 22–23 flagellomeres. Genitalia: digitus completely lobate at base; volsella medial area shallow, volsella tip (in lateral view) mainly rounded but somewhat flat; phallus apex slender; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat broad, phallus width clearly narrower than apex width; distal third of gonoforceps normally setose, setae somewhat sparse. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0036020. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservación +Guanacaste +, Costa Rica, 09-SRNP-69785. Database information: Costa Rica, ACG, +Alajuela Prov. +, Sector Rincon Rain Forest, Cafecito, +10.94404 +, +-85.31738 +, +455 m +, (Noe Castillo) caterpillar feeding on + +Pourouma bicolor + +( +Urticaceae +), coll +11.viii.2009 +, wasp eclosed +27.viii.2009 +. + +Paratypes +. + +13 ♀ +, +8 ♂ +, ( +EMUS +, +MNCR +, +MZUCR +, +USNM +). +COSTA RICA +, ACG database codes: 06-SRNP-41643: DHJPAR0028681 ( +♀ +); 06-SRNP-42818: DHJPAR0021540 ( +♀ +); 06-SRNP-42815: DHJPAR0021550 ( +♀ +); 06-SRNP-42822, DHJPAR0021529 ( +♀ +); 06-SRNP-42820:DHJPAR0021570 ( +♀ +); 06-SRNP-41638: DHJPAR0028690 ( +♀ +); 01-SRNP-4060: DHJPAR0014022 ( +♀ +); 01-SRNP-4772: DHJPAR0014013 ( +♀ +); 01- SRNP-4295: DHJPAR0028072 ( +♀ +); 10-SRNP-40127: DHJPAR0038463 ( +♂ +); 10-SRNP-40128, DHJPAR0039132 ( +♂ +); 10-SRNP-40125: DHJPAR0039137 ( +♂ +); 06-SRNP-42817, DHJPAR0021572 ( +♂ +); 01-SRNP-4112: DHJPAR0014024 ( +♀ +); 02-SRNP-7322, DHJPAR0014017 ( +♂ +); 06-SRNP-44060: DHJPAR0016996 ( +♀ +);10-SRNP-69022, DHJPAR0038789 ( +♂ +); 10-SRNP-69023: DHJPAR0038834 ( +♀ +); 06-SRNP-42813, DHJPAR0021559 ( +♂ +); 02- SRNP-7332: DHJPAR0014014 ( +♂ +); 00-SRNP-14124, DHJPAR0014023 ( +♀ +).13-SRNP-40334: DHJPAR0050743 ( +♀ +); 11-SRNP-81742: DHJPAR0046788 ( +♀ +); 06-SRNP-42816: DHJPAR00121189 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0036020 (574 bp): + +TGGATCTTTAATTAATAATGATCAAATTTATAATTCTATTGTAACTATACATGCCTTTATTATAATTTTCTTT ATAGTAATACCTATTATGATTGGTGGATTTGGAAATTGATTAACCCCCCTAATATTAGGGGCCCCAG ATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTACCCCCCTCATTATTTTTATTAATTTCTG GGGGTATTTTAAATCAAGGGGCTGGGACTGGCTGAACAGTTTACCCCCCTTTATCATCCAATGTAA ATCATGAAGGATTATCAGTTGATCTAAGAATTTTCTCCCTTCATTTAGCTGGAATATCATCAATCATAGGGGCAATT AATTTCATTACAACCATTTTTAATATAAAAATTAAATTATTATCTTTAGAACAACTTTCTTTATTTATTTGATCT ATTAAAATTACCACTATTTTACTTTTACTAGCAGTCCCTGTTTTAGCAGGAGCAATTACTATATTATTAACAG ATCGCAATTTAAATACTTCTTTTTTTGACCCTAGTGGAGGAGGAGACCCAATTTTATACCAACACTTATTT + + + +Etymology +. This species is named in recognition of the late Ian Gauld for his massive contributions to our understanding of the +Ichneumonidae +of the world, the +Hymenoptera +of +Costa Rica +, and very specifically, the +Ichneumonidae +of ACG since 1989. + + + + +Comments. + +Leurus iangauldi + +is the only species in the + +L. caeruliventris + +complex having the mid femur orangish colored; + +L. sondrawardae + +is somewhat similar in this respect, but has the mid femur more brownish. + +Leurus iangauldi + +is similar to + +Leurus marjorietownesae + +in having the metasoma black, without any noticeable metallic reflections, but the tegula of the former is dark colored posteriorly (as opposed to orange). The color of the scape and the tegula of + +L. iangauldi + +is similar to that of + +L. caeruliventris +, + +but the former differs by having a black metasoma without metallic reflections and by its orangish mid femur. It is also distinguished from all other species of ACG + +Leurus + +by its DNA barcode. + + + + +Hosts. + +Leurus +. +iangauldi + +has been reared 28 times from 4,300 caterpillars of the three species of ACG + +Patania + +( +Crambidae +, Spilomelinae) that feed on the leaves of + +Pourouma + +, + +Cecropia +, + +and + +Urera + +( +Urticaceae +) ( +Table 1 +). It shares two of its host caterpillar species with + +L +. +caeruliventris + +, but the latter species has not yet been recorded from + +Patania +Solis + +01, a specialist on + +Pourouma + +. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F14A71495FE540212CDFCA3.xml b/data/57/2E/87/572E87900F14A71495FE540212CDFCA3.xml new file mode 100644 index 00000000000..8e1debaa4c3 --- /dev/null +++ b/data/57/2E/87/572E87900F14A71495FE540212CDFCA3.xml @@ -0,0 +1,256 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus hugokonsi +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Figs. 18 +, +24 +) + + +Diagnostic description. Female +. Fore wing length +5.2–5.8 mm +( +holotype +5.4 mm +). Malar space 1.1 × basal mandibular width; antenna with 23 flagellomeres, the latter transverse except the first 2–3 and the last 2–3. Genitalia: setae on ovipositor sheaths extending basally for a distance equal to or greater than 0.3 × total length, constrained to ventral edge, setae sparse, thin and elongated; lower-anterior extension of quadrate plate elongated and broad, lobate at tip, setae on ventral edge of quadrate plate thin, normally large. +Coloration +. Scape, pedicel, and flagellum predominantly black. Tegula entirely black, or with just anterior margin white. Metasoma with metallic blue and purple iridescence. Trochanters and femora mostly black, front femur with yellow at apex; front tibia yellow, mid and hind tibiae mostly black but yellow at base; fore tarsus pale yellow with last 3 segments more orangish, mid tarsus pale yellow with last 3 segments light brown, hind tarsus with first segment white except dark at extreme apex, remaining segments mostly all black. + + +Male +. Similar to female in size and color, but with more white on anterior part of tegula (at least in some specimens); front femur orangish on anterior surface; hind tarsus with second segment mostly white, black at apex. Antenna with 23–26 flagellomeres. + +Genitalia: digitus completely lobate at base; volsella medial area deep, volsella tip (in lateral view) mainly rounded but somewhat flat; phallus apex slender, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat broad, phallus width evidently narrower than apex width; distal third of gonoforceps normally setose, setae somewhat sparse. + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0021094. 2. Caterpillar Voucher: D.H.Janzen & W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservación +Guanacaste +, +COSTA RICA +, 07-SRNP-2881. Database information: +Costa Rica +, ACG, +Alajuela Prov. +, Sector +San Cristobal +, Sendero Vivero, +10.86739 +, +-85.38744 +, +730m +(Elda Araya) spiloBioLep01 BioLep577 ( +Crambidae +) feeding on + +Maripa nicaraguensis + +( +Convolvulaceae +), coll. +22.vi.2007 +, wasp eclosed +19.vii.2007 +. + +Paratypes + +. +9 ♀ +, +1 ♂ +, ( +EMUS +, +MNCR +, +MZUCR +, +USNM +). +COSTA RICA +, ACG database: 09-SRNP-72625: DHJPAR0038422 ( +♂ +); 09-SRNP-73434: DHJPAR0037786 ( +♀ +); SRNP-73433: DHJPAR0038461 ( +♀ +); 11-SRNP-42694: DHJPAR0045047 ( +♀ +); 11-SRNP-42664: DHJPAR0045048 ( +♀ +); 11-SRNP-42697: DHJPAR0045046 ( +♀ +); 11-SRNP-42700: DHJPAR0045045 ( +♀ +); 11-SRNP-42951: DHJPAR0045041 ( +♀ +); 09-SRNP-73434: DHJPAR0037786 ( +♀ +); 11-SRNP-42705: DHJPAR0045044 ( +♀ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0021094 (657 bp): + +ATTTTATACTTCATTTTTGGAATTTGAGCGGGTATAATTGGAGCATCTTTAAGTCTTATTATTCG AATAGAATTAGGAACCCCCGGGTCTTTGATTAATAATGATCAAATTTATAATTCTATTGTGACTATACATGCCTTT ATTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTTGTTCCTTTAATACTAGG AGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGTTGTTACCCCCATCATTATTTTTATTAA TTTCTGGAAGTATCTTAAATCAAGGTGCTGGGACTGGTTGAACAGTATATCCTCCTCTATCATCTAATATTAATC ATGAAGGTTTATCAGTTGATTTAAGAATTTTTTCCCTCCATTTAGCTGGTATATCTTCAATTATAGGTGCAATT AATTTTATTACAACTATTTTTAATATAAAAATTAAATTATTAAATTTAGATCAACTTTCTTTATTTATCTGATCT ATTAAAATCACTACTATTTTACTTTTATTAGCTGCCCCTGTTTTAGCTGGAGCAATCACCATATTATTAACTG ATCGTAATTTAAATACTTCTTTCTTTGACCCTAGGGGAGGGGGGGACCCAATTTTATACCAACATTTATTT + + + +Etymology +. This species is dedicated to Hugo Kons formerly of the American Entomological Institute in recognition of his dedicated efforts to curate the +Hymenoptera +collection and aid in the resolution of +Ichneumonidae +taxonomic problems. + + + + +Comments. +Morphologically, we were unable to distinguish + +L. hugokonsi + +from + +L. sondrawardae + +. Both have metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, hind tarsomeres 1–2 with dark apices, and hind tibia with white base not extending more than 3 × length of tibia. However, + +L. hugokonsi + +can be distinguished by its distinctive barcode, and by its host caterpillar which it shares with no other species of + +Leurus +. + + + + + +Hosts. + +Leurus hugokonsi + +has been reared ten times from a sample of 211 caterpillars of spiloBioLep01 BioLep577 ( +Crambidae +, Spilomelinae) reared from two species of the rain forest vine + +Maripa + +( +Convolvulaceae +). + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F18A71095FE51A5153AF833.xml b/data/57/2E/87/572E87900F18A71095FE51A5153AF833.xml new file mode 100644 index 00000000000..66b308c7d2a --- /dev/null +++ b/data/57/2E/87/572E87900F18A71095FE51A5153AF833.xml @@ -0,0 +1,306 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus henrytownesi +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Figs. 12 +, +19 +, +25 +) + + +Diagnostic description. Female +. Fore wing length +5.5–5.9 mm +( +holotype +5.3 mm +). Malar space 1.2–1.3 × basal mandibular width; antenna with 24–25 flagellomeres, these being mostly quadrate (slightly transverse in central flagellomeres) except first 1–2 and last 1–2, which are longer than wide. Genitalia: setae on ovipositor sheaths extending basally for a distance greater than 0.3x the total length, constrained to ventral edge, setae sparse, thin and elongated; lower-anterior extension of quadrate plate elongated and broad, lobate at tip, setae on ventral edge of quadrate plate conspicuously large, broad. +Coloration +. Antennal scape dark brown dorsally, yellow ventrally; pedicel dark brown; flagellum dark brown. Tegula light colored anteriorly, black posteriorly. Metasoma with metallic blue iridescence. Trochanters brown; femora black, fore femur with yellow at apex and some orange on anterior surface; fore tibia yellow, mid and hind tibiae black with yellow at extreme base; fore tarsus yellow with last segment orange, mid tarsus yellow with last 2 segments brown, hind tarsus entirely white without dark apices. + + +Male +. Similar to female in size and color, but with scape, pedicel and base of flagellum yellowish orange; tegula orange posteriorly in some specimens; front and sometimes mid femur all orange, without any black. Antenna with 25–26 flagellomeres. Genitalia: volsella medial area deep, volsella tip (in lateral view) clearly flat; phallus apex somewhat stout, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat thin, straight looking; distal third of gonoforceps normally setose, setae somewhat sparse. + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0030368. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 09-SRNP-20115. Database information: Costa Rica, ACG, +Guanacaste Prov. +, Sector Del Oro, Montecristo, +11.01373 +, +-85.42531 +, +525m +(Lucia Ríos) + +Ategumia lotanalis + +( +Crambidae +) caterpillar feeding on + +Miconia trinervia + +( +Melastomataceae +) coll. +08.i.2009 +, wasp eclosed +07.ii.2009 +. + +Paratypes + +19 ♀ +, +5 ♂ +, ( +EMUS +, +MNCR +, +MZUCR +, +USNM +). +COSTA RICA +, ACG database codes: 05-SRNP-43402: DHJPAR0028653 ( +♀ +); 05-SRNP-43401: DHJPAR0028662 ( +♀ +); 09-SRNP-40871: DHJPAR0035145 ( +♀ +); 09-SRNP-40997: DHJPAR0035144 ( +♀ +); 09- SRNP-69902: DHJPAR0037719 ( +♀ +); 10-SRNP-81654: DHJPAR0041094 ( +♀ +); 05-SRNP-43396: DHJPAR0028654 ( +♀ +); 05-SRNP-42214: DHJPAR002865505 ( +♂ +); 05-SRNP-43403, DHJPAR0028664 ( +♀ +); 03-SRNP-10404: DHJPAR0028071 ( +♀ +); 09-SRNP-20818: DHJPAR0036798 ( +♀ +); 09-SRNP-80169: DHJPAR0037710 ( +♂ +); 11- SRNP-44169, DHJPAR0045717 ( +♀ +); 11-SRNP-81003, DHJPAR0045716 ( +♀ +); 09-SRNP-43156, DHJPAR0037810 ( +♀ +); 13-SRNP-69406, DHJPAR0051709 ( +♀ +); 09-SRNP-80158, DHJPAR0037711 ( +♀ +); 09-SRNP-80170, DHJPAR0037732 ( +♀ +); 12-SRNP-77300, DHJPAR0050887 ( +♀ +); 13-SRNP-2437, DHJPAR0069209 ( +♀ +); 12-SRNP-71337, DHJPAR0049680 ( +♀ +); 11-SRNP-69288, DHJPAR0042379 ( +♂ +); 12-SRNP-81899, DHJPAR0050852 ( +♂ +). + + +Barcode +. DNA barcode of female +holotype +DHJPAR0030368 (603bp): + +TATTCTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGGGCCTCTTTAAGTATTATTATTCG AATAGAACTAGGAACCCCCGGGNCTCTAATTAATAATGATCAAATTTACAATTCTATTGTAACTATACATGCTTTT ATTATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTCACCCCTTTAATATTAGG AGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTACCTCCATCATTATTTTT ATTAATTTCTGGGAGAATTTTAAATCAAGGAGCAGGGACTGGTTGAACAGTTTACCCTCCTTTATCATCTAATATT AATCATGAAGGGATATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCTGGTATATCCTCAATTATAGGAGC AATCAATTTTATTACAACTATTTTTAATATAAAAATTAAATTATTAACCTTAGACCAACTTTCTTTATTTATCTG ATCAATTAAAATTACTACTATTTTACTTTTACTAGCAGTCCCTGTTTTAGCAGGAGCAATCACTATATTATTAA CTGATCGTAATTTAAACAC + + + +Etymology +. This species is dedicated to the late Henry Townes, co-founder and funder of the American Entomological Institute, life-long researcher, pioneer in developing the systematics of the world +Ichneumonidae +, and identifier of the first ichneumonid reared by DHJ in ACG in 1978 ( + +Thyreodon atriventris +DHJPAR + +0000487), while the nascent institute resided in Ann Arbor, +Michigan +(now at EMUS). + + + + +Comments. + +Leurus henrytownesi + +can be distinguished by the combination of metallic blue metasoma, scape dark colored at least dorsally, tegula light anteriorly dark posteriorly, and male front femur without any black markings. It can also be distinguished by its distinctive barcode and by its hosts. + + + + +Hosts. +This species has been reared 26 times from + +Ategumia lotanalis + +( +Crambidae +) feeding on four species of rain forest +Melastomataceae +( +Table 1 +), most frequently the common second growth shrub + +Conostegia xalapensis + +. This host crambid is the same as that of + +L. marjorietownesae + +, but the host plants are mostly different ( +Table 1 +; see discussion of hosts under + +L. marjorietownesae + +). + +Leurus henrytownesi + +has also been reared from + +Microthyris prologalis +(Guenée) + +( +Crambidae +) feeding on sweet potato ( +Convolvulaceae +: + +Ipomoea batatas + +), the same crambid and host plant utilized by + +L. pammitchelli + +. + + + + \ No newline at end of file diff --git a/data/57/2E/87/572E87900F1BA71D95FE531D15A7FCD8.xml b/data/57/2E/87/572E87900F1BA71D95FE531D15A7FCD8.xml new file mode 100644 index 00000000000..e0efc198ac5 --- /dev/null +++ b/data/57/2E/87/572E87900F1BA71D95FE531D15A7FCD8.xml @@ -0,0 +1,254 @@ + + + +Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica + + + +Author + +Zuñiga, Ronald +Guanacaste Dry Forest Conservation Fund, Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica. + + + +Author + +Valerio, Alejandro A. +PO Box 2195 - 1000, San José, Costa Rica. + + + +Author + +Hanson, Paul +Centro de Investigación en Biodiversidad y Ecología Tropical, Escuela de Biologia, Universidad de Costa Rica, San Pedro, 11501 - 2060, San José, Costa Rica. + + + +Author + +Smith, M. Alex +0000-0002-8650-2575 +salex@uoguelph.ca + + + +Author + +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + + + +Author + +Janzen, Daniel H. +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +511 +531 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.5 + +journal article +10.11646/zootaxa.5529.3.5 +1175-5326 +14022829 +09787995-E3D5-4FB7-AB9F-AFB46371B02B + + + + + + + +Leurus billeberhardi +Zuñiga & Valerio + +, +sp. nov. + + + + + + +( +Fig. 7 +) + + +Diagnostic description +. +Female +. Fore wing length, +5.2−5.6 mm +( +holotype +5.3 mm +). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. +Coloration +. Antennal scape pale yellow to brownish, pedicel yellowish to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence. Trochanters yellowish orange to light brown; fore and mid femora predominantly black, hind femora entirely black; fore and mid tibiae pale yellow to orangish, hind tibiae pale yellow basally, black apically; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark. + + +Male +: Unknown + + + + + +Material. +Holotype +. + +♀ +. Deposited at +EMUS +. Specimen labels: 1. DHJPAR0042761. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation +Guanacaste +, Costa Rica, 11- SRNP-2012. Database information: Costa Rica, ACG, +Alajuela Prov. +, Sector Rincon Rain Forest, Camino Albergue Oscar, +10.87741 +, +-85.32363 +, +560m +(Elda Araya) host + +Rhectocraspeda periusalis + +( +Crambidae +) feeding on + +Piper sancti-felicis + +( +Piperaceae +) coll. +16.v.2011 +, wasp eclosed +11.vi.2011 +. + +Paratypes +. + +3 ♀ +, ( +EMUS +, +MNCR +). +COSTA RICA +, ACG database codes: 12-SRNP-1712: DHJPAR0048887 ( +♀ +); 10-SRNP-70339: DHJPAR0039118 ( +♀ +); 09- SRNP-56157: DHJPAR0036029 ( +♀ +). + + +Barcode. +Holotype +DHJPAR0042761 (574 bp) + +CGGCCCATTAATTAATAATGACCAAATTTACAATTCTATTGTTACTATACATGCCTTTATTATAATTTTCTTTATA GTTATACCAATTATGATTGGTGGATTTGGTAACTGACTCACCCCTTTAATATTAGGAGCCCCAGATATAGCTTTCC CTCGAATAAATAATATAAGATTTTGATTACTACCCCCTTCCCTATTTTTATTAATTGCAGGAAGAATCCTAAACCA AGGTGCTGGAACTGGTTGAACAGTATACCCCCCACTTTCATCTAACACAAACCATGAAGGATTATCTGTTGACTTA AGAATTTTCTCTCTCCATTTAGCAGGTATATCTTCAATTATAGGTGCAATCAATTTTATTACAACTATTCTAAATA TAAAAATTAAATCATTAAAATTTGAGCAACTTTCTTTATTTATTTGATCAATTAAAATTACTACAATTTTACTTTT ATTAGCAGTACCTGTTTTGGCAGGAGCAATTACCATGCTATTAACTGACCGTAATTTAAATACTTCCTTTTTTGAC CCTAGAGGGGGGGGAGACCCAATTTTATACCAACATTTATTT + + + +Etymology +. This species is named in honor of William Eberhard in recognition of his decades of study of the evolutionary biology of insect and spider reproduction, as well as the biology of pimpline ichneumonids parasitizing spiders. + + + + +Comments +. While the female (male unknown) of + +E. billeberhardi + +appears to be morphologically identical to that of + +E. maryjanewestae + +at our level of inspection, and both species parasitize the same species of crambid leaf roller feeding on rain forest +Piperaceae +in the same part of ACG, they are about 9% different in their DNA barcodes ( +Fig. 2 +), and therefore we are describing them as new, sibling species. However, this is still a tentative conclusion. Close inspection of the four “barcodes” of + +L. billeberhardi + +reveals that all four are the same pseudogene. While it would be logical, from the host data, to conclude that they are pseudogenes of the barcodes of + +L. maryjanewestae + +, which appears to be morphologically identical to + +L. billeberhardi + +, in fact they appear to be pseudogenes of the barcodes of + +L. wahli + +. However, + +L. wahli + +is exclusively a parasite of + +Herpetogramma phaeopteralis + +(a grass-feeding rain forest crambid that is very different from the Solanaceae-feeding rain forest crambid host of + +L. billeberhardi + +). This story will unfold further with additional samples and exploration. + + + + +Hosts +. + +Leurus billeberhardi + +is a very low density parasitoid, having been reared just four times from 490 wild-caught caterpillars of + +Rhectocraspeda periusalis +(Walker) + +( +Crambidae +), its sole host species, from among a sample of 65,000+ wild-caught ACG +Crambidae +caterpillars. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7941FFE4CED9FADBFC83F906.xml b/data/67/25/87/6725879F7941FFE4CED9FADBFC83F906.xml new file mode 100644 index 00000000000..abd3c09b941 --- /dev/null +++ b/data/67/25/87/6725879F7941FFE4CED9FADBFC83F906.xml @@ -0,0 +1,95 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +Genus + +Kathrynella +Omodeo 1996 + + + + + + + + +Type +species: + +Kathrynella guyanae +Omodeo 1996 + + + + +Alluroidids with a cylindrical muscular atrium (euprostate); male pores paired, intraclitellar, opening ventrally and equatorial in XIV. Spermathecal pores a pair, opening in intersegmental furrow 6/7. Modified setae +a +and +b +in VII; grooved penial setae ventral in XIV. Circulatory apparatus strongly developed, showing in the anterior segments long lateral commissures between dorsal and ventral vessels rolled into a ball. + +Kathrynella + +shares with + +Righiella + +the metandric condition of the male apparatus. The presence of sperm sacs and the absence of glandular lining of the atria may also be diagnostic ( +Omodeo & Coates, 2001 +). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7941FFEACED9F884FCEAFC79.xml b/data/67/25/87/6725879F7941FFEACED9F884FCEAFC79.xml new file mode 100644 index 00000000000..814eed8f7a3 --- /dev/null +++ b/data/67/25/87/6725879F7941FFEACED9F884FCEAFC79.xml @@ -0,0 +1,176 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Kathrynella guyanae +Omodeo 1996 + +(See +Fig 13 +) + + + + + + + +Kathrynella guyanae +Omodeo 1996 + +, 334. 11–15. +Fig 1A–N +, +2–5 +. + + +Body thread–like, flattened in clitellar and caudal regions, with deep intersegmental furrows conferring a moniliform appearance to the posterior half of worms. Longitudinal, latero–muscular grooves of body wall not observed but here recognized for +Figure 13A +. + + + + +FIGURE 13. + +Kathrynella guyanae +Omodeo 1996 + +. +A +. Ventral view of anterior segments. Note the pale lateral line. +B. +arrangement of genital organs. Abbreviations: a, atrium; gp, genital papilla; ♂, male pore; sp, spematheca; t, testis; ts, thickened septum. The penial setae are seen projecting from the male pore. Modified from +Omodeo (1996) +. + + + + +Length +85–89 mm +; diameter 600 µm at X, 520 µm at mid–body, segments 282, 259. No cutaneous pigmentation, integument transparent. Prostomium zygolobous, conical; peristomium short. Setae paired with lumbricin arrangement. Pygidium small, anus a vertical cleft. Clitellum annular, extending from the posterior part of XI to XVII; the ventral side of XIV with two large, circular papillae with swollen borders and a very thick, whitish, central part crossed by 4–5 transverse furrows; behind and beside these papillae two crescent–shaped fields visible, each bearing a single, large, grooved, penial seta. In all specimens examined, penial setae were broken but their length estimated as longer than 300 µm. No other ventral setae visible in XIV. Dorsal setal couples of midclitellar segments slanting relative to the long body axis, setae +c +located more posteriorly than setae +d +. Male pore as a slit on hinder portion of each crescent–shaped field in XIV; paired female pores on anterior border of XIV, near midventral line. No dorsal pores. Nephridiopores inconspicuous. Spermathecal pores in furrow 6/7 on setal line +a +. Setal ratio +aa:ab:bc:cd:dd +=5.6:1.1:5.6:1:10 at segment X; 2.5:1:1.5:1: +12 in +posterior segments (where all setae are displaced ventrad). The length of setae increases from II, where it is 37 µm, to VII where setae +a +and +b +measure 92 µm and setae +c +and +d +43 µm. Further posteriorly, the setal length decreases gradually (penial setae of XIV excepted), to become constant ( +ca +50 µm) behind the clitellum. Only caudal setae show distal ornamentation. + + +Body wall thin; cuticle approximately 0.5 µm thick; layer of circular muscles very thin. Septa 5/6–10/11 thickened, funnel–shaped. No pharyngeal pad distinguishable. Neither a gizzard, nor any apparent distinction between oesophagus and intestine present. Ciliated epithelium of intestine ending in clitellar region. Peri–intestinal blood sinus occurring from XII backwards. Holonephridia, apparently avesiculate, beginning in XII or XIII; initially poorly developed and acquiring normal size only behind clitellum. The circulatory apparatus exceptionally well developed. Dorsal and ventral vessels run the whole length of the worm and have very large diameters, only slightly less than that of the intestine. Seven pairs of long commissural vessels in V–XI, wound in balls whose size increases backwards; each ball covered with chloragocytes. A pair of large vessels originates in VII from the peri–intestinal blood sinus, and from XII to XVI run along the sperm sacs. Many lesser vessels seen everywhere, but no capillaries. Testes anterior in XI, facing the large seminiferous funnels, covered with sperm and bulging into segment XII. Sperm ducts coiled in XII in their proximal course, then running laterally within the body wall till XVII where they emerge again in the coelomic cavity, become thicker, and run forwards till XIV, where they form the atria. Atria possess thick muscular walls and appear as shining, bent, spindles which open in the middle of XIV, behind the penial setae; atria (which correspond to the ‘euprostates’ of +Eudrilidae +) with a thin external coating of non–glandular cells. Two long sperm sacs begin from septum 11/12 and run till XX, parallel to the egg sacs and to the posterior course of vasa deferentia. Ovaries located in the ventral forepart of XIII; two long cylindrical egg sacs, apparently beginning in XVII, extending as far back as XXXV; possessing thick glandular walls and containing up to a dozen large ripe eggs ( +ca +530 µm wide) between XXV–XXXV. Two large, convoluted spermathecae in VII; consisting of a short, partly ciliated duct and elongate ampulla; the ectal section of the latter containing the bulk of spermatozoa, whereas the ental section is filled with a hyaline secretion. The spermathecal length exceeds the body diameter and possibly the length of penial setae. It can be inferred that during copulation the sucker–shaped genital papillae in XIV help to fasten the two partners together, while at the same time the penial grooved setae are introduced into the spermathecae for sperm transfer. + + + + +Remarks. +In his elegant paper, +Omodeo (1996) +considered that + +Kathrynella guyanae + +showed traits, discussed here in a previous section, which were reminiscent of various ‘microdrile’ taxa. Omodeo saw two main differences (autapomorphies) of + +Kathrynella + +from the +Alluroididae +previously described i.e. the location of male pores in XIV and the metandric condition of the male apparatus which contrasted with the proandric condition of the +Alluroidinae +and the holoandric, supposedly plesiomorphic (cf. +Jamieson 1980 +), condition of the +Syngenodrilinae +. He noted a resemblance of the ‘atria’ of + +Kathrynella + +to the typical ‘euprostates’ of the +Eudrilidae +, an African family of unknown kinship. + + + + +Distribution +. Known only from the +type +locality in +Guyana +. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7942FFE7CED9FC51FAA9F9E1.xml b/data/67/25/87/6725879F7942FFE7CED9FC51FAA9F9E1.xml new file mode 100644 index 00000000000..fb7d735c7f9 --- /dev/null +++ b/data/67/25/87/6725879F7942FFE7CED9FC51FAA9F9E1.xml @@ -0,0 +1,136 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +Genus + +Brinkhurstia +Jamieson 1971 + + + + + + + + +Type +species: + +Alluroides americanus +Brinkhurst 1964 + + + + +Alluroidinae +in which the atria are very slender, much coiled tubes, prostatic cells surround the muscular sheath of the atrium, and the openings of each atrium into the rounded terminal, non–muscular chamber is separate from that of the corresponding vas deferens. Male pores ventrolateral. Ventral setal couples of XIII absent. Penial setae present. Spermathecal pore single, dorsal in IX. First septum 3/4; 10/11 not attenuated. First nephridia in IX? Intestine commencing in XIII–XV. No distinct seminal vesicles. + + + + +Distribution +. +Brazil +; Saint Lucia (Caribbean); +Argentina +; +Guyana +. + + + + +Remarks +. Unique features within the +Alluroidinae +of + +Brinkhurstia americanus + +are the extreme attenuation of the atrial prostates, the ratio width muscular tube of the atrium: width body being only 0.036 at maturity, and the presence of penial setae. The generic significance of the penial setae, +per se +, is questionable, however, as their presence or absence varies intragenerically in other families. + + + +Brinkhurstia + +resembles + +Standeria + +, and differs from + +Alluroides + +, in possessing at each male pore a distinct, rounded terminal chamber into which two ducts, positively identified as the atrium and vas deferens of the corresponding side, discharge ( +Fig. 3 +) but the chamber is exceptional in + +Brinkhurstia + +in being non–muscular. A particularly noteworthy difference from + +Standeria + +, shared with + +Alluroides + +, is the presence of prostatic cells ensheathing the atria. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7944FFE0CED9FA4BFA92FDA9.xml b/data/67/25/87/6725879F7944FFE0CED9FA4BFA92FDA9.xml new file mode 100644 index 00000000000..889788363c2 --- /dev/null +++ b/data/67/25/87/6725879F7944FFE0CED9FA4BFA92FDA9.xml @@ -0,0 +1,204 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Alluroides tanganyikae +Beddard 1906 + + + + + + + + + + +Alluroides tanganyikae +Beddard 1906: 215 + + +. + + + + + +Alluroides tanganyikae +Beddard + +(part.) + +Brinkhurst 1964: 528 + +; + +Brinkhurst & Jamieson 1971: 714–715 + +. + + + +(Non?) + +Alluroides tanganyikae + +; +Michaelsen 1913: 7 +; +1914a: 89 +; +1914b: 165 +; +1915: 29 +; +1935: 36 +. + + + + +Taken from +Brinkhurst and Jamieson (1971) +. + + +Length +30 mm +, width +1·5 mm +, segments 60. Prostomium long and pointed, transversely bisected by a constriction, but zygolobous. Ventral setal couples absent from XIII. Clitellum? Male pores on XIII in line with the ventral setae (of adjacent segments). Female pores in intersegment 13/ +14 in +ab +. Spermathecae single, pore middorsal in 8/9, with tumid periphery and very conspicuous. Septal glands obvious. Intestine beginning in XIX, transition from moniliform oesophagus abrupt. Chloragogen cells apparently beginning in IX. Nephridia? Atria a pair ending posteriorly in oval expansions; directed posteriorly to the pores. + + + + +Distribution +. Lake Tanganyika at about 10 fathoms (18.3 metres). + + + + +Remarks +. Since the last revision of this genus ( +Brinkhurst & Jamieson 1971 +) and owing to the fact that no new material has been collected and/or revised, the status of + +A. tanganyikae +Beddard (1906) + +remains uncertain owing to omissions and contradictions in the type–description and the paucity of information yielded by the +holotype +( +Brinkhurst 1964 +). Its inadequate characterization, together with an apparent difference in location of the male pores and in intestinal origin, have made it necessary to separate + +A. tanganyikae + +from the better–known material from Mt. Elgon referred to this species by +Brinkhurst (1964) +, the latter being regarded ( +Jamieson 1968 +; 1971) as a distinct species, + +A. brinkhursti + +. The affinity between + +tanganyikae + +and + +brinkhursti + +cannot be settled until topotypic material of the former taxon is collected from Lake Tanganyika, a lake noted for the high endemicity of its fauna. Occurrence of + +A. tanganyikae + +in the lake at a depth of +60 feet +(18.3 metres), whereas + +brinkhursti + +is a montane form, lends some support to taxonomic separation. Its affinities with + +pordagei + +are also uncertain but + +A. pordagei + +has been shown (Jamieson 1971) to be clearly distinguished from + +A. brinkhursti + +(Mt. Elgon and Ethiopian sub–species) in its extreme septal thickening. If this distinction is found to exist between + +pordagei + +and + +tanganyikae + +it will considerably strengthen the grounds for specific separation. They were merged as subspecies by +Michaelsen (1936) +. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7944FFE1CED9FD0DFA00FB9F.xml b/data/67/25/87/6725879F7944FFE1CED9FD0DFA00FB9F.xml new file mode 100644 index 00000000000..fc97327e515 --- /dev/null +++ b/data/67/25/87/6725879F7944FFE1CED9FD0DFA00FB9F.xml @@ -0,0 +1,121 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Alluroides ruwenzoriensis +Brinkhurst 1964 + +(See +Fig 9 +) + + + + + + + + + +Alluroides ruwenzoriensis +Brinkhurst 1964: 531 + + +, fig. 4; + +Jamieson 1968: 74 + +; + +Brinkhurst & Jamieson 1971: 714 + +. + + + + +Length +100 mm +, width just exceeding +1 mm +, segments 150. All segments, except first 2 or 3, triannulate. Setae broad, simple pointed; ventral couples absent from XIII at maturity. Spermathecal pores middorsal on +VII +and +VIII +(also on +VI +in +one specimen +). Sperm funnels, testes, seminal vesicles and ovaries as in + +pordagei + +. Atria elongate with glandular covering, standing vertically in XIII to which they are restricted. Vas deferens thin walled, joining the median face of the atrium about midway along the length of the latter. Each atrium narrowing distally and terminating in a well–defined penis which is visible externally on a raised papilla. Spermathecae single (in one case the spermathecal duct had 2 unequal ampullae) + +. + + + + +Distribution +. +Uganda +: Ruwenzori Mountains (lakes and stream at 3816 and +3930 m +., Nyamagasani Valley). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7945FFE7CED9FA46FCFFFC31.xml b/data/67/25/87/6725879F7945FFE7CED9FA46FCFFFC31.xml new file mode 100644 index 00000000000..16a344cd2d6 --- /dev/null +++ b/data/67/25/87/6725879F7945FFE7CED9FA46FCFFFC31.xml @@ -0,0 +1,181 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Barriejamiesonia aberratus +Ljungström 1971 + + + + + + + + + + +Barryjamiesonia aberratus +Ljungström 1971: 322–323 + + +. + + + +Maximum length +58 mm +. Greatest width in front of clitellum +1 mm +. Body round in cross–section, clitellar region dorsoventrally flattened. Colour, unpigmented white. Cuticle non–iridescent. Lateral grooves absent. Number of segments 127, 129 (plus about five undifferentiated and asetal segments) and 142, all segments smooth except VIII which is biannulate. Prostomium prolobous. Setae present from II and of equal size throughout; +cd +present on clitellum; no modified setae; +ab +present in XIII. Setal ratio on X: +aa:ab:bc:cd +=8.3:1:8.3:1, DD=0.44 C. Nephropores minute in straight lines in 1/2 +BC +, situated in intersegmental furrows. Dorsal pores absent. Clitellum pink reddish or whitish, smooth, saddle–shaped throughout down to B, intersegmental furrows obliterated down to B, on XII–XV or XII–XVI, ending at 11/12 and 15/16 or 16/17, anterior and posterior borders indistinct. Spermathecal pores one pair on extreme posterior margin of VIII in 1/2 BC. The pores big, slit–like and surrounded by glandular lips that form a transverse oval. Female pores minute, each visible as a black spot in 13/ +14 in +A. Seminal grooves absent. Genital markings circular, +0.36 mm +in diameter, low but protuberant from the body wall as glandular discs; post–setal and situated in file with protuberances around the atria in AB on XIII left, XIV and XV or XIV and XV. + + + +First septum in 5/6 behind which all are present, 5/6–10/11 somewhat and equally thickened and conical with posteriad apex or 5/6–8/9 equally thickened and then gradually becoming thinner from 9/10 to 11/12 but 5/6–11/12 conical. Gizzard absent. Septal glands in V–VII depending from anterior face of 5/6–8/9, covering dorsal face of gut. Extra–mural calciferous glands absent. + + +Hearts +(commissures) in X (not seen in +XI +) or in XI (not seen in X +). +Nephridia +holonephric, recognizable from +VII + +. + +From +VII + + +to about XX they are big, leaf–shaped and surrounded by a layer of (? connective) tissue. +Testes +and their funnels, one pair, free in +X. Male +ducts running in A under peritoneum back to XIII where they fuse with the ectal end of the atrial chamber. +Ovaries +probably in XIII, ovisac, oviduct and ovifunnels not seen. +Seminal +vesicles two pairs. +In +one specimen +the anterior are small, depending from 9/10 into +IX + + +and the posterior pair big depending from 11/12 into XII. +In +the other specimen both pairs are vestigial, the anterior pair depending from 9/10 into +IX + + +and the posterior pair from 10/11 into +X. Prostates +one pair originating in XIII. +The +prostatic duct swells up into a muscular (sheen present) bursa at parietes. +The +bursa somewhat spindle–shaped; from the bursa the duct gradually attenuates towards the gland from which it is not sharply demarcated. +Prostate +glands reaching to 19/20 on right and to 20/21 on left side in one worm. +The +greatest width of the bursa +0.25 mm +, of the duct +0.1 mm +and of the gland (in +XIII +) +0.27 mm +. +Genital +marking glands, two pairs, circular, rather flat, acinous; free in the coelom in XIV and XV (specimen with GM on XIV, +XV +) + +. + +Parthenogenesis is suspected. + + + +Distribution +. Natal. N41. Scottsburgh, Port Shepstone road. Aquatic, just below and near water’s edge. + + + + +Remarks +. During the preliminary identification the specimens were thought by Ljungström to represent an aberrant ocnerodriline. No data on spermathecae were provided in the original description, and the only information refers to its empty nature. Distinction from + +Standeria + +is uncertain. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7946FFE1CED9FA71FD08FD8D.xml b/data/67/25/87/6725879F7946FFE1CED9FA71FD08FD8D.xml new file mode 100644 index 00000000000..cd93dd02641 --- /dev/null +++ b/data/67/25/87/6725879F7946FFE1CED9FA71FD08FD8D.xml @@ -0,0 +1,302 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Alluroides pordagei +Beddard 1894 + +(see +Fig 8 +) + + + + + + + + + +Alluroides pordagei +Beddard, 1894: 244 + + +, +Fig. 4 +, +5 +. + + + + + + +Alluroides pordagei +Beddard, +Michaelsen 1900: 106–107 + + +; + +Brinkhurst 1964: 527 + +. + +Jamieson 1968: 75 + +, +Fig. 15 +–18; + +Brinkhurst & Jamieson 1971: 713–714 + +, +Fig. 14.3D, E +. + + + + +? + + +Alluroides tanganyikae +Beddard. +Michaelsen 1913: 7 + + +, Pl. XIX, +Fig. 9 +; 1914 a: 89; 1914 b: 165, Pl. V. +Fig. 13 +; 1915: 29; 1935: 36; 1936: 37 (part.) + + + +(Non) + +A. tanganyikae +Beddard 1906 + +. + + + + + +Length +25–48 mm +, width 1.0 mm, segments 202. Prolobous. Form approximately cylindrical throughout, anterior segments at least biannulate with the transverse furrow shortly postsetal. Lateral line in +bc +, nearer to +b +than to +c +. Anus terminal. Ventral setal couples of XIII absent at maturity; all setae sigmoid, with approximately central, well–developed node; none modified as genital setae. Outer setal couples dorsal, +dd:u +=ca 0.2. Clitellum annular, XII–XVI. Male pores a pair precisely lateral, or slightly ventrolateral, nearer to +b +than to +c +lines in the setal arc of XIII, each surrounded by a circular tumescence almost filling the segment longitudinally. Female pores in 13/14 directly in line with the male pores, inconspicuous. Spermathecal pore paired or single, dorsal and anterior in +VIII +, in the +type +paired near the dorsal midline + +. + + + +FIGURE 8. + +Alluroides pordagei +Beddard 1894 + +. +A +. Longitudinal section of the anterior region of the body of Beddard’s paratype. +B +. Spermatheca. +C +. Longitudinal section of wall of atrium. +D +. Transverse section of atrium. Abbreviations: at, atrium; at ch, atrial chamber; br, brain; cil, cilia; ep, epidermis; epi, epithelium; gl duc, glandular ductule(s); gl sh, glandular sheath; int, intestine; lum, lumen; m, mouth; ph m, pharyngeal musculature; per, peritoneum; sep.gl, septal gland; sp, spermatheca; sperm, spermatozoa; sph, sphincter; sp epi, spermathecal epithelium; sp m sh, muscular sheath of spermatheca; v.d, vas deferens.. Slightly modified from +Jamieson (1968) +. + + +Septa 4/5 (the first clearly developed), 9/10 exceptionally strongly thickened, 10/11 thin and attenuated, 11/12 and (though less so) 12/13 moderately thickened, the succeeding septa thin. Septal glands posterior in V– IX? Nephridia commencing in XII–XVI. Pharynx anterior to septum 4/5. Intestine commencing in XIII, internal epithelium with tall cilia; oesophagus similarly ciliated in XII in front of the oesophageal valve; ciliation not certainly present further anteriorly. Brown–granuled chloragogen cells commencing (always?) at 1/2 IX. Dorsal blood vessel large and adherent to the gut in XIII posteriorly; slender and freer anteriorly to this. Hearts (posterior commissural) very tortuous extending posteriorly into XI(XII?). Septum 10/11 bulging posteriorly far into XI to form a wide–mouthed (unpaired?) seminal vesicle. Muscular tubes of the atria forming slender somewhat coiled tubes extending from XIII into XIV or as far as XVI and widening immediately before opening at the male pores. With the exception of the terminal ectal chamber each tubular atrium surrounded by a sheath of unicellular prostate cells, which approximately doubled the width of the apparatus, the cells communicating with the atrial lumen by minute ductules. Vasa deferentia running in the glandular prostatic duct and presumably entering the atrium entally. Ovaries and funnels in XIII. Oviduct penetrating the body wall immediately behind septum 13/14. Female gonadial cells, at maturity, in XIII–XXI, probably in ovisacs. Spermatheca single or paired, dorsally in VIII. + + + +Distribution +. +Kenya +: swamp +4 miles +inland from +Mombasa +( +Type +locality, +Beddard 1894 +); lower forest region of Mt. +Kenya +at +2400 m +( +Michaelsen 1914 a +, b; +Michaelsen 1915 +, as + +A. tanganyikae + +); Kahawa stream, Athi River tributary, near Nairobi, collector B.G.M. Jamieson, +11 Dec. 1967 +. +Republic of the Congo +: Mulongo, Niunzu; Albertville ( +Michaelsen 1935 +); Leopoldville ( +Michaelsen 1936 +). +Rhodesia +: swampy earth, Zambezi River, near Victoria Falls (as + +A. tanganyikae, +Michaelsen 1913 + +). + + + + +Remarks +. Because of the uncertain status of Michaelsen’s material this account (from +Jamieson 1968 +) was derived solely from Beddard’s +type +–series, and his description, and incorporated results of examinations by +Brinkhurst (1964) +and Jamieson (Athi River material). + + +The extreme septal thickening, and its distribution, now emerge as diagnostic features of + +A. pordagei + +(condition still unknown, however, in + +A. tanganyikae +s + +. Beddard and s. Michaelsen). Intraspecific variation from a paired to a single spermatheca (in VIII) is confirmed and reinforces Brinkhurst’s conclusion (1964) that + +A. tanganyikae +s + +. Michaelsen (spermatheca single in VIII), but not +s +. Beddard (spermatheca single in IX), should be included in + +A. pordagei + +. + + +The decision by +Michaelsen (1936) +to recognize three subspecies, + +pordagei + +, + +tanganyikae + +and +congicus +, has not been followed here though it still deserves consideration. + +A +. +tanganyikae + +has been retained as a distinct species but recognition of +congicus +, from Leopoldsville, as a subspecies appears reasonable. Michaelsen distinguished it by the spermatheca with a thin–walled, sac–like ampulla and sharply demarcated muscular duct. He added that +congicus +was +90–100 mm +long, with +ca +210 segments, the largest form, whereas the typical subspecies was +22 mm +long, the smallest form, while + +tanganyikae + +had a length of +45 mm +, with +ca +150 segments, intermediate between the two other forms. Some of these figures no longer hold. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7949FFD3CED9FBC6FD60FF49.xml b/data/67/25/87/6725879F7949FFD3CED9FBC6FD60FF49.xml new file mode 100644 index 00000000000..f4d603506a3 --- /dev/null +++ b/data/67/25/87/6725879F7949FFD3CED9FBC6FD60FF49.xml @@ -0,0 +1,213 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Syngenodrilus lamuensis +Smith & Green 1919 + + + + + + + + + + +Syngenodrilus lamuensis +Smith & Green 1919: 145 + + +, +Fig. 1–8 +. + + + + + + +Syngenodrilus lamuensis +Smith & Green. +Gates 1945: 393 + + +; + +Pickford 1945: 397 + +; + +Jamieson 1968: 85 + +; 1971: 719. + + + +Length +52 mm +, width +4 mm +, segments137. Clitellum annular 2/3 XI–XVI. A copulatory band extends from 11/12 to setal arc XIV and filling +bc +. Setae very small; +aa +: +ab +: +bc +: +cd +: +dd +=17: 1:17 0.9:92; +dd +=0.6 U, +bc +=1.0 +aa +; present in the clitellar region. Nephropores commencing at the anterior margin of IV; some midway between +cd +and the mid–dorsal line others in +cd +. Male pores at the anterior margin of XIII at about 3/5 +bc +. Prostate pores intrasegmental in XI, XII and XIII, slightly dorsal of setal line +b +, presumably paired. Female pores slightly anteriad and dorsal to setae +b +of XIV. Spermathecal pores two pairs immediately in front of intersegmental furrows 7/8 and 8/9, slightly ventral of setal lines +c +. + + + + + +Septa +5/6–7/8 very strong. 8/9–12/13 very thin and imperfect. +Strong +gizzards in +VIII +and +IX +. +Intestine +commencing in XII or XIII, but oesophagus widened between it and the gizzard. +No +calciferous glands, intestine lacking typhlosole. +Hearts +in +VI +–XI (XII?), possibly absent from +X. Nephridia +paired; absent from I–III, XI and XII; with pyriform terminal dilatation. +Testes +and funnels paired in X and XI and enclosed in (unpaired?) testis–sacs containing hearts and nephridia. +Seminal +vesicles of the microdrile +type +, a pair extending backwards in the ovisacs to XX. Vasa deferentia lacking terminal atria. Three pairs of short tubular prostates, in XI, XII and XIII, opening separately from the male pores by very short ducts which are confined to the body wall. Penial and genital setae absent. Ovaries extensive in XIII; funnels broad and short on the anterior face of septum 13/14. Ovisacs extending posterior of XXII. Eggs yolky. Spermathecae two pairs, in +VIII +and +IX +, each with an irregular, simple tubular ampulla, +ca +0.35 mm +wide and somewhat longer than the duct which is +0.07–0.1 mm +wide: lacking diverticula + +. + + + + +Remarks +. +Gates (1945) +and +Pickford (1945) +rightly argued for exclusion of + +Syngenodrilus + +from the +Moniligastridae, They +recognized its affinity with the +Alluroididae, Gates +tentatively suggested inclusion in this family but Pickford advocated retaining a separate family +Syngenodrilidae +. Both authors noted that it differs from the +Alluroidinae +in possession of a well–developed, double oesophageal gizzard, in having simple + +Sparganophilus + +- like prostate glands which are not related to the male opening and in the absence of a moniligastrid–like atrium at the ectal end of the vas deferens. + + + + +Distribution +. +Kenya +: +Lamu +(Habitat unknown). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7949FFECCED9FEABFA04FC43.xml b/data/67/25/87/6725879F7949FFECCED9FEABFA04FC43.xml new file mode 100644 index 00000000000..169f60c5abe --- /dev/null +++ b/data/67/25/87/6725879F7949FFECCED9FEABFA04FC43.xml @@ -0,0 +1,130 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +Genus + +Syngenodrilus +Smith & Green 1919 + + + + + + + + +Type +species: + +Syngenodrilus lamuensis +Smith & Green 1919 + + + + +Slightly modified from +Jamieson (1968) +. + + + +Lateral lines unknown. Genital and penial setae absent; the dorsal median intersetal distance=0.6 of the circumference of the body (dd=0.6 U). Clitellum commencing in XI; intraclitellar tubercula pubertatis present. Male pores one pair lateral and anterior in XIII. Prostate pores separate from the male pores on XI, XII and XIII. Female pores in the setal arc of XIV. Spermathecal pores two pairs, posterior in +VII +and +VIII +. Two gizzards present, one in each of +VIII +and +IX +. Nephridia with pyriform terminal bladders. Holandric, testes in X and XI enclosed in testis– sacs. Sperm funnels with their mouths directed ventrally. Seminal vesicles of the microdrile +type +, +i.e. +extending posteriad within the ovisacs through several segments. Sperm ducts simple, prostate glands entirely separate + +. + + + + +Distribution +. +Kenya +; +Martinique +?. + + + + +Remarks +: An aquatic worm found in +Martinique +by +Chagné and Giani (1998) +was identified as +Syngenodrilinae +gen. sp. +However, the identification was made based on thickness of the clitellum (a single layer of cells) and its extent (XIII–XIX), dorsal location of the setae, presence of septal glands in V, VI, VII and VIII, holandry (testes and male funnels), a pair of ovaries in XIII and presence of lateral spermathecae in IX. Key characters such as position of male pores, number of gizzards, prostatic glands and penial and genital setae were not mentioned. Accordingly, this worm cannot be assigned with certainty to this subfamily. With the available information it might be considered more related to the alluroidid Mexican genus + +Lacandodrilus + +(but see Remarks to the +Martinique +species below). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F794AFFEECED9F935FC67FEF1.xml b/data/67/25/87/6725879F794AFFEECED9F935FC67FEF1.xml new file mode 100644 index 00000000000..c1bb799c3f7 --- /dev/null +++ b/data/67/25/87/6725879F794AFFEECED9F935FC67FEF1.xml @@ -0,0 +1,119 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +Genus + +Standeria +Jamieson 1968 + + + + + + + + +Type +species: + +Standeria transvaalensis +Jamieson 1968 + + + + +Alluroidinae +in which the atria have narrow ducts and bulbous ental ends, the prostatic cells are solely internal to the muscular sheath of the atrium, and the opening of each atrium into the terminal chamber is separate from that of the corresponding vas deferens. Male pores ventral at the sites of the absent ventral setal couples of XIII. Genital setae present. Spermathecal pores paired, lateral in IX. First septum 4/5; 10/11 attenuated. First nephridia in XI. Intestine commencing in XV. No distinct seminal vesicles. + + + + +Distribution +. +Mpumalanga Province +, in the former Transvaal, (Lake Chrissie). + + + + +Remarks. + +Standeria + +shows some notable resemblances to + +Brinkhurstia + +which distinguish the two genera from + +Alluroides + +. In both, rounded terminal male chambers each receive an atrial duct and a second duct which in + +Brinkhurstia + +is known to be the vas deferens and in + +Standeria + +is apparently so. Furthermore, in both genera the atria are significantly thinner relative to the body width than those of + +Alluroides + +. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F794BFFEDCED9FE11FB5EF825.xml b/data/67/25/87/6725879F794BFFEDCED9FE11FB5EF825.xml new file mode 100644 index 00000000000..0a1a771bc46 --- /dev/null +++ b/data/67/25/87/6725879F794BFFEDCED9FE11FB5EF825.xml @@ -0,0 +1,154 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Standeria transvaalensis +Jamieson 1968 + +(see Figs 16,17) + + + + + + + + + +Standeria transvaalensis +Jamieson 1968: 82–84 + + +, fig. 1, 2, 4–8; + +Brinkhurst &Jamieson 1971: 717–718 + +, fig. 14.1A; 14.2A–F. Length +25 mm +, width 1.1–l. +4 mm +, segments 82. Prostomium epilobous 1/2 although lacking a separate dorsal tongue. Form cylindrical; somewhat flattened ventrally at the clitellum. Lateral lines conspicuous, in mid +bc +; the posterior third of IV and a number of more posterior segments set off as a distinct annulus. Intersetal ratios in XII; +dd +=0.2 +bc +=1.7 +aa +; ventral pairs absent in XIII; replaced in XIV and XV on each side by 6 enlarged genital setae located within paired papillae. Lengths of 4 of 6 genital setae on the left side in XIV= +0.33–0.35 mm +. Length of lateral setae from the same segment +0.19 mm +. Neither +type +of seta with distinct node but both sigmoid with tapering extremities. Greatest widths: 15 µm for a genital seta and 10 µm for a lateral seta; ornamentation absent. Clitellum saddle–shaped; apparently extending from 1/2 XII– +ca +XV, 1/2 XVI, 1/2 XVII (=3 1/2, 4, 5 segments); ventral margins at +ca +1/4 +bc +. Male pores crescentic slits on low porophores at the sites of the absent ventral setae of XIII. Each porophore continuous posteriorly with a slight tumescence which extends to approximately midway between the former and the setal zone of XIV; female pores indentations at the posterior limits of each tumescence, anterior in XIV. Ventral setal couples of XVI and XVII each on slight but distinct protuberances. These protuberances confluent medially to form feebly developed transverse pads of glandular appearance. Spermathecal pores 1 pair, conspicuous in intersegmental furrow 8/9, lateral of setal lines +b +with very large tumescent anterior and posterior lips each of which occupies a third of the adjacent segment. Nephropores in setal lines +a +very close to the setal follicles. + + + + +FIGURE 16. + +Standeria transvaalensis +Jamieson 1968 + +. +A +. Paratype 2. The two atria +in situ +in segment XIII, +B +. Paratype 1. Atrial duct and vas deferens opening into the ectal atrial chamber. Abbreviations: atd, atrial duct; atsac, saccular portion of atrium; atch, terminal chamber of atrium; dvd, dilatation of the vas deferens; mus, muscle fibres; of, oviducal funnel. Adapted from +Jamieson (1968) +. + + + + +FIGURE 17. + +Standeria transvaalensis +Jamieson 1968 + +. Ventral view of forebody. Abbreviations: clit, clitellum; o, female pore; gen, papillae bearing genital setae; ♂, male pore; pad, ventral pads; pr, prostomium; sp, left spermathecal pore; From +Jamieson (1968) +; +Brinkhurst & Jamieson (1971) +. + + +Septa: 4/5 the first visible, it and 12/13 slightly thickened. 5/6, 7/8, 9/10 and 11/12 relatively strongly thickened; 6/7 and 8/9 moderately thickened; 10/11 and 13/14 unthickened and very delicate, as are 14/15 and succeeding septa. Septal glands attached dorsally to anterior faces of septa as far as 9/10 and also 11/12, 12/13? Oesophagus beginning in IV, widening to form the intestine, which is at least twice as wide, in mid–XV; longer and more slender in XIII than in other segments. Dorsal and ventral blood vessels single. No subneural vessel. A pair of commissural loops winding far laterally present in XII anteriad. Nephridia open holonephridia, at least as far anteriorly as XI; lacking bladders. Proandric; large lobed testes ventral and anterior in X embedded in free morulae and abundant spermatozoa which fill the remainder of the segment. Sperm funnels large, convoluted areas of septum 10/11, seminal vesicles absent. No reproductive organs or cells in XI. On each side, overlying the external male pore on XIII is a rounded muscular atrial chamber into which discharges the tubular entally dilated atrium of the corresponding side. Its ectal portion narrowed to form a slender duct which curves ventrally and medially to join the anterolateral aspect of the atrial chamber. This ectal region obscured by a web of muscle fibres, passing from the ventral to the lateral body wall, which bind it to the latter. A second, spindle–shaped sac about the width of the atrial duct, projects from the junction of the atrial chamber with the duct and apparently represents the thickened end of the vas deferens. The walls of the atria and of the appended sacs lined by cuboidal epithelium outside which is a layer of circular muscle fibres several times as thick. The wide lumen of the atrial chamber lined by columnar epithelium outside which is a thick sheath of radial and circular muscle fibres. Glandular investment of these male terminalia absent. Ovaries in XIII. Septum 13/14 evaginated posteriorly on each side as a broad funnel continuous into XIV as a slender oviduct. Spermathecae a pair of elongated, adiverticulate pouches in IX; their scarcely narrowed ducts being almost wholly embedded in the body wall. + + + +Distribution +. +South Africa +: +Mpumalanga Province +, in the former Transvaal, (Lake Chrissie). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F794DFFE8CED9FB29FE87F99D.xml b/data/67/25/87/6725879F794DFFE8CED9FB29FE87F99D.xml new file mode 100644 index 00000000000..dbad4ad33f0 --- /dev/null +++ b/data/67/25/87/6725879F794DFFE8CED9FB29FE87F99D.xml @@ -0,0 +1,103 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +Genus + +Righiella +Omodeo & Coates, 2001 + + + + + + + + +Type +species: + +Righiella jamieson + +i +Omodeo & Coates 2001 + + + +Alluroidinae +with large, coiled prostates having a thin muscular sheath surrounded by a thick glandular sleeve. The vas deferens enters the prostate, not ectally but at the ental tip. Metandric, male pores lateral in XIII, in the place of the absent ventral setae. A large unpaired spermatheca formed by duct and ampulla situated in pregonadial segments, opening in the mid–dorsal line. Lateromuscular groove conspicuous. + + + + +Remarks +. + +Righiella + +differs from the African genera and + +Brinkhurstia + +in being metandric, from + +Kathrynella + +by the position of the male and spermathecal pores, and from both American genera in the absence of penial setae ( +Table 1 +). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F794DFFEFCED9F9FDFDC8F9DF.xml b/data/67/25/87/6725879F794DFFEFCED9F9FDFDC8F9DF.xml new file mode 100644 index 00000000000..0d3358b3990 --- /dev/null +++ b/data/67/25/87/6725879F794DFFEFCED9F9FDFDC8F9DF.xml @@ -0,0 +1,183 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Righiella jamiesoni +Omodeo & Coates, 2001 + +(see +Fig 15 +) + + + + + + + +Righiella jamiesoni +Omodeo & Coates, 2001 + +, 45–46, +Figs 5B +– +7 +. + + +Length +35 mm +, width +0.8 mm +. Body slender, cylindrical, tapering posteriorly. Lateral lines evident in IV–XIV. Segments 105, multiannulated. Anus terminal. Clitellum annular XII–2/3XV. Male pores in XIII in the place of absent setae +ab +. Female pores in furrow 13/ +14 in +setal line +a +. Spermathecal pore mid–dorsal in furrow 7/8. Setae sigmoid, slender, unsculptured, the longest in X, ca 180 µm, their length decreasing anteriad and posteriad, measuring 134 +µ +m in V and 156 +µ +m in XVI. At XX, +aa +: +ab +: +bc +: +cd +: +dd +=approximately 3.0:1.0:4.5:1.0:3.8. No penial setae. Cuticle 1.8 +µ +m thick. + + + + +FIGURE 15. + +Righiella jamiesoni +Omodeo and Coates 2001 + +. +A +. Scheme showing arrangement of genital organs and vascular commissures. +B +. Cross section through spermathecal duct; +C +. Cross section through prostate. Abbreviations: a, spermathecal ampulla, at, male atrium, cv, commissural vessels, d, spermathecal duct, md, male duct, os, egg sac, pr, prostate, sps, sperm sac. From +Omodeo and Coates (2001) +, reproduced with permission. + + + + + +Septa 4/5–11/12 fairly thick. Septal glands in V– +VIII +moderately developed. Nephridia without bladders, beginning in XVII. Intestine moniliform beginning in XIV; maximum diameter in XVII. Perienteric sinus beginning in XIV; commissural vessels sinuous, moderately large (diameter 18 µm) in V–XI. Muscular fibres of the body wall ribbon–shaped, +ca +3 +µ +m thick and 25 µm high. Sperm funnels in the posterior part of XI; testes regressed; sperm sacs in XIV–XVIII. Male ducts convoluted in XIII, inserting into the prostates at their ental tips. Prostates confined to XIII; formed by an inner epithelial layer surrounded by a thin layer of muscle fibres and covered by long digitiform glands formed by cells with small nuclei; this covering disappears in the convoluted ectal portion which terminates with a penis enclosed in the terminal globular chamber. Ovaries and female funnels regressed in the posterior part of XIII, egg sac regressed, in XIV–XXIII? +Two eggs +in XXII and XXIII, measuring 300 by 400 µm. The spermatheca with a large globular ampulla in XII and a long duct opening in 7/8; the ectal portion of the duct filled with sperm, the ental portion narrow. Ampulla contained mucous matter containing mineral particles, fragments of sponge spicules and young gregarine trophozoites + +. + + + + +Distribution +. Collected in a pool, between buried roots, twigs, mud and silt, next to Kurupukari creek flowing into +Essequibo +River, +Guyana +. + + + + +Remarks +. + +Righiella jamiesoni + +lacks penial setae, an absence otherwise peculiar to the African +Alluroidinae +, but it is metandric whereas all African species are proandric; it also has more complex spermathecae. + +Righiella + +also resembles the South American + +Kathrynella + +, but that metandric genus has the male pores in XIV, has penial setae and has two simple spermathecae and thick muscular euprostates ( +Omodeo and Coates, 2001 +). + + +Intestinal contents were organic matter and a few sand granules together with fragments of spiculae of freshwater sponges. The gut lumen of XVI through XL harboured many astomatous ciliates attributable to + +Anoplophrya + +, a common commensal of oligochaetes. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F794FFFE8CED9F95CFBB6FBE9.xml b/data/67/25/87/6725879F794FFFE8CED9F95CFBB6FBE9.xml new file mode 100644 index 00000000000..b54d0f052a1 --- /dev/null +++ b/data/67/25/87/6725879F794FFFE8CED9F95CFBB6FBE9.xml @@ -0,0 +1,166 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Lacandodrilus paludosus +Fragoso & Rojas 2023 + + + + + + + + +Lacandodrilus paludosus +Fragoso & Rojas 2023 + +, 5255 (1), 136–156. + + +Maximal length +58 mm +. width, midbody +0.64 mm +; number of segments 248. Secondary annulation one pre– and one post–setal throughout the body. Pigmentless. Prostomium prolobious. Setae eight per segment, present from II; closely paired throughout. Setae of preclitellar segments conspicuous and with replacements. Setae +a +and +b +of preclitellar segments 130–150 µm long, almost straight, with a slight nodulus close to the basal end; without ornamentation. Setae +ab +of XI and XII larger, replacement setae 64 and 93 µm long; seta +c +(112 µm) and +d +smaller than seta +a +and +b +. Behind clitellum all setae similar (slightly curved and without ornamentation) measuring 105–117 µm. Setae +aa:ab:bc:cd:dd +at X: 3.7:1:4.7:0.9:9.2 and 0.54 +dd +; +dd +=½C ( +cd +dorsal); at XXX: 5.7:1:5.3:1:14.2 and 0.7 +dd +=½C ( +cd +slightly dorsal); ten segments before anus: 2.9:1:2.4:1:14.4 and 1.2 +dd +=½C ( +cd +ventral). Clitellum annular, from ½XII–½XVI, very thin. Dorsal pores absent. Spermathecal pores not visible. Female pores in XIV, presetal in AB. Nephridial pores not visible. Lateral lines (latero–muscular grooves) in BC close to C, from II or III to XIV, XVI or XX and more posterior segments; in one individual in CD. + + + + +FIGURE 14. + +Lacandodrilus paludosus +Fragoso & Rojas 2023 + +. +A +. External view of the anterior ventral region of a clitellate adult. +B +. Internal view of the anterior region of an adult. +C +. Spermatheca. Abbreviations: a, ampulla: clit, clitellum; d, duct; dv, dorsal vessel; gg, genital glands (prostates?); img, internal male gonoducts; mf, male funnels; n, nephridia; oe, oesophagus; sg, septal glands. Modified from +Fragoso & Rojas (2023) +. + + + + +Septa all thin and membranous. Paired septal glands in V, VI, VII, VIII and IX (in X incipient), attached to corresponding posterior septum, mixed with lateral vascular commissures. Gizzard, caeca and typhlosole absent. Oesophagus moniliform, with no distinct transition to intestine. Dorsal vessel single; sometimes increasing from XIV posteriad. Vascular commissures long and contorted in segments V?, VI–XI; embedded in septal glands. Ventral vessel present. Ventral holonephridia from XI backwards; covered by a granular peritoneal layer giving them an ovoid, flat appearance; this ovoid portion floating in the coelom, and not attached to septa. Nephridia gradually increasing in size and from XV attaining maximal size; exonephric (opening in +ab +) and probably open (stomate). Holandric; iridescent male funnels in X and XI; those of XI the larger; testes not seen. Both funnels enclosed in seminal vesicles. Male gonoduct coming from male funnels of X entering the body wall in XI; a second gonoduct coming from funnels of XI entering the body wall in XII. Both male ducts intraparietal over XI, XII and 3/4 of XIII (deduced from the externally observed, undulating cream band). Accordingly, male pore deduced to be in XIII, postsetal and in BC. One pair of sausage–shaped vesicles in XI; projecting in posterior direction from XII until segments XVIII or XX and running dorsolateral of the digestive tract, completely covering it. In X another pair of vesicles that also contain male funnels that run in anterior direction before turning over 180° and which, apparently, are limited to XII. Two pairs of lobulate, rosette–shaped glands internally on the ventral body wall XIII and XIV, the anterior the larger; composed of several short lobules, deduced to be prostatic glands. No tubular, atrium–like glands present. Large ovaries in XIII projecting from the ventral portion of 12/13 at AB and extending over the entire segment. Female funnels on the ventral wall of XIII very close to 13/14, in AB, and with a duct opening in XIV before setae +ab +. Septum 13/14 apparently modified as dorsolateral paired ovisacs that contain the corresponding seminal vesicles of XII and extending backwards until XVIII or XX. One pair of adiverticulate spermathecae in X opening ventrally in 9/10, at AB, the duct turned 180° to connect with a sausage–shaped ampulla. Total length of spermathecae 580 µm, 370 µm the ampulla, and 210 µm the duct. + + + + +Distribution +. +Mexico +, +Chiapas +, Lacandon tropical rain forest in semi–inundated gley soils at +30–40 cm +depth. + + + + +Remarks +. This species was considered as gen.nov.sp.nov.4, but not named, by +Fragoso & Lavelle (1987) +. Fragoso and Rojas (2033) suggest that future morphological and molecular evidence might render + +Lacandodrilus + +the +type +of a new family within the order +Alluroidida +. The absence of normal atria and presence of two pairs of prostates not associated with the male pores lend some support to this proposition. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F794FFFEACED9FB93FB80F93E.xml b/data/67/25/87/6725879F794FFFEACED9FB93FB80F93E.xml new file mode 100644 index 00000000000..1dd4bd0b5ad --- /dev/null +++ b/data/67/25/87/6725879F794FFFEACED9FB93FB80F93E.xml @@ -0,0 +1,108 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +Genus + +Lacandodrilus +Fragoso & Rojas, 2023 + + + + + + + + +Type +species: + +Lacandodrilus +Fragoso & Rojas 2023 + + + + +Setae eight per segment, closely paired, +ab +ventral, +cd +dorsolateral, all setae simple, straight, with a node. Clitellum annular. Septal glands in perigonadial segments. Gizzard, oesophageal glands and typhlosole absent. Dorsal vessel simple. Long and contorted vascular commissures embedded within septal glands and located before XII. Holonephric, ovoidal nephridia covered by a granular peritoneal layer. Holandric, with testes and sperm funnels in X and XI and paired male pores in XIII. Male gonoducts intraparietal. Seminal vesicles long, extending several segments backwards within ovisacs. Genital paired lobular glands (prostates?) in XIII and XIV. Metagynous, with large ovaries in XIII and paired female pores in XIV, presetal to AB. Paired spermathecae before XI, without diverticula and with ventral pores. Segment XII lacking gonads. + + + + +Remarks +: With the +Alluroididae + +Lacandodrilus + +shares the pair of male pores and single pair of ovaries in XIII, presence of septal glands and (assumed) the single–layered clitellum. However, it differs in the absence of tubular or globular atria and the intraparietal nature of the male gonoducts; it also differs in the number of testes (holandric, two pairs in X and XI vs. proandric one pair in X or metandric–one pair in XI). Intraparietal male gonoducts also occur in +Sparganophilidae (Jamieson 1971) +. + + + + +Distribution +. +Chiapas +, Lacandon tropical rainforest southeastern +Mexico +. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7958FFFCCED9FB86FA1FFBA1.xml b/data/67/25/87/6725879F7958FFFCCED9FB86FA1FFBA1.xml new file mode 100644 index 00000000000..ed8e79a4bde --- /dev/null +++ b/data/67/25/87/6725879F7958FFFCCED9FB86FA1FFBA1.xml @@ -0,0 +1,137 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Alluroides brinkhursti abyssinicus +Jamieson 1968 + +(see +Fig 6 +) + + + + + + + + + +Alluroides brinkhursti abyssinicus +Jamieson 1968: 77 + + +, +Fig. 9–11 +, +14 +; + +Brinkhurst & Jamieson 1971: 712–713 + +, +Figs 4.1B, C, D +, +14.3B +. + + + + +FIGURE 6. + +Alluroides brinkhursti abyssinicus +Jamieson (1968) + +. Longitudinal section of holotype. Abbreviations: epi, epithelium of atrium; gl sh, glandular sheath of atrium; m, mouth; msh, muscular sheath of atrium; oe, oesophagus; oo, oocyte: ph m, pharyngeal musculature; s.ves, seminal vesicle; sp, spermatheca; vbv, ventral blood vessel; vd, vas deferens; v n, ventral nerve cord. Slightly modified from +Jamieson (1968) +. + + + +Length +45 mm +, width +1.6 mm +, segments 144. Zygolobous. Body form slender, tapering uniformly to the somewhat pointed tail end; cylindrical throughout. A lateral line visible as a conspicuous white line running the length of the body on each side slightly above mid– +bc +and commencing at the lower limits of the peristomium. Ventral setal couples absent from XIII. Clitellum annular, over XII–XV but its limits not determinable with certainty; best developed in XII–XIV. Male pores one on each side in the setal arc of XIII immediately below the lateral line and thus almost exactly lateral. Each pore at the depressed centre of a very protuberant, transversely elliptical porophore which extends forwards to intersegmental furrow 12/13 and is preceded by a small tumescent crescent in XII. Female pores one on each side, each a small but conspicuous transverse slit, with minute elliptical lips, in intersegmental furrow 13/14 which is deflected posteriorly; slightly more ventrally located than the male pores. Spermathecal pore, a conspicuous unpaired mid–dorsal slit immediately in front of the posterior border of VII, with obvious but only slightly tumid lips which are surrounded by a transversely oval pale field. This field extending anteriorly almost to the setal arc and posteriorly impinging slightly on VIII. + + + + +Septa 4/5–12/13 fairly strong, with the exception of 10/11 which is very thin and is evaginated posteriad to form a bulbous seminal vesicle; 7/8–9/10 the thickest; 3/4 imperfect and very delicate; 13/14–15/16 thin but not as delicate as the succeeding septa. 13 /14 is deflected posteriad by the atria so as almost to touch 14/15 and is prolonged backwards to XVIII as the (unpaired?) ovisac. Chromophil glands extend posteriorly to the posterior wall of VII. The first nephridia with recognizable lumina in XVI, but peritoneal masses in XV and some more anterior segments possibly represent nephridia. The alimentary canal widens in XIII, but not until XV, which may be the segment of intestinal origin, is enlargement pronounced. Dorsal and ventral blood vessels well developed; subneural vessel absent. Sperm morulae in X form a compact mass suggesting the presence of a testis–sac and also contained in a narrow stalked seminal vesicle formed by backward evagination of septum 10/11 into XI which it almost fills. The sperm funnel situated in the spermatogenic mass at the neck of the seminal vesicle and directed dorsally so as to serve both X and the seminal vesicle. Atria each a bulbous tube with narrow lumen, restricted to XIII, with lining epithelium of eosinophil glandular cells surrounded in turn by a thick sheath of predominantly circular muscle and a layer of similar width and several cells thick of unicellular gland cells: total width of muscular tube (external surface) +0.38 mm +, narrowing to +0.195 mm +ectally. Ovaries and funnels in XIII. The ovisac almost occluded at the intersegmental septa but bulging dorsally to the gut in each segment and posteriorly containing large oocytes full of large eosinophil yolk granules. Spermatheca unpaired; a simple, narrow, blind tube, +0.14 mm +wide, recurving at the ental third, widening ectally before opening, via a narrower section at its pore dorsally in VIII. + + + + +Distribution +. +Ethiopia +: Stream at +10,500 feet +( +3,200 m +) in Choke Mts (Mt. Tab). Senan District, Goj jam Province. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7958FFFDCED9FF14FACFFC04.xml b/data/67/25/87/6725879F7958FFFDCED9FF14FACFFC04.xml new file mode 100644 index 00000000000..b7182b1f134 --- /dev/null +++ b/data/67/25/87/6725879F7958FFFDCED9FF14FACFFC04.xml @@ -0,0 +1,164 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Alluroides brinkhursti brinkhursti +Jamieson 1968 + +(see +Figs 4 +, +5 +) + + + + + + + + +Alluroides tanganyikae +Beddard + +(part.) + +Brinkhurst 1964: 528 + +, +Figs. 1–3 +, Pl. 1, +Fig. 1–2 +, Pl. 2, +Fig. 1–2 +. + + + + + + +Alluroides brinkhursti brinkhursti +Jamieson 1968:76 + + +, +Fig. 13 +; + +Brinkhurst & Jamieson 1971: 711–712 + +, +Fig. 14. 3A +, Frontispiece A–D. + + + +(Non) + +A. tanganyikae +Beddard 1906: 215 + +. +Michaelsen 1913: 7 +; +1914 a: 89 +; +1914b: 165 +; +1935: 36 +. + + + + +Length +35–45 mm +, width +1–1.5 mm +, segments 150. Length of a lateral seta from XV ental to the node, +0.109 mm +. in XI, +aa +: +ab:bc:cd:dd +=3.7:1.0:3.1:1.0:3.6; dd=0.21 +u +; +bc +: +aa +=0.8. Clitellum annular in 1/2XII to XV. Male pores ventrolateral in XIII, just dorsal to +b +. Female pores in line with the male pores immediately behind furrow 13/14. Spermathecal pore single, mid–dorsal on IX just behind 8/9 on a prominent papilla. + + +Septa very muscular from 4/5–9/10 inclusive; 3/4 not apparent; 10/11 dorsally partially thickened, mostly evaginated posteriad as a very thin–walled seminal vesicle; 11/12 and 12/13 only slightly thickened; 13/14 posteriad not appreciably thickened. Intestine beginning in XVI. Chromophil septal glands in V–VIII, attached to posterior septa. Nephridia commencing in XV or XVI. Testes ventral on the anterior wall of X. No testis–sacs apparent. Seminal vesicle almost filling XI. Sperm funnels posterior and ventral in X facing anteriorly and dorsally to serve both X and the seminal vesicle. Atria large and globular, almost filling XIII; +0.347 mm +wide narrowing ectally to 0.204. mm. Each with lining epithelium surrounded by a thick muscular sheath outside which, but not closely adherent, are tongues of unicellular gland cells which communicate with the atrial lumen by a large number of small ductules which penetrate the muscular layer. Penis eversible and elongate. Ovaries in XIII, on its anterior wall; funnels on its posterior wall, penetrating 13/14. Ovisac extending posteriad into XVI. Mature oocytes large and yolky. Nephridia commencing in XV or XVI. Spermatheca +0.138 mm +wide, single, lying recurved in IX. + + + + +Distribution +. +Uganda +, Mt. Elgon, in tributaries of the Kiriki River, which flows into Lake Okolitorom. + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F7959FFE3CED9FBE1FF7DFA10.xml b/data/67/25/87/6725879F7959FFE3CED9FBE1FF7DFA10.xml new file mode 100644 index 00000000000..95179ab6038 --- /dev/null +++ b/data/67/25/87/6725879F7959FFE3CED9FBE1FF7DFA10.xml @@ -0,0 +1,129 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + + +Alluroides lauzannei +Ljungström,1971 + +(see +Fig 7 +) + + + + + + + +Alluroides tanganyikae +, +Lauzanne 1968 + +. 107–109. + + + +Alluroides lauzannei +Ljungström 1971 + +, nomen nov. pro + +Alluroides tanganyikae +, +Lauzanne 1968 + +. + + +(Non) + +Alluroides tanganyikae +Beddard 1906 + +. + + + + +Length +20–60 mm +. width +1.2–1.5 mm +, segments 110–150. Colour rose to red. Prostomium conical and ciliated, divided into two parts. Setae 2 per bundle; simple–pointed and 150–170 um long; well demarcated and very thick in the anterior region; ventral setae absent in the region of the male pores. Clitellum poorly developed, in IX to XIII. Spermatheca single, with dorsomedial pore anterior in VIII forming a pad clearly visible on the body wall. + +Septa strongly developed in the anterior region as far as XII. Mouth followed by a well-developed pharynx. Oesophagus extending to XII–XIII where it is followed by a straight intestine with strongly marked constrictions. Gizzard absent. Circulatory system consisting of a large contractile dorsal vessel and a smaller ventral vessel. In the midregion the commissures short and not ramifying and attached to the intestine. In the anterior region (II–XII) the commissures long, powerful, contractile, and coiled. The posterior region richly vascularized; the commissures ramify into numerous vessels; this region possibly functioning as gills. Nephridia two per segment; absent from the anterior region, commencing in VIII; in VIII very near to intersegment 7/8; constituted by a thin–walled ovoid pouch and a strongly muscular duct. Segments X and XI occupied by a conspicuous mass, constituting, very likely, the testes, in X, and a sperm sac. Segment XII occupied by a yellowish mass constituted by the ovaries and sexual products. At maturity the eggs occupying the posterior of segments XIII and XIV; voluminous and rich in yolk These products apparently included in an ovisac issuing from septum 12/13. Female ducts not observed. Male genital tract represented in XIII by two voluminous, pyriform, and very elongate atria each with a thick muscular part. For most of its length but particularly in the swollen region each covered on the largest part of its length by a glandular mass, very likely functioning as a prostate; this formation richly vascularised. A series of fine canaliculi traverses the muscular mass in the swollen region. In the swollen part of the atrium there are pyriform cells orientated longitudinally. Atrium opening ventrolaterally via a short pseudo–penis, in the form of a corolla which becomes a truncated cone on fixation. Male funnel issuing from septum 10/11 closely associated with the sperm mass. The narrow sperm duct is elusive and better seen in the living animal. It follows the length of the ventral body wall and reaches segment XIII in the region of the pseudo–penis. It remounts the atrium at the interior of the glandular bed where its course is lost, it has not been possible to detect its opening into the atrium and it is presumed that the sperm enter the atrium through the canaliculi already referred to. The single, voluminous spermatheca, projecting into IX; consisting of an ovoid pouch with thin walls and a well–developed muscular duct. + + + +FIGURE 7. + +Alluroides lauzannei +Ljungström, 1971 + +. Detail of an atrium. Note the vas deferens entering the apex of the atrium via canaliculi. Relabelled from +Lauzanne (1968) +. + + + + +Distribution +. This worm forms the major part of the biomass of benthic oligochaetes in Lake +Chad +. It prefers sandy bottoms where currents give good oxygenation but is never found where vegetable debris predominates. The reproductive period is November to February. It is equally collected in Lakes Léré and Fianga (Mayo Kebi Region). + + + + \ No newline at end of file diff --git a/data/67/25/87/6725879F795AFFFFCED9FD55FC7FFA55.xml b/data/67/25/87/6725879F795AFFFFCED9FD55FC7FFA55.xml new file mode 100644 index 00000000000..7af1240cb90 --- /dev/null +++ b/data/67/25/87/6725879F795AFFFFCED9FD55FC7FFA55.xml @@ -0,0 +1,205 @@ + + + +A monograph of the Oligochaete family Alluroididae + + + +Author + +Jamieson, Barrie G. M. +School of the Environment, University of Queensland and 1 Maxwell Court, Coolum Beach, Queensland, Australia 4573. + + + +Author + +Fragoso, Carlos +Red de Bioversidad y Sistmatica, Instituto de Ecologia A. C, Xalapa, Mexico. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +401 +435 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.1 + +journal article +10.11646/zootaxa.5529.3.1 +1175-5326 +14022623 +C0662CC3-C5B1-4230-BF8D-EE6336A85242 + + + + + + +GENUS + +Alluroides +Beddard 1894 + +, emend. +Jamieson 1968 + + + + + + + +Type +species: + +Alluroides pordagei +Beddard 1894 + + + + + +Alluroidinae +in which the atria are wide, coiled tubes or are bulbous; prostate cells surround the muscular sheath of the atrium, and the vas deferens enters each atrium near the midlength of the latter or entally. Male pores lateral; ventral setae of XIII present or absent; genital and penial setae absent. Spermathecal pores paired or single, dorsal in +VI +, +VII +and +VIII +, or in +VII +and +VIII +only, or in either +VIII +or +IX +. First septum 3/4; septum 10/11 attenuated. First nephridia in +VIII +or XV or XVI. +Intestine +commencing in XIII–XIX. +Testes +in +X. With +or without distinct seminal vesicles but with spermatogenic masses partly occluding XI + +. + + + + +Distribution +. +Tanzania +; +Uganda +; +Zimbabwe +; +South Africa +; +Ethiopia +; +Chad +; +Kenya +; +Democratic Republic of the Congo +. + + + + +Remarks +. Collectively the features listed above adequately diagnose + +Alluroides + +from the remainder of the sub–family. An individual character of particular note which is not shared with + +Brinkhurstia + +and + +Standeria + +is the termination of the vasa deferens entally on each atrium, clearly demonstrated by +Brinkhurst (1964 +, +Fig. 9 +) for + +A. ruwenzoriensis + +and observed by +Jamieson (1968) +in + +A. pordagei + +. The vasa deferentia of + +A. brinkhursti + +and + +A. tanganyikae + +have not been observed but the overall phenetic resemblance of these to the other two species points to the existence of such a connection. In the other genera entry of two ducts into each terminal male chamber is readily seen while + +A. +tanganyikae + +and + +brinkhursti + +show no semblance of dual terminalia. At the specific level the systematics of + +Alluroides + +cannot be considered settled. Much larger series, from more localities, together with ecological and molecular data, are needed before the validity of the present division into + +A. +pordagei + +, + +lauzannei + +, + +tanganyikae + +, + +ruwenzoriensis + +and + +brinkhursti + +can be conclusively determined. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C61FF8CFF64FACFFE46FCB3.xml b/data/68/3E/87/683E87811C61FF8CFF64FACFFE46FCB3.xml new file mode 100644 index 00000000000..e182738d18a --- /dev/null +++ b/data/68/3E/87/683E87811C61FF8CFF64FACFFE46FCB3.xml @@ -0,0 +1,299 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Eumenes +( +Eumenes +) +selisi +Fateryga + +, +sp. nov. + + + + + + +( +Fig. 3A–J +) + + + + +Diagnosis. +Among the Palaearctic species of the genus + +Eumenes +Latreille + +, the new species is unequivocally characterized by the following combination of characters: body and legs with extensive yellow pattern ( +Fig. 3A, C +); clypeus, scapus, T2, and S2 without long setae; female clypeus wider than long ( +Fig. 3B +), male clypeus about 0.85× as wide as long ( +Fig. 3D +); male F11 slender and acute, light ferruginous, with very minute setae on ventral surface ( +Fig. 3E +); longest setae on occiput behind eye about as long as minimal width of upper lobe of eye; longest setae on propleuron about 1/2 as long as longest setae on occiput behind eye; basal third of scutum with two subtriangular lateral yellow spots in female ( +Fig. 3F +) and often in male as well; punctation on scutum and T2 moderately coarse ( +Fig. 3F, G +); apical margin of T2 strongly deflected upward ( +Fig. 3A, C +); apical lamella of T2 hyaline and transparent ( +Fig. 3G +); male S7+8 mostly without or with just a few punctures at center of distal half ( +Fig. 3H +). The most similar species is + +E. asiaticus + +but the latter has a narrower clypeus in both sexes, a dark F +11 in +the male, shorter setae on propleuron, a very coarse punctation on scutum and T2, and a dark apical lamella of T2. + + + + +Description. +Female +. Body length (from head to apical margin of T2) 11.5 mm; forewing length 8.5 mm. Head about 1.3× as wide as long in front view. Clypeus about 1.1× as wide as long, its apical emargination about 3.5× as deep as wide, taking about 1/3 of clypeal width, apical teeth rounded. Distance between lateral ocellus and occipital margin about as distance between lateral ocellus and eye. Occipital carina forming indistinct and very blunt angle slightly below center of gena, where gena as broad as F1 at distal end. Anterior pronotal carina complete. Scutum roundly convex. Scutellum very convex, raised above scutum and metanotum, with weak longitudinal furrow. Metanotum convex. Propodeum without distinct border between dorsal surface and propodeal concavity; median suture with small carina at lower 1/10 of propodeal concavity. Projection of submarginal carina of propodeum and apical end of valvula forming rounded right angle; ventral margin of valvula with blunt angle in basal half. T1 somewhat more than two times longer than apically wide, subapically with median longitudinal impression and two lateral transverse impressions. T +2 in +dorsal view two times wider than T1 apically; in lateral view, basal part of T2 forming approximately right angle with S2; apical margin of T2 strongly deflected upward. Apical lamella of T2 transparent. S2 flat basally and moderately convex in distal half, with apical lamella similar to that of T2. T3–T5 and S3–S5 with less developed apical lamellae. + + + +FIGURE 3 +. + +Eumenes selisi +Fateryga + +, + +sp. nov. +A + +, +B +, +F +, +G +, ♀, holotype; +C–E +, +H–J +, ♂, paratype. +A +, +C +, habitus in lateral view; +B +, +D +, head in front view; +E +, apex of flagellum; +F +, mesosoma in dorsal view; +G +, T2 in dorsal view; +H +, S7+8 in ventral view; +I +, left paramere and volsella in medial view; +J +, aedeagus in lateral view. Scale bars 1 mm. + + +Clypeus sparsely punctate with shallow rounded punctures, interspaces several times exceeding puncture diameter, with reticulate microsculpture. Frons between antennal sockets punctate coarser and less regularly than clypeus, interspaces with less distinct microsculpture. Upper part of frons densely and coarsely punctate, interspaces very narrow, except ocular sinus where interspaces distinct and dull but still not reaching puncture diameter. Vertex less coarsely punctate than upper part of frons, interspaces sometimes reaching puncture diameter, rather shining; gena with somewhat finer punctures than on vertex and similar microsculpture. Dorsal surface of pronotum, scutellum, and metanotum with coarse punctures, interspaces usually not reaching puncture diameter, shining. Scutum with punctures coarser than on dorsal surface of pronotum, scutellum, and metanotum, interspaces very narrow, with indistinct microsculpture; some interspaces nearly reaching puncture diameter near parapsidal furrows. Tegula shining, with indistinct microsculpture only. Dorsal mesepisternum punctate similarly to dorsal surface of pronotum, scutellum, and metanotum. Ventral mesepisternum and mesepimeron with much coarser and denser reticulate sculpture, each puncture with several micropunctures on bottom, interspaces very narrow. Epicnemium rather shining, with few scattered shallow punctures and reticulate microsculpture. Metapleuron without punctures, with indistinct longitudinal striation and reticulate microsculpture. Dorsolateral surface of propodeum with rather coarse punctures similar to that on dorsal surface of pronotum, scutellum, and metanotum and shining interspaces. Lateral surface of propodeum mostly with denser punctures, interspaces not reaching puncture diameter, dull; sculpture of propodeal concavity similar to that on lateral surface. T1 with sparse punctures, interspaces shining, reaching puncture diameter but becoming denser towards distal end, where interspaces not reaching puncture diameter; apical margin of T1 distad from impressions shining, without punctures; ventral side of T1 with coarse shallow punctures with very narrow interspaces. Basal and central area of T2 densely punctate with deep punctures smaller than on central area of scutum, interspaces reaching puncture diameter, rather shining, with indistinct microreticulation; punctures becoming denser and finer towards distal end of T2 but very small area at apical margin impunctate. Apical lamella of T2 with basal row of rounded to slightly elongated punctures, taking 1/3–1/2 of lamella. S2 very sparsely punctate with shallow rounded punctures similar to that on clypeus, interspaces several times exceeding puncture diameter, with distinct reticulate microsculpture. Following terga and sterna mostly without distinct punctures, with micropunctation only. +Mandible with straight setae as long as diameter of F1 at base. Clypeus with strait curved setae as long as diameter of lateral ocellus. Scapus with setae much shorted than on clypeus. Frons, vertex, occiput, dorsal surface of mesosoma and lateral surface of T1 with strait setae approximately as long as minimal width of upper lobe of eye. Posterior side of propodeum and dorsal side of T1 with somewhat shorter setae. Longest setae on propleuron and fore coxa about 1/2 as long as those on occiput. Few erect and rather short setae on apical margins of T3–T6 and S2–S5 and tarsomere 5 of all legs. Other body parts mostly with short appressed setae only. All setae whitish. +Basal color black. Following parts yellow: distal half of mandible, labrum, clypeus, large spot on frons, anterior side of scapus, narrow band along inner margin of eye from clypeus to ocular sinus, narrow spot on upper part of gena, dorsal surface of pronotum (except lateral black spots near tegulae), two subtriangular lateral spots on basal third of scutum, large spot on dorsal mesepisternum, narrow spot on ventral mesepisternum, tegula, parategula, large lateral spots on scutellum (nearly fused), band on metanotum, large lateral spots on propodeum, large lateral spots submedially on T1 (fused with apical band), large apical band on T1 (emarginate medially at longitudinal impression and with brownish spots laterally at transverse impressions), S1, large lateral spots subbasally on T2 (fused with apical band), large apical band on T2 enlarged medially (but with subapical brownish spot); distal half of S2 (but with three longitudinal black spots), large apical bands on T3–T5 and S2–S5 (mostly with three emarginations each), small subapical spots on T6 and S6. Apical lamella of T2 hyaline. Legs mostly yellow except black dorsal side of coxa of all legs, ventral side of hind coxa, dorsal side of proximal half of fore and mid femur, dorsal side of hind femur and mostly black dorsal side of hind tarsus; ventral side of hind tarsus brownish. Wings fuscous; veins dark brown. + +Male +. Body length (from head to apical margin of T2) +10–11 mm +; forewing length 7.5– +8 mm +. Structure resembles that in female except the following: head about 1.25× as wide as long in front view; clypeus about 0.85× as wide as long, its apical teeth more pointed; distance between lateral ocellus and occipital margin distinctly exceeding distance between lateral ocellus and eye. F11 slender and acute. S7+8 flat and rounded apically. Genitalia as in +Fig. 3I, J +. + +Sculpture similar to that in female but clypeus without distinct scattered punctures. Distal half of S7+8 with 2–3 rows of deep rounded punctures along lateral and apical margins and mostly without punctures at center. +Setae mostly as in female but denser on clypeus. F11 with very minute setae on ventral surface. S7+8 with short erect setae arising from bottom of each puncture. +Coloration mostly as in female but mandible entirely yellow; subtriangular lateral spots on basal third of scutum sometimes absent; large lateral spots submedially on T1 not fused with apical band; T7 and S7+8 black; mid and hind tarsomere 5 brownish but hind tarsomeres 1–4 yellow. F11 light ferruginous. + + + +Material examined. + + +HOLOTYPE +: + +♀ +, labeled “UZ, +2 km +SW +Simbulak +/ +40°38′37″N +66°36′18″E +” / + +31.V.2023 + +Proshchalykin // +Holotypus +♀ +/ + +Eumenes selisi + +/ Fateryga [red label]” [ +ZISP +] + +. + + +PARATYPES +: + +UZBEKISTAN +: +15 km +NWW +Pop +, +40°53′45″N +, +70°54′57″E +, + +20.IX.2022 + +, +1 ♀ +, leg. +M. Proshchalykin +[ +CAFK +]; ibid., + +20.IX.2022 + +, +1 ♂ +, leg. +M. Proshchalykin +[ +MSVI +] + +; + +2 km +SW +Simbulak +, +40°38′37″N +, +66°36′18″E +, + +31.V.2023 + +, +2 ♂ +, leg. +M. Proshchalykin +[ +CAFK +, +FSCV +]; ibid., + +31.V.2023 + +, +1 ♂ +, leg. +A. Fateryga +[ +ZISP +] + +. + + +Ethymology. +The new species is named after Italian entomologist Marco Selis (Viterbo) in recognition of his great contribution to the systematics of the vespid wasps. + + + + +Distribution. +Uzbekistan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C62FF80FF64FA54FC3DF8BF.xml b/data/68/3E/87/683E87811C62FF80FF64FA54FC3DF8BF.xml new file mode 100644 index 00000000000..a6cd56d4456 --- /dev/null +++ b/data/68/3E/87/683E87811C62FF80FF64FA54FC3DF8BF.xml @@ -0,0 +1,216 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Eumenes +( +Eumenes +) +asiaticus +Gusenleitner, 1970 + + + + + + + + + + +Eumenes pomiformis asiaticus + +Gusenleitner, 1970: 165 + + + +, +♂ +( +type +locality: “ +Zravšan +, +Samarkand +, + +1100 m + +, +Asia +centr.” [ +Uzbekistan +]). + + + + + +Material examined (new records). + +KAZAKHSTAN +. + +Jetisu Province + +: +Altyn-Emel National Park +, +Taygak +, +43.9163°N +, +77.8626°E +, + +6.V.2024 + +, +5 ♂ +, leg. +A. Fateryga +[ +CAFK +] + +; + +ibid., + +7.V.2024 + +, +1 ♀ +, +1 ♂ +, leg. +A. Fateryga +[ +CAFK +] + +. + + +Almaty Province + +: +Charyn National Park +, +Canyon +, +43.3496°N +, +79.0811°E +, + +13.V.2024 + +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +] + +; + +ibid., + +16.V.2024 + +, +1 ♀ +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +] + +; + +ibid., + +17.V.2024 + +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +] + +. + + + + +Distribution. +Tajikistan +, +Uzbekistan +, +Kyrgyzstan +, * +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C62FF83FF64F89DFE7FFD9A.xml b/data/68/3E/87/683E87811C62FF83FF64F89DFE7FFD9A.xml new file mode 100644 index 00000000000..f014c79eaf7 --- /dev/null +++ b/data/68/3E/87/683E87811C62FF83FF64F89DFE7FFD9A.xml @@ -0,0 +1,214 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Eumenes +( +Eumenes +) +dubius +de Saussure, 1852 + + + + + + + + + + +Eumenes dubia + +de Saussure, 1852: 32 + + + +, +♀ +♂ +( +type +locality: “ +Le +midi +de la France +”). + +Material +examined (new records). + +KYRGYZSTAN +: +Lower +reaches of +Bogemskoye Canyon +, + +1–2 km +below Chong-Kemin River + +mouth, + +31.VII.2000 + +, +1 ♂ +, leg. +V. Dubatolov +[ISEN]; +Sary-Chelekskiy Reserve +, Arkit, + +20.VII.2000 + +, +1 ♀ +, leg. +V. Dubatolov +[ISEN]. + + + + + +Distribution. +Western, Southern, and Eastern Europe, North Africa, +Russia +(European part), +Azerbaijan +, +Turkey +, +Cyprus +, +Syria +, +Jordan +, +Lebanon +, +Israel +and +Palestine +, +Iraq +, +Iran +, +Turkmenistan +, +Tajikistan +, +Uzbekistan +, * +Kyrgyzstan +, +Kazakhstan +, South America (introduced). + + + + +Remarks. +Taxonomic status of the subspecies + +E. dubius palaestinensis +Giordani Soika, 1952b + +(the name available under Art. 45.5.1 of +ICZN 1999 +; originally described from +Israel +and +Palestine +as + +E. dubius + + +dubius +var. +palaestinensis +Blüthgen, 1938 + +, unavailable under Art. 45.5 of +ICZN 1999 +) and + +E. dubius macedonicus +van der Vecht & Fischer, 1972 + +(the name available under Art. 45.5.1 of +ICZN 1999 +; originally described from North +Macedonia +as + +E. dubius + + +dubius +var. +macedonica +Blüthgen, 1952 + +, unavailable under Art. 45.5 of +ICZN 1999 +) is unclear and requires further verification. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C64FF81FF64F8EDFE69FE0A.xml b/data/68/3E/87/683E87811C64FF81FF64F8EDFE69FE0A.xml new file mode 100644 index 00000000000..6d4ec362c02 --- /dev/null +++ b/data/68/3E/87/683E87811C64FF81FF64F8EDFE69FE0A.xml @@ -0,0 +1,238 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Ancistrocerus nigricornis +(Curtis, 1826) + + + + + + + + +Odynerus nigricornis +Curtis, 1826: 137 + +, no. 8 ( +type +locality: +Great Britain +and +Ireland +). + + + + + +Odynerus callosus + +Thomson, 1870: 87 + + + +, +♂ +( +type +locality: +Sweden +). + + + + + + +Odynerus excisus + +Thomson, 1870: 87 + + + +, +♂ +( +type +locality: “ +Skåne +” [ +Sweden +]). + + + + + + +Ancistrocerus nigricornis + +var. +polonica +Blüthgen, 1952: 7 + + + +, +♀ +( +type +locality: “Serwetsch (Polen)” [Poland]). + +Material +examined (new records). + +TURKMENISTAN +: + +15 km +W Firyuza + +, +Dushak +, + +2.V.1988 + +, +1 ♀ +, leg. +A. Barkalov +[ISEN]; ibid., + +18.V.1988 + +, +1 ♀ +, leg. +A. Barkalov +[ISEN]; ibid., + +20.V.1988 + +, +1 ♀ +, leg. +A. Barkalov +[ISEN]. +TAJIKISTAN +: +Tavildara District +, +Dehi-Kolon +near +Tavildara +, +38°39′N +, +70°31′E +, + +13–17.V.2016 + +, +1 ♀ +, leg. +Yu. Danilov, A +. Barkalov, +V. Zinchenko +[ISEN]; +Badakhshan Mountainous Autonomous Region +, Dzhelondy, Biostation, +37.57°N +, +72.58°E +, + +15–18.VII.2018 + +, +1 ♀ +, leg. +A. Barkalov +[ISEN]. + + + + + +Distribution. +Western, Northern, Southern, and Eastern Europe, North Africa, +Russia +(European part, Urals, Western Siberia, Eastern Siberia, Far East), +Turkey +, +Iran +, * +Turkmenistan +, * +Tajikistan +, +Kazakhstan +, +Mongolia +, +China +(North-East), +Japan +, +India +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C64FF86FF64FA80FBE3F96F.xml b/data/68/3E/87/683E87811C64FF86FF64FA80FBE3F96F.xml new file mode 100644 index 00000000000..4d7c73e463f --- /dev/null +++ b/data/68/3E/87/683E87811C64FF86FF64FA80FBE3F96F.xml @@ -0,0 +1,175 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Ancistrocerus hangaicus +Kurzenko, 1977 + + + + + + + +( +Fig. 1A +) + + + + + + + +Ancistrocerus hangaicus + +Kurzenko, 1977: 572 + + + +, +♀ +( +type +locality: “Монголия, Ара-Хангайский аймак, р. ЧУлУтын-Гол, 30 км севернее ЧУлУта” [ +Mongolia +, +Arkhangai Aimak +, +Chulutyn-Gol River +, + +30 km +N Chulut + +]). + + + + + +Material examined (new records). + +KAZAKHSTAN +. + +Almaty Province + +: +Charyn National Park +, +Canyon +, +43.3496°N +, +79.0811°E +, + +13.V.2024 + +, +4 ♀ +, leg. +A. Fateryga +[ +CAFK +] + +; + +ibid., + +14.V.2024 + +, +1 ♀ +, leg. +M. Proshchalykin +[ +CAFK +] + +; + +ibid., + +16.V.2024 + +, +2 ♀ +, leg. +M. Proshchalykin +[ +CAFK +] + +. + + + + +Distribution. +Russia +( +Altai +, Eastern Siberia, Far East), * +Kazakhstan +, +Mongolia +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C64FF86FF64FC65FEC5FA8F.xml b/data/68/3E/87/683E87811C64FF86FF64FC65FEC5FA8F.xml new file mode 100644 index 00000000000..86076fecae8 --- /dev/null +++ b/data/68/3E/87/683E87811C64FF86FF64FC65FEC5FA8F.xml @@ -0,0 +1,192 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Ancistrocerus antilope +( +Panzer, 1798 +) + + + + + + + + + + +Vespa insolens +Harris, 1782: 129 + + +( +type +locality: +England +), nom. oblit. + + + + + + +Vespa antilope + +Panzer, 1798: 9 + + + +, [ +♀ +] ( +type +locality: “ +Austria +”), nom. protect. + + + + +Odynerus pictus +Curtis, 1826: 137 + +, no. 2 ( +type +locality: +Great Britain +and +Ireland +). + + + + +Material examined (new records). + +TAJIKISTAN +: +Vicinity of Iskanderkul Lake +, +Sarytag +, +39°03′N +, +68°19′E +, + +2370 m + +, + +19.VI.2022 + +, +1 ♂ +, leg. +A. Barkalov +[ +ISEN +]; Khodzha Obigarm Canyon, +38°53′N +, +68°47′E +, + +1720 m + +, + +30.V.2021 + +, +1 ♂ +, leg. +A. Barkalov +[ +ISEN +] + +. + + + + +Distribution. +Western, Northern, Southern, and Eastern Europe, +Russia +(European part, Urals, Western Siberia, Eastern Siberia, Far East), +Turkey +, +Afghanistan +, * +Tajikistan +, +Kyrgyzstan +, +Kazakhstan +, +Mongolia +, +China +(North-East), +Japan +, +India +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C65FF86FF64F8B1FD0FFF5E.xml b/data/68/3E/87/683E87811C65FF86FF64F8B1FD0FFF5E.xml new file mode 100644 index 00000000000..975ad21a355 --- /dev/null +++ b/data/68/3E/87/683E87811C65FF86FF64F8B1FD0FFF5E.xml @@ -0,0 +1,129 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Quartinia uzbeka +Kostylev, 1935 + + + + + + + + + + +Quartinia uzbeka + +Kostylev, 1935b: 106 + + + +, +♂ +( +type +locality: “ +Aman-Katan +, +Umgesb. v. Samarkand + +1.500 m + +. üb. M.” [ +Uzbekistan +]). + + + + + +Material examined (new records). + +TURKMENISTAN +: +5 km +N +Kushka +, + +26.V.1985 + +, +1 ♀ +, +1 ♂ +, leg. +V. Makarkin +[ +FSCV +] + +. + + + + +Distribution. +* +Turkmenistan +, +Uzbekistan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C65FF87FF64F9FBFD03F953.xml b/data/68/3E/87/683E87811C65FF87FF64F9FBFD03F953.xml new file mode 100644 index 00000000000..d82a9c92614 --- /dev/null +++ b/data/68/3E/87/683E87811C65FF87FF64F9FBFD03F953.xml @@ -0,0 +1,130 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Quartinia pusilla +Kostylev, 1935 + + + + + + + + + + +Quartinia pusilla + +Kostylev, 1935b: 104 + + + +, +♀ +( +type +locality: “ +Krasnovodsk +” [ +Turkmenistan +]). + + + + + +Material examined (new records). + +KAZAKHSTAN +: + +Kyzylorda Province + +: + +20 km +S Yany-Kurgan + +, +Kyzylkum Desert +, + +14–15.VII.1990 + +, +12 ♀ +, +1 ♂ +, leg. +V. Kazenas +[ +FSCV +] + +. + + + + +Distribution. +Turkmenistan +, * +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C65FF87FF64FB95FE71FA1D.xml b/data/68/3E/87/683E87811C65FF87FF64FB95FE71FA1D.xml new file mode 100644 index 00000000000..4a547ce7c0a --- /dev/null +++ b/data/68/3E/87/683E87811C65FF87FF64FB95FE71FA1D.xml @@ -0,0 +1,164 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Quartinia popovi +Richards, 1962 + + + + + + + + + + +Quartinia popovi + +Richards, 1962: 143 + + + +, +♀ +( +type +locality: “ +District of Kondara +” [ +Tajikistan +]). + + + + + +Material examined (new records). + +KYRGYZSTAN +: +Transalai Mountain Range +, +Berk-Suu Ravine +, +39°29′N +, +72°02′E +, ~ + +2600 m + +, + +19.VII.1998 + +, +1 ♀ +, leg. +D. Milko +[ +CSZT +]; + +Transalai Mountain Range +, W + +part, +Berksu River +gorge, +39°28′N +, +72°01′E +, + +2600 m + +, + +19.VII.1998 + +, +2 ♂ +, leg. +I. Makogonova +[ +CSZT +] + +. + + + + +Distribution. +Tajikistan +, * +Kyrgyzstan +. + + + + +Remarks. +The record of this species from +Turkey +( +Yildirim & Gusenleitner 2012 +) is very doubtful and obviously based on a misidentification. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C66FF84FF64FAD3FD65F9A1.xml b/data/68/3E/87/683E87811C66FF84FF64FAD3FD65F9A1.xml new file mode 100644 index 00000000000..c97244728f0 --- /dev/null +++ b/data/68/3E/87/683E87811C66FF84FF64FAD3FD65F9A1.xml @@ -0,0 +1,131 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Celonites crenulatus +Morawitz, 1888 + + + + + + + + + + +Celonites crenulatus + +Morawitz, 1888: 267 + + + +, +♀ +( +type +locality: “in territorio transcaspico ( +Kiltitschinar +)” [ +Turkmenistan +]). + + + + + +Material examined (new records). + +TAJIKISTAN +: +Sands + +5 km +S Kurdjalalkum + +, +37°08′N +, +68°10′E +, + +6.V.2002 + +, +1 ♀ +, +1 ♂ +, leg. +S. Zonstein +[ +CSZT +] + +. + + + + +Distribution. +Iran +, +Turkmenistan +, * +Tajikistan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C66FF87FF64F9AFFE84FBB7.xml b/data/68/3E/87/683E87811C66FF87FF64F9AFFE84FBB7.xml new file mode 100644 index 00000000000..f3e392db68a --- /dev/null +++ b/data/68/3E/87/683E87811C66FF87FF64F9AFFE84FBB7.xml @@ -0,0 +1,538 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Masaris carli +von Schulthess, 1922 + + + + + + + + + + +Masaris saussurei + +Carl, 1921: 449 + + + +, +♀ +♂ +( +type +locality: “ +Zarawchan +; ... Sutkend. Turkestan” [ +Uzbekistan +]), nom. praeocc., nec + + + + +Masaris saussurei +Brauns, 1905 + +. + +Masaris carli +von Schulthess, 1922: 404 + +, replacement name for + +M. saussurei +Carl, 1921 + +, nec +Brauns, 1905 +. + +Masaris smirnovi +Kostylev, 1925: 152 + +, fig. 2, +♂ +( +type +locality: “Perovsk (Turkestan, Syr-Darjja-Gebiet)” [ +Kazakhstan +]), + + +synonymized by +Kostylev 1935b: 87 +. + +Masaris elegans +Gusenleitner, 2002: 322 + +, figs 3–9, +♀ +♂ +( +type +locality: “ +Turkmenistan +, Farab”), +syn. nov. + + + + + +Material examined. +HOLOTYPE +Of + +MASARIS SMIRNOVI + +: + +♂ +, labeled “[golden disc] // Dist. Perovsk [Kyzylorda] / 29 V 923. / S. Tarbinskij // +Москва +/ Зоологический / МУЗей МГУ [ +Moscow +, Zoological Museum +MSU +] // тип [typus] / + +Masaris + +/ + +smirnovi +Kost. + +/ = + +M. carli +Schult + +/ синон. Устан. / Ю. Костылев [synonymy established by + + + +G. Kostylev +] / 23 VI 41 [ +G. Kostylev’s +signature] // + +Masaris + +/ + +smirnovi + +/ n. sp. / +Typus +// +Holotype +♂ +/ + +Masaris smirnovi + +/ +Kostylev, 1925 +[red label]” [ +ZMMU +]. + +Additional material +. + +UZBEKISTAN +: +Bukhara Region +, +Khargush +[Xargoʻsh], + +27.V.1928 + +, +1 ♀ +, leg. +A. Gerasimov +[ +ZISP +]. +KAZAKHSTAN +: + +Aktobe Province + +: +Turgay Oblast +, +Aja +, + +17.VIII.1899 + +, +1 ♂ +, leg. +P. Sushkin +[ +ZISP +]. + +Ulytau Province + +: +S Jezkazgan, S +part of +Samenkum Sands +, + +29.V.1962 + +, +1 ♂ +, leg. +V. Tobias +[ +ZIPS +]. + +Kyzylorda Province + +: +Baigakum +bei +Djulek +, + +1.V.1907 + +, +1 ♀ +, leg. +L. Wollmann +[ +ZISP +]; ibid., + +10.V.1908 + +, +1 ♀ +, leg. +L. Wollmann +[ +ZISP +]; ibid., + +11.V.1908 + +, +2 ♀ +, leg. +L. Wollmann +[ +ZISP +]; ibid., + +12.V.1908 + +, +1 ♀ +, +1 ♂ +, leg. +L. Wollmann +[ +ZISP +]; +Terenj-Uzjak +, + +30.V.1925 + +, +1 ♂ +, leg. +A. Zhelochovtsev +[ +ZMMU +]; +Perovsk +[Kyzylorda], + +18.V.1928 + +, +2 ♂ +, leg. +V. Popov +[ +ZISP +]; ibid., + +21.V.1928 + +, +1 ♂ +, leg. +V. Popov +[ +ZISP +]. + +Jetisu Province + +: + +60 km +NE Ushtobe + +, +Karatal River +, + +8.VI.1986 + +, +1 ♀ +, leg. +V. Kazenas +[ +FSCV +]. + +Almaty Province + +: + +20 km +SE Akzhar + +, + +10.VI.1986 + +, +3 ♂ +, leg. +V. Kazenas +[ +FSCV +]; vicinity of +Akzhar +, +44°52′49″N +, +75°53′11″E +, + +397 m + +, + +on + +Halimodendron halodendron + + +, + +26.V.2015 + +, +1 ♂ +, leg. +K. Fadeev +[ +ZISP +] + +. + + + + +Distribution. +Turkmenistan +, +Uzbekistan +, +Kazakhstan +. + + + + +Remarks. +Gusenleitner (1992 +, +2002 +) reported +two females +of + +M. carli + +from +Iran +but his treatment of this species was obviously incorrect. He apparently did not see the original description of + +M. saussurei + +by +Carl (1921) +, where a body size of +11 mm +was indicated, and used the key by +Richards (1962) +, where there were just three species of the genus, without indication of their size. In his paper, +Gusenleitner (2002) +indicated a body size of + +M. carli + +of +20 mm +. In the same paper, he described a much smaller species, + +M. elegans + +, with a body size of +11 mm +. Examination of the original descriptions of + +M. saussurei + +, + +M. smirnovi + +, and + +M. elegans + +, as well as the +holotype +of + +M. smirnovi + +and photographs of the male +holotype +( +ZOBODAT 2024a +) and a female +paratype +( +ZOBODAT 2024b +) of + +M. elegans + +revealed that these species were identical. + + +It is unclear what was mentioned by +Gusenleitner (1992 +, +2002 +) from +Iran +, we can speculate that it was an undescribed female of + +Masaris agnolii +Selis, 2019 + +. It is also a large species and no other species of + +Masaris +Fabricius, 1793 + +are currently known from +Iran +. The reports of + +M. carli + +from +Iran +by +Carpenter (2001) +and + +Rahmani +et al. +(2020) + +were based on +Gusenleitner’s (1992 +, +2002 +) record. Therefore, + +M. carli + +should be excluded from the fauna of +Iran +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C6AFF88FF64FF61FAB8FE04.xml b/data/68/3E/87/683E87811C6AFF88FF64FF61FAB8FE04.xml new file mode 100644 index 00000000000..2eb27163bd0 --- /dev/null +++ b/data/68/3E/87/683E87811C6AFF88FF64FF61FAB8FE04.xml @@ -0,0 +1,148 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Stenodynerus chitgarensis +Giordani Soika, 1970 + + + + + + + + + + +Stenodynerus chitgarensis + +Giordani Soika, 1970: 108 + + + +, +♀ +♂ +( +type +locality: “ +Iran +: +Teheran +, steppa presso +Chitgar +, 18 Km. W da +Teheran +”). + + + + + +Material examined (new records). + +KAZAKHSTAN +. + +Almaty Province + +: +3 km +NW +Kokpek +, +43.4657°N +, +78.6448°E +, + +19.V.2024 + +, +1 ♀ +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +] + +. + + + + +Distribution. +Russia +( +Dagestan +), +Azerbaijan +, +Turkey +, +Iran +, +Uzbekistan +, +Kyrgyzstan +, * +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C6BFF89FF64F932FC9FF817.xml b/data/68/3E/87/683E87811C6BFF89FF64F932FC9FF817.xml new file mode 100644 index 00000000000..8c6237e9f64 --- /dev/null +++ b/data/68/3E/87/683E87811C6BFF89FF64F932FC9FF817.xml @@ -0,0 +1,125 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Spinilabochilus desrticola +(Kostylev, 1935) + + + + + + + + + + +Microdynerus deserticola + +Kostylev, 1935a: 141 + + + +, +♀ +( +type +locality: “ +Utsh-Adzhi +” [ +Turkmenistan +]). + + + + + +Material examined (new records). + +UZBEKISTAN +: +Yozyovon Sands +, +40°42′34″N +, +71°28′03″E +, + +16.V.2023 + +, +1 ♀ +, leg. +M. Proshchalykin +[ +CAFK +] + +. + + + + +Distribution. +Turkmenistan +, * +Uzbekistan +, +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C6DFF8FFF64FA81FE15F94F.xml b/data/68/3E/87/683E87811C6DFF8FFF64FA81FE15F94F.xml new file mode 100644 index 00000000000..95188e3ee52 --- /dev/null +++ b/data/68/3E/87/683E87811C6DFF8FFF64FA81FE15F94F.xml @@ -0,0 +1,206 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Eustenancistrocerus +( +Eustenancistrocerus +) +tegularis +( +Morawitz, 1885 +) + + + + + + + + + + +Lionotus tegularis + +Morawitz, 1885: 165 + + + +, +♀ +♂ +( +type +locality: “Transcaucasia. Tschemachli” [ +Azerbaijan +]). + + + + + + +Eustenancistrocerus israelensis + +Giordani Soika, 1952b: 34 + + + +, +♂ +( +type +locality: “ +Gerico +” [ +Israel +and +Palestine +]), synonymized by +Fateryga +et al. +2019: 28. + + + + + +Material examined (new records). + +KYRGYZSTAN +: + +Issyk-Kul Lake +, S + +coast, + +10 km +E Kadzhi-Say + +, + +1670 m + +, + +22.VII.2000 + +, +1 ♀ +, leg. +G. Anufriev +, D. Potanin [ +CAFK +]; +Sary-Chelekskiy Reserve +, +Arkit +, + +8.VII.2000 + +, +1 ♂ +, leg. +V. Dubatolov +[ +ISEN +]; ibid., + +20.VII.2000 + +, +2 ♂ +, leg. +V. Dubatolov +[ +ISEN +] + +. + + + + +Distribution. +Bulgaria +,? +Greece +, +Armenia +, +Azerbaijan +, +Turkey +, +Syria +, +Israel +and +Palestine +, +Iran +, +Uzbekistan +, * +Kyrgyzstan +, +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C6DFF8FFF64FF61FE3DFC18.xml b/data/68/3E/87/683E87811C6DFF8FFF64FF61FE3DFC18.xml new file mode 100644 index 00000000000..0f45b2ffa64 --- /dev/null +++ b/data/68/3E/87/683E87811C6DFF8FFF64FF61FE3DFC18.xml @@ -0,0 +1,328 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Euodynerus +( +Euodynerus +) +setosus +Gusenleitner, 1970 + + + + + + + +( +Fig. 2B–D +) + + + + + + +Euodynerus setosus +Gusenleitner + +in + +Blüthgen & Gusenleitner 1970: 11 + +, fig. 4, +♀ +♂ +( +type +locality: “ +Birdjant +( +Chorassen +)” [ +Iran +]). + + + + + +Material examined (new records). + +UZBEKISTAN +: +4 km +NNE +Uchkulach +, +40°33′40″N +, +67°22′01″E +, + +26.V.2023 + +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +]; ibid., + +on + +Limonium otolepis + + +, + +26.V.2023 + +, +1 ♂ +, leg. +A. Fateryga +[ +CAFK +]; ibid., + +on + +Tamarix ramosissima + + +, + +26.V.2023 + +, +1 ♀ +, +3 ♂ +, leg. +A. Fateryga +[ +CAFK +]; ibid., + +27.V.2023 + +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +]; ibid., + +on + +Limonium otolepis + + +, + +27.V.2023 + +, +1 ♀ +, leg. +A. Fateryga +[ +CAFK +] + +; + + +2 km +SW Simbulak + +, +40°38′37″N +, +66°36′18″E +, + +31.V.2023 + +, +2 ♂ +, leg. +A. Fateryga +[ +CAFK +]; +Tamdytau Mts. +, +41°39′02″N +, +64°25′14″E +, + +28.V.2023 + +, +3 ♀ +, leg. +A. Fateryga +[ +CAFK +]; ibid., + +28.V.2023 + +, +4 ♀ +, +2 ♂ +, leg. +M. Proshchalykin +[ +CAFK +]; ibid., + +on + +Meristotropis triphylla + + +, + +28.V.2023 + +, +2 ♀ +, +3 ♂ +, leg. +A. Fateryga +[ +CAFK +] + +. + + + + +Distribution. +Transcaucasia, +Iran +, +Afghanistan +, +Turkmenistan +, * +Uzbekistan +. + + + + +Remarks. +The taxonomic status of + +E. setosus rubicundus +Gusenleitner, 1994 + +described from +Oman +remains unclear. + + +Field observations. +Similar to + +Chlorodynerus arenicola + +, females of + +E. setosus + +were observed at + +Glycyrrhiza triphylla + +at Tamdytau Mountains, Kyzylkum Desert, but the latter wasp species mainly robbed nectar from flowers that have not yet fully opened ( +Fig. 2B, C +). In addition, females sometimes did regular visits to open flowers ( +Fig. 2D +), as well as a secondary nectar robbing ( +sensu +Inoyue 1980) from buds already gnawed out by + +Ch. arenicola + +. Opening flowers that have not yet fully opened is known in some species of the pollen-wasp genus + +Celonites +Latreille + +but in the latter case the wasps use such flowers rather to uptake pollen than nectar ( +Mauss & Müller 2014 +; + +Fateryga +et al. +2023b + +). + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C6EFF8CFF64FB63FD31F9A1.xml b/data/68/3E/87/683E87811C6EFF8CFF64FB63FD31F9A1.xml new file mode 100644 index 00000000000..92b78a2ba1e --- /dev/null +++ b/data/68/3E/87/683E87811C6EFF8CFF64FB63FD31F9A1.xml @@ -0,0 +1,229 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Euodynerus +( +Euodynerus +) +pseudocaspicus +Blüthgen, 1942 + + + + + + + +( +Fig. 1B +) + + + + + + + +Euodynerus pseudocaspicus + +Blüthgen, 1942: 302 + + + +, +♀ +( +type +locality: “ +Turkestan +(ohne genaueren +Fundort +)” [ +Central Asia +]). + + + + + +Material examined (new records). + +UZBEKISTAN +: +15 km +NWW +Pop +, +40°53′45″N +, +70°54′57″E +, + +21.V.2023 + +, +2 ♀ +, leg. +A. Fateryga +[ +CAFK +] + +. + +KAZAKHSTAN +: + +Almaty Province + +: +Charyn National Park +, + +18 km +SWW Chundzha + +, +43.5028°N +, +79.2134°E +, + +11.V.2024 + +, +1 ♀ +, leg. +M. Proshchalykin +[ +CAFK +] + +; + +ibid., + +12.V.2024 + +, +1 ♂ +, leg. +A. Fateryga +[ +CAFK +]; +Charyn National Park +, +Canyon +, +43.3496°N +, +79.0811°E +, + +13.V.2024 + +, +1 ♂ +, leg. +M. Proshchalykin +[ +CAFK +] + +; + +ibid., + +14.V.2024 + +, +2 ♂ +, leg. +M. Proshchalykin +[ +CAFK +] + +; + +ibid., + +17.V.2024 + +, +3 ♀ +, leg. +A. Fateryga +[ +CAFK +] + +. + + + + +Distribution. +* +Uzbekistan +, * +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/68/3E/87/683E87811C6EFF8CFF64FC91FCACFBE8.xml b/data/68/3E/87/683E87811C6EFF8CFF64FC91FCACFBE8.xml new file mode 100644 index 00000000000..a2e498d835a --- /dev/null +++ b/data/68/3E/87/683E87811C6EFF8CFF64FC91FCACFBE8.xml @@ -0,0 +1,136 @@ + + + +New records of the solitary Vespidae (Hymenoptera: Vespidae: Masarinae and Eumeninae s. l.) from Central Asia, with new synonyms and description of a new species of Eumenes Latreille + + + +Author + +Fateryga, Alexander V. +T. I. Vyazemsky Karadag Scientific Station-Nature Reserve of RAS-Branch of A. O. Kovalevsky Institute of Biology of the Southern Seas of RAS, Nauki Str. 24, Kurortnoye, 298188 Feodosiya, Russia. + + + +Author + +Proshchalykin, Maxim Yu. +Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch of the Russian Academy of Sciences, 100 - let Vladivostoku Ave. 159, 690022 Vladivostok, Russia. + +text + + +Zootaxa + + +2024 + +2024-10-29 + + +5529 + + +3 + + +551 +569 + + + + +http://dx.doi.org/10.11646/zootaxa.5529.3.7 + +journal article +10.11646/zootaxa.5529.3.7 +1175-5326 +14022973 +B13DD0B6-4E8D-4194-8C42-25A2BC87C7FF + + + + + + + +Eumenes +( +Eumenes +) +separatus +Gusenleitner, 1972 + + + + + + + + + + +Eumenes separatus + +Gusenleitner, 1972: 97 + + + +, +♂ +( +type +locality: “ +Kurgan-Tjube +, Tadschikistan” [ +Tajikistan +]). + + + + + +Material examined (new records). + +KAZAKHSTAN +. + +Kyzylorda Province + +: + +100 km +NWW Kyzylorda + +, +45.1287°N +, +64.190583°E +, + +5.IX.2017 + +, +1 ♂ +, leg. +M. Mokrousov +[ +CAFK +] + +. + + + + +Distribution. +Tajikistan +, +Uzbekistan +, * +Kazakhstan +. + + + + \ No newline at end of file diff --git a/data/AA/1B/87/AA1B878AFF868678FF16FA6E7B60FDE4.xml b/data/AA/1B/87/AA1B878AFF868678FF16FA6E7B60FDE4.xml index efcc5ff18bc..79e18067118 100644 --- a/data/AA/1B/87/AA1B878AFF868678FF16FA6E7B60FDE4.xml +++ b/data/AA/1B/87/AA1B878AFF868678FF16FA6E7B60FDE4.xml @@ -1,55 +1,56 @@ - - - -Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) + + + +Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) - - -Author + + +Author -Fateryga, Alexander V. -0000-0002-5346-3477 -fater_84@list.ru +Fateryga, Alexander V. +0000-0002-5346-3477 +fater_84@list.ru - - -Author + + +Author -Selis, Marco -0000-0002-8200-9441 -marcozetsu@hotmail.it +Selis, Marco +0000-0002-8200-9441 +marcozetsu@hotmail.it -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -318 -340 + +318 +340 - -http://dx.doi.org/10.11646/zootaxa.5529.2.5 + +http://dx.doi.org/10.11646/zootaxa.5529.2.5 -journal article -10.11646/zootaxa.5529.2.5 -1175-5326 -CD62C48C-395B-4568-B24F-C4829FAEBF27 +journal article +10.11646/zootaxa.5529.2.5 +1175-5326 +14022454 +CD62C48C-395B-4568-B24F-C4829FAEBF27 - + @@ -71,9 +72,9 @@ ( -Figs 4A–G +Figs 4A–G , -10G–I +10G–I ) @@ -115,21 +116,21 @@ für Diagnosis. Body with yellow pattern, legs predominantly yellow ( -Fig. 4A, F +Fig. 4A, F ); apical margin of female clypeus approximately as wide as distance between antennal sockets, hardly emarginate ( -Fig. 4B +Fig. 4B ); male F11 moderately robust, apically rounded, with a subapical tyloid on ventral side ( -Fig. 4G +Fig. 4G ); antero-lateral angles of pronotum in dorsal view rather blunt ( -Fig. 4C +Fig. 4C ); scutellum and metanotum with yellow bands ( -Fig. 4A, F +Fig. 4A, F ); punctation on T2 moderately coarse and dense, interspaces not exceeding diameter of a puncture ( -Fig. 4D +Fig. 4D ); paramere very slender ( -Fig. 10G +Fig. 10G ); ventral lobe of aedeagus rather acutely triangular ( -Fig. 10I +Fig. 10I ). diff --git a/data/AA/1B/87/AA1B878AFF878676FF16FB207BC8F881.xml b/data/AA/1B/87/AA1B878AFF878676FF16FB207BC8F881.xml index 69b47cb8c7c..a31bfc66ffe 100644 --- a/data/AA/1B/87/AA1B878AFF878676FF16FB207BC8F881.xml +++ b/data/AA/1B/87/AA1B878AFF878676FF16FB207BC8F881.xml @@ -1,55 +1,56 @@ - - - -Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) + + + +Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) - - -Author + + +Author -Fateryga, Alexander V. -0000-0002-5346-3477 -fater_84@list.ru +Fateryga, Alexander V. +0000-0002-5346-3477 +fater_84@list.ru - - -Author + + +Author -Selis, Marco -0000-0002-8200-9441 -marcozetsu@hotmail.it +Selis, Marco +0000-0002-8200-9441 +marcozetsu@hotmail.it -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -318 -340 + +318 +340 - -http://dx.doi.org/10.11646/zootaxa.5529.2.5 + +http://dx.doi.org/10.11646/zootaxa.5529.2.5 -journal article -10.11646/zootaxa.5529.2.5 -1175-5326 -CD62C48C-395B-4568-B24F-C4829FAEBF27 +journal article +10.11646/zootaxa.5529.2.5 +1175-5326 +14022454 +CD62C48C-395B-4568-B24F-C4829FAEBF27 - + @@ -69,9 +70,9 @@ ( -Figs 3A–F +Figs 3A–F , -10D–F +10D–F ) @@ -111,23 +112,23 @@ für Diagnosis. Body with yellow pattern, legs predominantly yellow ( -Fig. 3A, D +Fig. 3A, D ); apical margin of female clypeus approximately as wide as distance between antennal sockets, hardly emarginate ( -Fig. 3B +Fig. 3B ); male F11 slender, apically rounded, without a tyloid ( -Fig. 3F +Fig. 3F ); antero-lateral angles of pronotum in dorsal view almost rounded ( -Fig. 3A, D +Fig. 3A, D ); scutellum and metanotum with yellow bands ( -Fig. 3A, D +Fig. 3A, D ); punctation on T2 fine and sparse, interspaces exceeding diameter of a puncture ( -Fig. 3C +Fig. 3C ); paramere very broad ( -Fig. 10D +Fig. 10D ); ventral lobe of aedeagus moderately triangular ( -Fig. 10F +Fig. 10F ). The only examined male shows a remarkably broadened and curved apex of the aedeagus and the apical part of the aedeagus proportionally much shorter when compared to the other species ( -Fig. 10E +Fig. 10E ), but it is unclear whether this is a diagnostic character or just an aberration. diff --git a/data/AA/1B/87/AA1B878AFF8F8660FF16FB6E7A11FD63.xml b/data/AA/1B/87/AA1B878AFF8F8660FF16FB6E7A11FD63.xml index 3d362b718ce..64e11b7b578 100644 --- a/data/AA/1B/87/AA1B878AFF8F8660FF16FB6E7A11FD63.xml +++ b/data/AA/1B/87/AA1B878AFF8F8660FF16FB6E7A11FD63.xml @@ -1,55 +1,56 @@ - - - -Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) + + + +Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) - - -Author + + +Author -Fateryga, Alexander V. -0000-0002-5346-3477 -fater_84@list.ru +Fateryga, Alexander V. +0000-0002-5346-3477 +fater_84@list.ru - - -Author + + +Author -Selis, Marco -0000-0002-8200-9441 -marcozetsu@hotmail.it +Selis, Marco +0000-0002-8200-9441 +marcozetsu@hotmail.it -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -318 -340 + +318 +340 - -http://dx.doi.org/10.11646/zootaxa.5529.2.5 + +http://dx.doi.org/10.11646/zootaxa.5529.2.5 -journal article -10.11646/zootaxa.5529.2.5 -1175-5326 -CD62C48C-395B-4568-B24F-C4829FAEBF27 +journal article +10.11646/zootaxa.5529.2.5 +1175-5326 +14022454 +CD62C48C-395B-4568-B24F-C4829FAEBF27 - + @@ -71,9 +72,9 @@ ( -Figs 8A–I +Figs 8A–I , -10T–W +10T–W ) @@ -103,25 +104,25 @@ Diagnosis. Body with orange pattern, legs predominantly orange ( -Fig. 8A, F +Fig. 8A, F ); apical margin of female clypeus from approximately as wide as distance between antennal sockets to slightly wider, hardly emarginate ( -Fig. 8B +Fig. 8B ); male F11 moderately robust, apically rounded, with a subapical tyloid on ventral side ( -Fig. 8G +Fig. 8G ); antero-lateral angles of pronotum in dorsal view usually rather blunt ( -Fig. 8C +Fig. 8C ); scutellum and metanotum with orange bands ( -Fig. 8A, F +Fig. 8A, F ); punctation on T2 moderately coarse and