diff --git a/data/03/84/21/03842100FFF9FFF87FC9F22340A9E99D.xml b/data/03/84/21/03842100FFF9FFF87FC9F22340A9E99D.xml index b7e783bdcb1..e27d953b7b8 100644 --- a/data/03/84/21/03842100FFF9FFF87FC9F22340A9E99D.xml +++ b/data/03/84/21/03842100FFF9FFF87FC9F22340A9E99D.xml @@ -1,48 +1,49 @@ - - - -A rare alpine skink Oligosoma pikitanga n. sp. (Reptilia: Scincidae) from Llawrenny Peaks, Fiordland, New Zealand + + + +A rare alpine skink Oligosoma pikitanga n. sp. (Reptilia: Scincidae) from Llawrenny Peaks, Fiordland, New Zealand - - -Author + + +Author -Bell, Trent P +Bell, Trent P - - -Author + + +Author -Patterson, Geoff B +Patterson, Geoff B -text - - -Zootaxa +text + + +Zootaxa - -2008 - -1882 + +2008 + +1882 - -57 -68 + +57 +68 -journal article -10.5281/zenodo.184231 -302581d2-0eb0-45cf-94cb-3be429360e1e -1175-5326 -184231 +journal article +48891 +10.5281/zenodo.184231 +302581d2-0eb0-45cf-94cb-3be429360e1e +1175-5326 +184231 - + - + Oligosoma pikitanga sp. nov. diff --git a/data/03/A5/80/03A5803CFF98FFCCFF1CFA0E380E751A.xml b/data/03/A5/80/03A5803CFF98FFCCFF1CFA0E380E751A.xml index 2e68a2767c9..0ebc023c210 100644 --- a/data/03/A5/80/03A5803CFF98FFCCFF1CFA0E380E751A.xml +++ b/data/03/A5/80/03A5803CFF98FFCCFF1CFA0E380E751A.xml @@ -1,54 +1,55 @@ - - - -Cyrtodactylus auribalteatus (Squamata: Gekkonidae), a new cave-dwelling gecko from Phitsanulok Province, Thailand + + + +Cyrtodactylus auribalteatus (Squamata: Gekkonidae), a new cave-dwelling gecko from Phitsanulok Province, Thailand - - -Author + + +Author -Sumontha, Montri +Sumontha, Montri - - -Author + + +Author -Panitvong, Nonn +Panitvong, Nonn - - -Author + + +Author -Deein, Gridsada +Deein, Gridsada -text - - -Zootaxa +text + + +Zootaxa - -2010 - -2370 + +2010 + +2370 - -53 -64 + +53 +64 -journal article -10.5281/zenodo.193690 -a2689638-0a82-48da-8a3a-a8344bcb3dd2 -1175-5326 -193690 +journal article +37626 +10.5281/zenodo.193690 +a2689638-0a82-48da-8a3a-a8344bcb3dd2 +1175-5326 +193690 - + - + Cyrtodactylus auribalteatus sp. nov. diff --git a/data/08/9A/CB/089ACB740909B932028372E72F51FB30.xml b/data/08/9A/CB/089ACB740909B932028372E72F51FB30.xml index dcd647b3f1a..f584e13f6ac 100644 --- a/data/08/9A/CB/089ACB740909B932028372E72F51FB30.xml +++ b/data/08/9A/CB/089ACB740909B932028372E72F51FB30.xml @@ -1,61 +1,61 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus fujiokai Jameson & Wada, 2004 + + + +Peltonotus fujiokai Jameson & Wada, 2004 Figs 5-8, 61, 76 - -Diagnosis (male and female). - + +Diagnosis (male and female). + Length 14.1-14.6 mm, color overall castaneous, elytra reddish-brown with castaneous vittae, reddish-brown, or black with iridescent bloom (Figs 5-8), head with some unisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 not enlarged and not dorsoventrally flat -tened +tened , mala without dense lamellate setal brush, maxillary stipes without setae curled at apices, male protibia tridentate, form of parameres (Fig. 61), female epipleuron simple, not incised and lacking emargination (Fig. 76). - -Distribution. -Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sabah). + +Distribution. +Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sabah). \ No newline at end of file diff --git a/data/0A/6D/C7/0A6DC797C79055499B7ED02757AC502D.xml b/data/0A/6D/C7/0A6DC797C79055499B7ED02757AC502D.xml index c61a379c432..91ccfc55035 100644 --- a/data/0A/6D/C7/0A6DC797C79055499B7ED02757AC502D.xml +++ b/data/0A/6D/C7/0A6DC797C79055499B7ED02757AC502D.xml @@ -1,1635 +1,1635 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius capensis (Macquart, 1842) -Figs 7 -, 30 -, 50 -, 70 -, 87 -, 110 -, 129 -, 160 -, 179 -, 209 + + + +Mesembrius capensis (Macquart, 1842) +Figs 7 +, 30 +, 50 +, 70 +, 87 +, 110 +, 129 +, 160 +, 179 +, 209 - - -Helophilus capensis + + +Helophilus capensis Macquart, 1842: 122 (South Africa). - -Helophilus capensis + +Helophilus capensis - - -Seguy + +Seguy (1931) : 118. - -Helophilus (Mesembrius) capensis + +Helophilus (Mesembrius) capensis - -Bezzi (1915) +Bezzi (1915) : 95. - -Tubifera capensis + +Tubifera capensis - - -Kertesz + +Kertesz (1910) : 250. - -Mesembrius capensis + +Mesembrius capensis - -Curran (1927) +Curran (1927) : 64 - -Curran (1939) +Curran (1939) : 10 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Helophilus lagopus + +Helophilus lagopus Loew, 1860: 386 (South Africa). syn. nov. - -Helophilus lagopus + +Helophilus lagopus - -Bezzi (1901) +Bezzi (1901) : 16. - -Helophilus (Mesembrius) lagopus + +Helophilus (Mesembrius) lagopus - -Bezzi (1915) +Bezzi (1915) : 95. - -Tubifera lagopus + +Tubifera lagopus - - -Kertesz + +Kertesz (1910) : 255. - -Mesembrius lagopus + +Mesembrius lagopus - -Curran (1927) +Curran (1927) : 62 - -Curran (1939) +Curran (1939) : 10 - van -Doesburg (1955) +Doesburg (1955) : 355 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504 - -De Meyer and Maragia (1993) +De Meyer and Maragia (1993) : 3. - -Differential diagnosis. - - -Mesembrius capensis + +Differential diagnosis. + + +Mesembrius capensis males lack an apical pile brush on the profemur and have an unmodified metatibia. The basoventral section of the profemur has a patch of black pile. The metafemur is entirely covered with long, thin yellow pile, but with long black pile interspersed in the anteroventral proximal 1/5. The fascia on tergite II is very large with a large anterior and smaller posterior triangular black marking. Males are easily distinguished from any other male by the patch of long black pile on the ventroproximal end of the profemur. Females have a frons which is pale pilose on the ventral half. It differs from females of other species with a pale pilose frons in the ventral half (except from the spined morph of - -M. caffer + +M. caffer ) in tergite II which has a yellow fascia (a pair of yellow maculae in other species). It differs from the female of the spined morph of - -M. caffer + +M. caffer in the mesotibia which lacks or has very inconspicuous black pile, except for a few thick, black spines at the distal ventral end (black pile conspicuous in ventral distal half and without thick black spines at distal ventral end in - -M. caffer + +M. caffer ). - -Examined material. - - -Helophilus capensis + +Examined material. + + +Helophilus capensis - + Macquart: -Lectotype +Lectotype (hereby designated), male, - + " -SYNTYPE +SYNTYPE " " MNHN, Paris // ED6791" " -1♂ -Helophilus +1♂ +Helophilus // -Helophilus capensis +Helophilus capensis Macq // -C.F. Kassebeer +C.F. Kassebeer 1999" [MNHN]. - -Helophilus capensis + +Helophilus capensis Macquart: -Paralectotype +Paralectotype , female, - + " -SYNTYPE +SYNTYPE " " MNHN, Paris // ED6790" " -SYNTYPES +SYNTYPES // Vockeroth -'69" +'69" "afrique // Delalande" [MNHN] . - - -Helophilus lagopus + + +Helophilus lagopus Loew: -Holotype +Holotype , female, " -Helophilus +Helophilus // -Mesembrius lagopus +Mesembrius lagopus " -"208" +"208" "Cap. B. // Spei." "Victo- // rin." " -LECTOTYPUS +LECTOTYPUS // -Helophilus lagopus +Helophilus lagopus // Loew, 1858" "design. Kassebeer 1993" "NHRS-BYWS // 000002620" [NRMS]. - -Other material. - - -Angola + +Other material. + + +Angola • -1♂ -1♀ +1♂ +1♀ ; - -30 km + +30 km NE of Duque de Braganza ; -Nov-Dec. +Nov-Dec. 1957; -G.H. Heinrich +G.H. Heinrich leg.; NHMUK • - -1♀ + +1♀ ; -Duque de Braganza +Duque de Braganza ; -Nov-Dec +Nov-Dec 1957; -G.H. Heinrich +G.H. Heinrich leg.; NHMUK . - -Botswana + +Botswana • -1♂ +1♂ ; -Gabarone +Gabarone ; -12 Nov 1988 +12 Nov 1988 ; -W.H.O. Ernst +W.H.O. Ernst leg.; RMNH . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♀ +1♀ ; -Sakania +Sakania ; -Sep 1931 +Sep 1931 ; -N.P. Cockerell +N.P. Cockerell leg.; NHMUK • - -1♂ -1♀ + +1♂ +1♀ ; -Lualaba +Lualaba ; -Bunkeya +Bunkeya ; -Oct 1907 +Oct 1907 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♂ + +1♂ ; -Katanga +Katanga ; -Kafubu Mission +Kafubu Mission ; -Nov 1931 +Nov 1931 ; -J. Ogilvie +J. Ogilvie leg.; CNC • - -1♀ + +1♀ ; -South Kivu +South Kivu ; -Kalambelembe-Baraka +Kalambelembe-Baraka ; -Jul 1918 +Jul 1918 ; - + R. -Mayne +Mayne leg.; KMMA • - -1♀ + +1♀ ; -Kapanga +Kapanga ; -Lulua +Lulua ; -Nov 1928 +Nov 1928 ; -Walker +Walker leg.; KMMA • - -1♂ -1♀ - -Leopoldville + +1♂ +1♀ + +Leopoldville [= -Kinshasa +Kinshasa ]; -27 May 1915 +27 May 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • - -1♂ + +1♂ ; -Elisabethville +Elisabethville [= Lubumbashi]; -11-17 Sep 1931 +11-17 Sep 1931 ; -A. Mackie +A. Mackie leg.; NHMUK • - -1♀ + +1♀ ; -Elisabethville +Elisabethville [= Lubumbashi]; -23 May 1920 +23 May 1920 ; -M. Bequaert +M. Bequaert leg.; KMMA • - -1♂ -1♀ + +1♂ +1♀ ; -Elisabethville +Elisabethville [= Lubumbashi]; 1927; -M. Bequaert +M. Bequaert leg.; KMMA • - -1♀ + +1♀ ; -Elisabethville +Elisabethville [= Lubumbashi]; -12 Nov 1928 +12 Nov 1928 ; -M. Bequaert +M. Bequaert leg.; KMMA • - -1♂ -1♀ + +1♂ +1♀ ; -Elisabethville +Elisabethville [= Lubumbashi]; -1 Dec 1929 +1 Dec 1929 ; -M. Bequaert +M. Bequaert leg.; KMMA • - -1♂ + +1♂ ; -Elisabethville +Elisabethville [= Lubumbashi]; -11-17 Nov 1931 +11-17 Nov 1931 ; -T.D.A. Cockerell +T.D.A. Cockerell leg.; CNC • - -1♂ -1♀ + +1♂ +1♀ ; -Elisabethville +Elisabethville [= Lubumbashi]; -9 Sep 1932 +9 Sep 1932 ; -De Loose +De Loose leg. • KMMA • - -2♀♀ + +2♀♀ ; -Elisabethville +Elisabethville [= Lubumbashi]; -1 Dec 1929 +1 Dec 1929 ; -M. Bequaert +M. Bequaert leg.; RMNH • - -1♂ + +1♂ ; -Elisabethville +Elisabethville [= Lubumbashi]; -15 Mar 1928 +15 Mar 1928 ; -M. Bequaert +M. Bequaert leg.; RMNH • - -1♂ + +1♂ ; -Elisabethville +Elisabethville [= Lubumbashi]; -23 May 1920 +23 May 1920 ; -M. Bequaert +M. Bequaert leg.; RMNH • - -1♂ + +1♂ ; -Sakania +Sakania ; -Nov 1931 +Nov 1931 ; -V.P. Cockerell +V.P. Cockerell leg.; CNC • - -1♀ + +1♀ ; -Tumbwe +Tumbwe ; -16 Nov 1921 +16 Nov 1921 ; -M. Bequaert +M. Bequaert leg.; KMMA • -1♀ +1♀ ; locality unknown; -8 Nov 1951 +8 Nov 1951 ; H. De Saeger leg.; KMMA. - -Eswatini + +Eswatini ; -1♀ +1♀ ; -Manzini +Manzini ; -7 May 1991 +7 May 1991 ; -J.A.W. Lucas +J.A.W. Lucas leg.; RMNH . - -Ethiopia + +Ethiopia • -1♂ -1♀ +1♂ +1♀ ; -Errer River +Errer River ; date unknown; -G. Kristensen +G. Kristensen leg.; NHMUK . - -Ghana + +Ghana • -1♂ +1♂ ; -Kumasi +Kumasi ; -28 Oct 1946 +28 Oct 1946 ; -J. Bowden +J. Bowden leg.; NMSA . - -Kenya + +Kenya • -2♂♂ -3♀♀ +2♂♂ +3♀♀ ; -Nairobi Prov. +Nairobi Prov. , -Kasarani +Kasarani ; -10-14 Dec 2016 +10-14 Dec 2016 ; -K. Jordaens +K. Jordaens and -R. Copeland +R. Copeland leg.; NMK • - -1♀ + +1♀ ; -Nairobi Prov. +Nairobi Prov. , -Kasarani +Kasarani ; -IV.2014 +IV.2014 ; -R. Copeland +R. Copeland leg.; ICIPE • - -1♀ + +1♀ ; -Central Prov. +Central Prov. , -Kinnyaga +Kinnyaga , -Mucagara Farm +Mucagara Farm ; -16-18 Dec 2016 +16-18 Dec 2016 ; -K. Jordaens +K. Jordaens and -R. Copeland +R. Copeland leg.; NMK • - -2♂♂ + +2♂♂ ; -Nyeri +Nyeri ; -X.1948 +X.1948 ; -van Someren +van Someren leg.; NHMUK • - -2♂♂ -2♀♀ + +2♂♂ +2♀♀ ; -Sola District +Sola District , -Lonje Valley +Lonje Valley , -Laikipia +Laikipia escarpment; -12 Sep 1919 +12 Sep 1919 ; -T.J. Anderson +T.J. Anderson leg.; NHMUK . - -Madagascar + +Madagascar • -1♀ +1♀ ; -Antananarivo +Antananarivo ; -28 Feb 2016 +28 Feb 2016 ; -G. Goergen +G. Goergen leg.; IITA . - -Malawi + +Malawi • -1♀ +1♀ ; -Ruo +Ruo ; date unknown; -R.C. Wood +R.C. Wood leg.; NHMUK . - -Mozambique + +Mozambique • -1♂ +1♂ ; -Luabo +Luabo ; -Lower Zambezi River +Lower Zambezi River , -Port East Africa +Port East Africa ; -1 Apr 1958 +1 Apr 1958 ; -P. Usher +P. Usher leg.; NMSA • - -1♂ + +1♂ ; -Rikatla +Rikatla ; date unknown; -H. Junod +H. Junod leg.; NMSA . - -Rwanda + +Rwanda • -1♀ +1♀ ; -Nduga +Nduga ; -Mar 1953 +Mar 1953 ; -P. Basilewsky +P. Basilewsky leg.; KMMA . - -South Africa + +South Africa • -1♀ +1♀ ; -Barberton +Barberton , -Aloe Bridge Farm +Aloe Bridge Farm ; -22 Oct 2016 +22 Oct 2016 ; - + A. -Vujic +Vujic et al.; leg.; UNS • - -2♂♂ + +2♂♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Bisley Valley Nature Reserve +Bisley Valley Nature Reserve ; -22 Dec 1993 +22 Dec 1993 ; -J.G.H. Londt +J.G.H. Londt and -Craddock +Craddock leg.; NMSA • - -1♂ -1♀ + +1♂ +1♀ ; -Bontebok National Park +Bontebok National Park ; -4 Dec 2016 +4 Dec 2016 ; A. - -Vujic + +Vujic ; S. - -Radenkovic + +Radenkovic ; - + N. -Velickovic +Velickovic and -Z. Petanidou +Z. Petanidou leg.; UNS • - -1♂ -1♀ + +1♂ +1♀ ; -Capland +Capland ; date unknown; -S. Krebs +S. Krebs leg.; MNB ; - -1♂ + +1♂ ; -Western Cape +Western Cape , -Cederberg +Cederberg ; -17-21 Oct 2017 +17-21 Oct 2017 ; -K. Jordaens +K. Jordaens leg.; KMMA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Doonybrook +Doonybrook ; -10 Oct 2015 +10 Oct 2015 ; - -Vujic + +Vujic et al. leg.; UNS • - -1♀ + +1♀ ; -Eastern Cape +Eastern Cape , -East London +East London ; -9 Apr 1922 +9 Apr 1922 ; -H.K. Munro +H.K. Munro leg.; RMNH • - -1♂ + +1♂ ; -Eastern Cape +Eastern Cape , -East London +East London ; -9 Apr 1922 +9 Apr 1922 ; -H.K. Munro +H.K. Munro leg.; NMSA • - -1♂ + +1♂ ; -Hottentot +Hottentot , -Holland +Holland ; -5 Dec 2016 +5 Dec 2016 ; A. - -Vujic + +Vujic ; S. - -Radenkovic + +Radenkovic ; - + N. -Velickovic +Velickovic and -Z. Petanidou +Z. Petanidou leg.; UNS • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Ashburton +Ashburton ; -8 Nov 1982 +8 Nov 1982 ; -D.A. Barraclough +D.A. Barraclough leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Barlett Estate +Barlett Estate , -Cato Ridge +Cato Ridge ; -9 Oct 2018 +9 Oct 2018 ; -G. Theron +G. Theron leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Bishopstown +Bishopstown , near -Pietermaritzburg +Pietermaritzburg ; -11 Dec 1982 +11 Dec 1982 ; -A. Seymour +A. Seymour leg.; NMSA • - -2♂♂ + +2♂♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Bisley Valley Reserve +Bisley Valley Reserve ; -22 Dec 1993 +22 Dec 1993 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Congelia +Congelia ; -26 Oct 1906 +26 Oct 1906 ; -G.F. Leigh +G.F. Leigh leg.; NMSA • - -2♂♂ + +2♂♂ ; -KwaZulu-Natal +KwaZulu-Natal ; -Ferncliff +Ferncliff ; -16 Nov 2018 +16 Nov 2018 ; -K. Jordaens +K. Jordaens leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Hudley +Hudley ; date unknown; -E. Pinhey +E. Pinhey leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Illovo +Illovo ; -14 Jun 1919 +14 Jun 1919 ; collector unknown; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Ingwavuma +Ingwavuma ; -21 Feb 1979 +21 Feb 1979 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Kosi Bay Nature Reserve +Kosi Bay Nature Reserve ; -30 Nov 1982 +30 Nov 1982 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • - -1♀ + +1♀ ; -KwaZulu-Natal +KwaZulu-Natal , -Kosi Lake +Kosi Lake ; -22-27 Jan 1967 +22-27 Jan 1967 ; -D. Gilissen +D. Gilissen leg.; RMNH • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Mkuzi Game Reserve +Mkuzi Game Reserve , -Nsumu Pan Area +Nsumu Pan Area ; -12 Jan 1994 +12 Jan 1994 ; -Natal Museum Staff +Natal Museum Staff leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Mtunzini +Mtunzini ; -7 Feb 1965 +7 Feb 1965 ; -T. Schofield +T. Schofield leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Port Shepstone +Port Shepstone , -Uvongo +Uvongo ; -23 Sep 2005 +23 Sep 2005 ; -A. Wilson +A. Wilson leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Salt Rock +Salt Rock ; -5 Oct 1991 +5 Oct 1991 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • - -2♂♂ + +2♂♂ ; -KwaZulu-Natal +KwaZulu-Natal ; -Zululand +Zululand , -Ndumu Game Reserve +Ndumu Game Reserve ; -26 Oct 1972 +26 Oct 1972 ; -M.E. Irwin +M.E. Irwin leg.; NMSA • - -3♂♂ -4♀♀ + +3♂♂ +4♀♀ ; -KwaZulu-Natal +KwaZulu-Natal , -Howick +Howick ; -18 Oct 2015 +18 Oct 2015 ; - + A. -Vujic +Vujic et al. leg.; UNS • - -1♀ + +1♀ ; -KwaZulu-Natal +KwaZulu-Natal , -Howick +Howick , near - -Curry's + +Curry's Post ; -14 Feb 2016 +14 Feb 2016 ; - + A. -Vujic +Vujic ; - + S. -Radenkovic +Radenkovic leg.; UNS • - -1♂ + +1♂ ; -Western Cape +Western Cape , -Keniworth Racecourse Cons. Area +Keniworth Racecourse Cons. Area ; -5 Nov 2014 +5 Nov 2014 ; - + A. -Vujic +Vujic et al. leg.; UNS • - -1♀ + +1♀ ; -Mpumulanga +Mpumulanga , -Mariepskop National Park +Mariepskop National Park ; -23-24 Jan 2017 +23-24 Jan 2017 ; -K. Jordaens +K. Jordaens leg.; KMMA • - -1♂ -1♀ + +1♂ +1♀ ; -Mpumulanga +Mpumulanga , -Molele Farm +Molele Farm ; -28 Jan 2017 +28 Jan 2017 ; -K. Jordaens +K. Jordaens leg.; KMMA • - -1♂ + +1♂ ; -Muizenberg +Muizenberg , -False Bay +False Bay ; -3 Jan 1972 +3 Jan 1972 ; Southern African Expedition leg.; NHMUK • - -1♀ + +1♀ ; -KwaZulu-Natal, N. +KwaZulu-Natal, N. from -Pietermaritzburg +Pietermaritzburg along - -Otto's + +Otto's Bluff ; -19 Oct 2015 +19 Oct 2015 ; -X. Mengual +X. Mengual leg.; ZFMK • - -4♂♂ -8♀♀ + +4♂♂ +8♀♀ ; -KwaZulu-Natal +KwaZulu-Natal , near -Howick +Howick ; -18 Oct 2015 +18 Oct 2015 ; -X. Mengual +X. Mengual leg.; ZFMK • - -1♂ + +1♂ ; -Cape Province +Cape Province , -Port Elizabeth +Port Elizabeth ; -22-27 Dec 1985 +22-27 Dec 1985 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • - -1♂ + +1♂ ; -Stellenbosch +Stellenbosch , -Delheim +Delheim winery; -10 Feb 2009 +10 Feb 2009 ; -E.M. & L. Laasonen +E.M. & L. Laasonen leg.; MZH • - -1♂ + +1♂ ; -Western Cape +Western Cape , -Cederberg NP +Cederberg NP ; -20 Nov 2011 +20 Nov 2011 ; - + A. -Vujic +Vujic leg.; MZH • - -1♂ -1♀ + +1♂ +1♀ ; -KwaZulu-Natal +KwaZulu-Natal , -Winterton +Winterton ; -1 Oct 2015 +1 Oct 2015 ; -X. Mengual +X. Mengual leg.; ZFMK • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Winterton +Winterton ; -27 Sep 2015 +27 Sep 2015 ; - + A. -Vujic +Vujic et al. leg.; UNS • - -1♂ -2♀♀ + +1♂ +2♀♀ ; -Zastron +Zastron ; -16 Dec 2016 +16 Dec 2016 ; - + A. -Vujic +Vujic ; S. - -Radenkovic + +Radenkovic ; - + N. -Velickovic +Velickovic and -Z. Petanidou +Z. Petanidou leg.; UNS • -1♂ -1♀ +1♂ +1♀ ; locality and date unknown; S. Krebs leg.; MNB • - -1♂ + +1♂ ; -Limpopo Province +Limpopo Province , -Moorddrift +Moorddrift ; date and collector unknown; NMSA • - -1♂ + +1♂ ; -Limpopo Province +Limpopo Province , -Plat River +Plat River ; -1 Jan 1903 +1 Jan 1903 ; -V. Judzncka +V. Judzncka leg.; NMSA • - -1♂ + +1♂ ; -Mongosi +Mongosi ; -May 1916 +May 1916 ; -W.E. Jones +W.E. Jones leg.; RMNH • - -2♂♂ + +2♂♂ ; -Mpumalanga +Mpumalanga , -Barberton +Barberton , -De Kaap +De Kaap ; -18 and 29 Apr 1929 +18 and 29 Apr 1929 ; -H.K. Munro +H.K. Munro leg.; NMSA • - -2♂♂ + +2♂♂ ; -Mpumalanga +Mpumalanga , -Lomati River +Lomati River ; -7 Nov 1970 +7 Nov 1970 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • - -1♀ + +1♀ ; -Piet Retief +Piet Retief ; -15 Mar 1918 +15 Mar 1918 ; -Dr. Brauns +Dr. Brauns leg.; RMNH • - -1♀ + +1♀ ; -Port Elizabeth +Port Elizabeth ; -24 Feb 1922 +24 Feb 1922 ; -H.K. Munro +H.K. Munro leg.; RMNH • - -1♂ + +1♂ ; -Western Cape +Western Cape , -Knysna +Knysna ; -1 Jan 1910 +1 Jan 1910 ; -H. Brauns +H. Brauns leg.; NMSA . - -Togo + +Togo • -1♀ +1♀ ; -Kloto Forest +Kloto Forest ; -Feb 2005 +Feb 2005 ; -G. Goergen +G. Goergen leg.; IITA . - -Uganda + +Uganda • -1♂ +1♂ ; -Entebbe +Entebbe ; -23-31 Jan 1973 +23-31 Jan 1973 ; -H. Falke +H. Falke leg.; CNC • - -1♀ + +1♀ ; -Entebbe +Entebbe ; -1-15 Apr 1983 +1-15 Apr 1983 ; -G.G.M. Schulten +G.G.M. Schulten leg.; RMNH • - -1♂ + +1♂ ; -Ibanda +Ibanda ; -23-28 Dec 1972 +23-28 Dec 1972 ; -H. Falke +H. Falke leg.; CNC . - -Zambia + +Zambia • -1♂ +1♂ ; -Lake Bangweulu +Lake Bangweulu , -Mbawala Island +Mbawala Island ; -Nov-Dec +Nov-Dec 1946; collector unknown; NHMUK • - -1♂ + +1♂ ; N. of -lake Bangweulu +lake Bangweulu , near -Milambo +Milambo ; -20 Oct 1946 +20 Oct 1946 ; collector unknown; NHMUK • - -1♂ + +1♂ ; N. of -Lake Bangweulu +Lake Bangweulu ; - -N'Sombo + +N'Sombo ; -11 Dec 1946 +11 Dec 1946 ; collector unknown; NHMUK • - -1♂ + +1♂ ; -Chilanga +Chilanga ; -2 Jan 1914 +2 Jan 1914 ; -R.C. Wood +R.C. Wood leg.; NHMK . - -Zimbabwe + +Zimbabwe • -1♂ +1♂ ; -upper Kalungwsisi +upper Kalungwsisi valley; -10 Sep 1908 +10 Sep 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • - -1♂ + +1♂ ; -Salisbury +Salisbury [= -Harare +Harare ]; date unknown; -G.A.K. Marshall +G.A.K. Marshall leg.; NHMUK • - -1♀ + +1♀ ; -Umtali District +Umtali District ; -2 Jan 1931 +2 Jan 1931 ; -P.A. Sheppard +P.A. Sheppard leg.; RMNH • - -1♂ + +1♂ ; N. -Vumba +Vumba ; -6 Oct 1963 +6 Oct 1963 ; -D. Cookson +D. Cookson leg.; NMSA . - -Re-description male - - + +Re-description male + + (Fig. -7 +7 ). Body length: 10.6-14.5 mm. Wing length: 8.1-10.4 mm. - -Head + +Head (Fig. -50 +50 ). Eyes bare; slightly dichoptic, distance between eyes approx. the width of ocellus. Face white with dark medial vitta; white pollinose; white pilose. Vertical triangle with black pile in lower half and at ocellar triangle, yellow pile on vertex; yellow pollinose until just before anterior ocellus; distance between lateral ocellus and eye margin 1/2 width of ocellus. Frontal triangle white; white pilose; white pollinose. Frontal prominence shiny black. Occiput yellow; yellow pilose; yellow and white pollinose. Antenna black, antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black with, dorsally, pair of well-demarcated yellow vittae and a faint yellow medial line, which are both connected at anterior and posterior parts of scutum; with lateral, yellow vitta; pile rufous. Scutellum uniformly yellow-brown; yellow pilose. - -Legs. + +Legs. Proleg (Fig. -160 +160 ): femur dark brown to black, without apical pile brush; yellow pilose, pile shorter on dorsal side; with a small patch of black pile at posteroventral proximal end. Tibia yellow to orange-brown, long yellow pilose with a few thick black pile at distal end; tarsi orange-brown, black pilose dorsally, yellow-orange pilose ventrally. Mesoleg (Fig. -179 +179 ): femur as in proleg, but without the posteroventral black pile at proximal end; tibia yellow-orange; with black pile on anterodorsal side; otherwise long yellow pilose. Basitarsus and second tarsal segment orange-brown; black pilose dorsally, long yellow pilose posteriorly. Other tarsi brown; black pilose, with long dark brown pile posteriorly. Metaleg: femur dark brown to black; yellow pilose, with long black pile interspersed at posteroventral proximal half and with some short and thicker black pile at distal end. Tibia dark brown; unmodified; long yellow pilose with sorter, black pile on ventrally and posteriorly, ventral side also with some long, black pile. Tarsi dark brown to black; black pilose dorsally, dark brown and orange pilose ventrally. - -Wing + +Wing (Fig. -129 +129 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -87 +87 ). Tergite II with a pair of large, yellow triangular maculae; black marking hourglass-shaped; posterior black marking, though sometimes very vague (as in Fig. -87 +87 ), equal in size or somewhat narrower than anterior black marking. Posterior black part with short, stiff black setulae which to not extend to the lateral margins. Tergite III and IV with yellow fascia of variable size, often occupying almost the entire tergite, but always with black triangular marking posteriorly. Tergite V strongly white pollinose, except for a black medial zone; with short, black stiff pile posteriorly which do not reach the lateral tergal sides, this pile being absent in specimens where the posterior black marking is strongly reduced. - -Genitalia + +Genitalia (Fig. -209 +209 ). Epandrium: Dorsal lobe of surstylus elongated, more or less rectangular with upwardly curved apex; with short, black spines in distal half; dorsolaterally with a few longer, black setulae; dorsally and laterally with long, yellow pile. Ventral lobe of surstylus with large expansion ventrally with, on ventral side of the expansion, very long and dense black setulae. - -Re-description female - - + +Re-description female + + (Fig. -30 +30 ). Body length: 9.6-14.4 mm. Wing length: 8.1-10.2 mm. - -Head + +Head (Fig. -70 +70 ). Eyes bare; dichoptic. Face yellow-white with dark medial vitta; white pilose, white pollinose. Frons yellow-white; predominantly black pilose on ocellar triangle and just ventrally of ocellar triangle, otherwise white pilose; strongly white pollinose on ventral 3/5. Distance between lateral ocellus and eye margin approx. -11/2 +11/2 x width of ocellus. Occiput yellow-white; yellow-white pilose; yellow-white pollinose. Frontal prominence shiny black, orange-brown at distal end; antenna black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum dark brown with one pair of dorsolateral lighter, yellow pollinose vittae which are connected posteriorly; with lateral, yellow pollinose vitta; yellow pilose. Scutellum yellow-orange; yellow pilose. - -Legs. + +Legs. Proleg: Femur black, distal end yellow-orange; yellow pilose; white pollinose. Tibia orange, darkened on dorsal distal 1/3; yellow pilose. Tarsi orange-brown to black; black pilose dorsally, yellow pilose ventrally with some thick, black pile ventrally. Mesoleg: Femur black; yellow-white pilose, with some short black spines at distal end ventrally. Tibia orange; yellow pilose, with some long, thick black pile at ventral distal end. Basitarsus orange; yellow pilose, with some long, thick black pile on dorsal distal end and ventrally. Other tarsi black; dorsally short black pilose, ventrally yellow pilose with some large, thick black pile. Metaleg: Femur black; yellow-white pilose with shorter and thicker black pile on ventral distal half; white pollinose. Tibia chocolate-brown; yellow-white pilose with some black pile interspersed ventrally, pile longer on distal ventral end. Tarsi black; short black and yellow pilose dorsally; densely yellow-orange pilose ventrally. - -Wing. + +Wing. Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Fig. -110 +110 ). Tergite II with a broad orange fascia, with a narrow black anterior marking and a larger, posterior black marking which, in the medial part, is approx. 1/2 the tergal length; yellow pilose, with some very short and thicker black pile posteriorly; especially the posterior part of the posterior black marking white pollinose. Tergite III with yellow-orange fascia which in the medial part is approx. 2/5 of tergal length; yellow pilose, with some very short and thicker black pile posteriorly; especially in the medial part strongly white pollinose. Tergite IV similar, but entire orange fascia strongly white pollinose and black pile in black marking almost absent. Tergite V black; yellow-white pilose; strongly white pollinose on anterior half, especially on the lateral sides. - -Distribution. -Angola, Botswana, Democratic Republic of the Congo, Eswatini, Ethiopia, Ghana, Kenya, Madagascar, Malawi, Mozambique, Rwanda, South Africa, Togo, Uganda, Zambia and Zimbabwe. + +Distribution. +Angola, Botswana, Democratic Republic of the Congo, Eswatini, Ethiopia, Ghana, Kenya, Madagascar, Malawi, Mozambique, Rwanda, South Africa, Togo, Uganda, Zambia and Zimbabwe. - -Comments. - + +Comments. + The study of the type material shows that - -M. lagopus + +M. lagopus (Loew, 1860) is morphologically similar to - -M. capensis + +M. capensis (Macquart, 1842) and hence, we consider both conspecific, with - -M. lagopus + +M. lagopus (Loew, 1860) being a junior synonym of - -M. capensis + +M. capensis (Macquart, 1842). diff --git a/data/0E/B4/3E/0EB43E74A744176454653D0C2DB4BD15.xml b/data/0E/B4/3E/0EB43E74A744176454653D0C2DB4BD15.xml index 3a2c9ddfdc5..a7494efbe63 100644 --- a/data/0E/B4/3E/0EB43E74A744176454653D0C2DB4BD15.xml +++ b/data/0E/B4/3E/0EB43E74A744176454653D0C2DB4BD15.xml @@ -1,67 +1,67 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - - -Peltonotus + + + + +Peltonotus podocrassus Jameson & Wada, 2004 Figs 29, 62, 77 - -Diagnosis (male and female). -Length 17.6-18.7 mm, color overall castaneous, elytra castaneous with weak iridescent bloom, head with some multisetigerous punctures, labrum deeply bi-lobed, mentum rounded in apical half (Fig. 29), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 29), mala with lamellate setal brush, maxillary stipes lacking setae curled at apices, male protibia bidentate, form of parameres (Fig. 62), female epipleuron incised and with oblong-oval emargination (Fig. 77). + +Diagnosis (male and female). +Length 17.6-18.7 mm, color overall castaneous, elytra castaneous with weak iridescent bloom, head with some multisetigerous punctures, labrum deeply bi-lobed, mentum rounded in apical half (Fig. 29), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 29), mala with lamellate setal brush, maxillary stipes lacking setae curled at apices, male protibia bidentate, form of parameres (Fig. 62), female epipleuron incised and with oblong-oval emargination (Fig. 77). - -Distribution. -Malaysia (Peninsular Malaysia). + +Distribution. +Malaysia (Peninsular Malaysia). - -Remarks. - -Peltonotus podocrassus + +Remarks. + +Peltonotus podocrassus and -Peltonotus gracilipodus +Peltonotus gracilipodus (distributed in Sumatra) are similar with respect to the male parameres and female epipleura. This may be indicative of recent divergence from a common ancestor. diff --git a/data/1C/B3/72/1CB372F78208B670B61D001D296807FE.xml b/data/1C/B3/72/1CB372F78208B670B61D001D296807FE.xml index bee1419dacc..5687a0e0bba 100644 --- a/data/1C/B3/72/1CB372F78208B670B61D001D296807FE.xml +++ b/data/1C/B3/72/1CB372F78208B670B61D001D296807FE.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus sisyrus Jameson & Wada, 2004 + + + +Peltonotus sisyrus Jameson & Wada, 2004 Figs 34, 70, 87 - -Diagnosis (male and female). -Length 16.1-16.4 mm, overall castaneous, elytra castaneous with weak iridescent bloom, head with some punctures multisetigerous, labrum bi-emarginate, mentum triangular in apical half (Fig. 34), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 34), mala with lamellate setal brush, maxillary stipes without setae curled at apices, male protibia bidentate, form of parameres (Fig. 70), female epipleuron incised and with broad, elongate emargination (Fig. 87). + +Diagnosis (male and female). +Length 16.1-16.4 mm, overall castaneous, elytra castaneous with weak iridescent bloom, head with some punctures multisetigerous, labrum bi-emarginate, mentum triangular in apical half (Fig. 34), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 34), mala with lamellate setal brush, maxillary stipes without setae curled at apices, male protibia bidentate, form of parameres (Fig. 70), female epipleuron incised and with broad, elongate emargination (Fig. 87). - -Distribution. -Indonesia, Sumatra Island. + +Distribution. +Indonesia, Sumatra Island. \ No newline at end of file diff --git a/data/24/3A/5D/243A5D3ADB205ECF9714BB61D130610A.xml b/data/24/3A/5D/243A5D3ADB205ECF9714BB61D130610A.xml index 2e03d21bba2..16f8c2c2061 100644 --- a/data/24/3A/5D/243A5D3ADB205ECF9714BB61D130610A.xml +++ b/data/24/3A/5D/243A5D3ADB205ECF9714BB61D130610A.xml @@ -1,2403 +1,2403 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius caffer (Loew, 1858) -Figs 1 -, 4 -, 5-6 -, 27-28 -, 29 -, 47-49 -, 84-86 -, 107-109 -, 128 -, 175 -, 178 -, 182 -, 195 -, 196 -, 206-208 + + + +Mesembrius caffer (Loew, 1858) +Figs 1 +, 4 +, 5-6 +, 27-28 +, 29 +, 47-49 +, 84-86 +, 107-109 +, 128 +, 175 +, 178 +, 182 +, 195 +, 196 +, 206-208 - - -Helophilus caffer + + +Helophilus caffer Loew, 1858: 380. - -Helophilus caffer + +Helophilus caffer - -Loew (1860) +Loew (1860) : 384 - -Karsch (1888) +Karsch (1888) : 381 - - -Herve-Bazin + +Herve-Bazin (1914a) : 297. - -Helophilus (Tubifera) caffer + +Helophilus (Tubifera) caffer - - -Herve-Bazin + +Herve-Bazin (1914b) : 103. - -Tubifera caffra + +Tubifera caffra - - -Kertesz + +Kertesz (1910) : 250. - -Mesembrius caffer + +Mesembrius caffer - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Mesembrius mediopectinatus -Szilady + +Mesembrius mediopectinatus +Szilady , 1942: 97. Syn. by -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Mesembrius ctenifera + +Mesembrius ctenifera Hull, 1941: 333. syn. nov. - -Mesembrius ctenifera + +Mesembrius ctenifera - -Keiser (1971) +Keiser (1971) : 261. - -Mesembrius ctenifer + +Mesembrius ctenifer - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius caffer + +Differential diagnosis. + + +Mesembrius caffer males lack an apical pile brush on the profemur and have an unmodified metatibia. The metafemur is entirely covered with long, thin yellow pile, but lacks pile in the anteroventral and ventral proximal 1/4. The posteroventral proximal 1/4 has a comb of long yellow or black pile and the remainder of the posteroventral side has a comb of shorter, black pile. The maculae on tergite II are very large and rounded so that black markings have an hourglass shape; the posterior black marking is narrower than the anterior black marking. It can be distinguished from any other male by the bare anteroventral proximal area of the metafemur and the thick comb of yellow or black pile on the proximal end posteroventrally. Females have a frons which is pale pilose on the ventral half. Females of the spined morph (see description below) differ from females of all other species with pale pile on the ventral half of the frons (except from - -M. capensis + +M. capensis ) in tergite II which has a yellow fascia (a pair of yellow maculae in other species). It differs from the female of - -M. capensis + +M. capensis in the mesotibia which has conspicuous black pile in the ventral distal half (inconspicuous in - -M. capensis + +M. capensis ) and the absence of thick, black spines at the distal ventral end (present in - -M. capensis + +M. capensis ). Females of the nominal morph have a pair of yellow maculae on tergite II (fascia in the spined morph of - -M. caffer + +M. caffer and in - -M. capensis + +M. capensis ). Pro- and mesofemur are dark brown to black (yellow-brown in - -M. senegalensis + +M. senegalensis ), the metafemur lacks a ventral medial swelling (present in - -M. minor + +M. minor ), the face is not markedly produced downwards (produced downwards in - -M. vockerothi + +M. vockerothi sp. nov.) and the mesofemur has very sparse and short black pile on the distal end ventrally (long black pile in - -M. strigilatus + +M. strigilatus ). - -Examined material. - - -Helophilus caffer + +Examined material. + + +Helophilus caffer - + Loew: -Lectotype +Lectotype (hereby designated), male, " -Helophilus +Helophilus // -Helophilus caffer +Helophilus caffer // -♂ +♂ " -"206" -"207" +"206" +"207" "Loan // 575/99" "NHRS-BYWS // 000002618" [NRMS]. - -Helophilus caffer + +Helophilus caffer Loew: -Paralectotype +Paralectotype , female, " -Helophilus +Helophilus // -Helophilus caffer +Helophilus caffer // -♀ +♀ " -"206" +"206" "Loan // 575/99" "NHRS-BYWS // 000002617" [NRMS] . - - -Mesembrius ctenifera + + +Mesembrius ctenifera - + Hull: -Holotype +Holotype , male, " -Mesembrius +Mesembrius // -Mesembrius ctenifera +Mesembrius ctenifera // Hull n. sp." "TYPE 6596 // -Mesembrius +Mesembrius // -Mesembrius ctenifera +Mesembrius ctenifera // -F.M. Hull +F.M. Hull " " -Oriental forest +Oriental forest // -Fanovana Dist. +Fanovana Dist. // -Fianarantsoa +Fianarantsoa // -Madagascar +Madagascar " "1-V, 1937. // ( -C. Lamberton +C. Lamberton )" [ANSP]. - - -Mesembrius ctenifera + + +Mesembrius ctenifera - + Hull: -Allotype +Allotype , female, " -Allotype -♀ +Allotype +♀ // -Mesembrius +Mesembrius // -Mesembrius ctenifera +Mesembrius ctenifera // -F.M. Hull +F.M. Hull " " -Oriental forest +Oriental forest // Fanovana, Dist. // -Fianarantsoa +Fianarantsoa // -Madagascar +Madagascar " [ANSP]. - -Other material - -(nominal morph; see below). - -Burundi + +Other material + +(nominal morph; see below). + +Burundi • -1♀ +1♀ ; - -Bujumbura + +Bujumbura ; -20 Feb 2017 +20 Feb 2017 ; -G. Goergen +G. Goergen leg.; IITA . - -Cameroon + +Cameroon • -1♀ +1♀ ; - -Maroua + +Maroua , -Meskina +Meskina ; -23 May 2018 +23 May 2018 ; - + M. -Azo'o +Azo'o Ela leg.; MAPC . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♂ +1♂ ,? - -Adu + +Adu ; -8 Apr 1955 +8 Apr 1955 ; collector unknown; KMMA • -1♀ +1♀ ; - -Coquilhatville + +Coquilhatville [= Mbandaka], -Bamania +Bamania , -Equateur +Equateur ; -21 Jul 1924 +21 Jul 1924 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♂ +1♂ ; - -Bambesa + +Bambesa , - -Bas-Uele + +Bas-Uele ; -Dec 1933 +Dec 1933 ; - + H.J -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; - -Barumbu + +Barumbu , - -Leopoldville + +Leopoldville [= -Kinshasa +Kinshasa ]; -15 Oct 1910 +15 Oct 1910 ; -Dr. Bequaert +Dr. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Boma + +Boma ; -15 Jul 1920 +15 Jul 1920 ; -H. Schouteden +H. Schouteden leg.; KMMA • -1♀ +1♀ ; - -Bondo + +Bondo , - -Bas-Uele + +Bas-Uele ; -J.J. Rodhain +J.J. Rodhain leg.; KMMA • -1♂ +1♂ ; - -Bukama + +Bukama , -Haut-Lomami +Haut-Lomami ; -28 Mar 1911 +28 Mar 1911 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Bukama + +Bukama , -Haut-Lomami +Haut-Lomami ; -24 May 1911 +24 May 1911 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Bunia + +Bunia , -Ituri +Ituri ; 1938; - + P. -Lefevre +Lefevre leg.; KMMA • -3♂♂ -3♀♀ +3♂♂ +3♀♀ ; - -Faradje + +Faradje , - -Haut-Uele + +Haut-Uele ; -Nov 1912 +Nov 1912 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -4♂♂ +4♂♂ ; - -Garamba + +Garamba , - -Haut-Uele + +Haut-Uele ; -Jun-Jul +Jun-Jul 1912; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -2♀♀ +2♀♀ ; - -Kalemie + +Kalemie ; -1-20 Jan 1919 +1-20 Jan 1919 ; - + R. -Mayne +Mayne leg.; KMMA • -1♂ +1♂ ; - -Kasenyi + +Kasenyi , -Lac Albert +Lac Albert , -Ituri +Ituri ; -15 May 1935 +15 May 1935 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; - -Kasongo + +Kasongo , -Maniema +Maniema ; date unknown; -Dr. Pons +Dr. Pons leg.; KMMA • -1♂ +1♂ ; - -Kasonsero + +Kasonsero , -Ituri +Ituri ; -17 Jul 1914 +17 Jul 1914 , -J. Bequaert +J. Bequaert ; KMMA • -1♂ -1♀ +1♂ +1♀ ; - -Stanleyville + +Stanleyville [= Kisangani], -Tshopo +Tshopo ; -Mar 1915 +Mar 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♂ +1♂ ; - -Komi + +Komi , -Sankuru +Sankuru ; -May 1930 +May 1930 ; - + J. -Ghesquiere +Ghesquiere leg.; KMMA • -1♂ +1♂ ; - - -N'Gwese + + +N'Gwese , -Lac -Kivu +Lac +Kivu ; date unknown; -Carlier +Carlier leg.; KMMA • -1♂ +1♂ ; - -Elisabethville + +Elisabethville [= Lubumbashi], -Haut-Katanga +Haut-Katanga ; -3 Jun 1920 +3 Jun 1920 ; -M. Bequaert +M. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Elisabethville + +Elisabethville [= Lubumbashi], -Haut-Katanga +Haut-Katanga ; -Dec 1925 +Dec 1925 ; -Van Sackeghem +Van Sackeghem leg.; KMMA; -1♂ +1♂ ; - -Elisabethville + +Elisabethville [= Lubumbashi], -Haut-Katanga +Haut-Katanga ; -Jan1933 +Jan1933 ; -M. Bequaert +M. Bequaert leg.; RMNH • -1♀ +1♀ ; - -Elisabethville + +Elisabethville [= Lubumbashi], -Haut-Katanga +Haut-Katanga ; -16 Nov 1921 +16 Nov 1921 ; -M. Bequaert +M. Bequaert leg.; RMNH • -1♀ +1♀ ; - -Elisabethville + +Elisabethville [= Lubumbashi], -Haut-Katanga +Haut-Katanga ; -9 May 1920 +9 May 1920 ; -M. Bequaert +M. Bequaert leg.; RMNH • -1♂ +1♂ ; - -Faradje + +Faradje , -Ituri +Ituri ; -11 Apr 1930 +11 Apr 1930 ; -A. Collart +A. Collart leg.; KMMA • -1♀ +1♀ ; - -Malima + +Malima ; -14 Oct 1910 +14 Oct 1910 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Mayumbe + +Mayumbe , -Luki +Luki ; 1924; -L. Pieters +L. Pieters leg.; KMMA • -1♀ +1♀ ; - -Nyangwe + +Nyangwe , -Maniema +Maniema ; -13 Dec 1910 +13 Dec 1910 ; -Dr. Bequaert +Dr. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Nyangwe + +Nyangwe , -Maniema +Maniema ; -19 Nov 1910 +19 Nov 1910 ; -Dr. Bequaert +Dr. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Nyangwe + +Nyangwe , -Maniema +Maniema ; -12 Nov 1910 +12 Nov 1910 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; - -Nyangwe + +Nyangwe , -Maniema +Maniema ; -Apr-May +Apr-May 1918; - + R. -Mayne +Mayne leg.; KMMA • -1♂ -1♀ +1♂ +1♀ , - -Apr-May + +Apr-May 1918, - + R. -Mayne +Mayne leg.; RMNH • -1♀ +1♀ ; - -Ubundu + +Ubundu , -Tshopo +Tshopo ; -21 Oct 1910 +21 Oct 1910 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♂ +1♂ ; - -Wombali + +Wombali , -Mai-Ndombe +Mai-Ndombe ; -Jul 1913 +Jul 1913 , -P. Vanderijst +P. Vanderijst leg.; KMMA • -1♀ +1♀ ; unknown locality; -14 Dec 1951 +14 Dec 1951 ; H. De Saeger leg.; KMMA. • -1♂ -1♀ +1♂ +1♀ ; -4 Jan 1951 +4 Jan 1951 ; H. De Saeger leg.; KMMA • -1♀ +1♀ ; -30 Oct 1951 +30 Oct 1951 ; H. De Saeger leg.; KMMA. - -Ethiopia + +Ethiopia • -1♀ +1♀ ; - -Koka + +Koka ; -14 Jan 1968 +14 Jan 1968 ; -J.W. Boyes +J.W. Boyes leg.; CNC • -1♂ +1♂ , - + N.W. shore of -lake Zwai +lake Zwai ; -3 Nov 1926 +3 Nov 1926 ; -H. Scott +H. Scott leg.; NHMUK • -1♂ +1♂ ; unknown locality; -Nov 1911 +Nov 1911 ; R.J. Stordy leg.; NHMUK. - -Ghana + +Ghana • -1♂ +1♂ ; - -Tamale + +Tamale ; -Nov 1916 +Nov 1916 ; -J.J. Simpson +J.J. Simpson leg.; NHMUK . - -Kenya + +Kenya • -2♂♂ +2♂♂ ; - -Kabete + +Kabete ; -24 May 1916 +24 May 1916 ; -T.J. Anderson +T.J. Anderson leg.; NHMUK • -4♂♂ +4♂♂ ; - -Kanyamkago + +Kanyamkago ; -13 Jun 1911 +13 Jun 1911 ; -J. Pugh +J. Pugh leg.; NHMUK • -1♂ +1♂ ; - -Marsabit District + +Marsabit District , -Rendili Njoro +Rendili Njoro ; date unknown; -C.A. Neave +C.A. Neave leg.; NHMUK • -1♂ +1♂ ; - -Mbuyuni + +Mbuyuni , -Serengetti Plains +Serengetti Plains ; -25 May 1916 +25 May 1916 ; -T.J. Anderson +T.J. Anderson leg.; NHMUK • -1♂ +1♂ ; - -Voi + +Voi ; -8-10 Feb 1912 +8-10 Feb 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♀ +1♀ ; - - -Fisherman's + + +Fisherman's Camp , -Naivasha +Naivasha ; -14 Mar 1993 +14 Mar 1993 ; -M. De Meyer +M. De Meyer leg.; KMMA • -1♀ +1♀ ; - -Chawia + +Chawia , near -Wundanyi +Wundanyi ; -25 Jan 2017 +25 Jan 2017 ; -A. Ssymank +A. Ssymank leg.; ASPC • -1♀ +1♀ ; - -Ologassai + +Ologassai ; -Apr 1986 +Apr 1986 ; -J. Muhangani +J. Muhangani leg.; NMK • -1♀ +1♀ ; - -Rift Valley + +Rift Valley ; -27-29 May 2013 +27-29 May 2013 ; -R. Copeland +R. Copeland leg.; ICIPE • -1♂ -1♀ +1♂ +1♀ ; - -Taita -Hills + +Taita +Hills ; 2017; -A. Ssymank +A. Ssymank leg.; ASPC • -1♂ +1♂ ; - -Turkana + +Turkana , -Lothagam +Lothagam ; -Jul-Aug +Jul-Aug 1994; -A.M. George +A.M. George leg.; NMK . - -Liberia + +Liberia • -Bong -1♂ +Bong +1♂ ; - -County + +County , -Suakoko +Suakoko ; -6 Feb 1988 +6 Feb 1988 ; -G.G.M. Schulten +G.G.M. Schulten leg.; RMNH . - -Madagascar + +Madagascar • -1♀ +1♀ ; - -Andasibe + +Andasibe , - -Perinet + +Perinet ; -29 Oct 2010 +29 Oct 2010 ; -A. Ssymank +A. Ssymank leg.; ASPC • -3♂♂ +3♂♂ ; - -Antananarivo + +Antananarivo ; -28 Feb 2016 +28 Feb 2016 ; -G. Goergen +G. Goergen leg.; IITA • -2♂♂ -1♀ +2♂♂ +1♀ ; - -Antananarivo + +Antananarivo ; -28 Feb 2016 +28 Feb 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; - -Antananarivo + +Antananarivo ; -8 Mar 2016 +8 Mar 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; - -Antananarivo + +Antananarivo , -Tsimbazaza +Tsimbazaza ; -7 Feb 1968 +7 Feb 1968 ; -J.W. Boyes +J.W. Boyes leg.; CNC • -1♀ +1♀ ; - -Antananarivo + +Antananarivo , -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -6 Nov 1993 +6 Nov 1993 ; -M. Hauser +M. Hauser leg.; CAS • -1♂ +1♂ ; - -Antananarivo + +Antananarivo , -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -9 Oct 1993 +9 Oct 1993 ; -M. Hauser +M. Hauser leg.; CAS • -1♂ -1♀ +1♂ +1♀ ; - -Antananarivo + +Antananarivo , -Tsimbazaza +Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CNC • -1♂ -1♀ +1♂ +1♀ ; - -Antananarivo + +Antananarivo , -Tsimbazaza +Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; NMK • -1♀ +1♀ ; - -Fianarantsoa + +Fianarantsoa , -Mahabo Mananivo +Mahabo Mananivo , -Ampitavananima forest +Ampitavananima forest ; -17-24 Mar 2007 +17-24 Mar 2007 ; -M. Irwin +M. Irwin , -F. Parker +F. Parker and - + R. -Harin'Hala +Harin'Hala leg.; CAS • -1♀ +1♀ ; - -Tananarive + +Tananarive ; -28-30 Apr 1968 +28-30 Apr 1968 ; -K.M. Guichard +K.M. Guichard leg.; NHMUK • -1♂ +1♂ ; - -Tananarive + +Tananarive ; -15 Oct 1957 +15 Oct 1957 ; -F. Keiser +F. Keiser leg.; NMB • -1♀ +1♀ ; - -Tananarive + +Tananarive ; -20 Oct 1957 +20 Oct 1957 ; -F. Keiser +F. Keiser leg.; NMB • -1♂ -1♀ +1♂ +1♀ ; - -Fianarantsoa + +Fianarantsoa ; -Ambodimanga +Ambodimanga ; -8 Aug 1958 +8 Aug 1958 ; -F. Keiser +F. Keiser leg.; NMB • -1♂ +1♂ ; - -Ambongamaranitra + +Ambongamaranitra ; -20 Jun 1958 +20 Jun 1958 ; -F. Keiser +F. Keiser leg.; NMB • -2♂♂ +2♂♂ ; - -Tananarive + +Tananarive ; -28-30 Apr 1968 +28-30 Apr 1968 ; -K.M. Guichard +K.M. Guichard leg.; NHMUK • -1♀ +1♀ ; - -Tananarive + +Tananarive ; -9 Sep 1980 +9 Sep 1980 ; -J. Stelleman +J. Stelleman leg.; RMNH . - -Malawi + +Malawi • -1♂ +1♂ ; - -Blantyre + +Blantyre ; -25 Apr 1910 +25 Apr 1910 ; -J.E.S. Old. +J.E.S. Old. leg.; NHMUK • -2♂♂ +2♂♂ ; - -Chiromo + +Chiromo ; -J.E.S. Old. +J.E.S. Old. leg.; NHMUK • -1♂ +1♂ ; - -Cholo + +Cholo ; -R.C. Wood +R.C. Wood leg.; NHMUK • -1♂ -2♀♀ +1♂ +2♀♀ ; - -Mulanje -Mountain Forest Reserve + +Mulanje +Mountain Forest Reserve ; -12-15 Nov 2016 +12-15 Nov 2016 ; -K. Jordaens +K. Jordaens leg.; KMMA • -1♂ -6♀♀ +1♂ +6♀♀ ; - -Mulanje -Mountain + +Mulanje +Mountain ; -Likhubula +Likhubula ; -12-14 Nov 2016 +12-14 Nov 2016 ; -K. Jordaens +K. Jordaens leg.; KMMA • -3♂♂ +3♂♂ ; N. - -Malawi + +Malawi ; 1916; -N.M. Leys +N.M. Leys leg.; NHMUK • -3♂♂ +3♂♂ ; - -Ruo + +Ruo ; -R.C. Wood +R.C. Wood leg.; NHMUK • -1♂ +1♂ ; - -Chinteche + +Chinteche ; -H.S. Stannus +H.S. Stannus leg.; NHMUK . - -Mozambique + +Mozambique • -3♂♂ +3♂♂ ; - -Sofala + +Sofala , -Gorongosa Park +Gorongosa Park ; -20-30 Apr 2015 +20-30 Apr 2015 ; -M. Hauser +M. Hauser and -A. Runig +A. Runig leg.; CAS • -1♀ +1♀ ; - -Luaba + +Luaba , -lower Zambesi +lower Zambesi ; -Jun-Jul +Jun-Jul 1957; -P.J. Usher +P.J. Usher and -B. Stuckenberg +B. Stuckenberg leg.; CNC • -1♂ +1♂ ; - -Luabo + +Luabo , -lower Zambesi +lower Zambesi ; -Apr 1958 +Apr 1958 ; -P.J. Usher +P.J. Usher leg.; CNC • -1♂ +1♂ ; - + E of -Mount Mulanje +Mount Mulanje ; -3-7 Oct 1913 +3-7 Oct 1913 ; -S.A. Neave +S.A. Neave leg.; NHMUK . - -Nigeria + +Nigeria • -1♀ +1♀ ; - -Samaru + +Samaru ; -15-22 Jun 1972 +15-22 Jun 1972 ; -P.H. Ward +P.H. Ward leg.; NHMUK • -1♀ +1♀ ; - -Ibadan + +Ibadan ; -28 May 1987 +28 May 1987 ; -G.G.M. Schulten +G.G.M. Schulten leg.; RMNH . - -Senegal + +Senegal • -1♂ +1♂ ; - -Dakar + +Dakar ; -14 Jan 1945 +14 Jan 1945 ; collector unknown; RMNH . - -South Africa + +South Africa • -1♀ +1♀ ; - -Mariepskop + +Mariepskop , -Mpumulanga +Mpumulanga ; -20-22 Jan 2017 +20-22 Jan 2017 ; -K. Jordaens +K. Jordaens leg.; KMMA • -1♂ +1♂ ; - -St. Lucia -Bay + +St. Lucia +Bay , -Natal +Natal ; -3 Nov 1959 +3 Nov 1959 ; -D.J. Greathead +D.J. Greathead leg.; NHMUK • -2♂♂ +2♂♂ ; - -KwaZulu-Natal + +KwaZulu-Natal , -Durban +Durban ; -1 Jul 1903 +1 Jul 1903 ; -G. Burn +G. Burn leg.; NMSA • -1♂ +1♂ ; - -Rinkarla + +Rinkarla ; date unkown; -H. Junod +H. Junod leg.; NMSA . - -Tanzania + +Tanzania • -2♂♂ +2♂♂ ; - -Bondei + +Bondei ; -Jan 1986 +Jan 1986 ; -C.W. Schmidt +C.W. Schmidt leg.; MNB • -1♂ +1♂ ; - -Zanzibar + +Zanzibar ; -Jan-Feb +Jan-Feb 1925; -H.J. Snell +H.J. Snell leg.; NHMUK • -5♂♂ +5♂♂ ; - -Zanzibar + +Zanzibar , -Kizimbani +Kizimbani ; -15 Jul 1985 +15 Jul 1985 ; -G.G.M. Schulten +G.G.M. Schulten leg.; RMNH • -5♂♂ -3♀♀ +5♂♂ +3♀♀ ; - -Kilanbeo + +Kilanbeo ; -1 May 1971 +1 May 1971 ; -W.S. Bos +W.S. Bos leg.; RMNH . - -Togo + +Togo • -1♂ +1♂ ; - -Kloto Forest + +Kloto Forest ; -Feb 2017 +Feb 2017 ; -G. Goergen +G. Goergen leg.; KMMA . - -Uganda + +Uganda • -2♂♂ +2♂♂ ; - -Budongo + +Budongo , forest near -Lake Albert +Lake Albert ; -Apr 1972 +Apr 1972 ; -E.B. Babyetagara +E.B. Babyetagara leg.; CNC • -1♂ +1♂ ; - -Entebbe + +Entebbe ; -3-4 Dec 1912 +3-4 Dec 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; - -Entebbe + +Entebbe ; -12-20 Jan 1912 +12-20 Jan 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -2♂♂ +2♂♂ ; - -Ibanda + +Ibanda ; -23-28 Dec 1972 +23-28 Dec 1972 ; -H. Falke +H. Falke leg.; CNC • -1♂ +1♂ ; - -Kigezi + +Kigezi , -Kayonza Forest +Kayonza Forest ; -Sep 1972 +Sep 1972 ; -H. Falke +H. Falke leg.; CNC • -1♂ +1♂ ; - -Kigezi + +Kigezi , -Kayonza Forest +Kayonza Forest ; -Dec 1972 +Dec 1972 ; -H. Falke +H. Falke leg.; CNC • -1♀ +1♀ ; - -Kitende + +Kitende ; -11 Sep 1927 +11 Sep 1927 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♂ +1♂ ; - -Masindi + +Masindi ; -15-19 Dec 1911 +15-19 Dec 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; locality unknown; -Nov 1904 +Nov 1904 ; E.D.W. Greig leg.; NHMUK • -2♂♂ -4♀♀ +2♂♂ +4♀♀ ; - -Western Region + +Western Region , -Kamwege District +Kamwege District , -Kibale -Forest +Kibale +Forest ; -8 Dec 2018 +8 Dec 2018 ; -K. Jordaens +K. Jordaens ; leg. KMMA • -3♂♂ -1♀ +3♂♂ +1♀ ; - -Mabamba + +Mabamba swamps, -Nkima +Nkima lodge and surroundings; -16 Dec 2018 +16 Dec 2018 ; -K. Jordaens +K. Jordaens leg.; KMMA . - -Zambia + +Zambia • -1♂ -1♀ +1♂ +1♀ ; - -Lusaka Province - -8.5 km + +Lusaka Province + +8.5 km NW Katondwe ; -20 Apr 2016 +20 Apr 