From cc2f4153b405b6a27f06298e672e1f867fe085df Mon Sep 17 00:00:00 2001 From: ggserver Date: Wed, 5 Mar 2025 19:04:30 +0000 Subject: [PATCH] Add updates up until 2025-03-05 19:01:03 --- .../34/300734BC667D58549AD577EDF677CE68.xml | 120 +++---- .../20/730620171A155128B1FB098533134A32.xml | 98 +++--- .../EF/885CEF51D73F5A8CA89219CB20107831.xml | 302 ++++++++++++++++++ .../B7/91DCB7B4BE045AE2B50D74C823DB5907.xml | 98 +++--- .../EE/97D8EE49011D5432ACDE6A13A38A6173.xml | 98 +++--- .../53/B8A153B6B63F5A5B96974376DF9D31A3.xml | 182 +++++------ 6 files changed, 590 insertions(+), 308 deletions(-) create mode 100644 data/88/5C/EF/885CEF51D73F5A8CA89219CB20107831.xml diff --git a/data/30/07/34/300734BC667D58549AD577EDF677CE68.xml b/data/30/07/34/300734BC667D58549AD577EDF677CE68.xml index 748682aab4f..498deb7de11 100644 --- a/data/30/07/34/300734BC667D58549AD577EDF677CE68.xml +++ b/data/30/07/34/300734BC667D58549AD577EDF677CE68.xml @@ -1,65 +1,65 @@ - - - -Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny + + + +Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny - - -Author + + +Author -Xue, Junxia -0000-0002-6387-0148 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Xue, Junxia +0000-0002-6387-0148 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Yang, Zihao -https://orcid.org/0009-0001-0699-2229 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Yang, Zihao +https://orcid.org/0009-0001-0699-2229 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Li, Ruotong -https://orcid.org/0009-0003-9428-3055 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Li, Ruotong +https://orcid.org/0009-0003-9428-3055 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Zhang, Lulu -0000-0001-8011-4451 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Zhang, Lulu +0000-0001-8011-4451 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China -text - - -MycoKeys +text + + +MycoKeys - -2025 - -2025-03-05 + +2025 + +2025-03-05 - -114 + +114 - -367 -383 + +367 +383 -journal article -308425 -10.3897/mycokeys.114.139180 -8a2665f8-9b49-4be5-9063-0c879cd4e749 +journal article +308425 +10.3897/mycokeys.114.139180 +8a2665f8-9b49-4be5-9063-0c879cd4e749 - + @@ -94,7 +94,7 @@ in ascigerous areas, which have many irregular small patches that are scattered - + ChinaYunnan Province @@ -132,7 +132,7 @@ et al. 20230681 ( ) ; • - + ibid ., Mengla County @@ -322,7 +322,7 @@ has complete ascigerous areas (not small patches or radially elongated), larger Additional specimens examined. - + ChinaHainan Province @@ -355,7 +355,7 @@ et al. 20230142 ( ) ; • - + ibid ., 20230138 ( @@ -364,7 +364,7 @@ et al. 20230142 ( ) ; • - + ibid ., 20230134 ( @@ -373,7 +373,7 @@ et al. 20230142 ( ) ; • - + Yunnan Province , Xishuangbanna Dai Nationality Autonomous Prefecture @@ -408,7 +408,7 @@ et al. 20230950 ( ) ; • - + ibid ., 20230969 ( @@ -417,7 +417,7 @@ et al. 20230950 ( ) ; • - + ibid ., @@ -442,7 +442,7 @@ et al. 20233946 ( ) ; • - + ibid ., @@ -467,7 +467,7 @@ et al. 20230973 ( ) ; • - + ibid ., @@ -492,7 +492,7 @@ et al. 20230847 ( ) ; • - + ibid ., on bamboo, @@ -507,7 +507,7 @@ et al. 20230837 ( ) ; • - + ibid ., Jinuo Mountain @@ -536,7 +536,7 @@ et al. 20230502 ( ) ; • - + ibid ., Wild Elephant Valley @@ -563,7 +563,7 @@ et al. 20230602 ( ) ; • - + ibid ., Primitive Forest diff --git a/data/73/06/20/730620171A155128B1FB098533134A32.xml b/data/73/06/20/730620171A155128B1FB098533134A32.xml index 10ce83fc321..814c43a996a 100644 --- a/data/73/06/20/730620171A155128B1FB098533134A32.xml +++ b/data/73/06/20/730620171A155128B1FB098533134A32.xml @@ -1,65 +1,65 @@ - - - -Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny + + + +Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny - - -Author + + +Author -Xue, Junxia -0000-0002-6387-0148 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Xue, Junxia +0000-0002-6387-0148 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Yang, Zihao -https://orcid.org/0009-0001-0699-2229 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Yang, Zihao +https://orcid.org/0009-0001-0699-2229 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Li, Ruotong -https://orcid.org/0009-0003-9428-3055 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Li, Ruotong +https://orcid.org/0009-0003-9428-3055 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Zhang, Lulu -0000-0001-8011-4451 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Zhang, Lulu +0000-0001-8011-4451 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China -text - - -MycoKeys +text + + +MycoKeys - -2025 - -2025-03-05 + +2025 + +2025-03-05 - -114 + +114 - -367 -383 + +367 +383 -journal article -308425 -10.3897/mycokeys.114.139180 -8a2665f8-9b49-4be5-9063-0c879cd4e749 +journal article +308425 +10.3897/mycokeys.114.139180 +8a2665f8-9b49-4be5-9063-0c879cd4e749 - + @@ -94,7 +94,7 @@ in its soralia and I – medulla. - + ChinaYunnan Province @@ -285,7 +285,7 @@ has granular isidia-like structures on the thallus, I + sky-blue medulla and mur Additional specimens examined. - + ChinaYunnan Province @@ -320,7 +320,7 @@ et al. 20230377 ( ) ; • - + ibid ., 20230381 ( diff --git a/data/88/5C/EF/885CEF51D73F5A8CA89219CB20107831.xml b/data/88/5C/EF/885CEF51D73F5A8CA89219CB20107831.xml new file mode 100644 index 00000000000..d8e09d850fd --- /dev/null +++ b/data/88/5C/EF/885CEF51D73F5A8CA89219CB20107831.xml @@ -0,0 +1,302 @@ + + + +Discovery of the Old World genus Rogas Nees (Hymenoptera, Braconidae, Rogadinae) in the New World by DNA barcoding + + + +Author + +Quicke, Donald L. J. +0000-0003-4471-6775 +Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand + + + +Author + +Sharkey, Michael J. +0000-0001-6201-7340 +The Hymenoptera Institute, 1339 La Loma Dr., Redlands, CA, 92373, USA + + + +Author + +Janzen, Daniel H. +0000-0002-7335-5107 +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA + + + +Author + +Hallwachs, Winnie +0000-0002-5166-809X +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA + + + +Author + +Butcher, Buntika A. +0000-0002-0541-0709 +Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand + +text + + +Deutsche Entomologische Zeitschrift + + +2025 + +2025-03-05 + + +72 + + +1 + + +1 +7 + + + +journal article +10.3897/dez.72.142960 +2EDA9D02-8F97-4E4D-AC6D-1F135B250971 + + + + +Genus + +Rogas +Nees, 1818 + + + + + + + + +Rogas +Nees, 1818: 306 + + +(type species: (designated by +Curtis 1834 +): + +Ichneumon testaceus +Fabricius, 1798 + +[nec + +I. testaceus +Gmelin, 1790 + +; + + += + + +Rogas luteus +Nees, 1834 + + +]). + + + + + + +Pelecystoma + +Wesmael, 1838: 91 +; + +Shenefelt 1975: 1206–1209 + +; Tobias 1976: 89; + +Marsh 1979 + +a: 178; Tobias 1986: 84–85 (included in + +Rogas + +auct). Syn. by van Achterberg 1982. Type species (designated by +Foerster 1862 +): + +Rogas luteus +Nees, 1834 + +[type lost]. Synonymy. + + + + + + + + + +Rhogas +Agassiz, 1846: 325 + +(invalid emendation). + + + + + + +Diagnosis. + + +Antenna with more than 50 flagellomeres. Maxillary palpus segment 3 strongly enlarged and laterally flattened in both sexes (Fig. +1 D, F +), segment 4 distinctly expanded basally. Labial palpus segment 2 inflated. Propodeum with short