dense, interspaces not exceeding diameter of a puncture ( -Fig. 8D +Fig. 8D ); paramere very slender ( -Fig. 10T, U +Fig. 10T, U ); ventral lobe of aedeagus rather acutely triangular ( -Fig. 10W +Fig. 10W ). The species shows variability in the width of the apical margin of the clypeus not only in the female but in the male as well ( -Fig. 8H, I +Fig. 8H, I ). The length of the digitus is also remarkably variable ( -Fig. 10T, U +Fig. 10T, U ). @@ -158,7 +159,7 @@ ssp. nov. 1975. [red label]” [ FSCV ] ( -Fig. 8E +Fig. 8E ) . @@ -696,7 +697,7 @@ from . - + FIGURE 8. diff --git a/data/AA/1B/87/AA1B878AFF938662FF16FF5378FDFC1F.xml b/data/AA/1B/87/AA1B878AFF938662FF16FF5378FDFC1F.xml index 1b35c421993..b350c559f00 100644 --- a/data/AA/1B/87/AA1B878AFF938662FF16FF5378FDFC1F.xml +++ b/data/AA/1B/87/AA1B878AFF938662FF16FF5378FDFC1F.xml @@ -1,55 +1,56 @@ - - - -Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) + + + +Unexpected diversity in the Pseudepipona lativentris species-group (Hymenoptera: Vespidae: Eumeninae) - - -Author + + +Author -Fateryga, Alexander V. -0000-0002-5346-3477 -fater_84@list.ru +Fateryga, Alexander V. +0000-0002-5346-3477 +fater_84@list.ru - - -Author + + +Author -Selis, Marco -0000-0002-8200-9441 -marcozetsu@hotmail.it +Selis, Marco +0000-0002-8200-9441 +marcozetsu@hotmail.it -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -318 -340 + +318 +340 - -http://dx.doi.org/10.11646/zootaxa.5529.2.5 + +http://dx.doi.org/10.11646/zootaxa.5529.2.5 -journal article -10.11646/zootaxa.5529.2.5 -1175-5326 -CD62C48C-395B-4568-B24F-C4829FAEBF27 +journal article +10.11646/zootaxa.5529.2.5 +1175-5326 +14022454 +CD62C48C-395B-4568-B24F-C4829FAEBF27 - + @@ -69,9 +70,9 @@ Gusenleitner, 1973 ( -Figs 9A–G +Figs 9A–G , -10X–Z +10X–Z ) @@ -102,21 +103,21 @@ Gusenleitner, 1973: 328 Diagnosis. Body usually with yellow pattern, legs usually predominantly yellow ( -Fig. 9A, F +Fig. 9A, F ); apical margin of female clypeus slightly wider than distance between antennal sockets, hardly emarginate ( -Fig. 9B +Fig. 9B ); male F11 moderately robust, apically rounded, without a tyloid ( -Fig. 9G +Fig. 9G ); antero-lateral angles of pronotum in dorsal view usually rather rectangular ( -Fig. 9C +Fig. 9C ); scutellum and metanotum with yellow bands ( -Fig. 9A, F +Fig. 9A, F ); punctation on T2 moderately coarse and dense, interspaces not exceeding diameter of a puncture ( -Fig. 9D +Fig. 9D ); paramere moderately broad ( -Fig. 10X +Fig. 10X ); ventral lobe of aedeagus rather acutely triangular ( -Fig. 10Z +Fig. 10Z ). diff --git a/data/E9/02/D1/E902D143FFBD0E28FF276407EC66FDDF.xml b/data/E9/02/D1/E902D143FFBD0E28FF276407EC66FDDF.xml index 5da98352903..c8f7e9d661c 100644 --- a/data/E9/02/D1/E902D143FFBD0E28FF276407EC66FDDF.xml +++ b/data/E9/02/D1/E902D143FFBD0E28FF276407EC66FDDF.xml @@ -1,55 +1,56 @@ - - - -A new species of Sphaeronemoura (Plecoptera: Nemouridae) from Guizhou, China with a revised key to males of this genus + + + +A new species of Sphaeronemoura (Plecoptera: Nemouridae) from Guizhou, China with a revised key to males of this genus - - -Author + + +Author -Zhu, Ya-Fei -0009-0000-5001-3190 -College of Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou 225009, China -1538544166@qq.com +Zhu, Ya-Fei +0009-0000-5001-3190 +College of Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou 225009, China +1538544166@qq.com - - -Author + + +Author -Du, Yu-Zhou -College of Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou 225009, China & Joint International Research Laboratory of Agriculture and Agri-Product Safety, the Ministry of Education, Yangzhou University, Yangzhou 225009, China +Du, Yu-Zhou +College of Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou 225009, China & Joint International Research Laboratory of Agriculture and Agri-Product Safety, the Ministry of Education, Yangzhou University, Yangzhou 225009, China -text - - -Zootaxa +text + + +Zootaxa - -2024 - -2024-10-25 + +2024 + +2024-10-25 - -5529 + +5529 - -2 + +2 - -373 -380 + +373 +380 - -http://dx.doi.org/10.11646/zootaxa.5529.2.8 + +http://dx.doi.org/10.11646/zootaxa.5529.2.8 -journal article -10.11646/zootaxa.5529.2.8 -1175-5326 -E6903A6B-B76A-4356-B67E-C29B74472D7A +journal article +10.11646/zootaxa.5529.2.8 +1175-5326 +14022545 +E6903A6B-B76A-4356-B67E-C29B74472D7A - + @@ -67,7 +68,7 @@ Zhu & Du ( -Figs. 2–8 +Figs. 2–8 ) @@ -123,20 +124,20 @@ Zhu & Du , China ( -Fig. 1 +Fig. 1 ) Adult habitus: Head dark brown, antennae brown; head slightly wider than pronotum ( -Fig. 3A +Fig. 3A ). Pronotum subquadrate, surface rough with distinct rugosities, the anterior corners truncated; cervical gills are paired, simple, tubular, and tapering apically, one simple gill located on either side of each cervical sclerite ( -Fig. 3B +Fig. 3B ). Wings subhyaline, infuscate, veins dark brown; legs brown ( -Fig. 2 +Fig. 2 ). - + FIGURE 2 . @@ -149,7 +150,7 @@ Head dark brown, antennae brown; head slightly wider than pronotum ( Male (left) and female (right). - + FIGURE 3 . @@ -170,36 +171,36 @@ Body length 8.6–9.0 mm, Forewing length , hindwing length 8.8–9.4 mm (n=3). Tergum 8 heavily sclerotized, featuring a sinuous posterior margin with acute posterolateral processes and a broad posteromedial process, forming a recurved bow-shape process ( -Figs. 4A +Figs. 4A , -5A–B +5A–B ), extending to the anterior edge of tergum 9, the latter which is largely sclerotized with a circular membranous area centrally ( -Figs. 4A +Figs. 4A , -5A–B +5A–B ). Sternum 9 with vesicle, claviform, slightly constricted basally, mostly membranous; base of hypoproct subpentagonal, apical projection slightly upcurved, tapering a blunt apex ( -Figs. 4B–C +Figs. 4B–C ). Tergum 10 membranous medially and sclerotized laterally; both sides posterior to medial membranous area with a large blunt sclerotized projection ( -Figs. 6B–C +Figs. 6B–C ). Paraprocts strongly sclerotized, divided into 3 lobes ( -Figs. 7A–B +Figs. 7A–B ); inner lobe small, apex pointed, almost adhering to the median lobe; median lobe apex pointed, shorter than inner lobe; outer lobe generally triangular with blunt angles, larger than median and inner lobes. Epiproct curled upward, apex indented medially; flagellum lash-like and extending to tergum 9 in dorsal view, apex pointed ( -Figs. 4A +Figs. 4A , -6C–D +6C–D ); dorsal sclerite heavily sclerotized, approximately rectangular ( -Fig. 6A +Fig. 6A ); ventral sclerite heavily sclerotized, without spines ( -Fig. 6B +Fig. 6B ). Cerci ( -Figs. 4A +Figs. 4A , -5C–D +5C–D ), heavily sclerotized, bilobed, generally tetrahedral in shape, swollen like a crab claw, with a blunt tip at the end, and a large, thick finger-like protrusion near the median. - + FIGURE 4 . @@ -212,7 +213,7 @@ dorsal view, apex pointed ( , male A: terminalia, dorsal; B: terminalia, ventral; C: terminalia, lateral. - + FIGURE 5 . @@ -225,7 +226,7 @@ dorsal view, apex pointed ( A: tergum 8 process, lateral; B: tergum 8 process, dorsal; C: cerci, lateral; D: cerci, dorsal. - + FIGURE 6 . @@ -245,9 +246,9 @@ Body length ; forewing length 12.4–12.9 mm ; hindwing length 11.6–12.0 mm (n=2). Pregenital plate nearly semicircular, lung-shaped, and dark brown, covering most of sternum 7 ( -Fig. 8A +Fig. 8A ); posterior edge of pregenital plate with a semicircular indentation and two posteriorly directed protrusions that extend to the anterior margin of sternum 8. Subgenital plate pale, with medial and lateral semicircular spots; vaginal lobes under semicircular spot have bilobed sclerites. Tergum 9 and sternum 9 dark brown ( -Fig. 8B +Fig. 8B ), with a narrow trapezoid membranous indentation on the middle of the anterior margin. diff --git a/data/F9/02/3D/F9023D04FFC8FFF6FF69E6943BF4EDE2.xml b/data/F9/02/3D/F9023D04FFC8FFF6FF69E6943BF4EDE2.xml new file mode 100644 index 00000000000..db5f9649bcc --- /dev/null +++ b/data/F9/02/3D/F9023D04FFC8FFF6FF69E6943BF4EDE2.xml @@ -0,0 +1,343 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +guizhouensis +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 29D +, +30D +, +31C‒D +, +32D‒F +, +36 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +IZAS +), + +CHINA +, +Guizhou +: + +Fanjingshan +, + +5.IV.2000 + +, leg. +C.S. Wu. + + + +PARATYPE +: +CHINA +, +Guizhou +: + +1♀ +( +IZAS +), same data as the holotype + +. + + + + +Differential diagnosis +. It looks similar to + +Rh. flavimima + +sp. nov. +in the general shape of aedeagus, but can be distinguished from the latter by the following characters: femora uniformly yellow, while bicolored and black dorsally in + +Rh. flavimima + +sp. nov. +; pronotum with a black rounded spot in center of disc, while with a black longitudinal median band in + +Rh. flavimima + +sp. nov. +( +Fig. 19A, B +); aedeagus: conjoint dorsal plate of parameres feebly bent ventrally in lateral view, with the middle emargination nearly as deep as that between conjoint dorsal plate and ventral process, while strongly bent ventrally, with the middle emargination shallower in + +Rh. flavimima + +sp. nov. +( +Fig. 20C +); ventral process of each paramere wider and acute at apex, with a small-triangular protuberance along dorsal margin in lateral view, while narrower and narrowly rounded at apex, without any protuberance in + +Rh. flavimima + +sp. nov. +( +Fig. 20C +). + + + + +Description. +Body length: +7.4‒8.4 mm +( +7.4 mm +in +holotype +); width: 2.0‒ +2.4 mm +(2.0 mm in +holotype +). + + +Male +( +Fig. 31C +). Coloration. Body black except for the following parts: head yellowish orange but black at vertex, pronotum yellowish orange, with a black marking before center and feebly darkened at posterolateral parts of disc, femora, coxae and trochanters yellowish orange, elytra pale yellow, each elytron with a wide longitudinal median black band that extending behind humerus to apex and and narrower in the anterior part than the posterior part. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes about 1.1 times pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 1.7 times as long as wide at apices, III about 3.3 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.1 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra with lateral margins feebly diverging posteriorly, about 3.1 times as long as humeral width, 5.1 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus moderately swollen laterally in middle ( +Fig. 32D +); ventral processes of parameres abruptly thinned apically near bases, slender and even in width, bent to each other in ventral view ( +Fig. 32D +), moderately wide and bent dorsally in lateral view, acute at apices, with a small-triangular protuberance in middle of dorsal margin ( +Fig. 32F +); conjoint dorsal plate of parameres distinctly shorter than ventral processes ( +Fig. 32F +), with apical margin triangularly and moderately deeply emarginate in middle, lateral margins moderately diverging apically, latero-apical angles acute in dorsal view ( +Fig. 32E +), and feebly bent ventrally in lateral view ( +Fig. 32F +); emargination between ventral process and conjoint dorsal plate about 1/4 length of aedeagus ( +Fig. 32F +). + + +Female +( +Fig. 31D +). Similar to male, but with larger and stouter body, antennae thinner, head width across eyes about as wide as anterior margin of pronotum, pronotum wider and about 1.2 times as wide as long, anterior margin less arcuate, lateral margins nearly parallel-sided, disc feebly convex on posterolateral parts, elytra yellowish brown at humeri, about 3.0 times as long as humeral width, with lateral margins moderately diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 29D +): vagina stout and abruptly thinned at ventroapical portion into a short and feebly stout tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, progressively thinned apically; spermathecal duct short and about 1/3 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and obviously longer than diverticulum; accessory gland moderately long, about 1.5 times as long as spermatheca. + + + +FIGURE 29. +Internal organ of female reproductive system, ventral view: +A. + +Rhagonycha maculaticeps + + +sp. nov. + +; +B. + +Rh. tibetanimima + + +sp. nov. + +; +C. + +Rh. weixiensis + + +sp. nov. + +; +D. + +Rh. guizhouensis + + +sp. nov. + +Scale bars: 1.0 mm. + + + + +FIGURE 30. +Abdominal sternites VIII of female, ventral view: +A. + +Rhagonycha maculaticeps + + +sp. nov. + +; +B. + +Rh. tibetanimima + + +sp. nov. + +; +C. + +Rh. weixiensis + + +sp. nov. + +; +D. + +Rh. guizhouensis + + +sp. nov. + +Scale bars: 1.0 mm. + + + +Abdominal sternite VIII ( +Fig. 30D +) moderately narrowed posteriorly, acute at latero-apical angles, and arcuately emarginate on both sides of posterior margin, with the portion between lateral emarginations arcuate at apex and not reaching apices of latero-apical angles. + + + + +Etymology. +The specific name is derived from the name of the +type +locality, +Guizhou +, +China +. + + + + +Distribution +( +Fig. 36 +). +China +( +Guizhou +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFCAFFF3FF69E5E93BEBEA57.xml b/data/F9/02/3D/F9023D04FFCAFFF3FF69E5E93BEBEA57.xml new file mode 100644 index 00000000000..7be0a93e091 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFCAFFF3FF69E5E93BEBEA57.xml @@ -0,0 +1,346 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +tibetanimima +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 27C‒D +, +28D‒F +, +29B +, +30B +, +39 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +IZAS +), + +CHINA +, +Yunnan +: + +Lushui +, +Pianma +, + +2100 m + +, + +29.Ⅴ.1981 + +, leg. +X.Z. Zhang. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +2♀♀ +( +IZAS +), +Yunlong +, +Zhibenshan +, + +2430 m + +, 20.Ⅴ + +I.1981 + +, leg. +S.Y. Wang + +; + +1♂ +( +IZAS +), +Lushui +, +Pianma +, + +2300 m + +, + +28.Ⅴ.1981 + +, leg. +S.Y. Wang + +; + +2♀♀ +( +IZAS +), same data as the preceding, + +29.Ⅴ.1981 + + +; + +1♂ +, +1♀ +( +IZAS +), same data as the preceding, leg. +X.Z. Zhang + +; + +1♂ +( +CAS +), +Tengchong +, +Jietoutown +, +Dantang +, +Dahelingganjiao +, +27.73939° N +, +98.69633° E +, + +2010 m + +, + +17.Ⅴ.2006 + +, +Sino-Amer Exped +, leg. +H.B. Liang. + + + + + +Differential diagnosis +. It looks similar to + +Rh. tibetana + +in the body coloration, but can be distinguished from the latter by the aedeagus: conjoint dorsal plate of parameres with lateral margins distinctly diverging apically in dorsal view, while feebly converging in + +Rh. tibetana + +( +Fig. 5H +); ventral process of each paramere triangularly expanded at apices in ventral view, shorter than conjoint dorsal plate in lateral view, while roundly expaned at apices ( +Fig. 5G +), longer than conjoint dorsal plate ( +Fig. 5I +); female reproductive system: spermatheca nearly as long as diverticulum, while longer in + +Rh. tibetana + +( +Fig. 7B +). + + + + +Description. +Body length: +7.5‒8.4 mm +( +7.5 mm +in +holotype +); width: +1.9‒2.3 mm +( +1.9 mm +in +holotype +). + + +Male. +( +Fig. 27C +). Coloration. Body balck except for head and pronotum yellowish orange. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 2.4 times as long as wide at apices, III about 2.5 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum subquadrate, about as wide as long, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and densely punctate. +Elytra nearly parallel-sided, about 3.5 times as long as humeral width, 5.0 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus strongly swollen laterally in middle ( +Fig. 28D +); ventral processes of parameres abruptly thinned apically near bases, widened and acute at apices, directing to each other in ventral view ( +Fig. 28D +), and almost straight in lateral view ( +Fig. 28F +), with apices widened and wide-traigular shaped; conjoint dorsal plate of parameres longer than ventral processes ( +Fig. 28D, F +), with apical margin moderately deeply and roundly emarginate in middle, lateral margins distinctly diverging apically in dorsal view ( +Fig. 28E +), latero-apical angles acute, feebly bent ventrally in lateral view ( +Fig. 28F +); emargination between ventral process and conjoint dorsal plate about 1/3 length of aedeagus ( +Fig. 28F +). + + +Female. +( +Fig. 27D +). Similar to male, but with larger and stouter body, antennae shorter and extending to apical third length of elytra when reclined, head width across eyes as wide as anterior margin of pronotum, pronotum wider and about 1.1 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra yellowish brown at humeri and progressively darkened apically, about 3.3 times as long as humeral width, with lateral margins moderately diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 29B +): vagina stout and abruptly thinned at ventroapical portion into a long and feebly stout tube, where diverticulum and spermathecal duct arising separately; diverticulum long and spiral, evenly thin along the whole length; spermathecal duct short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and nearly as long as diverticulum; accessory gland extremely long, about four times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 30B +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and trapezodianlly protuberant in middle of posterior margin. + + + + +Etymology. +The specific name is derived from the Latin +mimus +(imitator), referring to its similarity to + +Rh. tibetana + +. + + + + +Distribution +( +Fig. 39 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFCBFFF0FF69E5B13BEBE90F.xml b/data/F9/02/3D/F9023D04FFCBFFF0FF69E5B13BEBE90F.xml new file mode 100644 index 00000000000..4299030eeac --- /dev/null +++ b/data/F9/02/3D/F9023D04FFCBFFF0FF69E5B13BEBE90F.xml @@ -0,0 +1,343 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +weixiensis +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 29C +, +30C +, +31A‒B +, +32A‒C +, +39 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +MHBU +), + +CHINA +, +Yunnan +: + +Diqing +, +Weixi +, +Badi +, +Liduluo +, +27.91758° N +, +99.003584° E +, + +2570 m + +, + +30.VI.2020 + +, leg. +W.D. Huang. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +3♂♂ +, +3♀♀ +( +MHBU +), same data as the holotype + +; + +2♂♂ +, +3♀♀ +( +MHBU +), +Diqing +, +Weixi +, +Badi +, +27.894383° N +, +98.929086° E +, + +2139 m + +, + +27.VI.2020 + +, leg. +Y.Q. Liu + +; + +1♂ +( +MHBU +), +Diqing +, +Weixi +, +Badi +, +Nanjiluo +, +27.926377° N +, +98.899067° E +, + +2476 m + +, + +28.VI.2020 + +, leg. +Z. Chen + +; + +1♂ +( +IZAS +), +Weixi +, +Pantiange +, + +2500 m + +, + +24.VII.1981 + +, leg. +S.B. Liao. + + + + + +Differential diagnosis +. It looks similar to + +Rh. tibetana + +in both appearance and general shape of aedeagus, but can be easily distinguished from the latter by the detailed characters of aedeagus: conjoint dorsal plate of parameres with lateral margins diverging apically, latero-apical angles rounded at apices in dorsal view, while lateral margins converging, latero-apical angles truncate in + +Rh. tibetana + +( +Fig. 5H +); ventral process of each paramere fluent dorsally in lateral view, while convex at apex in + +Rh. tibetana + +( +Fig. 5I +). + + + + +Description. +Body length: 6.7‒7.0 mm ( +6.9 mm +in +holotype +); width: 1.8‒2.0 mm ( +1.8 mm +in +holotype +). + + +Male +( +Fig. 31A +). Coloration. Body black except for head and pronotum yellowish orange. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes about 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about twice as long as wide at apices, III about 2.1 times longer than II, VI longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.1 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra nearly parallel-sided, about 3.2 times as long as humeral width, 5.3 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus strongly swollen laterally in middle ( +Fig. 32A, B +); ventral processes of parameres abruptly narrowed apically near bases, widened and rounded at apices ( +Fig. 32C +), directing to each other in ventral view ( +Fig. 32A +), wide and almost straight in lateral view ( +Fig. 32C +), with apices transverse-triangular; conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 32C +), with apical margin roundly and moderately deeply emarginate in middle, lateral margins feebly diverging apically from middle in dorsal view ( +Fig. 32B +), latero-apical angles acute, feebly bent ventrally in lateral view ( +Fig. 32C +); emargination between ventral process and conjoint dorsal plate about 1/3 length of aedeagus ( +Fig. 32C +). + + +Female +( +Fig. 31B +). Similar to male, but with larger and stouter body, eyes less protruding, antennae thinner and shorter, extending to apical third length of elytra when reclined, pronotum with anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra yellowish brown at humeri and progressively darkened apically. + + +Internal organ of reproductive system ( +Fig. 29C +): vagina stout and abruptly thinned at ventroapical portion into a long and feebly stout tube, where diverticulum and spermathecal duct arising separately; diverticulum moderately long and spiral, evenly thin along the whole length; spermathecal duct short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland extremely long, about three times as long as spermatheca. + + +Abdominal sternite VIII ( +Fig. 30C +) strongly narrowed posteriorly, widely triangular at latero-apical angles, triangularly bilobed in middle of posterior margin. + + + + +Etymology. +The specific name is derived from the name of the +type +locality, Weixi, +Yunnan +, +China +. + + + + +Distribution +( +Fig. 39 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFCEFFF5FF69E2E63BEBEB53.xml b/data/F9/02/3D/F9023D04FFCEFFF5FF69E2E63BEBEB53.xml new file mode 100644 index 00000000000..e43968f5f4d --- /dev/null +++ b/data/F9/02/3D/F9023D04FFCEFFF5FF69E2E63BEBEB53.xml @@ -0,0 +1,280 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +acutiapicis +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 33A +, +34A‒C +, +39 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +IZAS +), + +CHINA +, +Yunnan +: + +Weixi +, +Pantiange +, + +2500 m + +, + +24.VII.1981 + +, leg. +S.Y. Wang. + + + + + +Differential diagnosis +. It looks similar to + +Rh. tibetanimima + +sp. nov. +in the appearance, but can be distinguished from the latter by the characteristic aedeagus: ventral processes of parameres long and abruptly thinned near apices, with apices acutely hooked in ventral view, while short and abruptly thinned near bases, with apices triangularly expanded in + +Rh. tibetanimima + +sp. nov. +( +Fig. 28D +); conjoint dorsal plate of parameres deeply emarginate in middle of apical margin in dorsal view, while moderately in + +Rh. tibetanimima + +sp. nov. +( +Fig. 28E +). + + + + +Description. +Body length: +6.4 mm +in +holotype +; width: +1.7 mm +in +holotype +. + + +Male +( +Fig. 33A +). Coloration. Body black except for head and pronotum yellowish orange. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + + + +FIGURE 31. +Habitus of + +Rhagonycha +species + +, dorsal view (A, C. holotype male; B, D. paratype female): +A–B. + +Rh. weixiensis + + +sp. nov. + +; +C–D. + +Rh. guizhouensis + + +sp. nov. + +Scale bars: 2.0 mm. + + + + +FIGURE 32. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. weixiensis + + +sp. nov. + +; +D‒F. + +Rh. guizhouensis + + +sp. nov. + +Scale bars: 1.0 mm. + + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes as wide as anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about twice as long as wide at apices, III about 2.4 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.1 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra nearly parallel-sided, about 3.2 times as long as humeral width, 5.5 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus feebly swollen laterally in middle ( +Fig. 34A +); ventral processes of parameres abruptly thinned apically near apices, largely hooked and acute at apices, directing to each other in ventral view ( +Fig. 34A +), and almost straight in lateral view ( +Fig. 34C +); conjoint dorsal plate of parameres nearly as long as ventral process ( +Fig. 34A, C +), with apical margin roundly and deeply emarginate in middle, lateral margins distinctly diverging apically, latero-apical angles narrowly rounded in dorsal view ( +Fig. 34B +), and strongly inclined ventrally in lateral view ( +Fig. 34C +); emargination between ventral process and conjoint dorsal plate about 2/5 length of aedeagus ( +Fig. 34C +). + + +Female. +Unknown. + + + + +Etymology. +The specific name is derived from the Latin +acutus +(acute), and +apices +(tips), and referring to its ventral processes of parameres of male genitalia being acute at its apex. + + + + +Distribution +( +Fig. 39 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFD0FFECFF69E3953A74EBEB.xml b/data/F9/02/3D/F9023D04FFD0FFECFF69E3953A74EBEB.xml new file mode 100644 index 00000000000..c5646fb6ad8 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFD0FFECFF69E3953A74EBEB.xml @@ -0,0 +1,352 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +ocula +Y. Yang, Xiao & Liu + +, +sp. nov. + + + + + + +( +Figs 23D +, +24D +, +25C‒D +, +26D‒F +, +38 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +MHBU +), + +CHINA +, +Yunnan +: + +Suijiang +, +Luohanping +, + +23.VII.2017 + +, leg. +P. Wang +& +G. Wang. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +4♀♀ +( +MHBU +), same data as holotype + +; + + +Chongqing +: + +1♂ +, +1♀ +( +MHBU +), +Nanchuan +, +Jinfo Shan +, + +24.–28.VII.2003 + +, leg. +C. X. Yuan +& +Y. S. Liu. + + + + + +Differential diagnosis +. It looks like + +Rh. bimucronata + +in the body coloration, but is evidently different from the latter in the aedeagus: ventral process of each paramere strongly bent to each other in ventral view, while nearly straight in the latter ( +Fig. 11A +); conjoint dorsal plate of parameres with lateral margins nearly parallel, apical margin shallowly emarginate in middle, latero-apical angles rounded at apices in dorsal view, while lateral margins feebly diverging posteriorly, apical margin deeply emargination in middle, latero-apical angles acute in the latter ( +Fig. 11B +). + + + + +Description. +Body length: +5.7‒7.3 mm +( +5.7 mm +in +holotype +); width: +1.5‒1.8 mm +( +1.5 mm +in +holotype +). + + +Male +( +Fig. 25C +). Coloration. Body yellow except for the following parts: antennae black except antennomeres Ⅰ yellowish orange, elytra pale yellow, almost transparent and feebly darkened at apices. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes strongly protruding, head width across eyes as wide as anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 1.8 times as long as wide at apices, III about 2.4 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.2 times as wide as long, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and densely punctate. + + +FIGURE 25. +Habitus of + +Rhagonycha +species + +, dorsal view (A, C. holotype male; B, D. paratype female): +A‒B. + +Rh. longicornis + + +sp. nov. + +; +C‒D. + +Rh. ocula + + +sp. nov. + +Scale bars: 2.0 mm. + + + + +FIGURE 26. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. longicornis + + +sp. nov. + +; +D‒F. + +Rh. ocula + + +sp. nov. + +Scale bars: 1.0 mm. + + + + +FIGURE 27. +Habitus of + +Rhagonycha +species + +, dorsal view (A, C. holotype male; B, D. paratype female): +A‒B. + +Rh. maculaticeps + + +sp. nov. + +; +C‒D. + +Rh. tibetanimima + + +sp. nov. + +Scale bars: 2.0 mm. + + +Elytra nearly parallel-sided, about 2.9 times as long as humeral width, 3.5 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus moderately swollen laterally near middle ( +Fig. 26D, E +); ventral processes of parameres abruptly thinned apically near bases, slender and thinned near apices, strongly bent to each other in ventral view ( +Fig. 26D +), and moderately bent ventrally in lateral view ( +Fig. 26F +); conjoint dorsal plate longer than ventral processes ( +Fig. 26F +), with apical margin shallowly and triangularly emarginate in middle, lateral margins nearly parallel-sided, latero-apical angels rounded in dorsal view ( +Fig. 26E +), feebly bent ventrally in lateral view ( +Fig. 26F +); emargination between ventral process and conjoint dorsal plate about 2/5 length of aedeagus ( +Fig. 26F +). + + +Female +( +Fig. 25D +). Similar to male, but with larger and stouter body, eyes less protruding, head width across eyes 1.1 times as wide as anterior margin of pronotum, antennae thinner and shorter, extending to apical third length of elytra when reclined, pronotum wider and about 1.2 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.0 times as long as humeral width. + + +Internal organ of reproductive system ( +Fig. 23D +): vagina stout and abruptly thinned at ventroapical portion into a very long and thin tube, where diverticulum and spermathecal duct arising separately; diverticulum moderately long and spiral, evenly thin along the whole length; spermathecal duct very short and about 1/6 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and shorter than diverticulum; accessory gland extremely long, about four times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 24D +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and feebly bisinuate at posterior margin. + + + + +Etymology. +The specific name is derived from the Latin +oculus +(eye), referring to its strongly prominent eyes. + + + + +Distribution +( +Fig. 38 +). +China +( +Yunnan +, +Chongqing +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFD3FFE8FF69E3FA3BE4EC33.xml b/data/F9/02/3D/F9023D04FFD3FFE8FF69E3FA3BE4EC33.xml new file mode 100644 index 00000000000..71fba6170b4 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFD3FFE8FF69E3FA3BE4EC33.xml @@ -0,0 +1,416 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +longicornis +Y. Yang, Xiao & Liu + +, +sp. nov. + + + + + + +( +Figs 23C +, +24C +, +25A‒B +, +26A‒C +, +38 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +MHBU +), + +CHINA +, +Xizang +: + +Mêdog +, +Hanmi +, + +28.VII.2013 + +, leg. +X.L. Bai +& +J.S. Shan. + + + +PARATYPES +: +CHINA +, +Xizang +: + +1♂ +, +1♀ +( +MHBU +), same data as the holotype + +; + +4♂♂ +, +20♀♀ +( +MHBU +), same locality as the holotype, + +2380 m + +, + +9.VIII.2016 + +, leg. +G.D. Ren + +; + +2♂♂ +, +2♀♀ +( +IZAS +), +Mêdog +, +Hanmi +, +No +1 +Bridge +, + +1300‒ 2380 m + +, + +10.VIII.2003 + +, leg. +H.J. Xue +& +X.P. Wang + +; + +1♀ +( +IZAS +), +Nyingchi +, +Pêlung +, + +2100 m + +, + +1.IX.2005 + +, leg. +X.L. Chen + +; + +1♀ +( +IZAS +), +Zayü +, +Gujing +, + +1.VI.1973 + +, leg. +F.S. Huang + +; + +4♀♀ +( +IZAS +), +Bomi +, +Yi’ong +, + +2300 m + +, + +14.VIII.1983 + +, leg. +Y.H. Han + +; + +1♂ +( +IZAS +), same data as the preceding, + +15.VIII.1983 + + +; + +2♂♂ +, +1♀ +( +CAU +), +Yi’ong +, + +2300 m + +, + +29.VII.1978 + +, leg. +F.S. Li + +; + +1♂ +( +CAU +), same data as the preceding, + +30.VII.1978 + + +; + +1♀ +( +CAU +), same data as the preceding, + +31.VII.1978 + + +. + + + + +Differential diagnosis +. It looks similar to + +Rh. spinosa + +in the shape of aedeagus, but can be distinguished from the latter by the following characters: legs and scutellum yellow, while black in + +Rh. spinosa + +( +Fig. 6A +); aedeagus: ventral process of each paramere feebly thinned near apex in ventral view, while obviously widened in + +Rh. spinosa + +( +Fig. 5D +); conjoint dorsal plate of parameres feebly longer than ventral processes in lateral view, while obviously longer in + +Rh. spinosa + +( +Fig. 5F +). + + + + +Description. +Body length: +7.5‒8.4 mm +( +7.6 mm +in +holotype +); width: +1.5‒2.1 mm +( +1.7 mm +in +holotype +). + + +Male +( +Fig. 25A +). Coloration. Body yellowish orange except for the following parts: antennae black, except antennomeres Ⅰ–II yellowish orange, elytra pale yellow, almost transparent. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 2.7 times as long as wide at apices, III about 1.8 times longer than II, VI longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.1 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra with lateral margins feebly diverging posteriorly, about 3.5 times as long as humeral width, 4.0 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus moderately swollen laterally near middle ( +Fig. 26A, B +); ventral processes of parameres abruptly thinned apically near bases, slender and thinned at apices, bent to each other in ventral view ( +Fig. 26A +), and almost straight in lateral view, with apices widened and rounded ( +Fig. 26C +); conjoint dorsal plate feebly longer than ventral process ( +Fig. 26C +), with apical margin feebly emarginate in middle, lateral margins feebly diverging apically from middle, latero-apical angles widely rounded in dorsal view ( +Fig. 26B +), nearly straight in lateral view ( +Fig. 26C +); emargination between ventral process and conjoint dorsal plate about 2/5 length of aedeagus ( +Fig. 26C +). + + +Female +( +Fig. 25B +). Similar to male, but with larger and stouter body, eyes less protruding, head width across eyes about 0.8 times as wide as anterior margin of pronotum, antennae thinner and shorter, extending to apical third length of elytra when reclined, pronotum wider and about 1.3 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.3 times as long as humeral width, with lateral margins moderately diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 23C +): vagina stout and abruptly thinned at ventroapical portion into a short and feebly stout tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, progressively thinned apically; spermathecal duct nearly as short as the apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and twice longer than diverticulum; accessory gland moderately long, about 1.5 times as long as spermatheca. + + +Abdominal sternite VIII ( +Fig. 24C +) strongly narrowed posteriorly, widely triangular at latero-apical angles, and shallowly emarginate on both sides of posterior margin, with the portion between lateral emarginations truncate at apex and nearly horizonital with apices of latero-apical angles. + + + + +Etymology. +The specific name is derived from the Latin +longus +(long), and +cornus +(horn), and referring to its long antennae. + + + + +Distribution +( +Fig. 38 +). +China +( +Xizang +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFD4FFF2FF69E4ED3BEBEAEE.xml b/data/F9/02/3D/F9023D04FFD4FFF2FF69E4ED3BEBEAEE.xml new file mode 100644 index 00000000000..f84cb854df5 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFD4FFF2FF69E4ED3BEBEAEE.xml @@ -0,0 +1,324 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +maculaticeps +Y. Yang, Xiao & Liu + +, +sp. nov. + + + + + + +( +Figs 27A‒B +, +28A‒C +, +29A +, +30A +, +37 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +MHBU +), + +CHINA +, +Yunnan +: + +Changjun Workstation +, +24.5438° N +, +101.0278° E +, + +10.VII.2018 + +, leg. +Y.J. Tong. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +1♀ +( +MHBU +), same data as holotype + +; + +1♂ +, +2♀ +( +MHBU +), Lincang, Wulao Shan Foresty, + +9.–10.VII.2000 + +, leg. +J. S. Xu +& +J. X. Zhang + +; + +1♀ +( +MHBU +), +Yunnan prov. +, +Lushui County +, +Pianma Town +, + +2400 m + +, + +6.VII.2010 + +, leg. +J.Q. Zhu. + + + + + +Differential diagnosis +. It is the most similiar to + +Rh. limbatella + +in the overall shape of aedeagus, but can be distinguished from the latter by the following characters: head with a black marking on vertex, while uniformly orange in + +Rh. limbatella + +; pronotum with a black longitudinal median band, while with a black rounded marking in center of disc in + +Rh. limbatella + +( +Fig. 1D +); aedeagus: ventral process of each paramere widened near apex, while thinned in + +Rh. limbatella + +( +Fig. 5A +); female internal genitalia: vagina abruptly thinned into a long tube, while into a short tube in + +Rh. limbatella + +( +Fig. 3D +). + + +Descriptive. +Body length: 6.0‒ +7.8 mm +(6.0 mm in +holotype +); width: 1.6‒2.0 mm ( +1.6 mm +in +holotype +). + + +Male. +( +Fig. 27A +). Coloration. Body yellowish orange except for the following parts: head with a black marking at vertex, antennae, tibiae and tarsi black, pronotum with a wide longitudinal median black band that is about one third width of pronotum, elytra pale yellow, each elytron with an evenly wide longitudinal median black band that extending from humerus to apex. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 2.5 times as long as wide at apices, III about 1.9 times longer than II, VIII longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.2 times as wide as long, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin feebly bisinuate, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and densely punctate. +Elytra nearly parallel-sided, about 3.3 times as long as humeral width, 4.4 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + + +FIGURE 28. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. maculaticeps + + +sp. nov. + +; +D‒F. + +Rh. tibetanimima + + +sp. nov. + +Scale bars: 1.0 mm. + + + +Aedeagus moderately swollen laterally in middle ( +Fig. 28A +); ventral processes of parameres abruptly thinned near bases, then widened apically, subrounded at apices, bent to each other in ventral view ( +Fig. 28A +), and almost straight in lateral view, with apices long-triangularly widened ( +Fig. 28C +); conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 28B, C +), with apical margin almost straight, lateral margins feebly diverging apically, latero-apical angles widely rounded in dorsal view ( +Fig. 28B +), and feebly inclined ventrally in lateral view ( +Fig. 28C +); emargination between ventral process and conjoint dorsal plate about 1/3 length of aedeagus ( +Fig. 28C +). + + +Female +( +Fig. 27B +). Similar to male, but with larger and stouter body, antennae shorter and extending to apical third length of elytra when reclined, head width across eyes as wide as anterior margin of pronotum, pronotum wider and about 1.3 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.3 times as long as humeral width. + + +Internal organ of reproductive system ( +Fig. 29A +): vagina stout and abruptly thinned at ventroapical portion into a long and feebly stout tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, evenly thin along the whole length; spermathecal duct very short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and twice longer than diverticulum; accessory gland long, about twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 30A +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and semicircularly protuberant in middle of posterior margin. + + + + +Etymology. +The specific name is derived from the Latin +maculatus +(spotted) and +ceps +(head), referring to its head with a black marking on vertex. + + + + +Distribution +( +Fig. 37 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFDBFFE1FF69E7A83BEEEF0F.xml b/data/F9/02/3D/F9023D04FFDBFFE1FF69E7A83BEEEF0F.xml new file mode 100644 index 00000000000..31270c4c8b7 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFDBFFE1FF69E7A83BEEEF0F.xml @@ -0,0 +1,444 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +trimacula +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 17D +, +18D +, +19C‒D +, +20D‒F +, +37 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +IZAS +), + +CHINA +, +Sichuan +: + +Gonggashan +, +Yanzigou +, + +2300 m + +, + +11.VI.1983 + +, leg. +S.Y. Wang. + + + +PARATYPES +: +CHINA +, +Sichuan +: + +1♀ +( +IZAS +), same data as holotype + +; + +1♀ +( +IZAS +), same locality and collector as the preceding, + +6.VI.1983 + + +; + +2♂♂ +, +2♀♀ +( +IZAS +), +Kangding +, + +2300 m + +, + +22.VI.1983 + +, leg. +S.Y. Wang + +; + +1♀ +( +IZAS +), +Kangding +, +Huangjiagou +, + +4.VIII.2004 + +, leg. +Y. Zhang + +; + +1♀ +( +IZAS +), +Luding +, +Xinxing +, +Yanzigou +, + +1560 m + +, + +7.VIII.2004 + +, leg. +Y. Zhang + +; + +1♂ +, +1♀ +( +IZAS +), +Luding +, +Xinxing +, + +19.VI.1983 + +; leg. +S.Y. Wang + +; + +2♀♀ +( +IZAS +), +Hailuogou Protection Station +, + +16.V.2009 + +, leg. +H.B. Liang + +; + +1♀ +( +IZAS +), +Emeishan +, + +2100 m + +, + +23.VI.1955 + +, leg. +K.R. Huang +& +Y.T. Jin. + + + + + +Differential diagnosis. +It resembles + +Rh. flavimima + +sp. nov. +in the general appearance, but can be distinguished from the latter by the following characters: femora uniformly black, while bicolored in + +Rh. flavimima + +sp. nov. +; pronotum with three black markings on disc, while only with a black longitudinal median band in + +Rh. flavimima + +sp. nov. +( +Fig. 19A, B +); aedeagus: ventral process of each paramere bent ventrally and shorter than conjoint dorsal plate in lateral view, while bent dorsally and longer in + +Rh. flavimima + +sp. nov. +( +Fig. 20C +); conjoint dorsal plate of parameres with lateral margins feebly converging apically, while diverging apically in + +Rh. flavimima + +sp. nov. +( +Fig. 20B +). + + + + +Description. +Body length: +6.8‒7.9 mm +( +6.9 mm +in +holotype +); width: +1.6‒2.8 mm +( +1.7 mm +in +holotype +). + + +Male +( +Fig. 19C +). Coloration. Body black except for the following parts: head yellowish orange except black at vertex, elytra pale yellow, each elytron with a moderately wide longitudinal median black band that extending behind humerus to apex and narrower in the anterior part than the posterior part; trochanters yellowish orange; pronotum yellowish orange, with a large black marking in center and a pair of small black markings on both sides of disc. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres long-triangular, widest in middle; antennae filiform, extending to apical third length of elytra when reclined, antennomeres II shortest, about 2.7 times as long as wide at apices, III about 1.7 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum subquadrate, about 0.9 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra with lateral margins feebly diverging posteriorly, about 3.6 times as long as humeral width, 4.9 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus moderately swollen laterally near middle ( +Fig. 20D, E +); ventral processes of parameres abruptly and strongly thinned apically near bases, feebly widened and rounded at apices, bent to each other in ventral view ( +Fig. 20D +), moderately wide and bent ventrally in lateral view ( +Fig. 20F +); conjoint dorsal plate of parameres longer than ventral processes, with apical margin roundly and deeply emarginate in middle, lateral margins feebly converging apically, latero-apical angles feebly widened and bent to each other in dorsal view ( +Fig. 20E +), acute at apices and moderately inclined ventrally in lateral view ( +Fig. 20F +); emargination between ventral process and conjoint dorsal plate about 2/5 length of aedeagus ( +Fig. 20F +). + + +Female +( +Fig. 19D +). Similar to male, but with larger and stouter body, antennae shorter, extending to elytral mid-length when reclined, eyes less protruding and head width across eyes about as wide as anterior margin of pronotum, pronotum wider and about 1.2 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.5 times as long as humeral width, with lateral margins moderately diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 17D +): vagina stout and abruptly thinned at ventroapical portion into a short and thin tube, where diverticulum and spermathecal duct arising separately; diverticulum long and spiral, evenly thin along the whole length; spermathecal duct short and about 1/3 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively tinned apically and nearly as long as diverticulum; accessory gland long, almost twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 18D +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and trapezodinally protuberant in middle of posterior margin. + + + + +FIGURE 19. +Habitus of + +Rhagonycha +species + +, dorsal view (A, C. holotype male; B, D. paratype female): +A‒B. + +Rh. flavimima + + +sp. nov. + +; +C‒D. + +Rh. trimacula + + +sp. nov. + +Scale bars: 2.0 mm. + + + + +FIGURE 20. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. flavimima + + +sp. nov. + +; +D‒F. + +Rh. trimacula + + +sp. nov. + +Scale bars: 1.0 mm. + + + + +Etymology. +The specific name is derived from the Latin +tres +(three) and +macula +(spot), referring to its pronotum with three black markings. + + + + +Distribution +( +Fig. 37 +). +China +( +Sichuan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFDDFFE5FF69E7A83BEBEF43.xml b/data/F9/02/3D/F9023D04FFDDFFE5FF69E7A83BEBEF43.xml new file mode 100644 index 00000000000..2a6262df9d7 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFDDFFE5FF69E7A83BEBEF43.xml @@ -0,0 +1,287 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +similis +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 21C‒D +, +22D‒F +, +23B +, +24B +, +37 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +IZAS +), + +CHINA +, +Yunnan +: + +Lushui +, +Yaojiaping +, + +2500 m + +, + +4.VI.1981 + +, leg. +S.B. Liao. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +1♀ +( +IZAS +), same data as holotype + +; + +6♂♂ +, +5♀♀ +( +MHBU +), +Lusaihe +, + +30.VI.2019 + +, leg. +Y.D. Chen +& +Q.L. Lei. + + + + + +Differential diagnosis +. It looks similar to + +Rh. limbatella + +in the general appearance, but can be easily distinguished from the latter by the following characters: tibiae and tarsi orange, while black in + +Rh. limbatella + +( +Fig. 1D +); aedeagus: conjoint dorsal plate of parameres with lateral margins nearly parallel, and apical margin obviously emarginate in middle, while lateral margins diverging apically, and apical margin hardly emarginate in middle in + +Rh. limbatella + +( +Fig. 5B +); female internal genitalia: spermatheca about as long as diverticulum, while longer in + +Rh. limbatella + +; accessory gland almost five times longer than spermatheca, while only twice longer in + +Rh. limbatella + +( +Fig. 3D +). + + + + +Description. +Body length: +7.1‒8.1 mm +( +7.1 mm +in +holotype +); width: 1.8‒2.0 mm ( +1.8 mm +in +holotype +). + + +Male +( +Fig. 21C +). Coloration. Body yellowish orange except for the following parts: pronotum with a small black marking in center of disc; antennae black, elytra pale yellow, each elytron with an evenly wide longitudinal median black band that extending from humerus to apex. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes about as wide as anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 1.7 times as long as wide at apices, III about 2.3 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.3 times as wide as long, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and densely punctate. +Elytra with lateral margins nearly parallel, about 3.3 times as long as humeral width, 4.5 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus feebly swollen laterally near middle ( +Fig. 22D +); ventral processes of parameres abruptly thinned apically near bases, slender and even in width, rounded at apices, bent to each other in ventral view ( +Fig. 22D +), and almost straight in lateral view ( +Fig. 22F +); conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 22E, F +), with apical margin roundly and shallowly emarginate in middle, lateral margins nearly parallel-side, latero-apical angles rounded in dorsal view ( +Fig. 22E +), and nearly straight in lateral view ( +Fig. 22F +); emargination between ventral process and conjoint dorsal plate about 1/3 length of aedeagus ( +Fig. 22F +). + + +Female +( +Fig. 21D +). Similar to male, but with larger and stouter body, antennae thinner and shorter, extending to apical third length of elytra when reclined, head width across eyes 0.9 times as wide as anterior margin of pronotum, pronotum wider and about 1.2 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.2 times as long as humeral width. + + +Internal organ of reproductive system ( +Fig. 23B +): vagina stout and abruptly thinned at ventroapical portion into a long and thin tube, where diverticulum and spermathecal duct arising separately; diverticulum moderately long and spiral, evenly thin along the whole length; spermathecal duct very short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and nearly as long as diverticulum; accessory gland extremely long, about five times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 24B +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and arcuately emarginate on both sides of posterior margin, with the portion between lateral emarginations truncate at apex and feebly extending over apices of latero-apical angles. + + + + +Etymology. +The specific name is derived from the Latin + +similis + +(resemble), referring to its similarity to + +Rh. limbatella + +in appearance. + + + + +Distribution +( +Fig. 37 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFDEFFE6FF69E7A83BEBEF1B.xml b/data/F9/02/3D/F9023D04FFDEFFE6FF69E7A83BEBEF1B.xml new file mode 100644 index 00000000000..98d4cc96bbb --- /dev/null +++ b/data/F9/02/3D/F9023D04FFDEFFE6FF69E7A83BEBEF1B.xml @@ -0,0 +1,258 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +curtiapicis +Y. Yang, Xiao & Liu + +, +sp. nov. + + + + + + +( +Figs 21A‒B +, +22A‒C +, +23A +, +24A +, +39 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +MHBU +), + +CHINA +, +Yunnan +: + +Malipo +, +Ganbazi +, + +7.VI.2015 + +, leg. +L.M. Li. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +3♀♀ +( +MHBU +), same data as holotype + +. + + + + +Differential diagnosis +. It is the most similar to + +Rh. tibetana + +in the overall shape of aedeagus, but can be distinguished from the latter by the following characters: pro- and mesofemora bicolored, while uniformly black in + +Rh. tibetana + +; each elytron with a wide longitudinal black band, while uniformly black in + +Rh. tibetana + +( +Fig. 6B +); aedeagus: conjoint dorsal plate of parameres distinctly longer than ventral processes and strongly bent ventrally in lateral view, with lateral margins diverging apically in dorsal view, while conjoint dorsal plate feebly shorter than ventral processes and feebly bent ventrally ( +Fig. 5I +), with lateral margins converging apically in + +Rh. tibetana + +( +Fig. 5H +). + + + + +Description. +Body length: 7.6‒8.0 mm ( +7.7 mm +in +holotype +); width: +1.8‒1.9 mm +( +1.8 mm +in +holotype +). + + +Male +( +Fig. 21A +). Coloration. Body black except for the following parts: head and pronotum yellowish orange, pro- and mesofemora yellowish orange and black along dorsal sides, coxae and trochanters yellowish orange; elytra pale yellow, each elytron with a evenly wide longitudinal median black band that extending from humerus to apex. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head subtriangular, surface densely and finely punctate; eyes moderately protruding, head width across eyes 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 2.7 times as long as wide at apices, III about 1.7 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum transverse, about 1.2 times as wide as long, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and densely punctate. +Elytra with lateral margins feebly diverging posteriorly, about 3.4 times as long as humeral width, 4.5 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus moderately swollen laterally near middle ( +Fig. 22A, B +); ventral processes of parameres abruptly thinned apically near bases, triangularly widened at apices, directing to each other in ventral view ( +Fig. 22A +), moderately wide and feebly inclined ventrally in lateral view ( +Fig. 22A +); conjoint dorsal plate of parameres obviously longer than ventral processes ( +Fig. 22A, C +), with apical margin roundly and deeply emarginate in middle, lateral margins distinctly diverging apically in dorsal view ( +Fig. 22B +), latero-apical angles acute, strongly bent ventrally in lateral view ( +Fig. 22C +); emargination between ventral process and conjoint dorsal plate about 2/5 length of aedeagus ( +Fig. 22C +). + + +Female +( +Fig. 21B +). Similar to male, but with larger and stouter body, eyes less protruding, head width across eyes 0.9 times as wide as anterior margin of pronotum, antennae shorter and extending to apical third length of elytra when reclined, pronotum wider and about 1.2 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.3 times as long as humeral width, with lateral margins moderately diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 23A +): vagina stout and abruptly thinned at ventroapical portion into a long and thin tube, where diverticulum and spermathecal duct arising separately; diverticulum long and spiral, almost evenly thin along the whole length; spermathecal duct very short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland long, almost twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 24A +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and trapezodinally protuberant in middle of posterior margin, with the middle protuberance feebly emarginate at apex. + + + + +Etymology. +The specific name is derived from the Latin +curvus +(curved) and +apices +(tip), referring to its conjoint dorsal plate bent ventrally. + + + + +Distribution +( +Fig. 39 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFE0FFD8FF69E7A83D65EA64.xml b/data/F9/02/3D/F9023D04FFE0FFD8FF69E7A83D65EA64.xml new file mode 100644 index 00000000000..2723af82611 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFE0FFD8FF69E7A83D65EA64.xml @@ -0,0 +1,173 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +disconigra +( +Pic, 1907 +) + + + + + + + +( +Figs 14D +, +40 +) + + + + + + + +Cantharis disconigra +Pic, 1907: 126 + + +. + + + + + + +Rhagonycha disconigra +Wittmer, 1997: 327 + + +. + + + + + +Other material examined. + +1♂ +( +Fig. 14D +, +NHMB +), “N +Vietnam +, + +13.v.1995 + +, +Lai Chau prov. +, Si Pang, N. rdg., +Hoan Lien Son Mts. +, + +1950‒1970m + +, +M. Owada +” (det. +W. Wittmer +) + +. + + + + +Distribution +( +Fig. 40 +). +Vietnam +( +Tonkin +). + + +Reamrks. +The +type +was not located in MNHN, but the habitus photo of a determined specimen by W. Wittmer in NHMB is provided to allow making comparisons with other species herein. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFE0FFD9FF69E55F3AE9EA0B.xml b/data/F9/02/3D/F9023D04FFE0FFD9FF69E55F3AE9EA0B.xml new file mode 100644 index 00000000000..51a7f2f4b29 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFE0FFD9FF69E55F3AE9EA0B.xml @@ -0,0 +1,479 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +nigricolor +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 15A‒B +, +16A‒C +, +17A +, +18A +, +41 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +IZAS +), + +CHINA +, +Sichuan +: + +Emeishan +, + +18.VI.1955 + +, leg. +K.R. Huang +& +Y.T. Jin. + + + +PARATYPES +: +CHINA +, +Sichuan +: + +1♂ +, +4♀♀ +( +IZAS +), +Emeishan +, + +20.VI.1955 + +, leg. +K.R. Huang +& +Y.T. Jin + +; + +1♀ +( +IZAS +); same data as the preceding, + +17.VI.1955 + + +; + +3♂♂ +( +IZAS +), same data as the preceding, + +18.VI.1955 + + +; + +1♂ +( +IZAS +), same data as the preceding, + +23.VI.1955 + + +; + +1♀ +( +IZAS +); same locality as the preceding, + +1600‒2100 m + +, + +24.VI.1955 + +, leg. +X.K. Bu + +; + +1♀ +( +IZAS +), +Emeishan +, +Xixiangchi +, + +1800‒2000 m + +, + +25.Ⅴ.1957 + +, leg. +K.R. Huang + +; + +1♀ +( +IZAS +), +Emeishan +, +Jiulaodong +, + +1800‒1900 m + +, + +6.VII.1957 + +, leg. +F.X. Zhu. + + + +Guizhou +: + +4♀♀ +( +MHBU +), +Leigongshan +, +Xiaodanjiang +, + +860‒ 1300 m + +, + +31.V–1.VI.2005 + +, leg. +Q.R. Liao + +; + +4♀♀ +( +MHBU +), +Leigongshan +, +Lianhuaping +, + +1300‒2178 m + +, + +2‒3.VI.2005 + +, leg. +Y.H. Song + +; + +1♀ +( +MHBU +), same data as the preceding, leg. +Z.H. Zhou. + + + +Chongqing +: + +1♂ +( +MHBU +), +Wuxi +, +Lanying +, +Lanying +, +31°24′24.54″ N +, +109°53′7.92″ E +, + +1764 m + +, + +24.VI.2022 + +, leg. +L.Y. Wang + +; + +1♂ +( +MHBU +), +Wuxi +, +Lanying +, +Yintiaoling Nature Reserve +, +Huangcaoping +, +31°24′50.13″ N +, +109°55′40.2″ E +, + +2039 m + +, + +24.VI.2022 + +, leg. +L.Y. Wang + +; + +1♀ +( +MHBU +), +Wuxi +, +Yintiaoling Nature Reserve +, +Zhuanping Management +and +Protection Station +, +31°29′56.9889′′ N +, +109°56′59.2115′′ E +, + +1973.24 m + +, + +18.VIII.2022 + +, leg. +L.Y. Wang +, +T.Y. Ren + +et al. + + + + +Differential diagnosis. +This species can be easily distinguished from all others by its uniformly black head and pronotum, as well as its aedeagus shape, which is strongly swollen laterally and ventrally at basal part (while at most moderately swollen in other species). + + + + +Description. +Body length: +7.8‒8.7 mm +( +8.6 mm +in +holotype +); width: +1.9‒3.5 mm +( +2.1 mm +in +holotype +). + + +Male +( +Fig. 15A +). Coloration. Body black except for elytra pale yellow, each elytron with a wide longitudinal median black band that extending from humerus to apex and narrower in the anterior part than the posterior part. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes about as wide as anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to basal 3/4 length of elytra when reclined, antennomeres II shortest, about 2.5 times as long as wide at apices, III about 1.8 times longer than II, V longest, XI feebly longer than X and pointed at apices. +Pronotum subquadrate, about 0.9 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra with lateral margins feebly diverging posteriorly, about 3.7 times as long as humeral width, 5.6 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus feebly swollen laterally near middle ( +Fig. 16A, B +) and strongly swollen ventrally in lateral view ( +Fig. 16C +); ventral processes of parameres abruptly and strongly thinned apically near bases, with apices rounded and bent to each other in ventral view ( +Fig. 16A +), narrow and almost straight in lateral view ( +Fig. 16C +); conjoint dorsal plate of parameres feebly longer than ventral processes ( +Fig. 16C +), with apical margin roundly and shallowly emarginate in middle, lateral margins nearly parallel, latero-apical angles truncate in dorsal view ( +Fig. 16B +), feebly inclined ventrally in lateral view ( +Fig. 16C +); emargination between conjoint dorsal plate and ventral process about 1/3 length of aedeagus ( +Fig. 16C +). + + +Female +( +Fig. 15B +). Similar to male, but with larger and stouter body, eyes less protruding, head width across eyes 0.9 times as wide as anterior margin of pronotum, antennae shorter and extending to apical third length of elytra when reclined, pronotum wider and about 1.3 times as wide as long, anterior margin more arcuate, disc feebly convex on posterolateral parts, elytra about 3.5 times as long as humeral width, with lateral margins moderately diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 17A +): vagina stout and abruptly thinned at ventroapical portion into a very short and stout tube, where diverticulum and spermathecal duct arising separately; diverticulum very short and spiral, evenly thin along the whole length; spermathecal duct very short; spermatheca provided with a spiral tube, progressively thinned apically and about twice longer than diverticulum; accessory gland extremely long, about five times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 18A +) moderately narrowed posteriorly, widely triangular at latero-apical angles, and small-triangularly emarginate in middle of posterior margin. + + + + +Etymology. +The specific name is derived from the Latin +niger +(black) and +color +(colour), referring to its black body colouration. + + + + +Distribution +( +Fig. 41 +). +China +( +Sichuan +, +Chongqing +, +Guizhou +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFE1FFDDFF69E58D3BEBE99F.xml b/data/F9/02/3D/F9023D04FFE1FFDDFF69E58D3BEBE99F.xml new file mode 100644 index 00000000000..145d7814047 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFE1FFDDFF69E58D3BEBE99F.xml @@ -0,0 +1,378 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +falcata +Y. Yang, Liu & X. Yang + +, +sp. nov. + + + + + + +( +Figs 15C‒D +, +16D‒F +, +17B +, +18B +, +39 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +CAS +), + +CHINA +, +Yunnan +: + +Tengchong +, +Jietou +, +Datang +, +25.74556° N +, +98.69630° E +, + +2030 m + +, + +15.Ⅴ.2006 + +, leg. +H.B. Liang. + + + +PARATYPES +: +CHINA +, +Yunnan +: + +1♂ +, +2♀♀ +( +CAS +), Tengchong, Houqiao, Danzha, Zhaobitang, +25.55627° N +, +98.20941° E +, + +29.