2016 ; -M. Hauser +M. Hauser leg.; CSCA . - -Zimbabwe + +Zimbabwe • -1♀ +1♀ ; - -Chishi Island + +Chishi Island , -Bangweolo +Bangweolo ; -26 Jun 1908 +26 Jun 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -Chinsali District + +Chinsali District , mid-Chambezi -Valley +Valley ; -17 Apr 1908 +17 Apr 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -Mirongo + +Mirongo ; -3 Apr 1908 +3 Apr 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -upper Luangwa Valley + +upper Luangwa Valley ; -29 Feb 1908 +29 Feb 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -upper Luangwa Valley + +upper Luangwa Valley ; -17 Mar 1908 +17 Mar 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -upper Luangwa Valley + +upper Luangwa Valley ; -20 Mar 1908 +20 Mar 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -upper Luangwa Valley + +upper Luangwa Valley ; -5-7 Mar 1908 +5-7 Mar 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM • -1♂ +1♂ ; - -upper Luangwa Valley + +upper Luangwa Valley ; -23-24 Mar 1908 +23-24 Mar 1908 ; -S.A. Neave +S.A. Neave leg.; OXUM . - + (Morphotype with conspicuous spine on metatibia; see Variation, comments and discussion). - -"ARABIA" + +"ARABIA" • -1♂ +1♂ ; -Abu +Abu ; date unknown; -C.G. Nurse +C.G. Nurse leg.; NHMUK. -Benin +Benin • -3♂♂ -3♀♀ +3♂♂ +3♀♀ ; -Calavi +Calavi ; -8 Dec 2013 +8 Dec 2013 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • -2♂♂ -3♀♀ +2♂♂ +3♀♀ ; -9 Dec 2013 +9 Dec 2013 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg; KMMA • -1♀ +1♀ ; Calavi; -Jan 2014 +Jan 2014 ; -G. Goergen +G. Goergen leg.; KMMA • 1 M; Calavi; -Mar 2000 +Mar 2000 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; Calavi; -17 Jul 2015 +17 Jul 2015 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; Calavi; -Oct 2015 +Oct 2015 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; Cotonou; -Dec 2003 +Dec 2003 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -2♀♀ +1♂ +2♀♀ ; Cotonou; -14 Dec 2013 +14 Dec 2013 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • -4♀♀ +4♀♀ ; Cotonou; -28 Jan 2016 +28 Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; Cotonou; -1 May 1989 +1 May 1989 ; -G.G.M. Schulten +G.G.M. Schulten leg.; RMNH • -1♂ +1♂ ; -Lama Forest +Lama Forest ; -23 Jan 1995 +23 Jan 1995 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; -Lama Forest +Lama Forest ; -26 Jul 1995 +26 Jul 1995 ; -G. Goergen +G. Goergen leg.; IITA • -2♀♀ +2♀♀ ; -Lama Forest +Lama Forest ; -23 Jun 1995 +23 Jun 1995 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; Niaouli; -2 Feb 2014 +2 Feb 2014 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -1♀ +1♂ +1♀ ; -Pobe +Pobe ; -27 Jan 2016 +27 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -1♀ +1♂ +1♀ ; Porto Novo; -27 Jan 2016 +27 Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; -Seme +Seme ; -7 Feb 2016 +7 Feb 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; Tanougou Waterfalls; -Nov 2016 +Nov 2016 ; -G. Goergen +G. Goergen leg.; KMMA. -Cameroon +Cameroon • -20♂ -20♀ +20♂ +20♀ ; Maroua, Meskina; -23 May 2018 +23 May 2018 ; - + M. -Azo'o +Azo'o Ela leg.; MAPC • -1♂ +1♂ ; Kribi, -Lobe Falls +Lobe Falls ; -22 May 2006 +22 May 2006 ; -A. Ssymank +A. Ssymank leg.; ASPC • -1♂ +1♂ ; Victoria; -5-18 Nov 1975 +5-18 Nov 1975 ; -W. Schacht +W. Schacht leg.; RMNH. -Ghana +Ghana • -1♂ +1♂ ; Japi; -Nov 1915 +Nov 1915 ; -J.J. Simpson +J.J. Simpson leg.; NHMUK • -1♀ +1♀ ; Tamale; -Nov 1915 +Nov 1915 ; -J.J. Simpson +J.J. Simpson leg.; NHMUK • -9♂♂ +9♂♂ ; Tamale; -Nov 1916 +Nov 1916 ; -J.J. Simpson +J.J. Simpson leg.; NHMUK. -Malawi +Malawi • -1♀ +1♀ ; -Mulanje +Mulanje Mountain; -12-14 Dec 2016 +12-14 Dec 2016 ; -K. Jordaens +K. Jordaens leg.; KMMA. Mali • -1♂ -2♀♀ +1♂ +2♀♀ ; Kogoni; -Aug 1983 +Aug 1983 ; -B. Sidibe +B. Sidibe leg.; NHMUK. -Nigeria +Nigeria • -1♂ +1♂ ; Samaru; -7-14 Jul 1970 +7-14 Jul 1970 ; -P.H. Ward +P.H. Ward leg.; NHMUK. -South Africa +South Africa • -1♂ +1♂ ; -Dukuduku Forest Reserve +Dukuduku Forest Reserve ; -16-17 Jul 1981 +16-17 Jul 1981 ; -J.G.H. Londt +J.G.H. Londt and -K. Craddock +K. Craddock leg.; NMSA. -Senegal +Senegal • -3♀♀ +3♀♀ ; -Dassilame -Serere +Dassilame +Serere ; -30 Nov 2011 +30 Nov 2011 ; - + S. -Cavailles +Cavailles leg.; SCPC • -1♀ +1♀ ; Dindefelo; -5 Nov 2016 +5 Nov 2016 ; - + S. -Cavailles +Cavailles and -R. Bou +R. Bou leg.; SCPC. -Togo +Togo • -1♂ +1♂ ; Marais -d'Asrama +d'Asrama ; -8 Apr 2008 +8 Apr 2008 ; -A. Ssymank +A. Ssymank leg.; MZH • -1♀ +1♀ ; -Kloto Forest +Kloto Forest ; -Nov 2016 +Nov 2016 ; -G. Goergen +G. Goergen leg.; KMMA. -Zambia +Zambia • -1♂ +1♂ ; Chilanga; -8 Sep 1913 +8 Sep 1913 ; -R.C. Wood +R.C. Wood leg.; NHMUK • -1♂ +1♂ ; -Chilanga +Chilanga ; -2 Jan 1914 +2 Jan 1914 ; -R.C. Wood +R.C. Wood leg.; NHMUK . - + (Morphotype with low spine on metatibia; see Variation, comments and discussion). - -Ghana + +Ghana • -9♂♂ +9♂♂ ; -Tamale +Tamale ; -Nov 1916 +Nov 1916 ; -J.J. Simpson +J.J. Simpson leg.; NHMUK. -Nigeria +Nigeria • -1♂ +1♂ ; Samaru; -7-14 Jul 1970 +7-14 Jul 1970 ; -P.H. Ward +P.H. Ward leg.; NHMUK. -Zambia +Zambia • -1♂ +1♂ ; -Chilanga +Chilanga ; -2 Jan 1914 +2 Jan 1914 ; -R.C. Wood +R.C. Wood leg.; NHMUK . - -Re-description of male - - + +Re-description of male + + (Figs -4 +4 - -6 +6 ). Body length: 12.1-13.8 mm. Wing length: 8.2-10.0 mm. - -Head + +Head (Figs -47-49 +47-49 ). Eyes bare; slightly dichoptic, distance between eyes approx. the width of ocellus. Face white with dark medial vitta; white pollinose; white pilose. Frontal triangle white; white pilose; white pollinose. Vertical triangle black pilose in ventral half and at ocellar triangle, yellow pilose on vertex; yellow pollinose until just before anterior ocellus; distance between lateral ocellus and eye margin less than 1/2 width of ocellus. Frontal prominence shiny black. Occiput yellow; yellow and white pollinose; yellow pilose. Antenna black, antennal arista reddish-brown. - - -Figures 3, 4. - -Mesembrius + + +Figures 3, 4. + +Mesembrius spp., habitus, lateral view -3 - -M. arcuatus +3 + +M. arcuatus sp. nov. (♂) -4 - -M. caffer +4 + +M. caffer (Loew) (nominal morph) (♂). - -Thorax. + +Thorax. Scutum black with only vague grey pollinose pair of vittae; yellow to rufous pilose. Scutellum uniformly yellow-brown; yellow pilose. - - -Figures 5, 6. - -Mesembrius + + +Figures 5, 6. + +Mesembrius spp., habitus, lateral view -5 - -M. caffer +5 + +M. caffer (Loew) (spined morph) (♂) -6 - -M. ctenifer +6 + +M. ctenifer Hull syn. nov. (♀). - -Legs. + +Legs. Proleg: Femur without apical pile brush; black; pile long, yellow, ventrally of equal size over entire length; without black pile. Tibia yellow in proximal half, black in distal half; with long, yellow pile. Tarsi dark brown; black pilose dorsally; orange pilose ventrally with some thick black pile, especially posteroventrally. Mesoleg (Figs -178 +178 , -182 +182 ): Femur dark brown to black; long yellow pilose, but short black pilose on dorsal distal 1/3. Tibia yellow, distally darkened; long yellow pilose, but with black pile interspersed in distal half. Tarsi dark brown; black pilose, with some yellow pile interspersed on basitarsus. Metaleg (Figs -195 +195 , -196 +196 ): Femur dark brown to black; bare in anteroventral and ventral proximal 1/4, posteroventral proximal 1/4 with thicker pile varying from entirely yellow (as in Fig. -195 +195 : red arrow) to entirely black (as in Fig. -196 +196 : red arrow); otherwise with long and thin yellow pile interspersed with shorter black pile ventrally. Tibia black; long yellow and black pilose; distal end variable: either with (as in Fig. -196 +196 ; referred to as spined morph) or without (as in Fig. -195 +195 ; referred to as nominal morph) a tooth-like projection ( -"spine" +"spine" ) at the ventral distal end; unmodified, but with two shallow depressions on posterior side; long yellow pilose on anterior and dorsal side, black pilose on posterior and ventral side. Basitarsus long, as long as tarsomeres 2+3; dark brown; black pilose. Other tarsi dark brown; black pilose. - - -Figures 7, 8. - -Mesembrius + + +Figures 7, 8. + +Mesembrius spp., habitus, lateral view -7 - -M. capensis +7 + +M. capensis (Macquart) (♂) -8 - -M. chapini +8 + +M. chapini Curran (♂). - -Wing + +Wing (Fig. -128 +128 ). Entire wing uniformly dense microtrichose. - - -Figures 9, 10. - -Mesembrius + + +Figures 9, 10. + +Mesembrius spp., habitus, lateral view -9 - -M. copelandi +9 + +M. copelandi sp. nov. (♂). 10. - -M. cyanipennis + +M. cyanipennis (Bezzi) (♂). - -Abdomen + +Abdomen (Figs -84-86 +84-86 ). Tergite II with a pair of very large, yellow rounded maculae; black marking hourglass-shaped; posterior black marking sometimes nearly absent (as in Fig. -85 +85 ), if present, then narrower than anterior black marking; with short, stiff black setulae which do not extend to the lateral margins. Tergite III and IV with yellow fascia of variable size, often occupying almost the entire tergite, but sometimes strongly reduced; Tergite V strongly white pollinose, except for a black medial zone; with short, black stiff pile posteriorly which does not reach the lateral tergal sides. - - -Figures 11, 12. - -Mesembrius + + +Figures 11, 12. + +Mesembrius spp., habitus, lateral view -11 - -M. ingratus +11 + +M. ingratus (Loew) (♂) -12 - -M. longipilosus +12 + +M. longipilosus sp. nov. (♂). - -Genitalia + +Genitalia (Figs -206-208 +206-208 ). Epandrium: Dorsal lobe of surstylus somewhat elongated, broadly rounded; with short, black spines on almost entire surface; dorsally long yellow pilose. Ventral lobe of surstylus straight without conspicuous pilosity. - - -Figures 13, 14. - -Mesembrius + + +Figures 13, 14. + +Mesembrius spp., habitus, lateral view -13 - -M. madagascariensis +13 + +M. madagascariensis Keiser (♂) -14 - -M. minor +14 + +M. minor (Bezzi) (♂). - -Variation. -Males of this species are highly variable in their morphology. Some males (spined morph) have a tooth-like projection (spine) on the distal ventral end of the metatibia and the pile on the posterventral distal end of the metafemur is predominantly black. The nominal morph does not have a tooth-like projection (spine) on the distal ventral end of the metatibia and the pile on the posterventral distal end of the metafemur is predominantly yellow. We found 11 males from Zambia, Nigeria and Ghana with a very low spine on the distal ventral end of the metatibia; some of these had a broad, yellow fascia on tergite II, while others had a pair of large, yellow maculae on tergite II. - - -Figures 15, 16. - -Mesembrius + +Variation. +Males of this species are highly variable in their morphology. Some males (spined morph) have a tooth-like projection (spine) on the distal ventral end of the metatibia and the pile on the posterventral distal end of the metafemur is predominantly black. The nominal morph does not have a tooth-like projection (spine) on the distal ventral end of the metatibia and the pile on the posterventral distal end of the metafemur is predominantly yellow. We found 11 males from Zambia, Nigeria and Ghana with a very low spine on the distal ventral end of the metatibia; some of these had a broad, yellow fascia on tergite II, while others had a pair of large, yellow maculae on tergite II. + + +Figures 15, 16. + +Mesembrius spp., habitus, lateral view -15 - -M. nigriceps +15 + +M. nigriceps Curran (♂) -16 - -M. perforatus +16 + +M. perforatus (Speiser) (♂). - - -Figures 17, 18. - -Mesembrius + + +Figures 17, 18. + +Mesembrius spp., habitus, lateral view -17 - -M. platytarsis +17 + +M. platytarsis Curran syn. nov. (♂) -18 - -M. regulus +18 + +M. regulus (Hull) (♂). - - -Figures 19, 20. -19 - -Mesembrius + + +Figures 19, 20. +19 + +Mesembrius spp., habitus, lateral view. - -M. rex + +M. rex Curran (♂) -20 - -M. senegalensis +20 + +M. senegalensis (Macquart) (♂). - -Re-description of female - - + +Re-description of female + + (Figs -27 +27 - -29 +29 ). Body length: 12.5-15.0 mm. Wing length: 10.1-10.3 mm. - - -Head + + +Head . Eyes bare; dichoptic. Face white with dark medial vitta; white pilose, white pollinose. Frons black on dorsal 2/5, yellow-white on ventral 3/5; black pilose on ocellar triangle and just ventrally of ocellar triangle, otherwise white pilose; pollinosity variable, but mostly strongly white pollinose on ventral 3/5. Distance between lateral ocellus and eye margin approx. width of ocellus. Occiput yellow-white; yellow-white pilose; yellow-white pollinose. Frontal prominence shiny black; antenna dark brown to black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum dark brown with one pair of dorsolateral yellow pollinose vittae which are connected posteriorly and with lateral, yellow pollinose vitta; yellow pilose. Scutellum yellow-orange; yellow pilose. - -Legs. + +Legs. Proleg: Femur black, distal end orange-brown; yellow pilose, short, black pilose on dorsal distal end. Tibia orange-brown in proximal 2/3, dark brown to black in distal 1/3; yellow pilose with thicker black pile interspersed on ventral side. Tarsi orange-brown; black pilose dorsally, yellow pilose ventrally. Mesoleg: Femur black; yellow-white pilose. Tibia orange-brown in proximal half, darkened in distal half; yellow-white pilose, with some shorter and thicker black pile ventrally, especially in distal half. Tarsi black; black pilose ventrally and dorsally, yellow pilose on posterior and anterior side. Metaleg: Femur black; yellow-white pilose with shorter and thicker black pile on ventral distal half. Tibia black; yellow-white pilose with some black pile interspersed ventrally. Tarsi black; short black pilose dorsally; densely yellow-orange pilose ventrally. In some specimens from Benin, the metafemur and metatibia is brown (but not as light as in - -M. senegalensis + +M. senegalensis ) and without the interspersed black pile ventrally. - -Wing. + +Wing. Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Figs -107-109 +107-109 ). Tergite II with a pair of very large, rounded yellow-orange maculae (Figs -107 +107 , -109 +109 ; nominal morph) or with a yellow-orange fascia (Fig. -108 +108 ; spined morph); yellow pilose on maculae, yellow and black pilose on hourglass-shaped black marking. Tergite III with broad (approx. 3/5 of tergal length in medial section), yellow-orange fascia, with posterior black marking; yellow pilose on fascia, predominantly black pilose on black marking and just anterior of black marking. Tergite IV with narrower yellow-orange fascia (approx. 1/3 of tergal length in medial section); yellow pilose on fascia, yellow and black pilose on black marking. Tergite V black; yellow pilose. - -Variation. -The females also show substantial variation in their morphology. Females of the spined morph have a broad yellow-orange fascia on tergite II, whereas females of the nominal morph have one pair of large, yellow-orange maculae. Females are variable in the colour of the legs (varying from brown to black) and the abdominal pattern, with some females almost entirely lacking black abdominal markings. Especially the extent of the black markings is variable. In some specimens from Benin, the black markings were very vague so that specimens had an almost yellow-orange abdomen. + +Variation. +The females also show substantial variation in their morphology. Females of the spined morph have a broad yellow-orange fascia on tergite II, whereas females of the nominal morph have one pair of large, yellow-orange maculae. Females are variable in the colour of the legs (varying from brown to black) and the abdominal pattern, with some females almost entirely lacking black abdominal markings. Especially the extent of the black markings is variable. In some specimens from Benin, the black markings were very vague so that specimens had an almost yellow-orange abdomen. - -Distribution. - -'Arabia' + +Distribution. + +'Arabia' , Benin, Burundi, Cameroon, Democratic Republic of the Congo, Ethiopia, Ghana, Kenya, Liberia, Madagascar, Malawi, Mali, Mozambique, Nigeria, Senegal, South Africa, Tanzania, Togo, Uganda, Zambia and Zimbabwe. - -Comments. - + +Comments. + The male syntype of - -M. caffer + +M. caffer (Loew, 1858) (designated here as lectotype) and the male holotype of - -M. ctenifer + +M. ctenifer Hull, 1941 are similar. According to -Hull (1941) +Hull (1941) , - -M. ctenifer + +M. ctenifer is differentiated from any other - -Mesembrius + +Mesembrius species by the broad oval metabasitarsus and the black comb-like patch of black setae on the metatibia. Yet, these characters are shared with - -M. caffer + +M. caffer , a species which was not mentioned in -Hull (1941) +Hull (1941) . DNA barcoding does not differentiate between - -M. caffer + +M. caffer and presumed specimens of - -M. ctenifer + +M. ctenifer (i.e. from Madagascar and identified as such by others). Male genital morphology neither differentiates between - -M. caffer + +M. caffer and presumed - -M. ctenifer + +M. ctenifer males (compare Fig. -206 +206 with Fig. -207 +207 ). Thus, we conclude that both are conspecific and that - -M. ctenifer + +M. ctenifer Hull, 1941 is a junior synonym of - -M. caffer + +M. caffer (Loew, 1858). According to -Hull (1941) +Hull (1941) , a female allotype is deposited at the ANSP, but the specimen could not be found. - + Apart from the differences outlined above, males and females of both morphs are similar in morphology and male genitalia of both morphotypes are similar as well (compare Fig. -206 +206 with Fig. -207 +207 ). DNA barcoding does not differentiate both morphs (both morphotypes even share haplotypes). For the time being, we consider the morphological difference between the nominal and spined morph as intraspecific variation. - + The species is widespread in the Afrotropical Region and has also been reported from -"Arabia" +"Arabia" (a male from Abu collected by C.G. Nurse; see examined material above). Arabia is the peninsular region, together with offshore islands, located in the extreme south-western corner of Asia. It is bounded by the Red Sea on the west and southwest, the Gulf of Aden on the south, the Arabian Sea on the south and southeast and the Gulf of Oman and the Persian Gulf on the east. It includes the modern coastal Arabian states of Yemen, Oman and the United Arab Emirates which, in a zoogeographical context, are part of the Afrotropical Region. However, we could not trace any reference of the collector of the specimen (C.G. Nurse) for the Afrotropical Region. Rather, C.G. Nurse has collected insects on Mount Abu, which is in Rajasthan (India) (see -Rosa et al. 2020 +Rosa et al. 2020 , for example) and it is thus likely that -"Abu" +"Abu" refers to Mount Abu and not a place in Arabia (which are usually also given as binomens, e.g. Abu-Dhabi). The occurrence of the species on the Arabian Peninsula is thus doubtful. In case the specimen is not mislabelled, then it means that - -M. caffer + +M. caffer also occurs in India. diff --git a/data/25/1C/35/251C351C606C5B46884DCE570E23B925.xml b/data/25/1C/35/251C351C606C5B46884DCE570E23B925.xml index 0e094894a06..9c1cbef327a 100644 --- a/data/25/1C/35/251C351C606C5B46884DCE570E23B925.xml +++ b/data/25/1C/35/251C351C606C5B46884DCE570E23B925.xml @@ -1,485 +1,485 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius rex Curran, 1927 -Figs 19 -, 39 -, 62 -, 77 -, 99 -, 120 -, 143 -, 154 -, 170 -, 184 -, 221 + + + +Mesembrius rex Curran, 1927 +Figs 19 +, 39 +, 62 +, 77 +, 99 +, 120 +, 143 +, 154 +, 170 +, 184 +, 221 - - -Mesembrius rex + + +Mesembrius rex Curran, 1927: 61. - -Mesembrius rex + +Mesembrius rex - -Curran (1939) +Curran (1939) : 10 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius rex + +Differential diagnosis. + + +Mesembrius rex males have an entirely black apical pile brush on the profemur, a metatibia with a row of> 10 short, widely spaced black spines (without spines or with dense pile in other species). The metatibia has one deep depression on the posterior side (three in - -M. perforatus + +M. perforatus ; none in - -M. tibialis + +M. tibialis ) which is not markedly bordered with long black pile (bordered with long black pile in - -M. chapini + +M. chapini and - -M. sulcus + +M. sulcus sp. nov.). Females have a frons which is black pilose on its entire length, except laterally. The female can be distinguished from the female of - -M. sulcus + +M. sulcus sp. nov. and - -M. tarsatus + +M. tarsatus by the colour of the tibiae (yellow-brown to chocolate-brown in - -M. rex + +M. rex ; black in - -M. sulcus + +M. sulcus sp. nov. and - -M. tarsatus + +M. tarsatus ), the absence of black pile on the ventral side of the pro- and mesotibia (present in - -M. regulus + +M. regulus and - -M. chapini + +M. chapini ). It also differs from - -M. regulus + +M. regulus by the concolourous protarsus and protibia (protarsus lighter than distal part of protibia in - -M. regulus + +M. regulus ) and wing cell r1 which is distinctly open (nearly closed in - -M. regulus + +M. regulus ). - -Examined material. - - -Mesembrius rex + +Examined material. + + +Mesembrius rex - + Curran: -Holotype +Holotype , male, " -Mesembrius +Mesembrius // TYPE // -Mesembrius rex -Curran +Mesembrius rex +Curran // No." " -Taken +Taken from -Bembex +Bembex " " -Stanleyville +Stanleyville , Cgo. // -25°10'E +25°10'E , -0°30'N +0°30'N // IV.7.1915" "Lang & Chapin // collectors" " -Stanleyville +Stanleyville // -Congo +Congo // -From Leg +From Leg of // -Type +Type [ -♂ +♂ ]" " -Mesembrius +Mesembrius // -Mesembrius rex +Mesembrius rex // det. -Curran +Curran // - -Det. C.H. Curran + +Det. C.H. Curran " [AMNH] [type studied from picture on website]. - -Other material - - -Democratic Republic of the Congo + +Other material + + +Democratic Republic of the Congo • -1♀ +1♀ ; -Bolongo +Bolongo ; -23 Jun 1936 +23 Jun 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • - -1♀ + +1♀ ; -Lulua +Lulua , -Kapanga +Kapanga ; -Nov 1928 +Nov 1928 ; -Walker +Walker leg.; KMMA • - -1♀ + +1♀ ; -Basoko +Basoko ; -Oct 1948 +Oct 1948 ; -P.L.G. Benoit +P.L.G. Benoit leg.; RMNH • - -1♂ + +1♂ ; -Eala +Eala ; -Oct 1935 +Oct 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; locality and date unknown; J. -Ghesquiere +Ghesquiere leg.; KBIN. - -Malawi + +Malawi • -1♀ +1♀ ; -Mount -Mulanje +Mount +Mulanje , -Likhubula +Likhubula ; -19 Nov 1912 +19 Nov 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♂ + +1♂ ; -Mount -Mulanje +Mount +Mulanje ; -25 Nov 1912 +25 Nov 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♀ + +1♀ ; -Mount -Mulanje +Mount +Mulanje ; -2 Dec 1912 +2 Dec 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♀ + +1♀ ; -Mount -Mulanje +Mount +Mulanje ; -16 Nov 1912 +16 Nov 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♀ + +1♀ ; -Mount -Mulanje +Mount +Mulanje ; -25 Nov 1912 +25 Nov 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK . - -Togo + +Togo • -1♀ +1♀ ; -Kloto Forest +Kloto Forest ; -Feb 2016 +Feb 2016 ; -G. Goergen +G. Goergen leg.; IITA . - -Uganda + +Uganda • -1♂ +1♂ ; W. shores of -Vic. Nyanza +Vic. Nyanza , -Buddu +Buddu ; -19-25 Sep 1911 +19-25 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♂ + +1♂ ; -Barada +Barada ; -16 Apr 1940 +16 Apr 1940 ; -B. Lebied +B. Lebied leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -11 Nov 1912 +11 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -2♂♂ + +2♂♂ ; -Entebbe +Entebbe ; -7 Oct 1971 +7 Oct 1971 ; -H. Falke +H. Falke leg.; CNC • -Country Unknown +Country Unknown • -1♀ +1♀ ; locality unknown; 1973; F.M. Hull leg.; CNC. - -Re-description male - - + +Re-description male + + (Fig. -19 +19 ). Body length: 14.3-17.0 mm. Wing length: 10.0-11.3 mm. - -Head + +Head (Fig. -62 +62 ). Eyes bare; holoptic, eye contiguity approximately as long as the length of the ocellar triangle. Face yellow with dark medial vitta; white pilose; white pollinose. Frontal triangle short, black, with a few long, black pile; white pollinose on dorsal half; vertical triangle black, black pilose, yellow pollinose on lower half. Distance between lateral ocellus and eye margin less than 1/2 width of ocellus. Frontal prominence shiny black with orange-brown apex. Occiput black; yellow pilose, with black pile interspersed dorsally; yellow and white pollinose. Antenna, scape and pedicel black; postpedicel brown; antennal arista orange-brown. - -Thorax. + +Thorax. Scutum black with, dorsally, one