mid-longitudinal carina medioanteriorly which divides to form a pair of near parallel submedial carinae. Hind wing veins 1 rs-m and M joining at an acute angle, much less than 75 °. Hind wing vein M 1.15–1.5 × longer than M + CU. Hind tibia with comb of modified setae distomedially (Fig. +2 B +). Hind tibial spurs straight and evenly setose. Tarsal claws with large, dark, rather square basal lobe. Metasomal tergite 1 approximately 1.2 × longer than posteriorly wide. Dorsope present, large and deep; dorsal carinae of metasomal tergite 1 remaining separate or joined to form point (Fig. +2 E +). Metasomal tergite 2 with wide polygonal midbasal area (Fig. +2 F +); midlongitudinal carina variably present. Metasomal tergites 2–5 with sharp lateral crease. Female hypopygium ventrally nearly straight and posteriorly truncate. + + + + + + + +Rogas shimborii +Quicke & Sharkey + +, +sp. nov. +, holotype, female, specimen voucher BIOUG 58035 - F 04 +A. +Habitus, lateral view; +B. +Habitus oblique dorsal view; +C. +Head, postero-ventral view showing connection between occipital and hypostomal carinae; +D. +Head and anterior mesosoma, lateral view; +E. +Head, anterior view; +F. +Labial palps, anterior view. + + + + + + + + +Rogas shimborii +Quicke & Sharkey + +, +sp. nov. +, holotype, female, specimen voucher BIOUG 58035 - F 04; +A. +Forewing and part of hind wing (inset data label); +B. +Apex hind tibia and hind tarsus, inner view; +C. +Hind claw; +D. +Propodeum; +E. +Metasomal tergite 1 oblique lateral; +F. +Metasomal tergite 2. + + + + +Rogas + +was redescribed and illustrated by +van Achterberg (1991) +, reproduced and slightly modified by +Chen and He (1997) +, and the +holotype +of + +Rogas luteus + +was illustrated by +van Achterberg (1991) +. +Chen and He (1997) +provide a key to Old World species. + + + +Rogas + +may be distinguished from both Old and New World + +Triraphis + +by its maxillary palpi having the third segment swollen and laterally flattened having the swollen third segment (Fig. +1 D, F +), the occipital carina being complete (although sometimes weak) ventrally and joining hypostomal carina (reduced ventrally, without ventral junction with hypostomal carina in + +Triraphis + +) (Fig. +1 C +) ( +Ratnasingham and Hebert 2013 +), and with claws which have a large, dark square (truncate) basal lobe (small, acute and pale in + +Triraphis + +) (Fig. +2 C +) ( +van Achterberg 1991 +; +Chen and He 1997 +). + + +All reliable host records for + +Rogas + +are from +Limacodidae +caterpillars ( +Quicke and Shaw 2006 +). Published records from +Zygaenidae +result from failure to recognize + +Triraphis + +as a distinct genus ( +Quicke et al. 2003 +) and records from other families might result from misidentifications of + +Aleiodes +species. + + + + + \ No newline at end of file diff --git a/data/91/DC/B7/91DCB7B4BE045AE2B50D74C823DB5907.xml b/data/91/DC/B7/91DCB7B4BE045AE2B50D74C823DB5907.xml index c13365ed7ea..a9b9d8253dc 100644 --- a/data/91/DC/B7/91DCB7B4BE045AE2B50D74C823DB5907.xml +++ b/data/91/DC/B7/91DCB7B4BE045AE2B50D74C823DB5907.xml @@ -1,65 +1,65 @@ - - - -Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny + + + +Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny - - -Author + + +Author -Xue, Junxia -0000-0002-6387-0148 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Xue, Junxia +0000-0002-6387-0148 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Yang, Zihao -https://orcid.org/0009-0001-0699-2229 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Yang, Zihao +https://orcid.org/0009-0001-0699-2229 