Ⅴ.2006 + +, leg. +H.B. Liang + +; + +1♂ +( +MHBU +), +Malipo +, +Ganbazi +, + +7.VI.2015 + +, leg. +L.M. Li. + + + + + +Differential diagnosis. +It looks similar to + +Rh. spinosa + +in the appearance, but can be easily distinguished from the latter by the characteristic aedeagus: ventral process of each paramere processively thinned near apex, while expanded in + +Rh. spinosa + +( +Fig. 5D +); conjoint dorsal plate of parameres with lateral margins each with a falcate prominence, and apical margin deeply emarginate in middle, while lateral margins without any prominence, apical margin hardly emarginate in + +Rh. spinosa + +( +Fig. 5E +). + + + + +Description. +Body length: 7.0‒ +8.5 mm +(7.0 mm in +holotype +); width: +1.8‒2.2 mm +( +1.8 mm +in +holotype +). + + +Male +( +Fig. 15C +). Coloration. Body black except for the following parts: head and pronotum uniformly yellowish orange, elytra pale yellow, almost transparent and feebly darkened at apices. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head rounded, surface densely and finely punctate; eyes moderately protruding, head width across eyes about as wide as anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to elytral apices when reclined, antennomeres II shortest, about 2.8 times as long as wide at apices, III about 1.9 times longer than II, VII longest, XI feebly longer than X and pointed at apices. +Pronotum subquadrate, about 0.9 times as long as wide, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. +Elytra nearly parallel-sided, about 3.3 times as long as humeral width, 4.6 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus strongly swollen laterally near middle ( +Fig. 16D, E +); ventral processes of parameres abrutly thinned apically near bases, with apices narrowly rounded and strongly bent to each other in ventral view ( +Fig. 16D +), progressively narrowed apically and almost straight in lateral view ( +Fig. 16D +); conjoint dorsal plate of parameres obviously longer than ventral processes ( +Fig. 16D, F +), with apical margin roundly and deeply emarginate in middle, lateral margins distinctly diverging apically in dorsal view ( +Fig. 16E +), latero-apical angles acute, inclined ventrally in lateral view, each side with a falcate prominence in middle of lateral margin ( +Fig. 16E, F +); emargination between conjoint dorsal plate and ventral process about 2/5 length of aedeagus ( +Fig. 16F +). + + +Female +( +Fig. 15D +). Similar to male, but with larger and stouter body, eyes less protruding, head width across eyes about as wide as anterior margin of pronotum, antennae thinner and shorter, extending to apical third length of elytra when reclined, pronotum wider and about 1.2 times as wide as long, disc feebly convex on posterolateral parts, elytra about 3.1 times as long as humeral width. + + + +FIGURE 15. +Habitus of + +Rhagonycha +species + +, dorsal view (A, C. holotype male; B, D. paratype female): +A‒B. + +Rh. nigricolor + + +sp. nov. + +; +C‒D. + +Rh. falcata + + +sp. nov. + +Scale bars: 2.0 mm. + + + + +FIGURE 16. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. nigricolor + + +sp. nov. + +; +D‒F. + +Rh. falcata + + +sp. nov. + +Scale bars: 1.0 mm. Abbreviations: bp—basal piece; dp—dorsal plate of each paramere; is—inner sac of median lobe; ml—median lobe; te—tegmen; vp—ventral process of each paramere. + + + + +FIGURE 17. +Internal organ of female reproductive system, ventral view: +A. + +Rhagonycha nigricolor + + +sp. nov. + +; +B. + +Rh. falcata + + +sp. nov. + +; +C. + +Rh. flavimima + + +sp. nov. + +; +D. + +Rh. trimacula + + +sp. nov. + +Scale bars: 1.0 mm. Abbreviations: ag—accessory gland; di— diverticulum; sd—spermathecal duct; sp—spermatheca; ov—median oviduct; va—vagina. + + + +Internal organ of reproductive system ( +Fig. 17B +): vagina stout and abruptly thinned at ventroapical portion into a long and thin tube, where diverticulum and spermathecal duct arising separately; diverticulum long and spiral, almost evenly thin along the whole length; spermathecal duct very short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and nearly as long as diverticulum; accessory gland extremely long, almost three times as long as spermatheca. + + +Abdominal sternite VIII ( +Fig. 18B +) moderately narrowed posteriorly, widely triangular at latero-apical angles, and widely and trapezodinally protuberant in middle of posterior margin. + + + + +Etymology. +The specific name is derived from the Latin +falcatus +(hooked), referring to its conjoint dorsal plate each side with a falcate prominence. + + + + +Distribution +( +Fig. 39 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFE5FFE2FF69E5793A65EFD9.xml b/data/F9/02/3D/F9023D04FFE5FFE2FF69E5793A65EFD9.xml new file mode 100644 index 00000000000..7119c0c2add --- /dev/null +++ b/data/F9/02/3D/F9023D04FFE5FFE2FF69E5793A65EFD9.xml @@ -0,0 +1,592 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +flavimima +Y. Yang, Xiao & Liu + +, +sp. nov. + + + + + + +( +Figs 17C +, +18C +, +19A‒B +, +20A‒C +, +36 +) + + + + +Type material. + + +HOLOTYPE +: + +♂ +( +MHBU +), + +CHINA +, +Hubei +: + +Shennongjia +, +Pingqian +, +31°28'08" N +, +110°02'23.4" E +, + +1576 m + +, + +4–7.VII.2014 + +, leg. +Y.B. Ba +& +S.Y. Tang. + + + +PARATYPES +: +CHINA +, +Hubei +: + +1♂ +, +26♀♀ +( +MHBU +), same data as the holotype + +; + +3♀♀ +( +MHBU +), +Shennongjia +, +Jiangping Forestry +, + +6.VI.2018 + +, leg. +P. Wang + +; + +2♀♀ +( +MHBU +), +Shennongjia +, +Hongping +, +Wenshui +, + +1.VI.2018 + +, leg. +P. Wang +& +L. Li + +; + +2♀♀ +( +MHBU +), +Shennongjia +, +Yousongping +, +Sentry +, + +23.VI.2019 + +, leg. +P. Wang + +; + +1♂ +, +1♀ +( +MHBU +), +Shennongjia +, +Wenshui Forestry +, + +1700–2000 m + +, + +16.VII.2003 + +, leg. +D.W. Dai + +; + +1♂ +, +1♀ +( +MHBU +), sanme data as the proceding, leg. +J. Fu + +; + +1♂ +, +1♀ +( +MHBU +), sanme data as the proceding, F. +Chen + +; + +2♀ +( +MHBU +), +Shennongjia +, +Wenshui +, + +1000–1800 m + +, + +22.VII.2003 + +, leg. +X.Y. Zhang + +; + +1♀ +( +MHBU +), +Shennongjia +, +Xiaodangyang +, + +1000 m + +, + +15.VII.2006 + +, leg. +L.K. Tan + +; + +1♀ +( +MHBU +), +Shennongjia +, +Songbai +, + +1200–1300 m + +, + +19.VII.2003 + +, leg. +X.Z. Huang. + + + +Chongqing +: + +2♀♀ +( +MHBU +), +Wuxi +, +Lanying +, +Lanying +, +31°24′24.54″ N +, +109°53′7.92″ E +, + +1764 m + +, + +24.VI.2022 + +, leg. +L.Y. Wang + +; + +1♀ +( +MHBU +), +Wuxi +, +Shuangyang +, +Yintiaoling Nature Reserve +, +Zhuangping +, +Sanchahe +, +31.496794° N +, +109.930699° E +, + +1731 m + +, + +21.VI.2022 + +, leg. +L.Y. Wang + +; + +1♀ +( +MHBU +), +Wuxi +, +Yintiaoling Nature Reserve +, +Guanshan Forest +Farm, +Stone Pillar +, +31°32′23.12″ N +, +109°41′50.75″ E +, + +2096 m + +, + +28.VI.2022 + +, leg. +L.Y. Wang + +; + +1♀ +( +MHBU +), +Wuxi +, +Lanying +, +Yintiaoling Nature Reserve +, +Huangcaoping +, +31°24′50.13″ N +, +109°55′40.2″ E +, + +2039 m + +, + +24.VI.2022 + +, leg. +L.Y. Wang. + + + + + +Differential diagnosis. +It looks similar to + +Rh. flava + +in the general shape of aedeagus, but can be easily distinguished from the latter by the following characters: head and pronotum bicolored, while unicolored in + +Rh. flava + +; tibiae uniformly black and femora black dorsally, while both uniformly yellowish orange in + +Rh. flava + +( +Fig. 10B +); aedeagus: ventral processes of parameres slender and narrowly rounded at apices, while stouter and acute at apices in + +Rh. flava + +( +Fig. 11F +); conjoint dorsal plate of parameres moderately deeply emarginate in middle of apical margin, with the middle emargination shallower than the emargination between ventral process and conjoint dorsal plate, while deeply emarginate and nearly as deep as in + +Rh. flava + +( +Fig. 11E +); female internal organ of reproductive: vagina abruptly thinned into a short tube, while thinned into a long tube in + +Rh. flava + +( +Fig. 12B +). + + + + +Description. +Body length: +6.9‒11.1 mm +(7.0 mm in +holotype +); width: +1.5‒4.1 mm +( +1.5 mm +in +holotype +). + + +Male +( +Fig. 19A +). Coloration. Body black except for the following parts: head yellowish orange except black at vertex, elytra pale yellow, each elytron with a wide longitudinal median black band that extending behind humerus to apex and narrower in the anterior part than the posterior part; antennomeres Ⅰ yellowish orange; femora yellowish orange and black along dorsal sides, coxae and trochanters yellowish orange; pronotum yellowish orange, with a longitudinal median black band, which is about one third width of pronotum. Surface sparsely and finely yellow pubescent, anterior margin of clypeus fringed with pale bristles. + +Head subtriangular, surface densely and finely punctate; eyes moderately protruding, head width across eyes 1.1 times wider than anterior margin of pronotum; terminal maxillary palpomeres subtriangular, widest at apical third; antennae extending to elytral apices when reclined, antennomeres II shortest, about 2.6 times as long as wide at apices, III about twice longer than II, VIII longest, XI feebly longer than X and pointed at apices. +Pronotum subquadrate, about as wide as long, anterior margin rounded, anterior angles subrounded, lateral margins feebly diverging posteriorly, posterior margin nearly straight, posterior angles sub-rectangular, disc strongly convex on posterolateral parts, surface finely and sparsely punctate. + + +FIGURE 18. +Abdominal sternites VIII of female, ventral view: +A. + +Rhagonycha nigricolor + + +sp. nov. + +; +B. + +Rh. falcata + + +sp. nov. + +; +C. + +Rh. flavimima + + +sp. nov. + +; +D. + +Rh. trimacula + + +sp. nov. + +Scale bars: 1.0 mm. + + +Elytra nearly parallel-sided, about 3.6 times as long as humeral width, 4.9 times longer than pronotum, surface finely rugulose-lacunose, almost lustrous at basal parts. + +Aedeagus moderately swollen laterally near middle ( +Fig. 20A, B +); ventral processes of parameres abruptly thinned apically near bases, with apices directing laterally in ventral view ( +Fig. 20A +), narrowly rounded at apices, slender and bent dorsally in lateral view ( +Fig. 20C +); conjoint dorsal plate of parameres shorter than ventral processes ( +Fig. 20A, C +), with apical margin roundly and moderately deeply emarginate in middle, lateral margins diverging apically in dorsal view ( +Fig. 20B +), latero-apical angels acute, strongly bent ventrally in lateral view ( +Fig. 20C +); emargination between ventral process and conjoint dorsal plate about 1/5 length of aedeagus ( +Fig. 20C +). + + +Female +( +Fig. 19B +). Similar to male, but with larger and stouter body, antennae thinner and shorter, extending to elytral mid-length when reclined, head width across eyes 0.9 times as wide as anterior margin of pronotum, pronotum wider and about 1.2 times as wide as long, anterior margin less arcuate, disc feebly convex on posterolateral parts, elytra about 3.3 times as long as humeral width, with lateral margins diverging posteriorly. + + +Internal organ of reproductive system ( +Fig. 17C +): vagina stout and abruptly thinned at ventroapical portion into a moderately long and feebly stout tube, where diverticulum and spermathecal duct arising next to each other; diverticulum short and spiral, evenly thin along the whole length; spermathecal duct very short; spermatheca provided with a spiral tube, progressively thinned apically and three times longer than diverticulum, extended into a short tube at base, where accessory gland opening; accessory gland extremely long, abruptly thinned apically near base, about three times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 18C +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and feebly bisinuate at posterior margin. + + + + +Etymology. +The specific name is derived from the Latin +mimus +(imitator), referring to its similarity to the aedeagi of + +Rh. flava + +. + + + + +Distribution +( +Fig. 36 +). +China +( +Hubei +, +Chongqing +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFEBFFD1FF69E1D23AB5EF08.xml b/data/F9/02/3D/F9023D04FFEBFFD1FF69E1D23AB5EF08.xml new file mode 100644 index 00000000000..31c208c3eb8 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFEBFFD1FF69E1D23AB5EF08.xml @@ -0,0 +1,358 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +bimucronata +Švihla, 2005 + + + + + + + +( +Figs 10A +, +11A–C +, +12A, 12C +, +36 +) + + + + + + + +Rhagonycha bimucronata +Švihla, 2005: 72 + + +, figs 1–3. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NMPC +), [p] “ +China +: +Sichuan +prov / +Maoxian +env. / + +1500 m + +. + +29.VI.2003 + +/ lgt. +S. Murzin +,”, [P] “HOLOYUPUS / +Rhagonycha +/ + +bimucronata + +sp. nov. +/ +V. Švihla +det. 2005”. + + + + +FIGURE 9. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. weichowensis +Wittmer, 1997 + +; +D‒F. + +Rh. yunnana +Wittmer, 1997 + +. Scale bars: 1.0 mm. + + + +Other material examined. + + +CHINA +, +Sichuan +: + +1♂ +, +2♀♀ +( +MHBU +), +Anzihe +, +Baliping +, + +11.VIII.2016 + +, leg. +L.M. Li + +; + +7♂♂ +, +5♀♀ +( +MHBU +), same data as the proceding, + +9.VIII.2016 + + +; + +2♂♂ +, +3♀♀ +( +MHBU +), +Wanglang Nature Reserve +, + +2500–2800 m + +, +32°57'22" N +; +104°2'17" E +, + +31.VII.2017 + +, leg. +Z.B. Yi + +; + +4♂♂ +, +27♀♀ +( +MHBU +), +Anzihe +, +Shaoyaogou +, + +11.VIII.2016 + +, leg. +W.Y. Zhou + +; + +5♀♀ +( +MHBU +), +Liziping +, +Menghuo +, + +26.VII.2016 + +, leg. +L.M. Li + +; + +5♀♀ +( +MHBU +), +Jiguanxiang +, +Baliping +, + +11.VIII.2016 + +, leg. +W.Y. Zhou. + + + + +FIGURE. 10. +Male habitus of + +Rhagonycha +species + +, dorsal view: +A. + +Rh. bimucronata +Švihla, 2002 + +; +B. + +Rh. flava +(Pic, 1926) + +. Scale bars: 2.0 mm. + + + +Descriptive notes. Male +( +Fig. 10A +). Aedeagus moderately swollen laterally near middle ( +Fig. 11A, B +); ventral processes of parameres abruptly thinned apically near bases, rounded at apices, approaching to each other in ventral view ( +Fig. 11A +), and feebly bent ventrlly in lateral view ( +Fig. 11C +); conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 11C +), with apical margin deeply and roundly emarginate in middle, lateral margins feebly diverging apically, acute at latero-apical angles ( +Fig. 11B +), feebly inclined ventrally in lateral view ( +Fig. 11C +); the emargination between conjoint dorsal plate and ventral process about 1/3 length of aedeagus ( +Fig. 11C +). + + +Female. +Internal organ of reproductive system ( +Fig. 12A +): vagina stout and abruptly thinned at ventroapical portion into a very short and stout tube, where diverticulum and spermathecal duct arising next to each other; diverticulum short and spiral, evenly thin along the whole length; spermathecal duct extremely short; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland long, about twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 12C +) moderately narrowed apically, widely rounded at latero-apical angles, and shallowly emarginate on both sides and triangularly emarginate in middle of posterior margin, with the portions between lateral and middle emarginations acute at apices and extending over apices of latero-apical angles. + + +Destribution +( +Fig. 36 +). +China +( +Sichuan +). + + + + +Remarks. +The aedeagus of this species was illustrated by +Švihla (2005) +. Here, the female reproductive system and abdominal sternite VIII are illustrated and described for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFECFFD4FF69E2BD3D67EEB1.xml b/data/F9/02/3D/F9023D04FFECFFD4FF69E2BD3D67EEB1.xml new file mode 100644 index 00000000000..a1591c94503 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFECFFD4FF69E2BD3D67EEB1.xml @@ -0,0 +1,163 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +testaceopallipa +Wittmer, 1997 + + + + + + + +( +Figs 13B +, +38 +) + + + + + + + +Rhagonycha testaceopallipa +Wittmer, 1997: 325 + + +, figs 196, 197. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +Fig. 13B +, +NHMB +), [h] “ +China +, W Hupeh / +Lichuan Distr. +”, [h] “ +Suisapa + +1000 m + +/ + +2.VIII.1949 + +”, [p] “ +HOLOTYPUS +”, [h] “R. / testaceopallipa / Wittm. / det. +W. Wittmer +”, [h] “116”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00002469”. + + + + + +Distribution +( +Fig. 38 +). +China +( +Hubei +). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFECFFD4FF69E3013D67ED5A.xml b/data/F9/02/3D/F9023D04FFECFFD4FF69E3013D67ED5A.xml new file mode 100644 index 00000000000..17466faa8cc --- /dev/null +++ b/data/F9/02/3D/F9023D04FFECFFD4FF69E3013D67ED5A.xml @@ -0,0 +1,139 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + + +Rhagonycha furcata +Wittmer, 1997: 327 + + +, figs 204, 205. + + + + + + +Type material examined. + +HOLOTYPE +♂ +( +Fig. 13A +, +NHMB +), [p] “ +YUNNAN + +2200-2500m + +/ +24.57N +98.45E +8-16/5 / GAOLIGONG mts. / +Vit Kubáň +leg. 1995”, [p] “ +HOLOTYPUS +”, [h] +“furcata +”, [h] “193”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00003066”. + + + + + +Distribution +( +Fig. 39 +). +China +( +Yunnan +). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFECFFD4FF69E4ED385AEC7A.xml b/data/F9/02/3D/F9023D04FFECFFD4FF69E4ED385AEC7A.xml new file mode 100644 index 00000000000..2a2c3607c8f --- /dev/null +++ b/data/F9/02/3D/F9023D04FFECFFD4FF69E4ED385AEC7A.xml @@ -0,0 +1,97 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +furcata +Wittmer, 1997 + + + + + + + +( +Figs 13A +, +39 +) + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFECFFD5FF69E0133D67E976.xml b/data/F9/02/3D/F9023D04FFECFFD5FF69E0133D67E976.xml new file mode 100644 index 00000000000..f457f89a5ea --- /dev/null +++ b/data/F9/02/3D/F9023D04FFECFFD5FF69E0133D67E976.xml @@ -0,0 +1,177 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +tryznai +Švihla, 2002 + + + + + + + +( +Figs 13C +, +38 +) + + + + + + + +Rhagonycha tryznai +Švihla, 2002: 306 + + +, figs 4–6. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +Fig. 13C +, +NMPC +), [p] “ +CHINA +- S +Sichuan +, 1997 / +Daliang Shan mts. +, + + + + +27.VII. / road +Meigu - Leibo +/ pass + +15 km +NE of Meigu + +/ +28°25′ N +, +103°17′ E +/ +M. Trýzna +et +O. Šafránek +lgt.”, [p] “ +HOLOTYPUS +/ +Rhagonycha +/ tryznai +sp. n. +/ det. V. +Švihla, 2002 +” + +. + + + + +Distribution +( +Fig. 38 +). +China +( +Sichuan +). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFEDFFD5FF69E1513D67EFAD.xml b/data/F9/02/3D/F9023D04FFEDFFD5FF69E1513D67EFAD.xml new file mode 100644 index 00000000000..6f91a588901 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFEDFFD5FF69E1513D67EFAD.xml @@ -0,0 +1,158 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +meghalayana +Wittmer, 1989 + + + + + + + +( +Figs 14C +, +40 +) + + + + + + + +Rhagonycha meghalayana +Wittmer, 1989: 218 + + +, figs 19, 20. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +Fig. 14C +, +NHMB +), [p] “Cherrapuniee / + +1200m + +16.5.76”, [p] “ +Megalaya +1976 / Wittmer, Baroni U.”, [p] “ +HOLOTYPUS +”, [p] “ +Rhagonycha +/ meghalayana / Wittm. / det. +W. Wittmer +”, [h] “894”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00003999”. + + + + + +Distribution +( +Fig. 40 +). +India +( +Megalaya +). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFEDFFD5FF69E3FC3D67EE76.xml b/data/F9/02/3D/F9023D04FFEDFFD5FF69E3FC3D67EE76.xml new file mode 100644 index 00000000000..b0d82bec8ca --- /dev/null +++ b/data/F9/02/3D/F9023D04FFEDFFD5FF69E3FC3D67EE76.xml @@ -0,0 +1,161 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +manipurensis +Wittmer, 1989 + + + + + + + +( +Figs 14B +, +40 +) + + + + + + + +Rhagonycha manipurensis +Wittmer, 1989: 216 + + +, figs 13–16. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +Fig. 14B +, +NHMB +), [h] “ + +Assam +Manipur + +/ Sirohi Kashong”, [h] “Suisapa + +1000m + +/10.6.60Sohmid”,[p]“ +HOLOTYPUS +”,[h]“895”,[p]“ +Rhagonycha +/manipurensis/Wittm./det. +W.Wittmer +”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00001043”. + + + + + +Distribution +( +Fig. 40 +). +India +( +Assam +). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFEDFFD5FF69E4273D67EC1B.xml b/data/F9/02/3D/F9023D04FFEDFFD5FF69E4273D67EC1B.xml new file mode 100644 index 00000000000..97edcdbe877 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFEDFFD5FF69E4273D67EC1B.xml @@ -0,0 +1,163 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +bomdiensis +Wittmer, 1989 + + + + + + + +( +Figs 14A +, +40 +) + + + + + + + +Rhagonycha bomdiensis +Wittmer, 1989: 216 + + +, figs 17, 18. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +Fig.14A +, +NHMB +), [h]“ +Assam +Kameng +/ +Bomdi La +8800.”,[h]“ + +15.7.1961 + +/ +F. Schmid +”, [p] “ +HOLOTYPUS +”, [h] “ +Rhagonycha +bomidiensis / det. +W. Wittmer +”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00001701”. + + + + + +Distribution +( +Fig. 40 +). +India +( +Assam +). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFEDFFD5FF69E6513D67EAAD.xml b/data/F9/02/3D/F9023D04FFEDFFD5FF69E6513D67EAAD.xml new file mode 100644 index 00000000000..6eb0d5c12fa --- /dev/null +++ b/data/F9/02/3D/F9023D04FFEDFFD5FF69E6513D67EAAD.xml @@ -0,0 +1,160 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +albidipennis +Pic, 1923 + + + + + + + +( +Figs 13D +, +40 +) + + + + + + + +Rhagonycha albidipennis +Pic, 1923: 60 + + +; + +Wittmer, 1997: 326 + +, figs 198, 199. + + + + + +Type material examined. + +LECTOTYPE +♂ +( +Fig. 13D +, +NHMB +), [h] “Hoa Bihn / Tokin”, [h] “ +Rhagonycha albidipennis +/ n sp”, [p] “LECOTYPUS”. + + + +Other material examined. + +1♂ +( +NHMB +), +Hoa Binh +, without date and collector (det. +W. Wittmer +) + +. + + + + +Distribution +( +Fig. 40 +). +Vietnam +(Hoa Bihn). + + +Reamrks. +The habitus photo of the +holotype +is provided for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFEEFFD4FF69E7A83BF2EBEA.xml b/data/F9/02/3D/F9023D04FFEEFFD4FF69E7A83BF2EBEA.xml new file mode 100644 index 00000000000..cb3dd8c8f87 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFEEFFD4FF69E7A83BF2EBEA.xml @@ -0,0 +1,369 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +flava +(Pic, 1926) + + + + + + + +( +Fig. 10B +, +11D–F +, +12B, 12D +, +36 +) + + + + + + + +Podabrus flavus +Pic, 1926b: 356 + + +. + + + + + +Rhagonycha flava + +: + +Wittmer, 1997: 326 + +, figs 200, 201. + + + + + +Type material examined. + +LECTOTYPE +♂ +( +MHNH +), [p] “MUSEUM PARIS / MOU PIN / A. DAVID 1870”, [p] “MUS. HIST. NAT. / A. DAVID / Moupin (Thibet) / 1871”, [p] “ +LECTOTYPUS +”, [p] “ +Podabrus +/ +flavus Pic +/ n sp”, [h] “ +Rhagonycha +/ flava / (Pic) / det. +W. Wittmer +”. + + + + +FIGURE 11. +Aedeagi of + +Rhagonycha +species + +(A, D. ventral view; B, E. dorsal view; C, F. lateral view): +A‒C. + +Rh. bimucronata +Švihla, 2005 + +; +D‒F. + +Rh. flava +(Pic, 1926) + +. Scale bars: 1.0 mm. + + + + +FIGURE 12. +Internal organ of female reproductive system (A, B) and abdominal sternites VIII, ventral view (C, D) of + +Rhagonycha +species + +: +A, C. + +Rh. bimucronata +Švihla, 2005 + +; +B, D. + +Rh. flava +(Pic, 1926) + +. Scale bars: 1.0 mm. + + + +Other material examined. + + +CHINA +, +Sichuan +: + +2♂♂ +( +IZAS +), +Emeishan +, +Jinding +, + +3000−3200 m + +, + +22.Ⅴ.1957 + +, leg. +K.R. Huang + +; + +1♂ +( +IZAS +), +Emeishan +, +Jiulaodong +, + +1800−1900 m + +, + +17.VI.1957 + +, leg. +Y.C. Xu + +; + +2♀♀ +( +MHBU +), +Chongzhou +, +Jiguanshan +, +Anzihe Nature Reserve +, +Shaoyaogou Protection Station +, + +30.Ⅴ.2016 + +, leg. +L.M. Li + +; + +1♂ +, +4♀♀ +( +MHBU +), same data as the proceding, + +29.Ⅴ.2016 + + +; + +3♂♂ +, +1♀ +( +MHBU +), +Chongzhou +, +Jiguanshan +, + +21.VI.2016 + +, leg. +F.M. Shi + +; + +12♂♂ +, +20♀♀ +( +MHBU +), +Anzihe +, +Shaoyaogou +, + +31.Ⅴ.2016 + +, leg. +L.M. Li + +; + +2♀♀ +( +MHBU +), +Liziping +, +Menghuo +, +Pusagang +, + +26.VII.2016 + +, leg. +L.M. Li. + + + +Descriptive notes. Male +( +Fig. 10B +). Aedeagus moderately swollen laterally near middle ( +Fig. 11D, E +); ventral processes of parameres abruptly thinned apically near bases, with apices directing laterally in ventral view ( +Fig. 11D +), acute at apices, moderately wide and feebly bent dorsally in lateral view ( +Fig. 11F +); conjoint dorsal plate of parameres feebly shorter than ventral processes ( +Fig. 11F +), with apical margin deeply and triangularly emarginate in middle, lateral margins moderately diverging apically in dorsal view ( +Fig. 11E +), latero-apical angles acute, bent ventrally in lateral view ( +Fig. 11F +); the emargination between conjoint dorsal plate and ventral process about 1/4 length of aedeagus ( +Fig. 11F +). + + +Female. +Internal organ of reproductive system ( +Fig. 12B +): vagina stout and abruptly thinned at ventroapical portion into a long tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, evenly thin along the whole length; spermathecal duct short and about 1/4 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and about twice longer than diverticulum; accessory gland long, about twice as long as spermatheca. + + +Abdominal sternite VIII ( +Fig. 12D +): moderately narrowed posteriorly, widely triangular at latero-apical angles, and feebly and trapezodinally protuberant in middle of posterior margin. + + +Destribution +( +Fig. 36 +). +China +( +Sichuan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFF0FFCEFF69E2843BEEEAA7.xml b/data/F9/02/3D/F9023D04FFF0FFCEFF69E2843BEEEAA7.xml new file mode 100644 index 00000000000..21e1412c505 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFF0FFCEFF69E2843BEEEAA7.xml @@ -0,0 +1,412 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +limbatella +Wittmer, 1997 + + + + + + + +( +Figs 1D +, +3D +, +4D +, +5A–C +, +37 +) + + + + + + + +Rhagonycha limbatella +Wittmer, 1997: 334 + + +, figs 213, 214. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NHMB +), [h] “W Yachow / + +10.VIII.1923 + +,”, [h] “ +China +, +Sichuan +/ ca. + +1800 m + +”, [p] “ +HOLOTYPUS +”, [h] “R. / limbatella / Wittm. / det. +W. Wittmer +”, [h] “REM / 95/ 13.18”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00002748”. + + + +Other material examined. + + +CHINA +, +Sichuan +: + +1♂ +, +3♀♀ +( +MHBU +), +Liziping +, +Menghuocheng +, + +26.VII.2016 + +, leg. +C.X. Yuan +, +S.H. Dong +& +S.S. Liu + +; + +1♀ +( +MHBU +), +Liziping +, +Gongyihai +, + +24.VII.2016 + +, leg. +C.X. Yuan +, +S.H. Dong +& +S.S. Liu + +; + +1♂ +, +1♀ +( +MHBU +), +40 km +, +Sud. Xichang +, +Laojishan +, +27°35' N +, +102°20' E +, + +2800 m + +, + +24.VII.2005 + +, leg. +S. Murzin + +; + +3♂♂ +, +5♀♀ +( +MHBU +), +Chongzhou +, +Anzihe Reserve +, +Shaoyaogou Protection Station +, + +31.Ⅴ.2016 + +, leg. +G.L. Xie + +; + +8♂♂ +, +8♀♀ +( +MHBU +), +Liziping +, +Menghuo +, + +28.VII.2016 + +, leg. +L.M. Li + +; + +1♂ +, +3♀♀ +( +MHBU +), +Liziping +, +Mamadi +, + +27.VII.2016 + +, leg. +L.M. Li + +; + +3♀♀ +( +MHBU +), +Jiguan +, +Baliping +, + +11.VIII.2016 + +, leg. +L.M. Li + +; + +3♀♀ +( +MHBU +), +Liziping +, +Menghuo +, +Pusagang +, + +2471 m + +, + +26.VII.2016 + +, leg. +L.M. Li + +; + +3♀♀ +( +MHBU +), +Anzihe +, +Shaoyaogou +, + +1590 m + +, + +12.VIII.2016 + +, leg. +L.M. Li. + + + + +FIGURE 5. +Aedeagi of + +Rhagonycha +species + +(A, D, G. ventral view; B, E, H. dorsal view; C, F, I. lateral view): +A‒C. + +Rh. limbatella +Wittmer, 1997 + +; +D‒F. + +Rh. spinosa +Wittmer, 1997 + +; +G‒I. + +Rh. tibetana +Švihla, 2002 + +. Scale bars: 1.0 mm. + + + +Descriptive notes. Male +( +Fig. 1D +). Aedeagus feebly swollen laterally near middle ( +Fig. 5A, B +); ventral processes of parameres abruptly thinned apically near bases, with apices narrowly rounded and bent to each other in ventral view ( +Fig. 5A +), rounded at apices, feebly inclined ventrally in lateral view ( +Fig. 5C +); conjoint dorsal plate nearly as long as ventral processes ( +Fig. 5C +), with apical margin arcuate and small-triangularly emarginate in middle, lateral margins diverging apically, latero-apical angles widely rounded in dorsal view, ( +Fig. 5B +), and moderately inclined ventrally in lateral view ( +Fig. 5C +); the emargination between conjoint dorsal plate and ventral process about 1/3 length of aedeagus ( +Fig. 5C +)). + + +Female. +Internal organ of reproductive system ( +Fig. 3D +): vagina stout and abruptly thinned at ventroapical portion into a short and stout tube, where diverticulum and spermathecal duct arising separately; diverticulum very short and spiral, evenly thin along the whole length; spermathecal duct about 1/3 shorter and thinner than apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and distinctly longer than diverticulum; accessory gland long, about twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 4D +) moderately narrowed apically, acute at latero-apical angles, widely emarginate on both sides and feebly emarginate in middle of posterior margin, with the portions between lateral and middle emarginations widely triangular at apices and not reaching apices of latero-apical angles. + + + + +Distribution +( +Fig. 37 +). +China +( +Sichuan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFF4FFD3FF69E2DC3BEEEA9B.xml b/data/F9/02/3D/F9023D04FFF4FFD3FF69E2DC3BEEEA9B.xml new file mode 100644 index 00000000000..0b5d1467909 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFF4FFD3FF69E2DC3BEEEA9B.xml @@ -0,0 +1,400 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +yunnana +Wittmer, 1997 + + + + + + + +( +Figs 6D +, +7D +, +8D +, +9D–F +, +38 +) + + + + + + + +Rhagonycha yunnana +Wittmer, 1997: 332 + + +, figs 211, 212. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NHMB +), [p] “ +China +Yunnan +1.‒19.VII. / HEISHUI +27.13N +100°19S +[E] / +35 km +N of +Lijiang +/ legit. +S. Bečvář +1992”, [p] “ +HOLOTYPUS +”, [h] “R. / yunnana / Wittm. / det. +W. Wittmer +”, [h] “REM / 95 / 9.7”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00003357”. + + + +Other material examined. + + +CHINA +, +Yunnan +: + +1♀ +( +IZAS +), +Lushui +, + +2500 m + +, + +4.VI.1981 + +, leg. +S.B. Liao + +; + +1♂ +, +5♀♀ +( +IZAS +), +Lijiang +, +Yulongshan +, + +2800 m + +, + +17.VII.1984 + +, leg. +S.Y. Wang + +; + +1♂ +( +IZAS +), same data as the preceding, + +2850 m + +, + +14.VII.1984 + +, leg. +D.J. Liu + +; + +1♂ +( +CAS +), +Gongshan Country +, +Qiqi reserve +, +27.63° N +, +98.62° E +, + +2100 m + +, + +12.VII.2000 + +, +Sino-Amer Exped +, leg. +H.B. Liang + +; + +1♂ +, +3♀♀ +( +CAS +), +Gongshan Country +, +No +12 +Bridge +, +27.72° N +, +98.60° E +, + +2750 m + +, + +15.VII.2000 + +, +Sino-Amer Exped +, leg. +H.B. Liang + +; + +1♀ +( +CAS +), +Gongshan Country +, +Danzhu +, +27.63° N +, +98.37° E +, + +2600 m + +, + +15.VII.2000 + +, +Sino-Amer Exped +, leg. +H.B. Liang. + + + + +FIGURE. 