pair of grey pollinose vittae; lateral vitta faint, not well-demarcated; pile, especially on the anterior half yellow, but with some black pile interspersed; pile on posterior half very short. Scutellum black in anterior 1/3, brown in middle 1/3, white-yellow in posterior 1/3, with long yellow and shorter black pile. Metasternum with very long, strongly curved golden pile. - -Legs. + +Legs. Proleg (Fig. -154 +154 ): Femur black; dorsoventrally flattened; with an apical pile brush of long, black pile dorsally and long, yellow pile ventrally. Tibia orange-brown; with very long, yellow pile on anteroventral side. Basitarsus orange; with a tuft of orange pile on posterior side. Other tarsi very broad; orange; becoming shorter distally; most distal tarsal segment white. Mesoleg: Femur dark brown; with long yellow pile dorsally, except for black pile on dorsal 1/5. Tibia orange-brown; proximal half strongly compressed. Basitarsus orange-brown. Other tarsi dark brown. Metaleg (Fig. -184 +184 ): Coxa with long yellow pile on anteroventrally. Femur long and slender; chocolate-brown; ventrally with a row of> 10 short, widely spaced black spines in the proximal 2/3; with denser, black spines on posterior 1/3; pile otherwise yellow and loose. Tibia orange-brown; with a deep invagination in the proximal 1/3 posteriorly which is bordered with long, black pile ventrally; remainder of ventral side with dense, black pile. Tarsi orange-brown. - -Wing + +Wing (Fig. -143 +143 ). Entire wing uniformly dense microtrichose; brown infuscated in dorsal half. - -Abdomen + +Abdomen (Fig. -99 +99 ). Tergite II with a pair of large, yellow rounded maculae; black markings hourglass-shaped, white pollinose on posterior end; yellow and black pilose, but black pile more conspicuous in posterior part of black marking. Tergite III with broad yellow fascia and a triangular black marking on posterior half which is strongly white pollinose and covered with short, black spines; yellow pilose otherwise. Tergite IV with large triangular posterior black marking; otherwise yellow with strong white pollinosity. - -Genitalia + +Genitalia (Fig. -221 +221 ). Epandrium: Dorsal lobe of surstylus short, broadly rounded, with short, black spines on almost entire surface; long brown pilose dorsally. Ventral lobe of surstylus straight; bare. - -Description female - - + +Description female + + (Fig. -39 +39 ). Body length: 16.0-16.2 mm. Wing length: 11.2-12.5 mm. As - -M. regulus + +M. regulus , but with the following differences: Pro- and mesotibia yellow pilose, with only short black pile on posterior side of mesotibia; protarsus chocolate-brown, concolourous with protibia (Fig. -170 +170 ); wing cell r1 distinctly open. Abdomen (Fig. -120 +120 ) with orange pilosity somewhat more prominent. Head as in Fig. -77 +77 . - -Distribution. -Democratic Republic of the Congo, Malawi, Togo and Uganda. + +Distribution. +Democratic Republic of the Congo, Malawi, Togo and Uganda. - -Comments. -The male has a set of unambiguous character states mentioned in the original description and cannot be confused with any other species of the genus. The specimens we have studied correspond with the photographs of the type and are, therefore, considered to be conspecific. Until now, the species was only known from the male holotype. We here report on the first females, which we matched with the males through DNA barcoding. The species seems rare throughout a large part of the Afrotropical Region and seems absent from southern Africa. + +Comments. +The male has a set of unambiguous character states mentioned in the original description and cannot be confused with any other species of the genus. The specimens we have studied correspond with the photographs of the type and are, therefore, considered to be conspecific. Until now, the species was only known from the male holotype. We here report on the first females, which we matched with the males through DNA barcoding. The species seems rare throughout a large part of the Afrotropical Region and seems absent from southern Africa. \ No newline at end of file diff --git a/data/2B/80/D8/2B80D8D091985DA382C8F97213F40741.xml b/data/2B/80/D8/2B80D8D091985DA382C8F97213F40741.xml index 1aa653c545f..27220813ab9 100644 --- a/data/2B/80/D8/2B80D8D091985DA382C8F97213F40741.xml +++ b/data/2B/80/D8/2B80D8D091985DA382C8F97213F40741.xml @@ -1,611 +1,611 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius simplicipes Curran, 1929 -Figs 17 -, 21 -, 37 -, 41 -, 60 -, 64 -, 75 -, 79 -, 97 -, 101 -, 118 -, 122 -, 141 -, 145 -, 166-167 -, 193 -, 194 -, 219 -, 223 + + + +Mesembrius simplicipes Curran, 1929 +Figs 17 +, 21 +, 37 +, 41 +, 60 +, 64 +, 75 +, 79 +, 97 +, 101 +, 118 +, 122 +, 141 +, 145 +, 166-167 +, 193 +, 194 +, 219 +, 223 - - -Mesembrius simplicipes + + +Mesembrius simplicipes Curran, 1929: 500. - -Mesembrius simplicipes + +Mesembrius simplicipes - -Keiser (1971) +Keiser (1971) : 266 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Mesembrius platytarsis + +Mesembrius platytarsis Curran, 1929: 501. syn. nov. - -Mesembrius platytarsis + +Mesembrius platytarsis - -Hull (1941) +Hull (1941) : 330 - -Keiser (1971) +Keiser (1971) : 265 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius simplicipes + +Differential diagnosis. + + +Mesembrius simplicipes males lack an apical pile brush on the profemur which is dorsoventrally flattened. The pro- and mesolegs are orange and with a darker area on the dorsal side of the femur. The probasitarsus is laterally expanded and has some long orange pile. The large yellow maculae on the abdomen lack short, black spines on the posterior edges. Scutum and scutellum are entirely yellow pilose. The male of this species cannot be confused with any other species by the lateral lobe on the probasitarsus. Females have a nearly black abdomen with a pair of vague lateral maculae on tergites II and III. The female of - -M. simplicipes + +M. simplicipes can be distinguished from any other species (except from - -M. madagascariensis + +M. madagascariensis ) by the nearly black abdomen (clearly yellow to orange and black in other species). It can be distinguished from - -M. madagascariensis + +M. madagascariensis by the pro- and mesolegs which are reddish-brown (extensively brown and black in - -M. madagascariensis + +M. madagascariensis ). - -Examined material. - - -Mesembrius simplicipes + +Examined material. + + +Mesembrius simplicipes - + Curran: -Holotype +Holotype , male: " -Mesembrius +Mesembrius // TYPE // -Mesembrius simplicipes +Mesembrius simplicipes // Curran. // No." " -Mesembrius +Mesembrius // -Mesembrius simplicipes +Mesembrius simplicipes // Curran" " -Madagascar +Madagascar // Great Oriental // Forest" "California Academy // of Sciences // Type No. 11230" [CAS] [date and collector unknown; type studied from pictures]. - - -Mesembrius platytarsis + + +Mesembrius platytarsis - + Curran: -Holotype +Holotype , male: " -Mesembrius +Mesembrius // TYPE // -Mesembrius platytarsis +Mesembrius platytarsis // Curran. // No." " -Madagascar +Madagascar // Great Oriental // Forest" "California Academy // of Sciences // Type No. 11229" [CAS] [date and collector unknown; type studied from pictures]. - -Other material - - -Madagascar + +Other material + + +Madagascar • -2♀♀ +2♀♀ ; -Alaotra +Alaotra , -Station Agric. +Station Agric. ; -24 Dec 1957 +24 Dec 1957 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • - -1♀ + +1♀ ; -Analvony +Analvony ; -30 Mar 1958 +30 Mar 1958 ; -F. Keiser +F. Keiser leg.; NMB • - -1♂ + +1♂ ; -Antananarivo +Antananarivo ; -Nov 1952 +Nov 1952 ; -E.S. Brown +E.S. Brown leg.; NHMUK • - -1♂ + +1♂ ; -Antananarivo +Antananarivo ; -18 Oct 1957 +18 Oct 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Antananarivo +Antananarivo ; -13 Dec 1957 +13 Dec 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -2♀♀ + +2♀♀ ; -Antananarivo +Antananarivo ; -14 Dec 1957 +14 Dec 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -1♂ + +1♂ ; -Antananarivo +Antananarivo ; -6 Sep 1958 +6 Sep 1958 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Antananarivo +Antananarivo ; -8 Feb 1970 +8 Feb 1970 ; -L. and R. Blommers +L. and R. Blommers leg.; RMNH • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Ampefy +Ampefy , -Lake Kavitaha +Lake Kavitaha ; -25 Mar 1959 +25 Mar 1959 ; -F. Keiser +F. Keiser leg.; NMB • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Ampefy +Ampefy , -Lake Kavitaha +Lake Kavitaha ; -29 Mar 1959 +29 Mar 1959 ; -F. Keiser +F. Keiser leg.; NMB • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Parc Tsimbazaza +Parc Tsimbazaza ; -2 Feb 1968 +2 Feb 1968 ; -J.W. Boyes +J.W. Boyes leg.; CNC • - -1♀ + +1♀ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -14 Dec 1957 +14 Dec 1957 ; -F. Keiser +F. Keiser ; NMB • - -1♀ + +1♀ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -15-22 Oct 1993 +15-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; NHMUK • - -1♂ -1♀ + +1♂ +1♀ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CNC • - -2♂♂ + +2♂♂ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CAS • - -1♂ -1♀ + +1♂ +1♀ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; NMK • - -1♀ + +1♀ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -26 Oct 1993 +26 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CNC • - -1♀ + +1♀ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -26 Oct 1993 +26 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CAS • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -6 Nov 1993 +6 Nov 1993 ; -C. Kassebeer +C. Kassebeer leg.; CNC • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Park Tsimbazaza +Park Tsimbazaza ; -6 Nov 1993 +6 Nov 1993 ; -C. Kassebeer +C. Kassebeer leg.; NHMUK • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Perinet +Perinet ; -30 Sep 1957 +30 Sep 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Nosivola +Nosivola ; date and collector unknown; RMNH . - -Re-description male - - + +Re-description male + + (Figs -17 +17 , -21 +21 ). Body length: 12.7-13.4 mm. Wing length: 8.8-10.4 mm. - -Head + +Head (Figs -60 +60 , -64 +64 ). Eyes bare; holoptic, eye contiguity as long as length of ocellar triangle. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; strongly yellow pollinose before anterior ocellus. Lateral ocelli nearly touching eye margin. Occiput black, yellow pilose with a few very short, stiff black setulae near dorsal eye margin; strongly white pollinose. Frontal triangle black; black pilose; strongly yellow pollinose. Frontal prominence shiny reddish-black. Antenna, scape and pedicel very dark reddish-black; postpedicel black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black with dorsally a pair of yellow pollinose vittae which are less well demarcated posteriorly; with a lateral yellow pollinose vitta; yellow pilose. Scutellum uniformly yellow-brown; yellow pilose. - -Legs. + +Legs. Proleg (Figs -166 +166 , -167 +167 ): Femur dorsoventrally flattened; dorsally brown, except proximal 1/5 and distal end; otherwise orange; yellow pile on posteroventral side longer than black pile on posterodorsal side; with a patch of very short black stiff spines on proximal ventral 1/5; pile entirely yellow anteriorly. Tibia orange; with long orange pile, but pile black on ventral distal end. Basitarsus whitish; laterally expanded; with a tuft of orange pile on the expansion; ventrally with some thick stiff pile on the expansion. Other tarsi orange; with orange and black short pile. Mesoleg: Femur as proleg, but without the posterodorsal black pile. Tibia orange; yellow pilose, with some short stiff black pile on distal end ventrally. Tarsi orange; with short black pile and some short stiff black pile ventrally. Metaleg (Figs -193 +193 , -194 +194 ): Femur chocolate-brown, distal end orange; with loose yellow pile on proximal 1/2 to 2/3 and mostly black pilose on distal 1/3 to 1/2. Tibia orange; with short black pile. Metabasitarsus either deeply excavated anteriorly at proximal end and with a lobe (Fig. -193 +193 ) or unmodified (Fig. -194 +194 ); orange; black pilose. Other tarsi orange; dorsally black pilose, ventrally orange pilose. - -Wing + +Wing (Figs -141 +141 , -145 +145 ). Entire wing uniformly very dense microtrichose. - -Abdomen + +Abdomen (Figs -97 +97 , -101 +101 ). Tergite II with a pair of very large, yellow almost square maculae which expand into the anterolateral corners; black markings hourglass-shaped, posterior part reaching the lateral sides of the tergite; posterior part of black marking with some black pile in the centre which do not extend to the lateral tergite sides; otherwise yellow pilose. Tergite III with a yellow fascia which is almost interrupted by the medial broad black marking; the latter strongly white pollinose anteriorly; with a medial area of white pollinosity; posterior part of black marking with sparse black pile in the centre; yellow pilose otherwise. Tergite IV strongly white pollinose, except for a black medial area and a darker posterior border; yellow pilose. - -Genitalia + +Genitalia (Figs -219 +219 , -223 +223 ). Epandrium: Dorsal lobe of surstylus short, bent (as a boomerang); irregularly covered with short black spines which are denser at distal and proximal end and at dorsal bend. Ventral lobe of surstylus straight; bare. - -Re-description female - - + +Re-description female + + (Figs -37 +37 , -41 +41 ). Body length: 14.2-14.9 mm. Wing length: 10.0-10.6 mm. - -Head + +Head (Figs -75 +75 , -79 +79 ). Eyes bare; dichoptic. Face yellow-white with dark medial vitta; white pilose, white pollinose. Frons black in dorsal half and medial part of ventral half, yellow-white on lateral parts of ventral half; black pilose on black parts, white pilose on yellow-white parts. Distance between lateral ocellus and eye margin approx. width of ocellus. Occiput yellow-white; yellow-white pilose; yellow-white pollinose. Frontal prominence shiny black, orange-brown at distal end; scape black; pedicel orange-brown; postpedicel black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum dark brown with one pair of dorsolateral yellow-white pollinose vittae which are vaguely connected posteriorly; with lateral, yellow-white pollinose vitta; short yellow pilose on anterior half, short yellow and black pilose on posterior half. Scutellum yellow-orange; yellow pilose with shorter, black pile interspersed in posterior half. - -Legs. + +Legs. Proleg: Femur orange brown with darker, central area on dorsal side; yellow-white pilose with black pile on posterodorsal side and posteroventral distal half. Tibia orange, slightly darkened on ventral distal end; yellow-white pilose. Tarsi orange-brown; basitarsus and second tarsomere yellow-white pilose, other tarsi yellow-white and black pilose. Femur orange brown with darker, central area on dorsal side; yellow-white pilose with black pile on ventral distal half. Tibia orange-brown; yellow-white pilose, with some short, thick black pile at ventral distal end. Basitarsus orange; yellow-white pilose, with short, thick black pile on ventral side. Other tarsi orange-brown; yellow-white and black pilose; with short, thick black pile ventrally, except on most distal tarsomere. Metaleg: Femur dark brown to black, reddish-brown at distal end; yellow-white pilose with shorter and thicker black pile on anteroventral and ventral distal 1/2. Tibia orange-brown; yellow-white and black pilose. Tarsi orange-brown; black and yellow-white pilose dorsally, yellow-orange pilose ventrally. - -Wing. + +Wing. Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Figs -118 +118 , -122 +122 ). Tergite II with a pair of large orange maculae; with an anterior and posterior black marking which are connected with a parallel-sided central black marking which is 1/5 the tergite width; yellow pilose on maculae and on anterior and central black marking, black pilose on posterior black marking; white pollinose on posterior black marking. Tergite III with orange fascia (approx. 1/2 of tergal length laterally; approx. 1/8 in medially); with posterior large black marking; yellow pilose on most of the orange fascia, black pilose on black marking and central area of orange fascia; strongly white pollinose on posterior half and medial anterior part. Tergite IV similar, but without orange fascia. Tergite V orange-brown with darker lateral sides; yellow-white pilose; white pollinose in anterolateral corners. - -Distribution. -Madagascar. + +Distribution. +Madagascar. - -Comments. - + +Comments. + Morphologically, the species is similar to - -M. platytarsis + +M. platytarsis syn. nov. Males of both species differ in the presence ( - -M. platytarsis + +M. platytarsis syn. nov.) or absence ( - -M. simplicipes + +M. simplicipes ) of a large lobe on the anterior side of the metabasitarsus. Male genitalia are also very similar (compare Fig. -219 +219 with Fig. -223 +223 ). Females are morphologically similar as well and the supposed difference in the extent of black pile amongst the yellow pile on the frons is unreliable. The mean interspecific -p +p -distance between both species is very low (0.02%) and of what is usually as observed within species. Both species have been described from the same locality, i.e. the Eastern Forest of Madagascar. -Keiser (1971) +Keiser (1971) also noted that both taxa often co-occur. We, therefore, consider the presence or absence of the lobe on the anterior side of the metabasitarsus in the male as a polymorphism and consider - -M. platytarsis + +M. platytarsis Curran, 1929 a junior synonym of - -M. simplicipes + +M. simplicipes Curran, 1929. diff --git a/data/2D/27/B6/2D27B621B82A5446BA6D65C5ACCF7564.xml b/data/2D/27/B6/2D27B621B82A5446BA6D65C5ACCF7564.xml index ce0254e5712..27a25dcad65 100644 --- a/data/2D/27/B6/2D27B621B82A5446BA6D65C5ACCF7564.xml +++ b/data/2D/27/B6/2D27B621B82A5446BA6D65C5ACCF7564.xml @@ -1,452 +1,452 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - - -Mesembrius vockerothi Jordaens, Goergen & De Meyer -sp. nov. -Figs 26 -, 45 -, 69 -, 82 -, 106 -, 126 -, 150 -, 228 + + + + +Mesembrius vockerothi Jordaens, Goergen & De Meyer +sp. nov. +Figs 26 +, 45 +, 69 +, 82 +, 106 +, 126 +, 150 +, 228 - -Differential diagnosis. - - -Mesembrius vockerothi + +Differential diagnosis. + + +Mesembrius vockerothi sp. nov. is the smallest of the - -Mesembrius + +Mesembrius species. Males lack an apical pile brush on the profemur, have an unmodified metatibia and are dichoptic and the face is markedly conical. It can be distinguished from the male of other species by its smaller size and the conical face. The yellow pile on the mesotarsomeres is inconspicuous (very prominent on all tarsomeres in - -M. capensis + +M. capensis ) and the scutellum is yellow pilose with short black pile interspersed on its entire surface (yellow pilose only in both morphotypes of - -M. caffer + +M. caffer , - -M. capensis + +M. capensis , - -M. minor + +M. minor and - -M. senegalensis + +M. senegalensis ; yellow pilose with black pile in posterior half in - -M. strigilatus + +M. strigilatus ). Females have a frons which is pale pilose on the ventral half. It can be distinguished from the female of other species by its smaller size and the conical face. The pro- and metafemur are dark brown to black (yellow-brown in - -M. senegalensis + +M. senegalensis ). Tergite II has a pair of yellow maculae (fascia in - -M. capensis + +M. capensis and spined morph of - -M. caffer + +M. caffer ) and the black posterior marking extends to the lateral margins (not so in - -M. minor + +M. minor ). The metafemur has no ventral swelling in the middle (present in - -M. minor + +M. minor ). The pro- and mesotarsi are uniformly dark brown (brown with a darker medial part in - -M. minor + +M. minor ). The posteroventral side of the metafemur has short black setae at distal 1/2 to 1/3 (only at distal 1/6 in the nominal morph of - -M. caffer + +M. caffer and in - -M. strigilatus + +M. strigilatus ). - -Examined material. - - -Mesembrius vockerothi + +Examined material. + + +Mesembrius vockerothi - -Jordaens + +Jordaens , Goergen & De Meyer: -Holotype +Holotype , male," " -UGANDA +UGANDA : // -Kampala +Kampala , // -12.xii.1934 +12.xii.1934 , // -F.W. Edwards. +F.W. Edwards. //B.M. 1935-203." - + " -HOLOTYPUS +HOLOTYPUS " " -Mesembrius vockerothi +Mesembrius vockerothi // Jordaens & De Meyer 2019" " NHMUK 010369964" [NHMUK]. - - - - -Paratypes + + + + +Paratypes : -Democratic Republic of the Congo +Democratic Republic of the Congo • -1♀ +1♀ ; -Kalembelembe +Kalembelembe , -Baraka +Baraka ; -Jul 1918 +Jul 1918 ; - + R. -Mayne +Mayne leg.; RMNH • - -1♀ + +1♀ ; -North-Kivu +North-Kivu , -Beni -a -Lesse +Beni +a +Lesse ; -Jul 1911 +Jul 1911 ; -Murtula +Murtula leg.; KMMA . - -Kenya + +Kenya • -1♂ +1♂ ; -Jinja +Jinja ; -Oct 1930 +Oct 1930 ; -van Someren +van Someren leg.; NHMUK • - -1♀ + +1♀ ; -Nyeri +Nyeri ; -Oct 1948 +Oct 1948 ; -van Someren +van Someren leg.; NHMUK . - -Uganda + +Uganda • -1♂ -1♀ +1♂ +1♀ ; -Entebbe +Entebbe ; -17 Aug 1911 +17 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -2♂♂ + +2♂♂ ; -Entebbe +Entebbe ; -9 Nov 1971 +9 Nov 1971 ; -H. Falke +H. Falke leg.; CNC • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -5 Jan 1972 +5 Jan 1972 ; -H. Falke +H. Falke leg.; CNC • - -1♀ + +1♀ ; -Kampala +Kampala ; -12-20 Mar 1918 +12-20 Mar 1918 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -3♂♂ + +3♂♂ ; -Kampala +Kampala ; -12 Dec 1934 +12 Dec 1934 ; -F.W. Edwards +F.W. Edwards leg.; NHMUK • - -1♂ -1♀ + +1♂ +1♀ ; -Namanue +Namanue ; -13 Dec 1934 +13 Dec 1934 ; -J. Ford +J. Ford leg.; NHMUK • - -1♀ + +1♀ ; -Tero Forest +Tero Forest ; -26-30 Sep 1911 +26-30 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♀ + +1♀ ; -Unyoro District +Unyoro District ; -C.H. Marshall +C.H. Marshall leg.; NMSA • - -1♀ + +1♀ ; -Central Region +Central Region , -Wakiso District +Wakiso District , -Mabamba Swamp +Mabamba Swamp ; -16 Dec 2018 +16 Dec 2018 ; - + G. -Stahls +Stahls leg.; MZH . - -Other material - -1♀ + +Other material + +1♀ with locality and date unknown, D. Bruce leg. (NHMUK). - -Description male - - + +Description male + + (Fig. -26 +26 ). Body length: 11.0-13.2 mm. Wing length: 9.6-10.5 mm. - -Head + +Head (Fig. -69 +69 ). Eyes dichoptic; distance between eyes approx. the width of anterior ocellus. Face conical; white with dark medial vitta; white pilose. Vertical triangle black; black pilose; yellow pollinose on ventral half. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Occiput yellow; yellow pilose; yellow and white pollinose. Frontal triangle short; yellow-white; with long, black pile medially, yellow pilose on gena; yellow pollinose. Frontal prominence shiny dark brown to black. Antenna dark brown, antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black with, dorsally, a pair of well-demarcated white pollinose vittae which are connected posteriorly; lateral white pollinose vitta clear; yellow pilose. Scutellum yellow-brown; yellow pilose with shorter black pile interspersed on its entire surface. - -Legs. + +Legs. All femora dark brown to black, except for extreme distal ends which are orange-brown; femora yellow to orange. Pro- and mesoleg: Femur with black pile on anterior and dorsal side and with longer yellow pile on posterior and posterodorsal sides. Tarsi yellow to orange. Metaleg: Femur with long and thin yellow pile; with black pile ventrally on distal half. Tibia with yellow and black pile, of which the yellow pile is longer on posterodorsal side. Metatibia unmodified. Metatarsi dark brown. - -Wing + +Wing (Fig. -150 +150 ). Entire wing uniformly very dense microtrichose. - -Abdomen + +Abdomen (Fig. -106 +106 ). Tergite II with a pair of very large yellow-orange, rounded maculae; black marking hourglass-shaped; posterior black marking equal in size to anterior black marking and with a medial white pollinose area; yellow pilose, but black pilose on posterior half of black marking. Tergite III with a pair of large yellow-orange maculae; with large black marking on posterior 2/3; yellow pilose on maculae, black pilose on black marking. Tergite IV black, with a pair of small yellow maculae in anterolateral corners; white pilose and strongly white pollinose on anterior and lateral parts; predominantly black pilose on black marking. - -Genitalia + +Genitalia (Fig. -228 +228 ). Epandrium: Dorsal lobe of surstylus distally broadly rounded, with characteristic large tooth-like projection; entirely pilose, except on tooth and at basis (stalk). Ventral lobe of surstylus with one large black setula in middle section and a row of 4-5 long black setulae. - -Description female - - + +Description female + + (Fig. -45 +45 ). Body length: 14.0-15.1 mm. Wing length: 9.7-10.3 mm. - + As male, except for the following character states: Eyes dichoptic (Fig. -82 +82 ). Frons white pilose, brown pilose on ocellar triangle and surrounding area; strongly white pollinose to just before ocellar triangle. Pile on legs shorter. Abdomen as in Fig. -126 +126 . - -Distribution. -Democratic Republic of the Congo, Kenya and Uganda. + +Distribution. +Democratic Republic of the Congo, Kenya and Uganda. - -Comments. - + +Comments. + This is a new species and the smallest in size of all Afrotropical - -Mesembrius + +Mesembrius hitherto known. It is the only Afrotropical - -Mesembrius + +Mesembrius species with a conical face. - -Etymology. -Named in honour of the Dipterist Dick Vockeroth (1928-2012), who already indicated on the labels that some specimens from Uganda probably belonged to a new species. The specific epithet should be treated as a noun in the genitive case. + +Etymology. +Named in honour of the Dipterist Dick Vockeroth (1928-2012), who already indicated on the labels that some specimens from Uganda probably belonged to a new species. The specific epithet should be treated as a noun in the genitive case. diff --git a/data/30/9F/29/309F29534676C3D7EBFE94F68F01B3DE.xml b/data/30/9F/29/309F29534676C3D7EBFE94F68F01B3DE.xml index d72323b35a7..5fa7492000e 100644 --- a/data/30/9F/29/309F29534676C3D7EBFE94F68F01B3DE.xml +++ b/data/30/9F/29/309F29534676C3D7EBFE94F68F01B3DE.