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Li, Ruotong -https://orcid.org/0009-0003-9428-3055 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Li, Ruotong +https://orcid.org/0009-0003-9428-3055 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Zhang, Lulu -0000-0001-8011-4451 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Zhang, Lulu +0000-0001-8011-4451 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China -text - - -MycoKeys +text + + +MycoKeys - -2025 - -2025-03-05 + +2025 + +2025-03-05 - -114 + +114 - -367 -383 + +367 +383 -journal article -308425 -10.3897/mycokeys.114.139180 -8a2665f8-9b49-4be5-9063-0c879cd4e749 +journal article +308425 +10.3897/mycokeys.114.139180 +8a2665f8-9b49-4be5-9063-0c879cd4e749 - + @@ -94,7 +94,7 @@ in the presence of black or purple dots on the thalli and hyaline to pale yellow - + ChinaYunnan Province @@ -284,7 +284,7 @@ has linear shape ascigerous areas, ovoid asci and transversely septate ascospore Additional specimens examined. - + ChinaYunnan Province @@ -320,7 +320,7 @@ et al. 20230629 ( ) ; • - + ibid ., 20234628 ( diff --git a/data/97/D8/EE/97D8EE49011D5432ACDE6A13A38A6173.xml b/data/97/D8/EE/97D8EE49011D5432ACDE6A13A38A6173.xml index b15b621713b..78aad8aeed0 100644 --- a/data/97/D8/EE/97D8EE49011D5432ACDE6A13A38A6173.xml +++ b/data/97/D8/EE/97D8EE49011D5432ACDE6A13A38A6173.xml @@ -1,65 +1,65 @@ - - - -Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny + + + +Four new species of Cryptothecia (Arthoniaceae, Ascomycota) and Myriostigma (Arthoniaceae, Ascomycota) from China, based on morphology and molecular phylogeny - - -Author + + +Author -Xue, Junxia -0000-0002-6387-0148 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Xue, Junxia +0000-0002-6387-0148 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Yang, Zihao -https://orcid.org/0009-0001-0699-2229 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Yang, Zihao +https://orcid.org/0009-0001-0699-2229 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Li, Ruotong -https://orcid.org/0009-0003-9428-3055 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Li, Ruotong +https://orcid.org/0009-0003-9428-3055 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China - - -Author + + +Author -Zhang, Lulu -0000-0001-8011-4451 -Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China +Zhang, Lulu +0000-0001-8011-4451 +Institute of Environment and Ecology, Shandong Normal University, Jinan 250300, China -text - - -MycoKeys +text + + +MycoKeys - -2025 - -2025-03-05 + +2025 + +2025-03-05 - -114 + +114 - -367 -383 + +367 +383 -journal article -308425 -10.3897/mycokeys.114.139180 -8a2665f8-9b49-4be5-9063-0c879cd4e749 +journal article +308425 +10.3897/mycokeys.114.139180 +8a2665f8-9b49-4be5-9063-0c879cd4e749 - + @@ -95,7 +95,7 @@ by its verrucose pseudisidia, which are loosely scattered on the thallus. The up - + ChinaHainan Province @@ -286,7 +286,7 @@ has delimited ascigerous areas (developing in the thallus centre and covered wit Additional specimens examined. - + ChinaHainan Province @@ -322,7 +322,7 @@ et al. 20230144 ( ) ; • - + ibid ., 20230145 ( diff --git a/data/B8/A1/53/B8A153B6B63F5A5B96974376DF9D31A3.xml b/data/B8/A1/53/B8A153B6B63F5A5B96974376DF9D31A3.xml index abfd58a618e..aa0b953ce4b 100644 --- a/data/B8/A1/53/B8A153B6B63F5A5B96974376DF9D31A3.xml +++ b/data/B8/A1/53/B8A153B6B63F5A5B96974376DF9D31A3.xml @@ -1,78 +1,78 @@ - - - -Discovery of the Old World genus Rogas Nees (Hymenoptera, Braconidae, Rogadinae) in the New World by DNA barcoding + + + +Discovery of the Old World genus