6. +Male habitus of + +Rhagonycha +species + +, dorsal view: +A. + +Rh. spinosa +Wittmer, 1997 + +; +B. + +Rh. tibetana +Švihla, 2002 + +; +C. + +Rh. weichowensis +Wittmer, 1997 + +; +D. + +Rh. yunnana +Wittmer, 1997 + +. Scale bars: 2.0 mm. + + + + +FIGURE 7. +Internal organ of female reproductive system, ventral view: +A. + +Rhagonycha spinosa +Wittmer, 1997 + +; +B. + +Rh. tibetana +Švihla, 2002 + +; +C. + +Rh. weichowensis +Wittmer, 1997 + +; +D. + +Rh. yunnana +Wittmer, 1997 + +. Scale bars: 1.0 mm. + + + +Descriptive notes. Male +( +Fig. 6D +). Aedeagus moderately swollen laterally near middle ( +Fig. 9D, E +); ventral processes of parameres abruptly thinned apically near bases, small-triangularly emarginate at apices, feebly bent to each other in ventral view ( +Fig. 9D +), widened and rounded at apices, feebly bent ventrally in lateral view ( +Fig. 9F +); conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 9F +), with apical margin moderately and roundly emarginate in middle, lateral margins feebly diverging apically, latero-apical angles rounded ( +Fig. 9E +), and feebly inclined ventrally in lateral view ( +Fig. 9F +); the emargination between conjoint dorsal plate and ventral process about 2/5 length of aedeagus ( +Fig. 9F +). + + +Female. +Internal organ of reproductive system ( +Fig. 7D +): vagina stout and abruptly thinned at ventroapical portion into a long tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, progressively thinned apically; spermathecal duct very short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and about twice longer than diverticulum; accessory gland extremely long, about three times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 8D +) moderately narrowed posteriorly, acute at latero-apical angles widely triangular, and arcuately emarginate on both sides and shallowly emarginate in middle of posterior margin, with the portions between lateral and middle emarginations acute at apices and extending over apices of latero-apical angles. + + +Destribution +( +Fig. 38 +). +China +( +Yunnan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFF6FFCFFF69E42C3BEEE92B.xml b/data/F9/02/3D/F9023D04FFF6FFCFFF69E42C3BEEE92B.xml new file mode 100644 index 00000000000..4454599347d --- /dev/null +++ b/data/F9/02/3D/F9023D04FFF6FFCFFF69E42C3BEEE92B.xml @@ -0,0 +1,606 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +spinosa +Wittmer, 1997 + + + + + + + +( +Figs 5D–F +, +6A +, +7A +, +8A +, +38 +) + + + + + + + +Rhagonycha spinosa +Wittmer, 1997: 329 + + +, figs 208, 209. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NHMB +), [h] “ +Sichuan +, + +2500 m + +/ +Emei Shan +/ +29°35' N +/ +103°11' E +”, [h] “ +CHINA +/ 22./ + +24.VI.1990 + +”, [p] “ +HOLOTYPUS +”, [h] “R. / spinosa / Wittm. / det. +W. Wittmer +”, [h] “REM / 95/ 9.2”, [p] “Naturhistorisches / Museum Basel”, [p] “ +CANTHARIDAE +/ CANTH00003157’. + + + +Other material examined. + + +CHINA +, +Sichuan +: + +1♂ +, +20♀♀ +( +MHBU +), +Fengtongzhai +, +Dashuigou +, + +31.VII.2016 + +, leg. +L.M. Li + +; + +22♀♀ +( +MHBU +), +Fengtongzhai +, +Mahuanggou +, + +30.VII.2016 + +, leg. +C.X. Yuan +, +S.H. Dong +& +S.S. Liu + +; + +2♂♂ +( +IZAS +), +Emeishan +, + +2100‒3100 m + +, + +25.VI.1955 + +, leg. +X C. Yang + +; + +1♂ +( +IZAS +), +Emeishan +, +Jinding +, + +3000‒3200 m + +, + +14.VII.1957 + +, leg. +F.X. Zhu + +; + +1♀ +( +IZAS +), +Emeishan +, +Baoguosi +, + +550‒750 m + +, + +5.VIII.1957 + +, leg. +K.R. Huang + +; + +1♀ +( +IZAS +), +Emeishan +, +Jiulaodong +, + +1800‒1900 m + +, leg. +Z.Y. Wang + +; + +1♂ +, +5♀♀ +( +IZAS +), +Emeishan +, +Xixiangchi +, + +1800‒2000 m + +, + +18.VIII.1957 + +, leg. +K.R. Huang + +; + +37♀♀ +( +MHBU +), +Danba +, +Bianer +, + +3‒5.VIII.2009 + +, leg. +Z.H. Gan +& +Y.P. Niu + +; + +32♀♀ +( +MHBU +), +Liziping +, +Menghuocheng +, + +26.VII.2016 + +, leg. +C.X. Yuan +, +S.H. Dong +& +S.S. Liu + +; + +7♀♀ +( +MHBU +), +Liziping +, +Gongyihai +, + +24.VII.2016 + +, leg. +C.X. Yuan +, +S.H. Dong +& +S.S. Liu + +; + +5♀♀ +( +IZAS +), +Kangding +, +Huangjiagou +, + +2900 m + +, + +4.VIII.2004 + +, leg. +H.J. Xue + +; + +1♀ +( +IZAS +), +Siguniangshan +, +Haizigou +, + +3340‒3860 m + +, + +29‒30.VII.2004 + +, leg. +X. Wan + +; + +1♀ +( +IZAS +), +Baoxing +, +Guobayan +, + +2680 m + +, + +1‒4.VII.2001 + +, leg. +X.D. Yu +& +H.Z. Zhou + +; + +1♀ +( +IZAS +), +Baoxing +, +Jiajinshan +, +Mahuanggou +, + +2495 m + +, + +2‒5.VII.2001 + +, leg. +X.D. Yu +& +H.Z. Zhou + +; + +1♀ +( +IZAS +), +Wolong +, +Wolongguan Gully +, + +2150 m + +, + +21.VII.2004 + +, leg. +X. Wan + +; + +1♀ +( +IZAS +), +Wolong +, +Wuyipeng +, + +20.VII.1990 + +, leg. +X. Wan + +; + +1♂ +, +7♀♀ +( +MHBU +), +Emeishan +, +Mt. Jinding +, +29°31' N +, +103°20' E +, + +3000 m + +, + +20.VII.2012 + +, leg. +Peng +, +Dai +& +Yin + +; + +1♀ +( +MHBU +), same data as the proceding, +Sichuan prov. +, +Tianquan County +, +Eriangshan Mt. +Yakou, +3.6km +, +29°31′N +, +103°17′E +, + +2600–2800m + +, + +11.VII.2012 + + +; + +1♀ +( +MHBU +), +Sichuan prov. +, +Hailuogou +, +Luding County +, + +3000 m + +, + +22.VII.2006 + +, leg. +Hu +& +Tang + +; + +1♀ +( +MHBU +), same data as the proceding, + +25.VII.2006 + + +. + + +Descriptive notes. Male +( +Fig. 6A +). Aedeagus feebly swollen laterally near middle ( +Fig. 5D, E +); ventral processes of parameres abruptly thinned apically near bases, with apices widened and narrowly rounded, strongly bent to each other in ventral view ( +Fig. 5D +), widened and rounded at apices, bent ventrally in lateral view ( +Fig. 5F +); conjoint dorsal plate of parameres obviously longer than ventral processes, with apical margin arcuate and small-triangularly emarginate in middle, lateral margins diverging apically from middle, latero-apical angles widely rounded in dorsal view ( +Fig. 5E +), and bent ventrally in lateral view ( +Fig. 5F +); the emargination between conjoint dorsal plate and ventral process about half length of aedeagus ( +Fig. 5F +). + + +Female. +Internal organ of reproductive system ( +Fig. 7A +): vagina stout and abruptly thinned at ventroapical portion into a very short and stout tube, where diverticulum and spermathecal duct arising separately; diverticulum very short and spiral, evenly thin along the whole length; spermathecal duct half shorter and thinner than apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland extremely long, almost three times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 8A +) moderately narrowed posteriorly, widely triangular at latero-apical angles, and widely emarginate on both sides and feebly emarginate in middle of posterior margin, with the portions between lateral and middle emarginations acute at apices and almost horizonital with apices of latero-apical angles. + + + + +Distribution +( +Fig. 38 +). +China +( +Sichuan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFF7FFCCFF69E29E3A32EDF7.xml b/data/F9/02/3D/F9023D04FFF7FFCCFF69E29E3A32EDF7.xml new file mode 100644 index 00000000000..fd46d7a76c3 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFF7FFCCFF69E29E3A32EDF7.xml @@ -0,0 +1,940 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +weichowensis +Wittmer, 1997 + + + + + + + +( +Figs 6C +, +7C +, +8C +, +9A–C +, +36 +) + + + + + + +Rhagonycha weichowensis + +: + +Wittmer, 1997: 331 + +, fig. 210. + + + + + +Type material examined. + +PARATYPE +: +1♂ +( +NHMB +), [p-h]“YaoGi nr.Mu /pin 14‒18Jul/ ’29 + +8000ft + +”,[p]“Szechuan / +CHINA +/ DCGraham”, [p] “ +PARATYPUS +”, [h] “R. / weichowensis / Wittm. / det. +W. Wittmer +”, [h] “REM / 95/ 9.4”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00003509” + +. + + +Other material examined. + + +CHINA +, +Sichuan +: + +1♂ +( +IZAS +), +Wenchuan +, +Wolong +, + +1920 m + +, + +26.VIII.1983 + +, leg. +S.Y. Wang + +; + +2♂♂ +, +9♀♀ +( +MHBU +), +Anzi River +, +Baliping +, + +11.VIII.2016 + +, leg. +L.M. Li + +; + +1♀ +( +IZAS +), same data as the preceding, + +1920‒2250 m + +, + +30. VIII.1983 + + +; + +2♀♀ +( +IZAS +), +Wolong +, +Wolongguan Gully +, + +2150 m + +, + +21.VII.2004 + +, leg. +X. Wan + +; + +1♀ +( +IZAS +), same data as the preceding, leg. +Y. Zhang + +; + +1♀ +( +IZAS +), same data as the preceding, + +20.VII.2004 + + +; + +1♀ +( +IZAS +), +Nanping +, +Jiuzhaigou +, + +2300 m + +, + +7.IX.1983 + +, leg. +R.Q. Wang + +; + +1♀ +( +IZAS +), same data as the preceding, + +3.IX.1983 + + +; + +5♀♀ +( +IZAS +), same data as the preceding, + +2350 m + +, leg. +C.L. Niu + +; + +1♀ +( +IZAS +), same data as the preceding, + +6.IX.1983 + +, leg. +S.Y. Wang + +; + +1♀ +( +IZAS +), same data as the preceding, + +2600 m + +, + +5.IX.1983 + + +; + +1♀ +( +IZAS +), +Yanyuan +, +Jinhe +, + +1250 m + +, + +1.VII.1984 + +, leg. +J.G. Fan + +; + +1♀ +( +IZAS +), +Maerkang +, +Erdaoping +, + +3230 m + +, + +18.VII.1961 + +, leg. +X.F. Li + +; + +1♂ +, +1♀ +( +MHBU +), +Tianquan +, +Labahe +, + +28–29.VII.2004 + +, +X.J. Yang +& +H.R. Hua + +; + +8♀♀ +( +MHBU +), +Baoxing +, +Fengtongzhai +, + +1–3.VIII.2004 + +, +X.J. Yang +& +H.R. Hua + +; + +1♂ +, +43♀♀ +( +MHBU +), +Wolong +, + +6–7.VIII.2004 + +, +X.J. Yang +& +H.R. Hua + +; + +4♀♀ +( +MHBU +), +Jiuzhaigou +, + +1.VIII.2002 + +; +M. Bai +& +J.F. Wang + +; + +1♀ +( +MHBU +), +Lixian +, +Shangmeng +, + +24–25.VII.2009 + +, leg. +Z.H. Gao +& +Y.P. Niu + +; + +4♀♀ +( +MHBU +), +Jiuzhaigou +, +Rize +, + +13.VIII.2002 + +, leg. +F.M. Shi + +; + +2♀♀ +( +MHBU +), +Jiuzhaigou +, +Shuzheng +, + +1.VIII.2002 + +, leg. +F.M. Shi + +; + +3♀♀ +( +MHBU +), +Jiuzhaigou +, +Zezhawagou +, + +15.VIII.2002 + +, leg. +F.M. Shi. + + + +Gansu +: + +2♀♀ +( +MHBU +), +Tianshui +, +Maicaogou Reserve +, +34°17′56.14″ N +, +106°12′22.8″ E +, + +1500 m + +, + +20.VIII.2021 + +, leg. +S.Q. Huo + +; + +1♀ +( +MHBU +), +Qingshui +, +Shanmen Forestry +, +34.682718° N +, +106.292808° E +, + +1762 m + +, + +24.VI.2022 + +, leg. +Q. Liu +& +S.Q. Huo + +; + +4♀♀ +( +MHBU +), +Tianshui +, +Jinlongshan Forest +Park, +34°23′47.12″ N +, +106°29′32.72″ E +, + +1492 m + +, + +5.VIII.2021 + +, leg. +Q. Liu + +; + +2♀♀ +( +MHBU +), +Liangdang +, +Heihe Forest +Park, +34°9′48.56″ N +, +106°32′14.58″ E +, + +1600 m + +, + +16.VIII.2021 + +, leg. +S.Q. Huo. + + + +Shannxi +: + +2♂♂ +, +43♀♀ +( +MHBU +), +Ningshan +, +Huoditang +, +33.434126° N +, +108.448091° E +, + +1505 m + +, + +14.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +1♂ +, +12♀♀ +( +MHBU +), same data as the proceding, + +15.VII.2013 + + +; + +1♂ +, +12♀♀ +( +MHBU +), +Zhouzhi +, +Houzhenzi +, 33°50′77″ N, +107°50′00″ E +, + +1354 m + +, + +27.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +1♂ +, +12♀♀ +( +MHBU +), +Ningshan +, +Xunyangba +, +33.552672° N +, +108.545616° E +, + +1325 m + +, + +12.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +29♀♀ +( +MHBU +), same data as the proceding, + +13.VII.2013 + + +; + +1♀ +( +MHBU +), +Liuba +, +Zibai Shan +, +33°39′42.5″ N +, +106°46′30.4″ E +, + +1599 m + +, + +19.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +1♀ +( +MHBU +), +Liuba +, +Caishenmiao +, +33°43′27.0″ N +, +107°12′11.1″ E +, + +1212 m + +, + +17.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +1♀ +( +MHBU +), +Ningshan +, 18 zhangs waterfall, +33.401284° N +, +108.362930° E +, + +1108 m + +, + +15.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +2♀♀ +( +MHBU +), +Ningshan +, +Yaowangtang +, +33.766992° N +, +108.803251° E +, + +1258 m + +, + +11.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +1♀ +( +MHBU +), +Fengxian +, +Huangniupu +, +34°14′07.9″ N +, +106°57′26.6″ E +, + +1501 m + +, + +21.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +2♀♀ +( +MHBU +), +Ningshan +, +Guanghuojie +, +33.363417° N +, +108.771307° E +, + +1135 m + +, + +10.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +1♀ +( +MHBU +), +Ningshan +, +Gangou +, +33.825886° N +, +108.787338° E +, + +1758 m + +, + +10.VII.2013 + +, leg. +X.C. Zhu +& +Y. Tian + +; + +2♀♀ +( +MHBU +), +Fengxian +, +Jialingjiangyuan +, + +13.VII.2012 + +, leg. +G.D. Ren + +et. al. + + +Descriptive notes. Male +( +Fig. 6C +). Aedeagus strongly swollen laterally near middle ( +Fig. 9A, B +); ventral processes of parameres abruptly thinned apically near middle, with apices triangularly expanded and directing laterally in ventral view ( +Fig. 9A +), and almost straight in lateral view ( +Fig. 9C +); conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 9C +), with apical margin moderately deeply and roundly emarginate in middle, lateral margins moderately diverging apically in dorsal view ( +Fig. 9B +), latero-apical angels acute, feebly bent ventrally in lateral view ( +Fig. 9C +); the emargination between conjoint dorsal plate and ventral process about 1/4 length of aedeagus ( +Fig. 9C +). + + +Female. +Internal organ of reproductive system ( +Fig. 7C +): vagina stout and abruptly thinned at ventroapical portion into a very short and stout tube, where diverticulum and spermathecal duct arising separately; diverticulum moderately long and spiral, evenly thin along the whole length; spermathecal duct short and stout; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland long, almost twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 8C +) moderately narrowed posteriorly, widely rounded at latero-apical angles, and feebly emarginate on bith sides of posterior margin. + + +Destribution +( +Fig. 36 +). + +China +( +Sichuan +, +Gansu +, Shannxi) + +. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFF7FFCFFF69E6AD3AB5ED25.xml b/data/F9/02/3D/F9023D04FFF7FFCFFF69E6AD3AB5ED25.xml new file mode 100644 index 00000000000..41913b69b3b --- /dev/null +++ b/data/F9/02/3D/F9023D04FFF7FFCFFF69E6AD3AB5ED25.xml @@ -0,0 +1,228 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +tibetana +Švihla, 2002 + + + + + + + +( +Figs 5G–I +, +6B +, +7B +, +8B +, +39 +) + + + + + + + +Rhagonycha tibetana +Švihla, 2002: 305 + + +, figs 1–3. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NMPC +), [p] “ +CHINA +, SE – +TIBET +, ZAYU Co., / +Salween +side of HENGDUAN +Shan +/ SW of MEILIXUE +Shan +, + +2500‒3800m + +/ 28°16-21'N 98°32‒41'E 5.‒10.6. 99/ L. & R. BUSINSKÝ legt.”, [p] “ +HOLOTYPUS +/ +Rhagonycha +/ tibetana +sp. n. +/ det. V. +Švihla, 2002 +”. + + + +Other material examined. + + +CHINA +, +Yunnan +: + +2♂♂ +, +2♀♀ +( +MHBU +), +Dimalou Village +, + +5.VII.2019 + +, leg. +Y.D. Chen +& +Q.L. Lei. + + + +Descriptive notes. Male +( +Fig. 6B +). Aedeagus moderately swollen laterally near middle ( +Fig. 5G, H +); ventral processes of parameres abruptly thinned apically near bases, with apices widened and rounded, bent to each other in ventral view ( +Fig. 5G +), wide and almost straight in lateral view ( +Fig. 5I +); conjoint dorsal plate of parameres nearly as long as ventral processes ( +Fig. 5I +), with apical margin moderately deeply and roundly emarginate in middle, lateral margins feebly converging apically, latero-apical angles truncate in dorsal view ( +Fig. 5H +), and feebly inclined ventrally in lateral view ( +Fig. 5I +); the emargination between conjoint dorsal plate and ventral process about 1/3 length of aedeagus. + + +Female. +Internal organ of reproductive system ( +Fig. 7B +): vagina stout and abruptly thinned at ventroapical portion into a long and thin tube, where diverticulum and spermathecal duct arising separately; diverticulum moderately long and spiral, evenly thin along the whole length; spermathecal duct very short and about 1/8 length of apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland long, about twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 8B +) strongly narrowed posteriorly, widely rounded at latero-apical angles, and trapezodinally protuberant in middle of posterior margin. + + +Destribution +( +Fig. 39 +). + +China +( +Xizang +, +Yunnan +) + +. + + + + +Remarks. +The aedeagus of this species was illustrated by +Švihla (2002) +. Here, the female reproductive system and abdominal sternite VIII are illustrated and described for the first time. + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFFCFFC8FF69E4083A5CE9C7.xml b/data/F9/02/3D/F9023D04FFFCFFC8FF69E4083A5CE9C7.xml new file mode 100644 index 00000000000..8d3200b093f --- /dev/null +++ b/data/F9/02/3D/F9023D04FFFCFFC8FF69E4083A5CE9C7.xml @@ -0,0 +1,746 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +hubeiana +Wittmer, 1997 + + + + + + + +( +Figs 1C +, +2G–I +, +3C +, +4C +, +36 +) + + + + + + + +Rhagonycha hubeiana +Wittmer, 1997: 326 + + +, figs 202, 203. + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NHMB +), [p] “ +CHINA +, W – +HUBEI +, 1300- / + +2000m + +, DASHENNONGJIA / massif – E slope, / 31°24-30' N / 101°21-24' E / 28.6-5.7.95 / L. + R. BUSINSKÝ”, [p] “ +HOLOTYPUS +”, [h] “R. / hubeiana / Wittm. / det. +W. Wittmer +”, [h] “235”, [p] “Naturhistorisches / Museum Basel / +Coll. W. Wittmer +”, [p] “ +CANTHARIDAE +/ CANTH00003418”. + + + +Other material examined. + + +CHINA +, +Hubei +: + +1♂ +( +IZAS +), +Shennongjia +, + +19.VII.1980 + +, leg. +P.Y. Yu + +; + +2♂♂ +, +1♀ +( +MHBU +), +Shennongjia +, +Wenshui +, + +1600−1800 m + +, + +22.VII.2003 + +, leg. +X.Y. Zhang + +; + +1♂ +, +1♀ +( +MHBU +), +Shennongjia +, +Wenshui +, + +1600−1800 m + +, + +22.VII.2004 + +, leg. +X.Z. Huang + +; + +1♀ +( +MHBU +), +Shennongjia +, +Muyu +, + +1200 m + +, + +12.VIII.2004 + +, leg. +F.L. Zou + +; + +1♂ +( +MHBU +), same data as the preceding, leg. +S.B. Liao + +; + +1♂ +( +MHBU +), +Shennongjia +, +Muyu +, +Longjiangping +, + +4.VI.2018 + +, leg. +P. Wang + +; + +1♂ +( +MHBU +), +Shennongjia +, +Bajiaomiao +, + +1200−1300 m + +, + +18.VII.2003 + +, leg. +X.Z. Huang + +; + +1♂ +, +9♀♀ +( +MHBU +), +Shennongjia +, +Xiaodangyang +, + +1000 m + +, + +15.VII.2006 + +, leg. +L.K. Tan + +; + +1♂ +, +3♀♀ +( +MHBU +), +Shennongjia +, +Jiuhuping +, + +1900 m + +, + +29.VII.2006 + +, leg. +L.K. Tan + +; + +1♂ +, +9♀♀ +( +MHBU +), +Shennongjia +, +Hongping +, + +1200 m + +, + +12.VIII.2004 + +, leg. +Y. Min + +; + +1♂ +, +1♀ +( +IZAS +), +Shennongjia +, +Hongping Forestry +, + +1660 m + +, + +16.VII.1987 + +, leg. +Y.H. Han + +; + +1♂ +( +MHBU +), +Badong +, +Tiansanping +, + +1500 m + +, + +14.VIII.2006 + +, leg. +H. Yao + +; + +1♀ +( +MHBU +), +Dalaoling Nature reserve +, + +1200 m + +, + +11.VII.2011 + +, leg. +R. Chen. + + + +Shanxi +: + +2♂♂ +, +8♀♀ +( +MHBU +) + +, + +3♂♂ +, +3♀♀ +( +MHBU +), +Lishan National Nature Reserve +, + +9‒19.VII.2013 + +, leg. +Z. Li + +; + +16♂♂ +, +29♀♀ +( +MHBU +), same data as the preceding, + +12‒20.VII.2012 + +, leg. +Y.Y. Lu + +; + +2♂♂ +, +8♀♀ +( +MHBU +), +Lishan +, +Dahe Forestry +, + +23.VII.2012 + +, leg. +H.L. Wang +, +H. Zhang +, & +Y.X. Du + +; + +6♂♂ +, +53♀♀ +( +MHBU +), +Lishan +, +Xiachuan +, + +28.VII.2012 + +, leg. +H.L. Wang +, +H. Zhang +, & +Y.X. Du. + + + +Ningxia +: + +1♂ +( +MHBU +), +Guyuan +, +Kaicheng +, + +16.VII.2009 + +, leg. +X.P. Wang +& +H.F. Ran + +; + +2♀ +( +MHBU +), +Jingyuan +, +Erlonghe Foresty +, + +19–20.VII.2008 + +, leg. +X.P. Wang +, +H.F. Ran +& +Q.Q. Wu + +; + +1♀ +( +MHBU +), +Jingyuan +, +Erlonghe +, + +06.VII.2009 + +, leg. +S.Y. Zhou +& +X.J. Meng + +; + +1♀ +( +MHBU +), +Jingyuan +, +Qiuqianjia Foresty +, + +13–14.VII.2008 + +, leg. +X.M. Li +, +H.F. Ran +& +Q.Q. Wu + +; + +1♀ +( +MHBU +), +Longtan Foresty +, + +05.VII.2009 + +, leg. +X.P. Wang +& +X.Q. Yang + +; + +5♀ +( +MHBU +), +Jingyuan +, +Hongxia Foresty +, + +1998 m + +, + +9.VII.2008 + +, leg. +X.P. Wang +& +X.L. Liu. + + + +Descriptive notes. Male +( +Fig. 1C +). Aedeagus moderately swollen laterally near middle ( +Fig. 2G, H +); ventral processes of parameres abruptly thinned apically near bases, with apices acute and directing laterally in ventral view ( +Fig. 2G +), pointed at apices, inclined ventrally in lateral view ( +Fig. 2I +); conjoint dorsal plate of parameres feebly longer than ventral processes ( +Fig. 2G–I +), with apical margin roundly and moderately emarginate in middle, lateral margins diverging apically, latero-apical angles rounded in dorsal view ( +Fig. 2H +), and feebly bent ventrally in lateral view ( +Fig. 2I +); the emargination between conjoint dorsal plate and ventral process about 1/4 length of aedeagus ( +Fig. 2I +). + + + +FIGURE. 1. +Male habitus of + +Rhagonycha +species + +, dorsal view: +A. + +Rh. albolimbata +Pic, 1926 + +; +B. + +Rh. furcatiformis +Wittmer, 1997 + +; +C. + +Rh. hubeiana +Wittmer, 1997 + +; +D. + +Rh. limbatella +Wittmer, 1997 + +. Scale bars: 2.0 mm. + + + + +FIGURE 2. +Aedeagi of + +Rhagonycha +species + +(A, D, G. ventral view; B, E, H. dorsal view; C, F, I. lateral view): +A‒C. + +Rh. albolimbata +Pic, 1926 + +; +D‒F. + +Rh. furcatiformis +Wittmer, 1997 + +; +G‒I. + +Rh. hubeiana +Wittmer, 1997 + +. Scale bars: 1.0 mm. The abbreviations are as follows: bp—basal piece; dp—dorsal plate of each paramere; is—inner sac of median lobe; ml—median lobe; te—tegmen; vp—ventral process of each paramere. + + + + +FIGURE 3. +Internal organ of female reproductive system, ventral view (Abbreviations: ag—accessory gland; di—diverticulum; sd—spermathecal duct; sp—spermatheca; ov—median oviduct; va—vagina): +A. + +Rhagonycha albolimbata +Pic, 1926 + +; +B. + +Rh. furcatiformis +Wittmer, 1997 + +; +C. + +Rh. hubeiana +Wittmer, 1997 + +; +D. + +Rh. limbatella +Wittmer, 1997 + +. Scale bars: 1.0 mm. + + + +Female. +Internal organ of reproductive system ( +Fig. 3C +): vagina stout and abruptly thinned at ventroapical portion into a very short tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, evenly thin along the whole length; spermathecal duct very short and stout; spermatheca provided with a spiral tube, progressively thinned apically and longer than diverticulum; accessory gland extremely long, about three times longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 4C +) moderately narrowed apically, widely rounded at latero-apical angles, and feebly bilobed in middle of posterior margin. + + + + +Distribution +( +Fig. 36 +). +China +( +Hubei +, +Shanxi +, +Ningxia +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFFFFFC4FF69E06E3BF2EA9B.xml b/data/F9/02/3D/F9023D04FFFFFFC4FF69E06E3BF2EA9B.xml new file mode 100644 index 00000000000..9a5e1acbd62 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFFFFFC4FF69E06E3BF2EA9B.xml @@ -0,0 +1,193 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + + +Rhagonycha furcatiformis +Wittmer, 1997: 328 + + +, figs 206, 207. + + + + + + +Type material examined. + +HOLOTYPE +♂ +( +NMPC +), [p] “ +China +Sichuan +23. ‒27.VI. / Jiulonggou nr. Dayi / +70 km +W +Chengdu +/ +M. Trýzna +lgt. 1993”, [p] “ +HOLOTYPUS +”, [h] “Rhag. / furcatiformis / Wittm. / det. +W. Wittmer +”. + + + +Other material examined. + + +CHINA +, +Sichuan +: + +1♂ +, +1♀ +( +MHBU +), +70 km +, +West Chengdu +, +Qingcheng Hou Shan mts. +, +30°44' N +, +103°08' E +, + +1500 m + +, + +1‒06.VI.2005 + +, leg. +S. Murzin. + + + +Descriptive notes. Male +( +Fig. 1B +).Aedeagus moderately swollen laterally near middle ( +Fig. 2D, E +), moderately swollen ventrally in lateral view ( +Fig. 2F +); ventral processes of parameres abruptly thinned apically near bases, with apices narrowly rounded, approaching to each other in ventral view ( +Fig. 2D +), and nearly straight in lateral view ( +Fig. 2F +); conjoint dorsal plate of parameres feebly longer than ventral processes ( +Fig. 2D, F +), with apical margin roundly and deeply emarginate in middle, lateral margins distinctly diverging apically, latero-apical angles rounded in dorsal view ( +Fig. 2E +), and feebly cinclined ventrally in lateral view ( +Fig. 2F +); the emargination between conjoint dorsal plate and ventral process about 1/3 length of aedeagus ( +Fig. 2F +). + + +Female. +Internal organ of reproductive system ( +Fig. 3B +): vagina stout and abruptly thinned at ventroapical portion into a moderately long tube, where diverticulum and spermathecal duct arising separately; diverticulum long and spiral, evenly thin along the whole length; spermathecal duct short, about 1/6 length of apical tube of vagina; spermatheca provided with a spiral tube, evenly thin along the whole length and nearly as long as diverticulum; accessory gland long, about twice longer than spermatheca. + + +Abdominal sternite VIII ( +Fig. 4B +) strongly narrowed posteriorly, widely triangular at latero-apical angles, and trapezodinally protuberant in middle of posterior margin. + + +Destribution +( +Fig. 35 +). +China +( +Sichuan +). + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFFFFFC7FF69E1DA38B5EF4E.xml b/data/F9/02/3D/F9023D04FFFFFFC7FF69E1DA38B5EF4E.xml new file mode 100644 index 00000000000..2b1b0e262a8 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFFFFFC7FF69E1DA38B5EF4E.xml @@ -0,0 +1,103 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +furcatiformis +Wittmer, 1997 + + + + + + + +( +Figs 1B +, +2D–F +, +3B +, +4B +, +35 +) + + + + \ No newline at end of file diff --git a/data/F9/02/3D/F9023D04FFFFFFC7FF69E6893AF1EEF9.xml b/data/F9/02/3D/F9023D04FFFFFFC7FF69E6893AF1EEF9.xml new file mode 100644 index 00000000000..4c832ce66b7 --- /dev/null +++ b/data/F9/02/3D/F9023D04FFFFFFC7FF69E6893AF1EEF9.xml @@ -0,0 +1,420 @@ + + + +Taxonomic review of the Rhagonycha flava species group (Coleoptera, Cantharidae), with descriptions of fourteen new species from China + + + +Author + +Xiao, Yun-Feng +0009-0007-0594-9724 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & xyfxr 1005 @ 163. com; https: // orcid. org / 0009 - 0007 - 0594 - 9724 +xyfxr1005@163.com + + + +Author + +Liu, Hao-Yu +0000-0003-1383-5560 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & liuhy @ hbu. edu. cn; https: // orcid. org / 0000 - 0003 - 1383 - 5560 +liuhy@hbu.edu.cn + + + +Author + +Yang, Xing-Ke +0000-0003-3676-6828 +Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China. & yangxk @ ioz. ac. cn; https: // orcid. org / 0000 - 0003 - 3676 - 6828 +yangxk@ioz.ac.cn + + + +Author + +Yang, Yu-Xia +0000-0002-3118-6659 +Key Laboratory of Zoological Systematics and Application, School of Life Science, Hebei University, Baoding 071002, Hebei Province, China. & Hebei Basic Science Center for Biotic Interaction, Hebei University, Baoding 071002, China. & yxyang @ hbu. edu. cn; https: // orcid. org / 0000 - 0002 - 3118 - 6659 * Corresponding authors +yxyang@hbu.edu.cn + +text + + +Zootaxa + + +2024 + +2024-10-31 + + +5534 + + +1 + + +1 +69 + + + + +http://dx.doi.org/10.11646/zootaxa.5534.1.1 + +journal article +10.11646/zootaxa.5534.1.1 +1175-5334 +C36ED8DA-FCF2-44FE-A38E-41112A1C0D6D + + + + + + + +Rhagonycha +(s.str.) +albolimbata +Pic, 1926 + + + + + + + +( +Figs 1A +, +2A–C +, +3A +, +4A +, +35 +) + + + + + + +Rhagonycha albolimbata + +: + +Pic, 1926a: 5 + +; + +Wittmer, 1989: 219 + +, figs 21, 22. + + + + + +Type material examined. +HOLOTYPE +♂ +( +MNHN +), [p] “Szetschwan/ Kwanhsien / Exp. Stötzner”, [h] “ +Rhagonycha +/ albolimata / n sp”, [p] “ +HOLOTYPUS +”. + + +Other material examined. + + +CHINA +, +Sichuan +: + +1♂ +( +IZAS +), +Dujiangyan +, + +676 m + +, + +12.V.2009 + +, leg. +G.Y. Yang + +; + +2♂♂ +, +3♀♀ +( +IZAS +), +Dujiangyan +, +Puyang +, +Huaxi +, + +12.Ⅴ.2009 + +, leg. +F. Yuan + +; + +1♀ +( +IZAS +), +Qingchengshan +, + +1600 m + +, + +30.Ⅴ.1979 + +, leg. +J.W. Shang + +; + +1♂ +, +1♀ +( +IZAS +), +Emeishan +, +Qingyin’ge +, + +800−1000 m + +, + +30.IV.1957 + +, leg. +K.R. Huang + +; + +1♂ +( +IZAS +), same locality as the preceding, + +20.IV.1957 + +, leg. +Z.Y. Wang + +; + +2♀♀ +( +IZAS +), same data as the preceding, + +22.IV.1957 + + +; + +2♂♂ +( +IZAS +), same data as the preceding, + +23.IV.1957 + + +; + +1♀ +( +IZAS +), same locality as the preceding, + +21.VI.1957 + +, leg. +F.X. Zhu + +; + +1♂ +( +IZAS +), same data as the preceding, + +3.Ⅴ.1957 + + +; + +1♂ +( +IZAS +), +Emeishan +, +Baoguosi +, + +550−750 m + +, + +23.IV.1957 + +; leg. +Y.C. Xu + +; + +2♀♀ +( +IZAS +), +Emeishan +, + +3.VI.1955 + +, leg. +K.R. Huang +& +Y.T. Jin + +; + +1♂ +( +IZAS +), same data as the preceding, + +17.VI.1955 + + +; + +2♂♂ +( +IZAS +), same data as the preceding, + +18.VI.1955 + + +; + +2♂♂ +( +IZAS +), +Emeishan +, +Jinding +, + +3000−3200 m + +, + +22.V.1957 + +, leg. +K.R. Huang + +; + +1♂ +( +IZAS +), +Emeishan +, +Jiulaodong +, + +1800−1900 m + +, + +17.VI.1957 + +, leg. +Y.C. Xu. + + + +Descriptive notes. Male +( +Fig. 1A +). Aedeagus moderately swollen laterally near middle ( +Fig. 2A, B +); ventral processes of parameres abruptly and strongly thinned apically near bases, approaching to each other in ventral view ( +Fig. 2A +), hooked and acute at apices, bent ventrally in lateral view ( +Fig. 2C +); conjoint dorsal plate of parameres obviously longer than ventral processes ( +Fig. 2A, C +), with apical margin roundly and deeply emarginate in middle, lateral margins feebly diverging apically, latero-apical angles rounded in dorsal view ( +Fig. 2B +), and strongly inclined ventrally in lateral view ( +Fig. 2C +); the emargination between conjoint dorsal plate and ventral process about half length of aedeagus ( +Fig. 2C +). + + +Female. +Internal organ of reproductive system ( +Fig. 3A +): vagina stout and abruptly thinned at ventroapical portion into a short tube, where diverticulum and spermathecal duct arising separately; diverticulum short and spiral, evenly thin along the whole length; spermathecal duct short and nearly as long as the apical tube of vagina; spermatheca provided with a spiral tube, progressively thinned apically and nearly as long as diverticulum; accessory gland extremely long, about five times as long as spermatheca. + + +Abdominal sternite VIII ( +Fig. 4A +) strongly narrowed posteriorly, almost straight at posterior margin, with latero-apical angles widely rounded. + + +Destribution +( +Fig. 35 +). +China +( +Sichuan +). + + + + +Remarks. +The aedeagus of this species was illustrated only in ventral and lateral views by +Wittmer (1989) +. In this study, we present the first illustrations and descriptions of the female reproductive system and abdominal sternite VIII, as well as the aedeagus in lateral view for this species. + + + + \ No newline at end of file