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus morio Burmeister, 1847 + + + +Peltonotus morio Burmeister, 1847 Figs 12, 24, 65, 80, 92 - -Diagnosis (male and female). -Length 14.0-18.0 mm, color overall black or castaneous, elytra black or castaneous and shining (Fig. 12), head with unisetigerous punctures, labrum weakly sinuate (Fig. 24), mentum quadrate in apical half, labial palpomere 2 not enlarged and not dorsoventrally flattened, mala lacking lamellate setal brush, maxillary stipes without setae curled at apices, male protibia tridentate with basal tooth weakly developed, form of male parameres (Fig. 65), female epipleuron weakly, quadrately incised (Fig. 80) and with moderately developed dorsal pillow. + +Diagnosis (male and female). +Length 14.0-18.0 mm, color overall black or castaneous, elytra black or castaneous and shining (Fig. 12), head with unisetigerous punctures, labrum weakly sinuate (Fig. 24), mentum quadrate in apical half, labial palpomere 2 not enlarged and not dorsoventrally flattened, mala lacking lamellate setal brush, maxillary stipes without setae curled at apices, male protibia tridentate with basal tooth weakly developed, form of male parameres (Fig. 65), female epipleuron weakly, quadrately incised (Fig. 80) and with moderately developed dorsal pillow. - -Distribution -(Fig. 92). Bhutan, India (northeastern), Myanmar, Nepal, Thailand, Vietnam. + +Distribution +(Fig. 92). Bhutan, India (northeastern), Myanmar, Nepal, Thailand, Vietnam. \ No newline at end of file diff --git a/data/40/94/14/4094143C88D8CD39A16DCAFAA89D501F.xml b/data/40/94/14/4094143C88D8CD39A16DCAFAA89D501F.xml index 179eafdcd4e..10bcb3b4ca4 100644 --- a/data/40/94/14/4094143C88D8CD39A16DCAFAA89D501F.xml +++ b/data/40/94/14/4094143C88D8CD39A16DCAFAA89D501F.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus talangensis Jameson & Jakl, 2010 + + + +Peltonotus talangensis Jameson & Jakl, 2010 Figs 16, 35, 43, 48, 71, 89 - -Diagnosis (male and female). -Length 14.1-15.2 mm, color overall castaneous, elytra castaneous or with weak reddish tones and lacking iridescent bloom (Fig. 16), head with some punctures unisetigerous, labrum bi-emarginate, mentum triangular in apical half (Fig. 35), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 35), mala with lamellate setal brush (Fig. 43), maxillary stipes without setae curled at apices (Fig. 43), male protibia tridentate (Fig. 48), form of parameres (Fig. 71), female epipleuron simple, not incised (Fig. 89). + +Diagnosis (male and female). +Length 14.1-15.2 mm, color overall castaneous, elytra castaneous or with weak reddish tones and lacking iridescent bloom (Fig. 16), head with some punctures unisetigerous, labrum bi-emarginate, mentum triangular in apical half (Fig. 35), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 35), mala with lamellate setal brush (Fig. 43), maxillary stipes without setae curled at apices (Fig. 43), male protibia tridentate (Fig. 48), form of parameres (Fig. 71), female epipleuron simple, not incised (Fig. 89). - -Distribution. -Indonesia, Sumatra Island. + +Distribution. +Indonesia, Sumatra Island. \ No newline at end of file diff --git a/data/42/41/90/42419061EB17690A2570C5DEBAC110C9.xml b/data/42/41/90/42419061EB17690A2570C5DEBAC110C9.xml index 4cf4fed8dff..ab2540b7e40 100644 --- a/data/42/41/90/42419061EB17690A2570C5DEBAC110C9.xml +++ b/data/42/41/90/42419061EB17690A2570C5DEBAC110C9.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus malayensis Arrow, 1910 + + + +Peltonotus malayensis Arrow, 1910 Figs 10-11, 21, 28, 41, 47, 64, 79 - -Diagnosis (male and female). -Length 14.4-17.2 mm, color overall castaneous or black, elytra reddish-brown or black with weak iridescent bloom (Figs 10-11), head with some multisetigerous punctures, labrum bi-emarginate (Fig. 21), mentum rounded in apical half (Fig. 28), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 41), mala with weak lamellate setal brush, maxillary stipes setae curled at apices (Fig. 41), male protibia bidentate (Fig. 47), form of male parameres (Fig. 64), female epipleuron incised and with rounded emargination (Fig. 79). + +Diagnosis (male and female). +Length 14.4-17.2 mm, color overall castaneous or black, elytra reddish-brown or black with weak iridescent bloom (Figs 10-11), head with some multisetigerous punctures, labrum bi-emarginate (Fig. 21), mentum rounded in apical half (Fig. 28), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 41), mala with weak lamellate setal brush, maxillary stipes setae curled at apices (Fig. 41), male protibia bidentate (Fig. 47), form of male parameres (Fig. 64), female epipleuron incised and with rounded emargination (Fig. 79). - -Distribution. -Brunei; Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sarawak). + +Distribution. +Brunei; Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sarawak). \ No newline at end of file diff --git a/data/42/E7/05/42E7056D366851C986C5B613BCE4D966.xml b/data/42/E7/05/42E7056D366851C986C5B613BCE4D966.xml index 5816734046f..9650c9f650b 100644 --- a/data/42/E7/05/42E7056D366851C986C5B613BCE4D966.xml +++ b/data/42/E7/05/42E7056D366851C986C5B613BCE4D966.xml @@ -1,365 +1,365 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius perforatus (Speiser, 1913) -Figs 16 -, 59 -, 96 -, 140 -, 152 -, 163 -, 185 -, 218 + + + +Mesembrius perforatus (Speiser, 1913) +Figs 16 +, 59 +, 96 +, 140 +, 152 +, 163 +, 185 +, 218 - - -Prionotomyia perforata + + +Prionotomyia perforata Speiser, 1913: 129. - -Mesembrius perforatus + +Mesembrius perforatus - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius perforatus + +Differential diagnosis. + + +Mesembrius perforatus males have a black apical pile brush on the profemur, the protarsi are very broad, orange and the probasitarsus has a tuft of orange pile on the posterior side. The metafemur is long and slender with black pile ventrally which becomes longer towards the distal end. The metatibia has a long and deep posterior depression which is bordered with long black pile. The species resembles other species with a dark apical pile brush on the profemur, but the probasitarsus has a tuft of orange pile as in - -M. rex + +M. rex from which it differs in the metafemur which is entirely covered in short black pile ventrally (with a row of short spines in - -M. rex + +M. rex ). Other species with a dense apical pile brush have either no tuft of pile on the probasitarsus ( - -M. regulus + +M. regulus ) or a tuft of black pile (other species). It is the only species which has three depressions on the posterior side of the metatibia. The female is unknown. - -Examined material. - - - -Holotype + +Examined material. + + + +Holotype , male: -Tanzania +Tanzania • -Niussi +Niussi ; -17 Dec 1905 +17 Dec 1905 ; - + Chr. -Schroeder +Schroeder leg. (type not found/studied). - -Other material - - -Benin + +Other material + + +Benin • -1♂ +1♂ ; -Calavi +Calavi ; -11 Nov 1993 +11 Nov 1993 ; -G. Goergen +G. Goergen leg.; IITA • - -1♂ + +1♂ ; -Calavi +Calavi ; -Oct 2001 +Oct 2001 ; -G. Goergen +G. Goergen leg.; IITA . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♂ +1♂ ; -Elisabethville +Elisabethville [= Lubumbashi]; -Apr 1930 +Apr 1930 ; -M. Bequaert +M. Bequaert leg.; KMMA • - -1♂ + +1♂ ; -Elisabethville +Elisabethville [= Lubumbashi]; -Apr 1930 +Apr 1930 ; -M. Bequaert +M. Bequaert leg.; RMNH • - -1♂ + +1♂ ; -Tshibinda +Tshibinda ; -21-27 Aug 1931 +21-27 Aug 1931 ; -W.P. Cockerell +W.P. Cockerell leg.; NHMUK . - -Kenya + +Kenya • -1♂ +1♂ ; -Kakamega -Forest +Kakamega +Forest , -Isecheno Station +Isecheno Station ; -24 Jan 1991 +24 Jan 1991 ; -Earthwatch Team +Earthwatch Team 2 leg.; NMK . - -Uganda + +Uganda • -1♂ +1♂ ; -Entebbe +Entebbe ; -27 May 1912 +27 May 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -4♂♂ + +4♂♂ ; -Entebbe +Entebbe ; -7-9 May 1912 +7-9 May 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -21 Aug 1911 +21 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -18-20 Nov 1912 +18-20 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -3♂♂ + +3♂♂ ; -Entebbe +Entebbe ; -7 Oct 1971 +7 Oct 1971 ; -H. Falke +H. Falke leg.; CNC • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -23-31 Jan 1973 +23-31 Jan 1973 ; -H. Falke +H. Falke leg.; CNC • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -25-27 Mar 1973 +25-27 Mar 1973 ; -H. Falke +H. Falke leg.; CNC . - -Re-description male - - + +Re-description male + + (Fig. -16 +16 ). Body length: 14.6-15.7 mm. Wing length: 10.5-11.5 mm. - -Head + +Head (Fig. -59 +59 ). Eyes bare; slightly dichoptic, distance between the eyes approx. the width of ocellus. Face yellow with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; yellow pollinose on lower half. Distance between lateral ocellus and eye margin less than 1/2 width of ocellus. Occiput black; yellow pilose with black pile in dorsal area; yellow and white pollinose. Frontal triangle short; black; with some long black pile; white pollinose. Frontal prominence shiny black with orange-brown apex. Antenna, scape and postpedicel black; pedicel dark orange-black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black with, dorsally, a pair of faint grey pollinose vittae; lateral vitta faint, not well-demarcated; black pilose with long yellow pile on anterolateral part and postpronotum. Scutellum uniformly yellow-brown; with long yellow and black pile. - -Legs. + +Legs. Proleg (Figs -152 +152 , -163 +163 ): Femur black; dorsoventrally flattened; with a black apical pile brush; proximoventral section with long, thick black setae; posterior side with long golden pile. Tibia dorsally brown, ventrally orange-brown; with, especially on the ventral side, long black pile. Basitarsus very broad; orange; with a tuft of orange pile on posterior side (Fig. -163 +163 ). Other tarsi very broad; orange; becoming shorter distally; the most distal tarsal segment white; sparsely black pilose dorsally, but with denser short black pile in anterior half, short orange pilose ventrally. Mesoleg: Femur dark brown; with long yellow pile on ventroproximal side, scattered yellow pile posterodorsally, but black at distal end. Tibia dorsally brown, ventrally orange-brown; with a tuft of black curved pile on ventroproximal end. Tarsi orange; sparsely black pilose dorsally, orange pilose ventrally with some thick long black pile. Metaleg (Fig. -185 +185 ): Femur long and slender; dark brown; black pilose ventrally, the pile gradually becomes longer towards distal end; pile otherwise yellow and less dense. Tibia dorsally dark brown, ventrally orange-brown; in anterior view with a strong carina on the ventral side in the middle; with three deep depressions on the posterior side of the proximal half which are bordered with long, black pile, especially dorsally. Tarsi dark brown; sparsely black pilose dorsally, short orange pilose ventrally. - -Wing + +Wing (Fig. -140 +140 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -96 +96 ). Tergite II with pair of large, yellow triangular maculae; black marking hourglass-shaped, white pollinose on posterior end; yellow and black pilose, but black pile most conspicuous on posterior black marking of tergite. Tergite III with broad yellow fascia and a triangular black marking on posterior half; black marking strongly white pollinose, covered with short black spines; otherwise yellow pilose. Tergite IV with large triangular posterior black marking, otherwise yellow; strongly white pollinose. - -Genitalia + +Genitalia (Fig. -218 +218 ). Epandrium: Dorsal lobe of surstylus short, broadly rounded, with short, black spines on almost entire surface. Ventral lobe of surstylus straight; bare. - -Female. -Unknown. + +Female. +Unknown. - -Distribution. -Benin, Democratic Republic of the Congo, Kenya, Tanzania and Uganda. + +Distribution. +Benin, Democratic Republic of the Congo, Kenya, Tanzania and Uganda. - -Comments. -We could not find the male holotype in any of the surveyed collections. The male has a set of unambiguous character states mentioned in the original description and cannot be confused with any other species of the genus. The specimens we have studied correspond with the original species description and are therefore considered to be conspecific. + +Comments. +We could not find the male holotype in any of the surveyed collections. The male has a set of unambiguous character states mentioned in the original description and cannot be confused with any other species of the genus. The specimens we have studied correspond with the original species description and are therefore considered to be conspecific. \ No newline at end of file diff --git a/data/48/C3/F5/48C3F554CBCC5493984B7E0CD53C6BB6.xml b/data/48/C3/F5/48C3F554CBCC5493984B7E0CD53C6BB6.xml index 3dcdbde2910..ba6e6b5574b 100644 --- a/data/48/C3/F5/48C3F554CBCC5493984B7E0CD53C6BB6.xml +++ b/data/48/C3/F5/48C3F554CBCC5493984B7E0CD53C6BB6.xml @@ -1,901 +1,901 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius regulus (Hull, 1937) -Figs 18 -, 38 -, 61 -, 76 -, 98 -, 119 -, 142 -, 153 -, 171 -, 183 -, 202 -, 220 + + + +Mesembrius regulus (Hull, 1937) +Figs 18 +, 38 +, 61 +, 76 +, 98 +, 119 +, 142 +, 153 +, 171 +, 183 +, 202 +, 220 - - -Tityusia regulus + + +Tityusia regulus Hull, 1937: 119. - -Mesembrius regulus + +Mesembrius regulus - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius regulus + +Differential diagnosis. + + +Mesembrius regulus males have a dark brown apical pile brush on the profemur, a strongly flattened protibia with long black pile in the proximal half and long yellow-orange pile in the distal half. The species resembles other species with a dark apical pile brush on the profemur, but the probasitarsus lacks a tuft of orange or black pile as in the other species. It is the only species with a strongly flattened protibia and with very long, thick black pile on the metabasitarsus. Females have a frons which is black pilose on its entire length, except laterally. The female can be distinguished from the female of - -M. sulcus + +M. sulcus sp. nov. and - -M. tarsatus + +M. tarsatus by the colour of the tibiae (yellow-brown to chocolate-brown in - -M. regulus + +M. regulus ; black in - -M. sulcus + +M. sulcus sp. nov. and - -M. tarsatus + +M. tarsatus ). It differs from - -M. chapini + +M. chapini by the black pile on the protibia which is restricted to the distal half (over the entire length in - -M. chapini + +M. chapini ). It differs from the female of - -M. rex + +M. rex by the presence of black pile on the ventral side of the pro- and mesotibia (absent in - -M. rex + +M. rex ), the lighter protarsus compared to the distal part of the protibia (concolourous in - -M. rex + +M. rex ) and wing cell r1 which is nearly closed (distinctly open in - -M. rex + +M. rex ). - -Examined material. - - -Tityusia regulus + +Examined material. + + +Tityusia regulus - + Hull: -Holotype +Holotype , male, "Efufup // -Kamerun +Kamerun , // -W. Africa +W. Africa // VIII.30.1919" "Carn. Mus. //Acc. 6552" -"type" +"type" " -Tityusia +Tityusia // -Tityusia regulus +Tityusia regulus // type Hull" "Monstromyia rex // Hull Curr." [MCZ] [type studied from pictures]. - -Other material - - -Benin + +Other material + + +Benin • -2♂♂ -1♀ +2♂♂ +1♀ ; - -Calavi + +Calavi ; -Apr 2014 +Apr 2014 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Calavi + +Calavi ; -Oct 2015 +Oct 2015 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Ifangni-range + +Ifangni-range ; -6 May 2016 +6 May 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ -2♀♀ +1♂ +2♀♀ ; - -Ifangni-range + +Ifangni-range ; -19 Mar 2017 +19 Mar 2017 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; - - -Pobe + + +Pobe ; -27 Jan 2016 +27 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Porto Novo + +Porto Novo ; -Mar 2003 +Mar 2003 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Porto Novo + +Porto Novo ; -Dec 2005 +Dec 2005 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Porto Novo + +Porto Novo ; -Jul 2005 +Jul 2005 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Porto Novo + +Porto Novo ; -Jan 2008 +Jan 2008 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -2♀♀ +1♂ +2♀♀ ; - -Porto Novo + +Porto Novo ; -Mar 2008 +Mar 2008 ; -G. Goergen +G. Goergen leg.; IITA • -2♂♂ +2♂♂ ; - -Porto Novo + +Porto Novo ; -31 Jan 2014 +31 Jan 2014 ; -G. Goergen +G. Goergen leg.; KMMA • -2♀♀ +2♀♀ ; - -Porto Novo + +Porto Novo ; -27 Jan 2016 +27 Jan 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -3♀♀ +3♀♀ ; - -Porto Novo + +Porto Novo ; date unknown; -K. Jordaens +K. Jordaens leg.; KMMA . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Oct 1935 +Oct 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KMMA • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Sep 1935 +Sep 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♂ +1♂ ; - -Equateur + +Equateur , -Eala +Eala ; -Aug 1935 +Aug 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -Jan 1936 +Jan 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -1♀ +1♀ ; - -Equateur + +Equateur , -Lopri River +Lopri River ; -May-Jun +May-Jun 1927; - + J. -Ghesquiere +Ghesquiere leg.; KMMA • -1♀ +1♀ ; - -Terr. de Banningville + +Terr. de Banningville , -Kwilu +Kwilu , -Panga +Panga ; -Aug 1945 +Aug 1945 ; -Fain +Fain leg.; KMMA • -1♀ +1♀ ; - -Tshuapa + +Tshuapa , -Flandria +Flandria [= Boteka]; -18 Oct 1945 +18 Oct 1945 ; -P. Hulstaert +P. Hulstaert leg.; KMMA • -1♀ +1♀ ; - -Ubangi + +Ubangi , -Nzali +Nzali ; -3-4 Mar 1932 +3-4 Mar 1932 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♂ +1♂ ; - - -Uele + + +Uele , -Tukpwo +Tukpwo ; -Jul 1937 +Jul 1937 ; -J. Vrijdagh +J. Vrijdagh leg.; KMMA . - -Nigeria + +Nigeria • -1♀ +1♀ ; - -Lagos + +Lagos ; -22 Nov 1911 +22 Nov 1911 ; -W.A. Lamborn +W.A. Lamborn leg.; -OXUM +OXUM • -1♀ +1♀ ; - -Lagos + +Lagos ; -20 Feb 1912 +20 Feb 1912 ; -W.A. Lamborn +W.A. Lamborn leg.; -OXUM +OXUM • -2♂♂ +2♂♂ ; - -Lagos + +Lagos ; -21 Mar 1912 +21 Mar 1912 ; -W.A. Lamborn +W.A. Lamborn leg.; -OXUM +OXUM . - -Togo + +Togo ; -1♂ +1♂ ; - -Kloto Forest + +Kloto Forest ; -Feb 2008 +Feb 2008 ; -G. Goergen +G. Goergen leg.; IITA . - -Re-description male - - + +Re-description male + + (Fig. -18 +18 ). Body length: 21.5-24.2 mm. Wing length: 13.2-15.0 mm. - -Head + +Head (Fig. -61 +61 ). Eyes bare; holoptic, eye contiguity as long as length of ocellar triangle. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; yellow pollinose on lower half. Ocellus and eye touching. Occiput black; yellow pilose; black pilose dorsally; yellow and white pollinose. Frontal triangle short; black; with some long black pile; strongly white pollinose. Frontal prominence shiny black with orange apex. Antenna black; postpedicel strongly white pollinose; antennal arista orange-brown. - -Thorax. + +Thorax. Scutum dark brown to black with, dorsally, a pair of very faint, grey pollinose vittae which fade out posteriorly; pile short, dense, black and yellow-white. Scutellum yellow-brown with darker anterior border; with dense yellow and, on the posterior half and centre, shorter, black pile. - -Legs. + +Legs. Proleg (Figs -153 +153 , -171 +171 ): Femur dark brown; dorsoventrally flattened; with a dark brown apical pile brush; remainder of posterior side with less dense, long brown pile. Tibia orange-brown in proximal 1/3, but darker in distal 2/3; very broad; with brown to black pile which is longer posteriorly. Basitarsus orange-brown, longer than wide. Other tarsi orange-brown; progressively becoming shorter, wider and lighter; most distal tarsal segment greyish. Mesoleg: Femur dark brown; with long yellow pile on ventroposterior 4/5, black on distal 1/5; pile otherwise short and black. Tibia orange-brown; with long black pile ventrally and shorter, strongly curved black pile dorsally. Tarsi orange; with short, black pile. Metaleg (Figs -183 +183 , -202 +202 ): Femur long and slender; orange-brown; with long yellow pile on all but ventral sides, except for long black pile at extreme distal end; pile much shorter and black ventrally. Tibia orange-brown; with brown to black long pile; unmodified. Basitarsus orange-brown; with a very conspicuous thick tuft of very long and very dense brown pile on distal dorsal half; with long brown pile at extreme proximal end ventrally. Second tarsomere orange-brown; with long brown pile posteriorly. Other tarsi orange-brown; sparsely black pilose dorsally, short orange-brown pilose ventrally. - -Wing + +Wing (Fig. -142 +142 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -98 +98 ). Tergite II with a pair of large yellow, rounded maculae; black marking hourglass-shaped; yellow pilose in anterior half and along tergite margins, black pilose in posterior half; black marking white pollinose posteriorly. Tergite III with yellow fascia and a triangular black marking on posterior half which is strongly white pollinose; yellow pilose on anterior 1/3 and along tergite margins, black pilose on posterior 2/3. Tergite IV dark brown to black; yellow-white pilose, but with shorter, black pile medially; strongly white pollinose on anterior 1/3 to 1/2. - - -Figures 83-88. - -Mesembrius + + +Figures 83-88. + +Mesembrius spp., abdomen, dorsal view -83 - -M. arcuatus +83 + +M. arcuatus sp. nov. (♂) -84 - -M. caffer +84 + +M. caffer (Loew) (nominal morph) (♂) -85 - -M. caffer +85 + +M. caffer (Loew) (spined morph) (♂) -86 - -M. ctenifer +86 + +M. ctenifer Hull syn. nov. (♂) -87 - -M. capensis +87 + +M. capensis (Macquart) (♂) -88 - -M. chapini +88 + +M. chapini Curran (♂). - -Genitalia + +Genitalia (Fig. -220 +220 ). Epandrium: Dorsal lobe of surstylus short, broadly rounded; with short, black spines on almost entire surface; long yellow pilose dorsally, especially at proximal end. Ventral lobe of surstylus straight; bare. - - -Figures 89-94. - -Mesembrius + + +Figures 89-94. + +Mesembrius spp., abdomen, dorsal view -89 - -M. copelandi +89 + +M. copelandi sp. nov. (♂) -90 - -M. cyanipennis +90 + +M. cyanipennis (Bezzi) (♂) -91 - -M. ingratus +91 + +M. ingratus (Loew) (♂) -92 - -M. longipilosus +92 + +M. longipilosus sp. nov. (♂) -93 - -M. madagascariensis +93 + +M. madagascariensis Keiser (♂) -94 - -M. minor +94 + +M. minor (Bezzi) (♂). - -Description female - - + +Description female + + (Fig. -38 +38 ). Body length: 11.8-16.7 mm. Wing length: 11.2-12.5 mm. - -Head + +Head (Fig. -76 +76 ). Eyes bare; dichoptic. Face white with dark medial vitta; white pilose; white pollinose. Distance between lateral ocellus and eye margin approx. width of ocellus. Occiput black; yellow and black pilose; yellow pollinose. Frons black; black pilose; yellow pollinose on ventral half, sometimes pollinosity almost absent. Frontal prominence shiny black, orange-brown at distal end; scape and pedicel orange-brown to black; postpedicel black; postpedicel white pollinose; antennal arista reddish-brown. - - -Figures 95-100. - -Mesembrius + + +Figures 95-100. + +Mesembrius spp., abdomen, dorsal view -95 - -M. nigriceps +95 + +M. nigriceps Curran (♂) -96 - -M. perforatus +96 + +M. perforatus (Speiser) (♂) -97 - -M. platytarsis +97 + +M. platytarsis Curran syn. nov. (♂) -98 - -M. regulus +98 + +M. regulus (Hull) (♂) -99 - -M. rex +99 + +M. rex Curran (♂) -100 - -M. senegalensis +100 + +M. senegalensis (Macquart) (♂). - -Thorax. + +Thorax. Scutum dark brown to black with, dorsally, a pair of very vague yellow pollinose vittae; short yellow and black pilose. - -Legs. + +Legs. All legs brown to black, protibia and protarsus lighter, yellow-brown; protarsus lighter than distal part of protibia; profemur predominantly black pilose, the pile is longer on the posterior and posterodorsal side than on the remainder of the profemur; pro- and mesotibia black pilose in distal 1/2-1/4, otherwise yellow and black pilose. - - -Figures 101-106. - -Mesembrius + + +Figures 101-106. + +Mesembrius spp., abdomen, dorsal view -101 - -M. simplicipes +101 + +M. simplicipes Curran (♂) -102 - -M. strigilatus +102 + +M. strigilatus (Bezzi) (♂) -103 - -M. sulcus +103 + +M. sulcus sp. nov. (♂) -104 - -M. tarsatus +104 + +M. tarsatus (Bigot) (♂) -105 - -M. tibialis +105 + +M. tibialis sp. nov. (♂) -106 - -M. vockerothi +106 + +M. vockerothi sp. nov. (♂). - -Wing. + +Wing. Entire wing uniformly dense microtrichose. Wing cell r1 nearly closed. - -Abdomen + +Abdomen (Fig. -119 +119 ). Tergite II with a pair of large, orange maculae; black medial marking narrow, approximately 1/9 of tergal width; orange pilose on anterior half, black pilose on posterior half; posterior black marking strongly white pollinose. Tergite III with orange fascia (approx. half of tergite length on lateral sides; approx. 