Rogas Nees (Hymenoptera, Braconidae, Rogadinae) in the New World by DNA barcoding - - -Author + + +Author -Quicke, Donald L. J. -0000-0003-4471-6775 -Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand +Quicke, Donald L. J. +0000-0003-4471-6775 +Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand - - -Author + + +Author -Sharkey, Michael J. -0000-0001-6201-7340 -The Hymenoptera Institute, 1339 La Loma Dr., Redlands, CA, 92373, USA +Sharkey, Michael J. +0000-0001-6201-7340 +The Hymenoptera Institute, 1339 La Loma Dr., Redlands, CA, 92373, USA - - -Author + + +Author -Janzen, Daniel H. -0000-0002-7335-5107 -Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA +Janzen, Daniel H. +0000-0002-7335-5107 +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA - - -Author + + +Author -Hallwachs, Winnie -0000-0002-5166-809X -Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA +Hallwachs, Winnie +0000-0002-5166-809X +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA - - -Author + + +Author -Butcher, Buntika A. -0000-0002-0541-0709 -Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand +Butcher, Buntika A. +0000-0002-0541-0709 +Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand -text - - -Deutsche Entomologische Zeitschrift +text + + +Deutsche Entomologische Zeitschrift - -2025 - -2025-03-05 + +2025 + +2025-03-05 - -72 + +72 - -1 + +1 - -1 -7 + +1 +7 -journal article -10.3897/dez.72.142960 -2EDA9D02-8F97-4E4D-AC6D-1F135B250971 +journal article +10.3897/dez.72.142960 +2EDA9D02-8F97-4E4D-AC6D-1F135B250971 - + - + Rogas shimborii Quicke & Sharkey @@ -84,7 +84,7 @@ Quicke & Sharkey Type material. - + Holotype @@ -95,17 +95,13 @@ Quicke & Sharkey • ; - -Area -de Conservación - -Guanacaste +Area de Conservación Guanacaste , Guanacaste Province , Sector Pailas , -Pailas Dos +Pailas Dos , 10.76 ° N @@ -121,29 +117,25 @@ Area 2. viii. 2018 , leg. - -D. -Janzen, W - -. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, +D. Janzen +, +W. Hallwachs +, +ecotone between lowland tropical dry forest and intermediate elevation rain forest +, Malaise trap -PL 12-9 -); +PL 12-9); CNC (Specimen voucher: -BIOUG 58035 -- F 04; BIN - -BOLD -: -AEF 7075 - +BIOUG 58035-F 04 +; BIN +BOLD: AEF 7075 ) . - + Paratype @@ -152,17 +144,13 @@ D. • 1 ♀ ; - -Area -de Conservación - -Guanacaste +Area de Conservación Guanacaste , Guanacaste Province , Sector Pailas , -Pailas Dos +Pailas Dos , 10.764 ° N @@ -178,26 +166,21 @@ Area 25. vi. 2020 , leg. - -D. -Janzen, W - -. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, +D. Janzen +, +W. Hallwachs +, +ecotone between lowland tropical dry forest and intermediate elevation rain forest +, Malaise trap -( -PL 12-6 -); +(PL 12-6); CNC . (Specimen voucher: -BIOUG 63902 -- A 02; BIN - -BOLD -: -AEF 707 - +BIOUG 63902-A 02 +; BIN +BOLD: AEF 707 ) . @@ -208,10 +191,7 @@ D. Diagnostics. - -BOLD -: AEF 7075 - +BOLD: AEF 7075 . Consensus barcode: TTTATATTTTTTATTTGGTATTTGAGCGGGGCTTTTAGGGCTATCTATAAGGTTAATTATTCGGTTAGAATTAAGTATACCTGGGAGGTTATTAGGTAATGATCAGATTTATAATGGAATAGTAACTGCACATGCATTTATCATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATGGCTTTCCCTCGTATAAATAATATAAGATTTTGATTGTTAATTCCGTCATTAATTTTATTATTATTAAGAGCTATTGTAAATGTAGGGGTTGGTACAGGTTGAACAATTTATCCTCCTTTATCTTCTTTAATAGGGCATGGAGGGATATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATCTCTTCTATTATAGGGGTTGTAAATTTTATTTCTACAATTTTTAATATAAAGTTAATTTCTATTAGTCTAGATCAGATTAATTTATTTGTATGGTCTGTTTTAATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCGGGGGCCATTACAATATTATTAACAGATCGTAATTTAAATACAACTTTTTTTGATTTTTCAGGGGGGGGGGATCCTGTTTTATTTCAACATTTATTT