1/5 of tergite length in medial area); orange pilose on anterior end, otherwise black pilose; posterior half white pollinose, especially in medial area. Tergite IV as tergite III, but yellow pilose throughout with black pile interspersed on black marking. Tergite V black with or without a pair of vague orange maculae in anterolateral corner; yellow pilose; white pollinose on anterior half. - - -Figures 107-112. - -Mesembrius + + +Figures 107-112. + +Mesembrius spp., abdomen, dorsal view -107 - -M. caffer +107 + +M. caffer (Loew) (nominal morph) (♀) -108 - -M. caffer +108 + +M. caffer (Loew) (spined morph) (♀) -109 - -M. ctenifer +109 + +M. ctenifer syn. nov. Hull (♀) -110 - -M. capensis +110 + +M. capensis (Macquart) (♀) -111 - -M. chapini +111 + +M. chapini Curran (♀) -112 - -M. cyanipennis +112 + +M. cyanipennis (Bezzi) (♀). - -Distribution. -Benin, Cameroon, Democratic Republic of the Congo, Nigeria and Togo. + +Distribution. +Benin, Cameroon, Democratic Republic of the Congo, Nigeria and Togo. - -Comments. -The male has a set of unambiguous character states mentioned in the original description and cannot be confused with any other species of the genus. The specimens we have studied correspond with the original species description and are, therefore, considered to be conspecific. Until now, the species was only known from the male holotype. We here report on the first females, which we matched with the males through DNA barcoding. The species seems locally common in west and central Africa. - - -Figures 113-118. - -Mesembrius + +Comments. +The male has a set of unambiguous character states mentioned in the original description and cannot be confused with any other species of the genus. The specimens we have studied correspond with the original species description and are, therefore, considered to be conspecific. Until now, the species was only known from the male holotype. We here report on the first females, which we matched with the males through DNA barcoding. The species seems locally common in west and central Africa. + + +Figures 113-118. + +Mesembrius spp., abdomen, dorsal view -113 - -M. cyanipennis +113 + +M. cyanipennis (Bezzi) (♀) -114 - -M. maculifer +114 + +M. maculifer Hull (♀) -115 - -M. madagascariensis +115 + +M. madagascariensis Keiser (♀) -116 - -M. minor +116 + +M. minor (Bezzi) (♀) -117 - -M. morio +117 + +M. morio (Bezzi) (♀) -118 - -M. platytarsis +118 + +M. platytarsis Curran syn. nov. (♀). - - -Figures 119-123. - -Mesembrius + + +Figures 119-123. + +Mesembrius spp., abdomen, dorsal view -119 - -M. regulus +119 + +M. regulus (Hull) (♀) -120 - -M. rex +120 + +M. rex Curran (♀) -121 - -M. senegalensis +121 + +M. senegalensis (Macquart) (♀) -122 - -M. simplicipes +122 + +M. simplicipes Curran (♀) -123 - -M. strigilatus +123 + +M. strigilatus (Bezzi) (♀). - - -Figures 124-126. - -Mesembrius + + +Figures 124-126. + +Mesembrius spp., abdomen, dorsal view -124 - -M. sulcus +124 + +M. sulcus sp. nov. (♀) -125 - -M. tarsatus +125 + +M. tarsatus (Bigot) (♀) -126 - -M. vockerothi +126 + +M. vockerothi sp. nov. (♀). diff --git a/data/4E/9E/15/4E9E15B32A915056B629586447A8C6FB.xml b/data/4E/9E/15/4E9E15B32A915056B629586447A8C6FB.xml index af75266aede..4bd676b2cd1 100644 --- a/data/4E/9E/15/4E9E15B32A915056B629586447A8C6FB.xml +++ b/data/4E/9E/15/4E9E15B32A915056B629586447A8C6FB.xml @@ -1,132 +1,132 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius Rondani, 1857 + + + +Mesembrius Rondani, 1857 - - -Mesembrius + + +Mesembrius Rondani, 1857: 50. Type-species: -Helophilus peregrinus +Helophilus peregrinus Loew, 1846, (by monotypy). - -Prionotomyia + +Prionotomyia Bigot, 1883: cxxi. Type-species: -Prionotomyia tarsata +Prionotomyia tarsata Bigot, 1883 (by monotypy). - -Vadonimyia -Seguy + +Vadonimyia +Seguy , 1951: 16. Type-species: -Vadonimyia discophora -Seguy +Vadonimyia discophora +Seguy , 1951 (by original designation). - -Tityusia + +Tityusia Hull, 1937: 118. Type-species: -Tityusia regulus +Tityusia regulus Hull, 1937 (by original designation). - -Generic diagnosis. - + +Generic diagnosis. + Afrotropical species of - -Mesembrius + +Mesembrius s.s. (i.e. excluding representatives of the subgenus -Mesembrius Vadonimyia +Mesembrius Vadonimyia , cf. Introduction) have the following combination of diagnostic characters: postpronotum pilose; compound eye bare (Figs -46 +46 - -82 +82 ); wing vein R4+5 strongly sinuate; wing vein M1 processive distally (Figs -127 +127 - -150 +150 ); wing cell r1 open (rarely, cell r1 is narrowly open as in Fig. -142 +142 ); thorax with katepimeron conspicuously pilose; and metabasitarsus with basoventral globuliferous setae (e.g. Figs -185 +185 , -196 +196 ). diff --git a/data/56/2A/67/562A67C0D970496197C494D29C262847.xml b/data/56/2A/67/562A67C0D970496197C494D29C262847.xml index 5cc0c3cc543..e6c6945c30a 100644 --- a/data/56/2A/67/562A67C0D970496197C494D29C262847.xml +++ b/data/56/2A/67/562A67C0D970496197C494D29C262847.xml @@ -1,63 +1,63 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus adelphosimilis Jameson & Wada, 2004 + + + +Peltonotus adelphosimilis Jameson & Wada, 2004 Figs 50, 55 - -Diagnosis (male and female). - + +Diagnosis (male and female). + Length 20.3-18.9 mm, color overall black or castaneous, elytra black or castaneous with or without iridescent bloom, head with some multisetiger -ous +ous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 not enlarged or obviously dorsoventrally flattened, mala lacking lamellate setal brush, maxillary stipes without setae curled at apices, male protibia bidentate, protarsomere 5 of male with internoapical protuberance (Fig. 50), form of parameres (Fig. 55), female epipleuron incised and with rounded emargination (similar to -Peltonotus similis +Peltonotus similis , Fig. 86). - -Distribution. -Indonesia, Borneo Island (Kalimantan). + +Distribution. +Indonesia, Borneo Island (Kalimantan). \ No newline at end of file diff --git a/data/57/9D/92/579D924128DE5AFF974E995F3D727CA1.xml b/data/57/9D/92/579D924128DE5AFF974E995F3D727CA1.xml index 5b6af9197e0..a51c6f5872b 100644 --- a/data/57/9D/92/579D924128DE5AFF974E995F3D727CA1.xml +++ b/data/57/9D/92/579D924128DE5AFF974E995F3D727CA1.xml @@ -1,331 +1,331 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius ingratus (Loew, 1858) -Figs 11 -, 54 -, 91 -, 133 -, 158 -, 190 -, 213 + + + +Mesembrius ingratus (Loew, 1858) +Figs 11 +, 54 +, 91 +, 133 +, 158 +, 190 +, 213 - - -Helophilus ingratus + + +Helophilus ingratus Loew, 1858: 380. - -Helophilus ingratus + +Helophilus ingratus - -Loew (1860) +Loew (1860) : 386 - - -Herve-Bazin + +Herve-Bazin (1914a) : 297. - -Helophilus (Mesembrius) ingratus + +Helophilus (Mesembrius) ingratus - -Bezzi (1915) +Bezzi (1915) : 97. - -Tubifera ingrata + +Tubifera ingrata - - -Kertesz + +Kertesz (1910) : 254. - -Mesembrius ingratus + +Mesembrius ingratus - -Curran (1927) +Curran (1927) : 60 - - -Szilady + +Szilady (1942) : 92 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius ingratus + +Differential diagnosis. + + +Mesembrius ingratus males are holoptic, have a loose black apical pile brush on the profemur, a densely yellow pilose scutum with vague longitudinal vittae, a tuft of black pile on the posterior side of the probasitarsus, a slender metatibia and a posterior deep depression in the proximal half of the metatibia which ventrally extends into a deep groove. It can be distinguished from any other species by the apical pile brush of the profemur which is loose and yellowish with some black pile interspersed (black dorsally, yellow ventrally in - -M. arcuatus + +M. arcuatus sp. nov.; black in - -M. tarsatus + +M. tarsatus ) and by the deep groove on the metatibia (strongly compressed in - -M. arcuatus + +M. arcuatus sp. nov.; with a rounded swelling in - -M. tarsatus + +M. tarsatus ). The female is unknown. - -Examined material. - - -Helophilus ingratus + +Examined material. + + +Helophilus ingratus Loew: -Holotype +Holotype , male, " -Helophilus +Helophilus // -Helophilus ingratus +Helophilus ingratus " -"209" -"209" +"209" +"209" " -HOLOTYPUS +HOLOTYPUS // -Helophilus ingratus +Helophilus ingratus // Loew, 1858" "design. Kassebeer 1993" "NHRS-BYWS // 000002619" [NRMS]. - -Other material - - -Malawi + +Other material + + +Malawi • -1♂ +1♂ ; -Mount -Mulanje +Mount +Mulanje ; -20 Oct 1912 +20 Oct 1912 ; S.A. Neave leg.; NHMUK. - -Senegal + +Senegal • -2♂♂ +2♂♂ ; -Dakar +Dakar ; -14 Jan 1945 +14 Jan 1945 ; collector unknown; RMNH. - -South Africa + +South Africa • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , - -Manguzi Forest Reserve + +Manguzi Forest Reserve ; -13-16 Dec 2010 +13-16 Dec 2010 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , - -St. Lucia -Park Reserve + +St. Lucia +Park Reserve ; -2 Feb 1988 +2 Feb 1988 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • - -1♂ + +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Ngoya Forest Reserve +Ngoya Forest Reserve ; -26 Apr 1988 +26 Apr 1988 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA . - -Re-description male - - + +Re-description male + + (Fig. -11 +11 ). Body length: 10.9-11.1 mm. Wing length: 8.0-8.4 mm. - -Head + +Head (Fig. -54 +54 ). Eyes bare; holoptic, length of eye contiguity approx. 1/3 the length of ocellar triangle. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle with black pile in ventral half and at ocellar triangle; yellow pilose in dorsal half; yellow pollinose. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Frontal triangle and gena white; white pilose; white pollinose. Frontal prominence shiny black; black pilose. Occiput black, but strongly white-grey pollinose; yellow-brown pilose, with a row of almost equally long black pile at dorsal eye margin. Antenna reddish-brown. - -Thorax. + +Thorax. Scutum dark brown with dorsally a pair of vague yellow vittae; yellow-brown pilose. Scutellum uniformly light yellow-brown; yellow pilose. - -Legs. + +Legs. All legs dark brown, except for pro- and mesotarsi which are yellow-brown. All femora and tibiae with long, loose yellow pile. Proleg (Fig. -158 +158 ): Femur with a loose, yellow apical pile brush interspersed with some long black pile; very short thick pile and longer thin black pile at proximal 1/4 ventrally. Tibia with long, black pile, except dorsally. Basitarsus black pilose dorsally, with tuft of black pile on posterior side, short orange pilose ventrally. Other tarsi black pilose dorsally, short orange pilose ventrally. Mesoleg: Femur long yellow pilose posteriorly and posterodorsally, except at distal end where pile is black; short black pilose anteriorly and anterodorsally; ventrally with longer black pile. Tibia long black and short yellow pilose. Tarsi short black pilose dorsally; short yellow pilose ventrally with a few thick black spines. Metaleg (Fig. -190 +190 ): Femur very slender; covered with long, thin yellow pile; shorter black pile on ventral 1/4 and at distal end. Tibia with a deep posterior depression in the proximal half which is extended as a groove on the ventral side, demarcated with short, dense black pile; proximal half dorsoventrally flattened; predominantly black pilose. Tarsi black pilose dorsally; orange pilose ventrally. - -Wing + +Wing (Fig. -133 +133 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -91 +91 ). Tergite II with pair of very large, yellow triangular maculae; yellow pilose; black marking hourglass-shaped; posterior black marking equal in size or somewhat narrower than anterior black marking, but more vague because of medial white pollinosity; posterior black marking with black pile that posterolaterally extends into the yellow maculae. Tergite III with yellow fascia of variable size, occupying approx. the entire tergite; yellow pilose; with posterior, triangular black marking; black pilose; white pollinose. Tergite IV black; white pilose and white pollinose on anterior fascia, black and yellow pilose on remainder of tergite. - -Genitalia + +Genitalia (Fig. -213 +213 ). Epandrium: Dorsal lobe of surstylus somewhat elongated, broadly rounded, with short, black spines on almost entire surface; dorsally long yellow pilose. Ventral lobe of surstylus straight; bare. - -Female. -Unknown. + +Female. +Unknown. - -Distribution. -Malawi, Senegal and South Africa. + +Distribution. +Malawi, Senegal and South Africa. - -Comments. - -Curran (1927) + +Comments. + +Curran (1927) cites several specimens from three localities in the Democratic Republic of the Congo. In a later publication, -Curran (1939) +Curran (1939) suggests that these specimens belong to - -M. tarsatus. + +M. tarsatus. -Bezzi (1915) +Bezzi (1915) also mentions the species from Uganda and Durban in South Africa, but -Curran (1939) +Curran (1939) also considers these specimens as - -M. tarsatus + +M. tarsatus . We have not encountered females that could be associated with the male of - -M. ingratus + +M. ingratus . No DNA barcodes are available for - -M. ingratus + +M. ingratus . diff --git a/data/58/1A/AB/581AABC2A0D2980BDCC1553117141AE7.xml b/data/58/1A/AB/581AABC2A0D2980BDCC1553117141AE7.xml index d1c8e1df8ce..4b3b0741d0a 100644 --- a/data/58/1A/AB/581AABC2A0D2980BDCC1553117141AE7.xml +++ b/data/58/1A/AB/581AABC2A0D2980BDCC1553117141AE7.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus karubei Muramoto, 2000 + + + +Peltonotus karubei Muramoto, 2000 Figs 9, 20, 40, 63 - -Diagnosis (male only). -Length 13.4-14.5 mm, overall color black or castaneous, elytra reddish orange or black with iridescent bloom (Fig. 9), head with some multisetigerous punctures, labrum deeply bilobed (Fig. 20), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 40), mala with weak lamellate setal brush (Fig. 40), maxillary stipes without setae curled at apices, male protibia bidentate, form of male parameres (Fig. 63). + +Diagnosis (male only). +Length 13.4-14.5 mm, overall color black or castaneous, elytra reddish orange or black with iridescent bloom (Fig. 9), head with some multisetigerous punctures, labrum deeply bilobed (Fig. 20), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 40), mala with weak lamellate setal brush (Fig. 40), maxillary stipes without setae curled at apices, male protibia bidentate, form of male parameres (Fig. 63). - -Distribution. -Vietnam (southern). + +Distribution. +Vietnam (southern). \ No newline at end of file diff --git a/data/68/5F/FD/685FFD53922E5405B76892715A036447.xml b/data/68/5F/FD/685FFD53922E5405B76892715A036447.xml index bb8cf11c60f..75159b08450 100644 --- a/data/68/5F/FD/685FFD53922E5405B76892715A036447.xml +++ b/data/68/5F/FD/685FFD53922E5405B76892715A036447.xml @@ -1,199 +1,199 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius maculifer Hull, 1941 -Figs 33 -, 73 -, 114 -, 135 + + + +Mesembrius maculifer Hull, 1941 +Figs 33 +, 73 +, 114 +, 135 - - -Mesembrius maculifera + + +Mesembrius maculifera Hull, 1941: 332. - -Mesembrius maculifer + +Mesembrius maculifer - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - + +Differential diagnosis. + The female of - -Mesembrius maculifer + +Mesembrius maculifer cannot be confused with any other species by the reddish-brown colour of tergite II with a pair of cream-coloured slender maculae. The male is unknown. - -Examined material. - - -Mesembrius maculifera + +Examined material. + + +Mesembrius maculifera - + Hull: -Holotype +Holotype , female, " -Oriental forest +Oriental forest // Fanovana, Dist. // -Fianarantsoa +Fianarantsoa // -Madagascar +Madagascar " "I-V, 1937 // C Lamberton" "TYPE 6595 // -Mesembrius +Mesembrius // -Mesembrius maculifera +Mesembrius maculifera // -F.M. Hull +F.M. Hull " " -Mesembrius +Mesembrius // -Mesembrius maculifera +Mesembrius maculifera // Hull n.sp." [ANSP] - - - - -Paratype + + + + +Paratype : -Madagascar +Madagascar • -1♀ +1♀ ; -Oriental Forest +Oriental Forest , -Fanovana +Fanovana ; date and collector unknown; CNC . - -Re-description female - - + +Re-description female + + (Fig. -33 +33 ). Body length: 11.2 mm. Wing length: 8.7 mm. (Only female paratype measured). - -Head + +Head (Fig. -73 +73 ). Eyes bare, dichoptic. Face chocolate-brown to mahogany-red. Frons with ventral 2/3 light yellow-brown pilose. Face very short reddish pubescent; sparsely long pale pilose. Ocellar triangle bare. Frontal triangle with a transverse band of dark pile. Occiput chocolate-brown to mahogany-red; thick dark brown pilose. Antenna dark reddish-brown; arista paler. - -Thorax. + +Thorax. Dull black; lateral margins and scutellum very dark red; pleurites black; reddish-orange pilose. Scutellum dull black; white pilose. - -Legs. + +Legs. Predominantly black, the distal part of the pro- and mesolegs dark red; all tibiae dark red; all tarsi black dorsally, the hind pair rather flattened. Pile pale whitish on tarsi and tibiae. - -Wing + +Wing (Fig. -135 +135 ). Proximal half of the wing deep brown, especially at the r-m crossvein. - -Abdomen + +Abdomen (Fig. -114 +114 ). Dull black. Tergite II with a pair of prominent light-yellow maculae; white pilose anteriorly, light reddish pilose posteriorly. Tergite III and IV dark brown to black; light reddish pilose, but blackish on the middle of the posterior part. - -Male. -Unknown. + +Male. +Unknown. - -Distribution. -Madagascar. + +Distribution. +Madagascar. \ No newline at end of file diff --git a/data/6A/80/FA/6A80FA85551F5011BCC3E82CBBEEFAD3.xml b/data/6A/80/FA/6A80FA85551F5011BCC3E82CBBEEFAD3.xml index 59a1c9bc88e..471f9fe274e 100644 --- a/data/6A/80/FA/6A80FA85551F5011BCC3E82CBBEEFAD3.xml +++ b/data/6A/80/FA/6A80FA85551F5011BCC3E82CBBEEFAD3.xml @@ -1,621 +1,621 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius tibialis Jordaens, Goergen & De Meyer -sp. nov. -Figs 25 -, 68 -, 105 -, 149 -, 156 -, 165 -, 177 -, 188 -, 227 + + + +Mesembrius tibialis Jordaens, Goergen & De Meyer +sp. nov. +Figs 25 +, 68 +, 105 +, 149 +, 156 +, 165 +, 177 +, 188 +, 227 - -Differential diagnosis. - - -Mesembrius tibialis + +Differential diagnosis. + + +Mesembrius tibialis sp. nov. males have an apical pile brush on the profemur of thick, dense black pile dorsally and yellow pile ventrally. The metafemur is very long and slender and has long yellow pile and shorter yellow and black pile on the ventral side. The metatibia has no groove on the posterior side. The probasitarsus has a tuft of long black pile. The mesotibia is curved and the proximal half is compressed. The male differs from any other species in the colour of the apical pile brush (except from - -M. sulcus + +M. sulcus sp. nov.) which is black dorsally and golden-yellow ventrally (yellow-orange in - -M. chapini + +M. chapini ; dark-brown to black in other species). It differs from - -M. sulcus + +M. sulcus sp. nov. in the orange and black probasitarsus (orange in - -M. sulcus + +M. sulcus sp. nov.), in the absence of a deep groove in the posterior proximal half of the metatibia and in the strongly compressed mesotibia (unmodified in - -M. sulcus + +M. sulcus sp. nov.). The female is unknown. - - -Figures 177-180. - -Mesembrius + + +Figures 177-180. + +Mesembrius spp., mesoleg, dorsal view -177 - -M. tibialis +177 + +M. tibialis sp. nov. (♂) -178 - -M. caffer +178 + +M. caffer (Loew) (♂) -179 - -M. capensis +179 + +M. capensis (Macquart) (♂) -180 - -M. madagascariensis +180 + +M. madagascariensis Keiser (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Examined material. - - -Mesembrius tibialis + +Examined material. + + +Mesembrius tibialis - + Jordaens, Goergen & De Meyer: -Holotype +Holotype , male - + " -HOLOTYPUS +HOLOTYPUS " " -Togo +Togo , -Kloto Forest +Kloto Forest // -II.2017 +II.2017 // leg. -G. Goergen +G. Goergen " " -Mesembrius tibialis +Mesembrius tibialis // - -Det. K. Jordaens + +Det. K. Jordaens " "DNA 1149A04 // -K. Jordaens +K. Jordaens // RMCA 2019" [KMMA]. - - -Figures 181-184. - -Mesembrius + + +Figures 181-184. + +Mesembrius spp., mesoleg, dorsal view - -181 - -M. senegalensis + +181 + +M. senegalensis (Macquart) ( -♂ +♂ ) - -182 - -M. caffer + +182 + +M. caffer (Loew) ( -♂ +♂ ). Metaleg, posterior view - -183 - -M. regulus + +183 + +M. regulus (Hull) ( -♀ +♀ ) - -184 - -M. rex + +184 + +M. rex Curran ( -♀ +♀ ). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - - - - -Paratypes + + + + +Paratypes : -Togo +Togo • -2♂♂ +2♂♂ ; -Kloto Forest +Kloto Forest ; -Dec 2017 +Dec 2017 ; -G. Goergen +G. Goergen leg.; IITA . - - -Figures 185-188. - -Mesembrius + + +Figures 185-188. + +Mesembrius spp., mesoleg, dorsal view - -185 - -M. perforatus + +185 + +M. perforatus (Speiser) ( -♀ +♀ ). Metaleg, posterior view - -186 - -M. chapini + +186 + +M. chapini Curran ( -♂ +♂ ) - -187 - -M. sulcus + +187 + +M. sulcus sp. nov. ( -♂ +♂ ). Metaleg, ventral view - -188 - -M. tibialis + +188 + +M. tibialis sp. nov. ( -♂ +♂ ). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Description male - - + +Description male + + (Fig. -25 +25 ). Body length: 14. mm. Wing length: 12.7 mm. - -Head + +Head (Fig. -68 +68 ). Eyes bare; holoptic, eye contiguity approx. as long as length of ocellar triangle. Face yellow to orange with dark medial vitta; white pollinose; yellow-white pilose. Vertical triangle black; black pilose; yellow pollinose on medium third. Distance between lateral ocellus and eye margin slightly less than width of ocellus. Occiput black; yellow pilose with some shorter and thicker black pile near eye margin; white pollinose. Frontal triangle short; yellow-white; with some long black pile; white pollinose. Frontal prominence shiny black. Antenna black; postpedicel white pollinose; antennal arista orange-brown. - - -Figures 189-192. - -Mesembrius + + +Figures 189-192. + +Mesembrius spp., metaleg, posterior view -189 - -M. tarsatus +189 + +M. tarsatus (Bigot) (♂) -190 - -M. ingratus +190 + +M. ingratus (Loew) (♂) -191 - -M. arcuatus +191 + +M. arcuatus sp. nov. (♂) -192 - -M. nigriceps +192 + +M. nigriceps Curran (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Thorax. + +Thorax. Scutum black with dorsally, in the anterior half, a pair of very faint yellow pollinose vittae. Scutellum black in anterior half, yellow-brown in posterior half; yellow pilose with, in the posterior half, some shorter black pile interspersed. - - -Figures 193-196. - -Mesembrius + + +Figures 193-196. + +Mesembrius spp., metaleg, dorsal view -193 - -M. platytarsis +193 + +M. platytarsis Curran syn. nov. (♂) -194 - -M. simplicipes +194 + +M. simplicipes Curran (♂). Metaleg, anterior view -195 - -M. caffer +195 + +M. caffer (Loew) (nominal morph) (♂) -196 - -M. caffer +196 + +M. caffer (Loew) (spined morph) (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Legs. + +Legs. All legs chocolate-brown to black; distal ends black; other tarsi black. Proleg (Figs -156 +156 , -165 +165 ): Femur dorsoventrally flattened; with apical pile brush of long dense and curved thick black pile dorsally and thick yellow pile ventrally; ventrally with long black and shorter yellow pile. Tibia black; with long black pile. Basitarsus black and orange; with tuft of black pile on posterior side. Tarsi 2-4 black, tarsomere 5 white. Mesoleg (Fig. -177 +177 ): Femur with long yellow pile posterodorsally; short black pile ventroproximally. Tibia curved; proximal half compressed. Metaleg (Fig. -188 +188 ): Femur with very long and thin yellow pile, especially on anterior and posterior side; with shorter black pile ventrally and posteriorly. Tibia with long black pile; without groove on posterior side. - - -Figures 197-200. - -Mesembrius + + +Figures 197-200. + +Mesembrius spp., metaleg, ventral view -197 - -M. strigilatus +197 + +M. strigilatus (Bezzi) (♂). Metaleg, ventral view -198 - -M. minor +198 + +M. minor (Bezzi) (♂). Metaleg, frontal view -199 - -M. copelandi +199 + +M. copelandi sp. nov. (♂). Metaleg, posterior view -200 - -M. senegalensis +200 + +M. senegalensis (Macquart) (♀). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Wing + +Wing (Fig. -149 +149 ). Entire wing uniformly dense microtrichose. - - -Figures 201-204. - -Mesembrius + + +Figures 201-204. + +Mesembrius spp., metaleg, anterior view -201 - -M. chapini +201 + +M. chapini Curran (♀). Metaleg, posterior view -202 - -M. regulus +202 + +M. regulus (Hull) (♀) -203 - -M. strigilatus +203 + +M. strigilatus (Bezzi) (♀). Metaleg, anterior view -204 - -M. minor +204 + +M. minor (Bezzi) (♀). Abbreviations: fem-femur. - -Abdomen + +Abdomen (Fig. -105 +105 ). Tergite II with a pair of very large yellow, rounded maculae; black marking hourglass-shaped; yellow pilose except for short, black pile on the posterior black marking; posterior marking white pollinose. Tergite III and IV with orange fascia; short orange pile in medial part of tergites; long yellow-orange pilose on lateral sides; with white pollinose triangular posterior area. - - -Figures 205-216. - -Mesembrius + + +Figures 205-216. + +Mesembrius spp., male genitalia, lateral view -205 - -M. arcuatus +205 + +M. arcuatus sp. nov. -206 - -M. caffer +206 + +M. caffer (Loew) (nominal morph) -207 - -M. caffer +207 + +M. caffer (Loew) (spined morph) -208 - -M. ctenifer +208 + +M. ctenifer Hull syn. nov. -209 - -M. capensis +209 + +M. capensis (Macquart) -210 - -M. chapini +210 + +M. chapini Curran -211 - -M. copelandi +211 + +M. copelandi sp. nov. -212 - -M. cyanipennis +212 + +M. cyanipennis (Bezzi) -213 - -M. ingratus +213 + +M. ingratus (Loew) -214 - -M. longipilosus +214 + +M. longipilosus sp. nov. -215 - -M. madagascariensis +215 + +M. madagascariensis Keiser -216 - -M. minor +216 + +M. minor (Bezzi). - -Genitalia + +Genitalia (Fig. -227 +227 ). Epandrium: Dorsal lobe of surstylus short, broadly rounded; covered in short black spines and some longer pile. Ventral lobe of surstylus straight; bare. - - -Figures 217-228. - -Mesembrius + + +Figures 217-228. + +Mesembrius spp., male genitalia, lateral view -217 - -M. nigriceps +217 + +M. nigriceps Curran -218 - -M. perforatus +218 + +M. perforatus (Speiser) -219 - -M. platytarsis +219 + +M. platytarsis Curran syn. nov. -220 - -M. regulus +220 + +M. regulus (Hull) -221 - -M. rex +221 + +M. rex Curran -222 - -M. senegalensis +222 + +M. senegalensis (Macquart) -223 - -M. simplicipes +223 + +M. simplicipes Curran -224 - -M. strigilatus +224 + +M. strigilatus (Bezzi) -225 - -M. sulcus +225 + +M. sulcus sp. nov. -226 - -M. tarsatus +226 + +M. tarsatus (Bigot) -227 - -M. tibialis +227 + +M. tibialis sp. nov -. 228 - -M. vockerothi +. 228 + +M. vockerothi sp. nov. - -Female. -Unknown. + +Female. +Unknown. - -Distribution. -Togo. + +Distribution. +Togo. - -Comments. -This is a new species that is only known from three males from Kloto Forest, Togo. + +Comments. +This is a new species that is only known from three males from Kloto Forest, Togo. - -Etymology. - + +Etymology. + The specific epithet - -Mesembrius tibialis + +Mesembrius tibialis is derived from the Latin word -tibia +tibia (pertaining to the tibia) and was chosen in reference to the mesotibia, which is curved and proximally compressed. It is to be treated as an adjective (nominative singular masculine). diff --git a/data/72/20/A2/7220A207FAF45ACBA7C83B7B13D2F214.xml b/data/72/20/A2/7220A207FAF45ACBA7C83B7B13D2F214.xml index 4f75413d2ee..7aa88d1db41 100644 --- a/data/72/20/A2/7220A207FAF45ACBA7C83B7B13D2F214.xml +++ b/data/72/20/A2/7220A207FAF45ACBA7C83B7B13D2F214.xml @@ -1,1043 +1,1043 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius chapini Curran, 1939 -Figs 8 -, 31 -, 51 -, 72 -, 88 -, 111 -, 130 -, 151 -, 169 -, 186 -, 201 -, 210 + + + +Mesembrius chapini Curran, 1939 +Figs 8 +, 31 +, 51 +, 72 +, 88 +, 111 +, 130 +, 151 +, 169 +, 186 +, 201 +, 210 - - -Mesembrius chapini + + +Mesembrius chapini Curran, 1939: 10. - -Mesembrius chapini + +Mesembrius chapini - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius chapini + +Differential diagnosis. + + +Mesembrius chapini males have a profemur with a thick and dense, golden apical pile brush. The metafemur is long and slender with some long, black thick pile in the ventral middle. The metatibia has a shallow anterior depression in the middle and a deeper depression on the ventral side of the distal end; the ventral side has a carina. The male is easily distinguished by the thick golden yellow to orange apical pile brush of the profemur and the series of minute, black spines in the ventroproximal section of the metafemur. Females have a frons which is black pilose on its entire length, except laterally. It can be distinguished from the female of - -M. sulcus + +M. sulcus sp. nov. and - -M. tarsatus + +M. tarsatus by the yellow-brown to chocolate-brown tibiae (black in - -M. sulcus + +M. sulcus sp. nov. and - -M. tarsatus + +M. tarsatus ). It differs from the female of - -M. rex + +M. rex and - -M. regulus + +M. regulus by the very conspicuous black pile over the entire length of the protibia (absent in - -M. rex + +M. rex ; restricted to distal half in - -M. regulus + +M. regulus ) and by the dark brown to black protarsus (yellow-brown to chocolate-brown in - -M. rex + +M. rex and - -M. regulus + +M. regulus ). The legs are very dark, but especially the tibiae are yellow-brown to chocolate-brown. The protibia has conspicuous black pile over its entire length. Wing cell r1 is distinctly open. - - -Figures 21, 22. -21 - -Mesembrius + + +Figures 21, 22. +21 + +Mesembrius spp., habitus, lateral view. - -M. simplicipes + +M. simplicipes Curran (♂) -22 - -M. strigilatus +22 + +M. strigilatus (Bezzi) (♂). - -Examined material. - - -Mesembrius chapini + +Examined material. + + +Mesembrius chapini - + Curran: -Holotype +Holotype , male, " -Mesembrius +Mesembrius // -Mesembrius chapini +Mesembrius chapini // -♂ +♂ // -Holotype +Holotype // -Curran +Curran " " -Lukolela +Lukolela // left bank // -Congo +Congo R. - + 1°5 - + 'S/ -7.I.1931 +7.I.1931 " " -J.P. Chapin +J.P. Chapin // Ac. 31300" [AMNH]. Type studied from picture on the website. - - -Figures 23, 24. - -Mesembrius + + +Figures 23, 24. + +Mesembrius spp., habitus, lateral view - -23 - -M. sulcus + +23 + +M. sulcus sp. nov. ( -♂ +♂ ) - -24 - -M. tarsatus + +24 + +M. tarsatus (Bigot) ( -♂ +♂ ). - -Other material - - -Benin + +Other material + + +Benin • -2♂♂ +2♂♂ ; - -Ahozon + +Ahozon ; date unknown; -G. Goergen +G. Goergen leg.; IITA • -3♂♂ -2♀♀ +3♂♂ +2♀♀ ; - -Calavi + +Calavi ; -Apr 2014 +Apr 2014 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Cotonou + +Cotonou ; -16-18 Jan 2016 +16-18 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -1♀ +1♂ +1♀ ; - -Cotonou + +Cotonou ; -1 Nov 2013 +1 Nov 2013 ; -G. Goergen +G. Goergen and -K. Jordaens +K. Jordaens leg.; KMMA • -1♂ +1♂ ; - -Cotonou + +Cotonou ; -28 Jan 2016 +28 Jan 2016 ; -K. Jordaens +K. Jordaens leg.; KMMA • -1♂ +1♂ ; - -Dangbo + +Dangbo ; -13 Jun 2015 +13 Jun 2015 ; -G. Goergen +G. Goergen leg.; KMMA • -2♂♂ +2♂♂ ; - -Lokossa + +Lokossa ; -Nov 2005 +Nov 2005 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Niaouli + +Niaouli ; -15 Jan 1998 +15 Jan 1998 ; -G. Goergen +G. Goergen leg.; IITA • -2♂♂ -1♀ +2♂♂ +1♀ ; - -Pahou + +Pahou ; -11 Jan 2014 +11 Jan 2014 ; -G. Goergen +G. Goergen leg.; IITA • -2♀♀ +2♀♀ ; - -Porto Novo + +Porto Novo ; -28 Nov 2002 +28 Nov 2002 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Porto Novo + +Porto Novo ; -Oct 2004 +Oct 2004 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Porto Novo + +Porto Novo ; -27 Jan 2016 +27 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Porto Novo + +Porto Novo ; -Jan 2016 +Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • -2♂♂ +2♂♂ ; -5♀♀ +5♀♀ ; - -Porto Novo + +Porto Novo ; -20 Jan 2018 +20 Jan 2018 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -12♀♀ +1♂ +12♀♀ ; - -Porto Novo + +Porto Novo ; -27 Jan 2016 +27 Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; - -Porto Novo + +Porto Novo ; -27 Jan 2016 +27 Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; IITA • -5♂♂ -8♀♀ +5♂♂ +8♀♀ ; - -Porto Novo + +Porto Novo ; -7 Mar 2018 +7 Mar 2018 ; -G. Goergen +G. Goergen & -K. Jordaens +K. Jordaens leg.; KMMA • -4♂♂ +4♂♂ ; - -Porto Novo + +Porto Novo ; date unknown; -K. Jordaens +K. Jordaens leg.; KMMA . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♀ +1♀ ; - -Tshopo + +Tshopo , -Basoko +Basoko ; -Oct 1948 +Oct 1948 ; -P.L.G. Benoit +P.L.G. Benoit leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Jul 1936 +Jul 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; KMMA ; -1♂ +1♂ ; - -Equateur + +Equateur , -Eala +Eala ; -Mar 1936 +Mar 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♂ +1♂ ; - -Equateur + +Equateur , -Eala +Eala ; -5 Apr 1935 +5 Apr 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♂ +1♂ ; - -Equateur + +Equateur , -Eala +Eala ; -Sep 1935 +Sep 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Jan 1936 +Jan 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -2♂♂ -2♀♀ +2♂♂ +2♀♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Feb 1936 +Feb 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -5♂♂ -1♀ +5♂♂ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Mar 1936 +Mar 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Sep 1936 +Sep 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -28 Sep 1936 +28 Sep 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♂ -2♀♀ +1♂ +2♀♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Dec 1936 +Dec 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♂ +1♂ ; - -Equateur + +Equateur , -Eala +Eala ; -25 Jul 1935 +25 Jul 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -2♂♂ -1♀ +2♂♂ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Aug 1935 +Aug 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -1♂ +1♂ ; - -Equateur + +Equateur , -Eala +Eala ; -Sep 1935 +Sep 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -1♀ +1♀ ; - -Equateur + +Equateur , -Eala +Eala ; -Dec 1935 +Dec 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN • -1♀ +1♀ ; - - -Leopoldville + + +Leopoldville [= -Kinshasa +Kinshasa ]; -1 Jun 1915 +1 Jun 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA . - -Nigeria + +Nigeria • -1♂ +1♂ ; - -Ibadan + +Ibadan , IITA -Station +Station ; -18 Nov 2004 +18 Nov 2004 ; -G. Goergen +G. Goergen leg.; IITA . - - -Figures 25, 26. - -Mesembrius + + +Figures 25, 26. + +Mesembrius spp., habitus, lateral view - -25 - -M. tibialis + +25 + +M. tibialis sp. nov. ( -♂ +♂ ) - -26 - -M. vockerothi + +26 + +M. vockerothi sp. nov. ( -♂ +♂ ). - -Re-description male - - + +Re-description male + + (Fig. -8 +8 ). Body length: 14.0-17.2 mm. Wing length: 10.2-11.3 mm. - - -Figures 27, 28. - -Mesembrius + + +Figures 27, 28. + +Mesembrius spp., habitus, lateral view -27 - -M. caffer +27 + +M. caffer (Loew) (nominal morph) (♀) -28 - -M. caffer +28 + +M. caffer (Loew) (spined morph) (♀). - -Head + +Head (Fig. -51 +51 ). Eyes bare; holoptic, eye contiguity almost as long as length of ocellar triangle. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; yellow pollinose on ventral half. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Frontal triangle short; yellow-white; with some long, black pile; yellow pollinose. Frontal prominence shiny black with orange-brown apex. Occiput yellow; yellow pilose; with some shorter and thicker black pile near eye margin; yellow and white pollinose. Antenna, scape and pedicel reddish-brown; postpedicel black; antennal arista reddish-brown. - - -Figures 29, 30. - -Mesembrius + + +Figures 29, 30. + +Mesembrius spp., habitus, lateral view -29 - -M. ctenifer +29 + +M. ctenifer syn. nov. Hull (♀) -30 - -M. capensis +30 + +M. capensis (Macquart) (♀). - -Thorax. + +Thorax. Scutum black with dorsally a pair of well-demarcated yellow vittae which are largely connected posteriorly. Scutum with faint lateral vitta; yellow and black pilose. Scutellum uniformly yellow-brown; with long yellow and shorter black pile. - - -Figures 31, 32. - -Mesembrius + + +Figures 31, 32. + +Mesembrius spp., habitus, lateral view -31 - -M. chapini +31 + +M. chapini Curran (♀) -32 - -M. cyanipennis +32 + +M. cyanipennis (Bezzi) (♀). - -Legs. + +Legs. All legs chocolate-brown; tarsi chocolate-brown. Proleg (Fig. -151 +151 ): Femur dorsoventrally flattened; posterodorsal side with sparse, long black and yellow pile in proximal half; with apical pile brush of long, dense and curved yellow thick pile, this yellow pile is longer in the distal 1/3 and is interspersed with equally long black pile; ventrally with long, black pile. Basitarsus without tuft of orange or black pile posteriorly. Mesoleg: Femur with long, yellow pile on proximal 2/3 and long black pile on distal 1/3. Tibia and tarsi black pilose. Metaleg (Fig. -186 +186 ): Femur long and thin, slightly curved pile; pile on dorsal and anterior side inconspicuous, except for some long, black pile at anterior distal end; patch of long yellow pile on proximal part; with row of very short and thick black spines on ventral distal half; with 2-5 very long, thick black pile in ventral middle; posteriorly with loose, long yellow and black pile which becomes denser at distal end. Tibia with long, black pile, especially in distal 2/3; anteriorly with shallow excavation in the middle; posteriorly with deep and broad bare excavation in proximal 1/3. Tarsi black pilose dorsally, orange pilose ventrally. - - -Figures 33, 34. - -Mesembrius + + +Figures 33, 34. + +Mesembrius spp., habitus, lateral view -33 - -M. maculifer +33 + +M. maculifer Hull (♀) -34 - -M. madagascariensis +34 + +M. madagascariensis Keiser (♀). - -Wing + +Wing (Fig. -130 +130 ). Entire wing dark, uniformly dense microtrichose. - - -Figures 35, 36. - -Mesembrius + + +Figures 35, 36. + +Mesembrius spp., habitus, lateral view -35 - -M. minor +35 + +M. minor (Bezzi) (♀) -36 - -M. morio +36 + +M. morio (Bezzi) (♀). - -Abdomen + +Abdomen (Fig. -88 +88 ). Tergite II with pair of very large, yellow rounded maculae; black markings hourglass-shaped; anterior and posterior black markings equal in size marking, but posterior black marking with stronger white pollinosity; yellow and black pilose, but black pile more conspicuous in posterior half of tergite and somewhat denser in posterolateral corners. Tergite III and IV with broad yellow fascia; black markings on posterior half vague because of white pollinosity, but more pronounced in medial part; black and yellow pilose, but black pile rare in anterior 1/4. - - -Figures 37, 38. - -Mesembrius + + +Figures 37, 38. + +Mesembrius spp., habitus, lateral view -37 - -M. platytarsis +37 + +M. platytarsis syn. nov. Curran (♀) -38 - -M. regulus +38 + +M. regulus (Hull) (♀). - -Genitalia + +Genitalia (Fig. -210 +210 ). Epandrium: Dorsal lobe of surstylus short, broadly rounded; with short black spines on almost entire surface. Ventral lobe of surstylus straight; bare. - - -Figures 39, 40. - -Mesembrius + + +Figures 39, 40. + +Mesembrius spp., habitus, lateral view -39 - -M. rex +39 + +M. rex Curran (♀) -40 - -M. senegalensis +40 + +M. senegalensis (Macquart) (♀). - -Description female - - + +Description female + + (Fig. -31 +31 ). Body length: 13.3-16.3 mm. Wing length: 10.2-11.0 mm. - - -Figures 41, 42. - -Mesembrius + + +Figures 41, 42. + +Mesembrius spp., habitus, lateral view -41 - -M. simplicipes +41 + +M. simplicipes Curran (♀) -42 - -M. strigilatus +42 + +M. strigilatus (Bezzi) (♀). - -Head + +Head (Fig. -72 +72 ). Eye bare; dichoptic. Face yellow-orange with dark medial vitta; white pilose; white pollinose. Frons black; black pilose in dorsal half, black and yellow pilose on ventral half; weakly white pollinose. Distance between lateral ocellus and eye margin approx. width of ocellus. Occiput black; yellow pilose, with some black pile near eye margin; yellow-white pollinose. Frontal prominence shiny black, distal end orange-brown; scape and pedicel orange-brown; postpedicel black; antennal arista reddish-brown. - - -Figures 43, 44. - -Mesembrius + + +Figures 43, 44. + +Mesembrius spp., habitus, lateral view -43 - -M. sulcus +43 + +M. sulcus sp. nov. (♀) -44 - -M. tarsatus +44 + +M. tarsatus (Bigot) (♀). - -Thorax. + +Thorax. Scutum dark brown to black with dorsolateral a pair of vague, grey pollinose vittae which are connected posteriorly; grey pollinose lateral vitta very vague; yellow pilose with some black pile interspersed. Scutellum yellow-orange; yellow pilose with very sparse, shorter black pile interspersed. - - -Figure 45. - -Mesembrius + + +Figure 45. + +Mesembrius spp., habitus, lateral view. - -M. vockerothi + +M. vockerothi sp. nov. (♀). - -Legs + +Legs (Figs -169 +169 , -201 +201 ). All femora black, except for extreme distal ends which are orange-brown; yellow pilose. All tibia orange-brown, most distal tarsomere darkened; yellow and black pilose dorsally, yellow pilose ventrally. All tarsi orange-brown; black pilose, except for protarsus which is yellow-orange pilose ventrally. - -Wing. + +Wing. Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -111 +111 ). Tergite II with a pair of large, orange, rounded maculae; yellow pilose, with dense short thick black pile on posterior black marking. Tergite III with orange fascia in anterior half and black marking in posterior half; yellow pilose with dense short thick black pile on posterior black marking. Tergite IV with narrow orange fascia; yellow-orange pillose. Tergite V black; yellow pilose. - -Distribution. -Benin, Democratic Republic of the Congo and Nigeria. + +Distribution. +Benin, Democratic Republic of the Congo and Nigeria. - -Comments. -The female of the species was hitherto unknown. The male cannot be confused with any other species. + +Comments. +The female of the species was hitherto unknown. The male cannot be confused with any other species. \ No newline at end of file diff --git a/data/74/45/84/7445843A2C3757C4903ACFFDF002A473.xml b/data/74/45/84/7445843A2C3757C4903ACFFDF002A473.xml index f17d2245cae..7f416f56462 100644 --- a/data/74/45/84/7445843A2C3757C4903ACFFDF002A473.xml +++ b/data/74/45/84/7445843A2C3757C4903ACFFDF002A473.xml @@ -1,227 +1,227 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius copelandi Jordaens, Goergen & De Meyer -sp. nov. -Figs 9 -, 52 -, 89 -, 131 -, 199 -, 211 + + + +Mesembrius copelandi Jordaens, Goergen & De Meyer +sp. nov. +Figs 9 +, 52 +, 89 +, 131 +, 199 +, 211 - -Differential diagnosis. - + +Differential diagnosis. + Males of - -Mesembrius copelandi + +Mesembrius copelandi sp. nov. lack an apical pile brush on the profemur and have an unmodified metatibia. The ventral 1/4 of the profemur is black pilose with some longer yellow pile antero- and posteroventrally. The metaleg has long, yellow pile which becomes darker on the tarsi; the pile is much shorter on the posterior side. The metafemur has a patch of conspicuous black pile on the proximal 1/5 ventrally. The metabasitarsus is very long and almost as long as the metatibia; in all other species, the metabasitarsus is much shorter than the metatibia. The female is unknown. - -Examined material. - - -Mesembrius copelandi + +Examined material. + + +Mesembrius copelandi - + Jordaens, Goergen & De Meyer: -Holotype +Holotype , male, - + " -HOLOTYPUS +HOLOTYPUS " " -Kenya +Kenya // -Nairobi Prov. +Nairobi Prov. // ICIPE campus // -Kasarani +Kasarani , -1.22296°S +1.22296°S , // -36.89704°E +36.89704°E , - -1600 m + +1600 m " " - -6 m + +6 m -Malaise +Malaise trap, near // stream, woodland // remnant, 17-25 JAN // 2017, -R. Copeland +R. Copeland " " -Mesembrius copelandi +Mesembrius copelandi // - -Det. K. Jordaens + +Det. K. Jordaens , 2019" "DNA 1301F04 // -K. Jordaens +K. Jordaens // RMCA 2020" "ICIPE 1180" [KMMA] - - -Paratype + + +Paratype : -Kenya +Kenya • -1♂ +1♂ ; -Sosoma area +Sosoma area ; -30 Jun-6 Jul 2018 +30 Jun-6 Jul 2018 ; -R. Copeland +R. Copeland leg.; ICIPE 9544; ICIPE . - -Description male - - + +Description male + + (Fig. -9 +9 ). Body length: 13.7-14.7 mm. Wing length: 9-10.5 mm. - -Head + +Head (Fig. -52 +52 ). Eyes bare; slightly dichoptic, distance between eyes approx. 1/2 width of ocellus. Face white-yellow with dark medial vitta; white pollinose; white pilose. Vertical triangle black pilose, with some yellow pile near vertex; yellow pollinose until just before anterior ocellus. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Occiput yellow; yellow pilose; yellow and white pollinose. Frontal triangle brownish; yellow pilose with a few black pile near antenna; yellow pollinose. Frontal prominence shiny black, dark brown at apex. Antenna, scape and pedicel reddish-brown; postpedicel black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black; with a pair of well-demarcated yellow vittae and a yellow medial line dorsally, vitta and medial line are broadly connected posteriorly; with lateral, yellow vitta; yellow pilose with some black pile in the posterolateral corners. Scutellum uniformly yellow; yellow pilose. - -Legs. + +Legs. Tibia and tarsi entirely rufous, but metatarsi black dorsally. Proleg: Femur black, distal end rufous; without apical pile brush; pile ventrally black on distal 1/4, otherwise rufous. Tibia rufous; black and yellow pilose which is longer on posterior side. Basitarsus black and rufous pilose. Other tarsi black pilose. Mesoleg: Femur black, distal end rufous; yellow and black pilose. Tibia similar as in proleg, but black and yellow pile in proximal 1/4 of markedly longer than on remainder of tibia. Tarsi similar as in proleg. Metaleg (Fig. -199 +199 ): Femur black, distal end rufous; with long, thin yellow pile, but shorter and less dense ventrally and posteroventrally; with a band of black pile on extreme proximal end ventrally. Tibia rufous; unmodified; long yellowish pilose, except for the posterior side where pile shorter and black; with a patch of posteroventral longer black pile. Basitarsus black dorsally, rufous ventrally; very long, almost as long as tibia; very long yellow pilose with some long black pile at distal end. Other tarsi black dorsally, rufous ventrally; very long yellow pilose with some long black pile at distal end. - -Wing + +Wing (Fig. -131 +131 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -89 +89 ). Tergite II with a pair of large, yellow rectangular maculae; black marking hourglass-shaped; posterior black marking equal in size or somewhat narrower than anterior black marking. Posterior black part with short, stiff black setulae which to not extend to the lateral tergal sides. Tergite III and IV with yellow fascia of variable size, often occupying almost the entire tergite with mostly posterior, triangular black marking. Tergite V strongly white pollinose, except for a black medial zone; with short, black stiff setulae at posteriorly which do not reach the lateral tergal sides, these setulae are absent in specimens where the posterior black marking is strongly reduced. - -Genitalia + +Genitalia (Fig. -211 +211 ). Epandrium: Dorsal lobe of surstylus elongated, distally rounded, with characteristic small tooth-like projection; dorsally long yellow pilose, short black pilose at distal end. Ventral lobe of surstylus with one large black setula in middle section and a row of approximately ten long black setulae. - -Female. -unknown. + +Female. +unknown. - -Distribution. -Kenya. + +Distribution. +Kenya. - -Comments. - + +Comments. + This is a new species to the Afrotropical Region. The species is only known from two males from Kenya. Two DNA barcodes are available (Fig. -229 +229 ) and the species is strongly differentiated from others. - -Etymology. -Named in honour of Robert Copeland (ICIPE) who collected both males. The specific epithet should be treated as a noun in the genitive case. + +Etymology. +Named in honour of Robert Copeland (ICIPE) who collected both males. The specific epithet should be treated as a noun in the genitive case. \ No newline at end of file diff --git a/data/76/2E/8C/762E8C6BA67D5D0E831DFC9035491346.xml b/data/76/2E/8C/762E8C6BA67D5D0E831DFC9035491346.xml index 6abb3dad7b2..0703a0482d2 100644 --- a/data/76/2E/8C/762E8C6BA67D5D0E831DFC9035491346.xml +++ b/data/76/2E/8C/762E8C6BA67D5D0E831DFC9035491346.xml @@ -1,378 +1,378 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius sulcus Jordaens, Goergen & De Meyer -sp. nov. -Figs 23 -, 43 -, 66 -, 80 -, 103 -, 124 -, 147 -, 155 -, 164 -, 176 -, 187 -, 225 + + + +Mesembrius sulcus Jordaens, Goergen & De Meyer +sp. nov. +Figs 23 +, 43 +, 66 +, 80 +, 103 +, 124 +, 147 +, 155 +, 164 +, 176 +, 187 +, 225 - -Differential diagnosis. - - -Mesembrius sulcus + +Differential diagnosis. + + +Mesembrius sulcus sp. nov. males have an apical pile brush on the profemur of thick and dense black pile dorsally and yellow pile ventrally. The metafemur is very long and slender and has long yellow pile throughout and shorter, yellow and black pile on the ventral side. The metatibia has a deep groove on the posterior proximal half which is bordered by long black pile. The probasitarsus has a tuft of long black pile on the posterior side. The male differs from any other species in the colour of the apical pile brush (except from - -M. tibialis + +M. tibialis sp. nov.) which is black dorsally and golden-yellow ventrally (yellow-orange in - -M. chapini + +M. chapini ; dark-brown to black in other species). It differs from - -M. tibialis + +M. tibialis sp. nov. in the entirely orange probasitarsus (orange and black in - + M -Mesembrius tibialis +Mesembrius tibialis sp. nov.), in the presence of a deep groove in the posterior proximal half of the metatibia (absent in - -M. tibialis + +M. tibialis sp. nov.) and in the unmodified mesotibia (proximal half strongly compressed in - -M. tibialis + +M. tibialis sp. nov.). Females have a frons which is black pilose on its entire length, except laterally. It can be distinguished from other such females (except from - -M. tarsatus + +M. tarsatus ) by the black legs, including the tibiae (tibiae yellow-brown in other species). It differs from the female of - -M. tarsatus + +M. tarsatus in tergite II, which has a pair of small yellow-orange maculae that laterally reach to halfway of the tergite length (almost to posterior end in - -M. tarsatus + +M. tarsatus ) and in tergite III which has a pair of vague anterolateral yellow-orange maculae (clear pair of maculae in - -M. tarsatus + +M. tarsatus ). - -Examined material. - - -Mesembrius sulcus + +Examined material. + + +Mesembrius sulcus - + Jordaens, Goergen & De Meyer: -Holotype +Holotype , male, - + " -HOLOTYPUS +HOLOTYPUS " -"MUSEE +"MUSEE DU -CONGO +CONGO // -Ituri +Ituri : -Nioka +Nioka // - -VII-1934 +VII-1934 // -J. Leroy +J. Leroy " " -van Doesburg +van Doesburg det., 1956 // -Mesembrius +Mesembrius // spec.?nov. -♂ +♂ " "RMCA ENT // 000030186" [KMMA]. - - - - -Paratypes + + + + +Paratypes : -Malawi +Malawi • -1♂ +1♂ ; -Mount -Mulanje +Mount +Mulanje ; -17 Oct 1913 +17 Oct 1913 ; -S.A. Neave +S.A. Neave leg.; NHMUK 013428977 • - -1♂ + +1♂ ; -Zomba +Zomba ; -Feb 1911 +Feb 1911 ; -J.E.G. Old. Leg. +J.E.G. Old. Leg. ; NHMUK • - -2♂♂ + +2♂♂ ; -Mount -Mulanje +Mount +Mulanje ; -17 Oct 1913 +17 Oct 1913 ; -S.A. Neave +S.A. Neave leg.; NHMUK . - -Kenya + +Kenya • -3♂♂ -3♀♀ +3♂♂ +3♀♀ ; -Nairobi +Nairobi , -Karura Forest +Karura Forest ; -2 Dec 2017 +2 Dec 2017 ; -K. Jordaens +K. Jordaens leg.; ICIPE . - -South Africa + +South Africa • -1♂ +1♂ ; -Port St. Johns +Port St. Johns ; -1-31 Oct 1969 +1-31 Oct 1969 ; -E. and W. Gess +E. and W. Gess leg.; AMGS . - -Description male - - + +Description male + + (Fig. -23 +23 ). Body length: 14.0-15.6 mm. Wing length: 10.2-11.5 mm - -Head + +Head (Fig. -66 +66 ). Eyes bare; holoptic, eye contiguity approx. as long as length of ocellar triangle. Face yellow to orange with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; yellow pollinose on medium third. Distance between lateral ocellus and eye margin slightly less than width of ocellus. Occiput yellow; yellow pilose with some shorter and thicker black pile near eye margin; yellow and white pollinose. Frontal triangle short; yellow-white; with some long, yellow and black pile; white pollinose. Frontal prominence shiny black with orange-brown apex. Antenna, scape and pedicel reddish-brown; postpedicel black, white pollinose; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black with dorsally a pair of very faint white pollinose vittae; lateral white pollinose vitta very faint; yellow pilose. Scutellum uniformly yellow-brown; long yellow pilose with some very short black pile on posterior half. - -Legs. + +Legs. All legs chocolate-brown to black, but protarsus orange. Proleg (Figs -155 +155 , -164 +164 ): Femur dorsoventrally flattened; with long yellow pile posterodorsally; with apical pile brush of thick black pile dorsally and thick yellow pile ventrally; with short and black thick pile at proximal end. Basitarsus orange; with a tuft of black pile posteriorly. Other tarsi orange; with sparse short black pile. Mesoleg (Fig. -176 +176 ): Femur, ventrally with long yellow pile on proximal 2/3 and shorter black pile on distal 1/3, with some long black pile interspersed in middle section. Metaleg (Fig. -187 +187 ): Femur long and thin, slightly curved; with yellow pile anterodorsally; with some denser shorter and black pile at distal ventral end. Tibia with long black pile; posteriorly with deep and broad excavation in proximal half which is bordered with long black pile. - -Wing + +Wing (Fig. -147 +147 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -103 +103 ). Tergite II with a pair of very large, yellow, more or less triangular maculae; black marking hourglass-shaped; posterior and anterior black marking slightly connected in the middle; posterior marking with strong white pollinosity; yellow pilose, except for black pile at posterior border of posterior black marking. Tergite III and IV with orange fascia; black marking on posterior half strong white pollinose; black pilose in medial part of black marking, yellow pilose on orange fascia and lateral parts of black marking. - -Genitalia + +Genitalia (Fig. -225 +225 ). Epandrium: Dorsal lobe of surstylus broadly rounded; with short black spines on almost entire surface; dorsally long yellow pilose. Ventral lobe of surstylus straight; bare. - -Description female - - + +Description female + + (Fig. -43 +43 ). Body length: 11.2-13.4 mm. Wing length: 12.7-16.6 mm. - -Head + +Head (Fig. -80 +80 ). Eyes bare; dichoptic. Face white with dark medial vitta; white pilose; white pollinose. Frons black; black pilose in dorsal half and medial ventral half, yellow pilose on lateral sides of ventral half; yellow-white pollinose, especially in ventral half. Distance between lateral ocellus and eye margin -11/2x +11/2x width of ocellus. Occiput black; yellow pilose, with some black pile near eye margin; yellow-white pollinose. Frontal prominence shiny black. Antenna, scape and pedicel orange-brown; postpedicel black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum dark brown to black with dorsally a pair of vague brown pollinose vittae which are connected posteriorly; yellow pilose with some black pile interspersed. Scutellum dark brown with lighter posterior border; yellow pilose. - -Legs. + +Legs. All femora, tibiae and metatarsi dark brown to black, except for extreme distal ends which are reddish-brown (as in - -M. tarsatus + +M. tarsatus ; Fig. -168 +168 ); yellow pilose; metatibia with short black spines on posteroventral 1/3. Pro- and mesotarsi orange; most distal tarsomere darkened distally, sometimes all tarsi darkened; dorsally short black pilose, ventrally short yellow pilose. - -Wing. + +Wing. Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -124 +124 ). Tergite II black; yellow pilose with some very short thick black pile on black markings; with a pair of L-shaped, small orange maculae; white pollinose, especially in the central area of the posterior black marking. Tergite III black; yellow pilose with short thick black pile interspersed, especially in the posterior half; with a pair of small orange maculae in the anterolateral corners. Tergite IV as tergite III, but without orange maculae. Tergite V black; yellow pilose. - -Distribution. -Democratic Republic of the Congo, Kenya, Malawi and South Africa. + +Distribution. +Democratic Republic of the Congo, Kenya, Malawi and South Africa. - -Comments. - + +Comments. + This is a new species to the Afrotropical Region with a relatively wide distribution. The species morphologically resembles - -M. tarsatus + +M. tarsatus , which appears to be its sister species (see Fig. -230 +230 ), but the males differ markedly in the morphology of the metafemur. Females are very similar to females of - -M. tarsatus + +M. tarsatus . The mean -p +p -distance for the DNA barcoding is relatively low (1.6 %), but differences are consistent (i.e. no barcodes are shared between the species) (Fig. -229 +229 ). - -Etymology. - + +Etymology. + The specific epithet - -Mesembrius sulcus + +Mesembrius sulcus (Latin) means groove (noun in apposition) and was chosen with reference to the deep groove on the metatibia. It is to be treated as an adjective (nominative singular masculine). diff --git a/data/76/91/EC/7691ECD7246651228DCD1D9BE08E00EC.xml b/data/76/91/EC/7691ECD7246651228DCD1D9BE08E00EC.xml index 7aa1a5400ac..b5de17f3791 100644 --- a/data/76/91/EC/7691ECD7246651228DCD1D9BE08E00EC.xml +++ b/data/76/91/EC/7691ECD7246651228DCD1D9BE08E00EC.xml @@ -1,280 +1,280 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius nigriceps Curran, 1927 -Figs 15 -, 58 -, 95 -, 139 -, 192 -, 217 + + + +Mesembrius nigriceps Curran, 1927 +Figs 15 +, 58 +, 95 +, 139 +, 192 +, 217 - - -Mesembrius nigriceps + + +Mesembrius nigriceps Curran, 1927: 63. - -Mesembrius nigriceps + +Mesembrius nigriceps - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius nigriceps + +Differential diagnosis. + + +Mesembrius nigriceps males lack an apical pile brush on the profemur and have a metatibia which is curved, but less than in - -M. strigilatus + +M. strigilatus . The face ground colour is black (white to yellow in - -M. strigilatus + +M. strigilatus ). The metafemur is curved, has a patch of conspicuous black pile at the base and, perpendicular to this, a stretch of dense black pile on the ventroposterior side. The male is distinguished from any other species (except from - -M. strigilatus + +M. strigilatus ) by the strongly curved metafemur and metatibia. It differs from - -M. strigilatus + +M. strigilatus in the colour of the face (white to yellow in - -M. strigilatus + +M. strigilatus ; black in - -M. nigriceps + +M. nigriceps ), in the size and shape of the maculae on tergite II which are small and nearly triangular (large and rounded in - -M. strigilatus + +M. strigilatus ) and by the broader black medial marking on tergite II (narrow in - + M -Mesembrius strigilatus +Mesembrius strigilatus ). The female is unknown. - -Examined material. - - -Mesembrius nigriceps + +Examined material. + + +Mesembrius nigriceps - + Curran: -Holotype +Holotype , male, " -Mesembrius +Mesembrius // TYPE // -Mesembrius nigriceps +Mesembrius nigriceps // Curran" "Taken from Bembex" "Stanleyville, Cgo. // -25°10'E +25°10'E , -0°30'N +0°30'N // -III.1915 +III.1915 " "Lang & Chapin // Collectors" [AMNH]. -Type +Type studied from picture on website. - -Other material - - -Ghana + +Other material + + +Ghana • -1♂ +1♂ ; -Eastern Region +Eastern Region , N of -Kibi +Kibi , -Atewa Range Forest Reserve +Atewa Range Forest Reserve ; -21 Jun 2006 +21 Jun 2006 ; -K.-D.B. Dijkstra +K.-D.B. Dijkstra leg.; MZH . - -Togo + +Togo • -1♂ +1♂ ; -Kloto Forest +Kloto Forest ; -Mar 2004 +Mar 2004 ; -G. Goergen +G. Goergen leg.; IITA . - -Re-description male - - + +Re-description male + + (Fig. -15 +15 ). Body length: 11.0 mm. Wing length: 8.4 mm. - -Head + +Head (Fig. -58 +58 ). Eyes bare; slightly dichoptic, distance between eyes approx. width of ocellus. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; lower half weakly white pollinose. Distance between lateral ocellus and eye margin somewhat less than width of ocellus. Frontal triangle black; white pilose; grey pollinose at the sides. Frontal prominence shiny black; black pilose. Occiput black; yellow pilose with a stretch of black pile near the eye margin; grey-white pollinose. Antenna black; antennal arista brown. - -Thorax. + +Thorax. Scutum black with, dorsally, a pair of faint yellow vittae which fade out posteriorly; lateral yellow vitta very faint; yellow-rufous pilose. Scutellum uniformly yellow-brown; yellow-rufous pilose, with some short black pile interspersed, especially in the posterior half. - -Legs. + +Legs. Femora and entire metaleg dark brown to black; pro- and mesofemora and tarsi dark brown; tarsi without a small darkened medial patch. Proleg: Femur without apical pile brush; short black pilose dorsally, long black pilose ventrally, long yellow pilose posteriorly. Tibia long yellow pilose and short black pilose, except for a row of long black pile posterodorsally. Tarsi black pilose dorsally, yellow-orange pilose ventrally. Mesoleg: Femur similar to profemur, but with long, black pile on posterior and posteroventral side and with black pile on anterodorsal side which is markedly longer in the proximal half. Tibia yellow pilose ventrally, except at extreme distal end, where it is also black; short black pilose dorsally; long black pilose anterordorsally, especially in proximal 1/2. Tarsi black pilose dorsally, yellow-orange pilose ventrally, with some thick black pile on ventral side. Metaleg (Fig. -192 +192 ): Femur weakly curved; thickened in distal 1/3; with long yellow pile on anterior and anteroventral side; ventrally with dense, long black pile in proximal 1/3 and less thick and less dense black pile elsewhere; no swelling on the mid-section of the ventral side. Tibia strongly curved, especially from posterior view; flattened; with very long, black pile on dorsal and ventral side. Tarsi black pilose dorsally, yellow-orange pilose ventrally. - -Wing + +Wing (Fig. -139 +139 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -95 +95 ). Tergite II with a pair of large, triangular, yellow maculae; anterior and posterior black markings equal in size and with broad medial black marking; black markings with short, stiff black setulae which do not extend to the lateral sides; strongly yellow-orange pilose. Tergite III with a pair of smaller, triangular to rounded yellow maculae in anterior half; strongly yellow-orange pilose. Tergite IV black; long yellow-orange pilose, especially on lateral sides. - -Genitalia + +Genitalia (Fig. -217 +217 ). Epandrium: Dorsal lobe of surstylus strongly bent, sickle-shaped, short yellow pilose on distal half; with long, thick black setulae at bend ventrally; distal half dorsally broadly convex; densely covered with long yellow pile and with some equally long, but thicker black pile interspersed. Ventral lobe of surstylus bare. - -Female. -Unknown. + +Female. +Unknown. - -Distribution. -Democratic Republic of the Congo, Ghana and Togo. + +Distribution. +Democratic Republic of the Congo, Ghana and Togo. - -Comments. - + +Comments. + The species is very similar in morphology to - -M. strigilatus + +M. strigilatus and they are sister species in the NJ phylogenetic analysis (but no support for such relationship in the ML analysis). Compared to - -M. strigilatus + +M. strigilatus , - -M. nigriceps + +M. nigriceps has a black face, a less curved metatibia, the yellow maculae on tergite II are smaller and more triangular and the yellow abdominal pile on abdominal tergite IV is not so strongly appressed on the sides. The male surstylus is morphologically also similar to that of - -M. strigilatus + +M. strigilatus , but the thin apex is much longer in - -M. nigriceps + +M. nigriceps and the dorsal surface of the distal half is more convex in - -M. nigriceps + +M. nigriceps . diff --git a/data/7D/70/79/7D70799903B2588EB4D2CD8993A771B3.xml b/data/7D/70/79/7D70799903B2588EB4D2CD8993A771B3.xml index 7a1c25a1f9b..395be0862ba 100644 --- a/data/7D/70/79/7D70799903B2588EB4D2CD8993A771B3.xml +++ b/data/7D/70/79/7D70799903B2588EB4D2CD8993A771B3.xml @@ -1,52 +1,52 @@ - - - -Notes on Ichneumoninae (Hymenoptera, Ichneumonidae) from southern China, with descriptions of one new genus and twelve new species + + + +Notes on Ichneumoninae (Hymenoptera, Ichneumonidae) from southern China, with descriptions of one new genus and twelve new species - - -Author + + +Author -Riedel, Matthias -https://orcid.org/0000-0001-5747-1223 -Blumenlage 22 C, D- 29683 Bad Fallingbostel, Germany -mamaflo.riedel@t-online.de +Riedel, Matthias +https://orcid.org/0000-0001-5747-1223 +Blumenlage 22 C, D- 29683 Bad Fallingbostel, Germany +mamaflo.riedel@t-online.de -text - - -Contributions to Entomology +text + + +Contributions to Entomology - -2023 - -2023-12-08 + +2023 + +2023-12-08 - -73 + +73 - -2 + +2 - -223 -248 + +223 +248 - -http://dx.doi.org/10.3897/contrib.entomol.73.e107542 + +http://dx.doi.org/10.3897/contrib.entomol.73.e107542 -journal article -http://dx.doi.org/10.3897/contrib.entomol.73.e107542 -2511-6428-2-223 -7FD0965E3F374137A55EA7F0C1A98659 -37C8C471EE2F591F8806F196018A347E +journal article +http://dx.doi.org/10.3897/contrib.entomol.73.e107542 +2511-6428-2-223 +7FD0965E3F374137A55EA7F0C1A98659 +37C8C471EE2F591F8806F196018A347E - + -Rugichneumon tricolor +Rugichneumon tricolor sp. nov. diff --git a/data/87/23/23/8723231101295135F454C0A0CE067F82.xml b/data/87/23/23/8723231101295135F454C0A0CE067F82.xml index 308849229ac..4a5cd68619c 100644 --- a/data/87/23/23/8723231101295135F454C0A0CE067F82.xml +++ b/data/87/23/23/8723231101295135F454C0A0CE067F82.xml @@ -1,61 +1,61 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus cybele Jameson & Wada, 2009 + + + +Peltonotus cybele Jameson & Wada, 2009 Figs 2-3, 37, 46, 58, 74 - -Diagnosis (male and female). - + +Diagnosis (male and female). + Length 14.5-16.5 mm, color overall castaneous, elytra castaneous suffused with dark red or reddish-brown and iridescent bloom (Figs 2-3), head with some unisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 not enlarged or obviously dorsoventrally flattened, mala lacking lamellate setal brush (Fig. 37), maxillary stipes without setae curled at apices -( +( Fig. 37), male protibia tridentate (Fig. 46), form of parameres (Fig. 58), female epipleuron incised and with rounded emargination (Fig. 74). - -Distribution. -Indonesia, Sumatra Island. + +Distribution. +Indonesia, Sumatra Island. \ No newline at end of file diff --git a/data/8B/34/81/8B3481DFE2735475A417BB3469539B9A.xml b/data/8B/34/81/8B3481DFE2735475A417BB3469539B9A.xml index cd5b90ab490..d61a013a9ff 100644 --- a/data/8B/34/81/8B3481DFE2735475A417BB3469539B9A.xml +++ b/data/8B/34/81/8B3481DFE2735475A417BB3469539B9A.xml @@ -1,294 +1,294 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius morio (Bezzi, 1915) -Figs 36 -, 74 -, 117 -, 138 + + + +Mesembrius morio (Bezzi, 1915) +Figs 36 +, 74 +, 117 +, 138 - - -Helophilus (Mesembrius) morio + + +Helophilus (Mesembrius) morio Bezzi, 1915: 98. - -Mesembrius morio + +Mesembrius morio - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius morio + +Differential diagnosis. + + +Mesembrius morio females are entirely black and cannot be confused with any other - -Mesembrius + +Mesembrius species. The male is unknown. - -Examined material. - - -Helophilus morio + +Examined material. + + +Helophilus morio - + Bezzi: -Holotype +Holotype , female, -"Holo-//type" +"Holo-//type" "Hel. (Mes.)//Type// -Helophilus morio +Helophilus morio //Bezzi" "Neguelo,//Usambara,// -German E. Africa +German E. Africa //Purchd. From// -H.Rolle. +H.Rolle. //1904-117." " -Mesembrius +Mesembrius // -Mesembrius morio +Mesembrius morio n.sp.//Type -♀ +♀ "; " NHMUK 013428952" [NHMUK]. - - - - -Paratype + + + + +Paratype : -Tanzania +Tanzania • -1♀ +1♀ ; -Usambara Mountains +Usambara Mountains , -Neguelo +Neguelo ; date unknown; -H. Rolle +H. Rolle leg.; NHMUK . - -Other material - - -Democratic Republic of the Congo + +Other material + + +Democratic Republic of the Congo • -1♀ +1♀ ; -Eala +Eala ; -24 Aug 1935 +24 Aug 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; KBIN . - -Malawi + +Malawi • -1♀ +1♀ ; -Mount -Mulanje +Mount +Mulanje ; -6 Nov 1913 +6 Nov 1913 ; -S.A. Neave +S.A. Neave leg.; NHMUK . - -Tanzania + +Tanzania • -2♀♀ +2♀♀ ; -Neguelo +Neguelo , -Usambara Mountains +Usambara Mountains ; date unknown; -H. Rolle +H. Rolle leg.; NHMUK . - -Uganda + +Uganda • -2♀♀ +2♀♀ ; -Entebbe +Entebbe ; -17 Jun 1972 +17 Jun 1972 ; -H. Falke +H. Falke leg.; CNC . - -Re-description female - - + +Re-description female + + (Fig. -36 +36 ). Body length: 12.7-13.5 mm. Wing length: 11.6-12.5 mm. - -Head + +Head (Fig. -74 +74 ). Eyes bare; dichoptic. Face black; black and white pilose; white pollinose. Frons black; black pilose; lower half white pollinose. Vertex black; black pilose; grey pollinose. Distance between lateral ocellus and eye margin approx. the width of ocellus. Occiput black; yellow and black pilose dorsally, yellow pilose more ventrally; grey pollinose. Frontal prominence shiny brown-black; black pilose. Antenna black; arista reddish-brown. - -Thorax. + +Thorax. Scutum and scutellum black; without vitta; short white and black pilose. - -Legs. + +Legs. Dark reddish-brown to black; short black and white pilose. - -Wing + +Wing (Fig. -138 +138 ). Entire wing uniformly, very densely microtrichose; dark brown in anterior half. - -Abdomen + +Abdomen (Fig. -117 +117 ). Entirely black; short yellow-white and black pilose. - -Male. + +Male. Unknown. - -Distribution. -Democratic Republic of the Congo, Malawi, Tanzania and Uganda. + +Distribution. +Democratic Republic of the Congo, Malawi, Tanzania and Uganda. - -Comments. - + +Comments. + Previously only known from the holo- and paratype. -Curran (1927) +Curran (1927) considers - -M. morio + +M. morio to be a dark morphotype of - -M. cyanipennis + +M. cyanipennis . As the male of - -M. morio + +M. morio is unknown, we could not compare the male genitalia. However, since the differentiation between the two species with DNA barcodes ( -p +p -distance: 6.4%) is of the same magnitude as the differentiation between other closely related species (range -p +p -distances: 4.3-14.7%; see Discussion and Fig. -229 +229 ), we consider - -M. morio + +M. morio and - -M. cyanipennis + +M. cyanipennis as two different morphospecies. diff --git a/data/8C/89/34/8C8934B81A42FD8FB635EBE484D2FF31.xml b/data/8C/89/34/8C8934B81A42FD8FB635EBE484D2FF31.xml index 1f422635a25..d3eae249021 100644 --- a/data/8C/89/34/8C8934B81A42FD8FB635EBE484D2FF31.xml +++ b/data/8C/89/34/8C8934B81A42FD8FB635EBE484D2FF31.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus pruinosus Arrow, 1910 + + + +Peltonotus pruinosus Arrow, 1910 Figs 32, 84 - -Diagnosis (female only). -Length ~15.7 mm, color overall black, elytra black with iridescent bloom, head punctate and lacking setae, labrum bi-emarginate, mentum rounded in apical half and moderately bi-lobed at middle (Fig. 32), labial palpomere 2 not enlarged and not obviously dorsoventrally flattened (Fig. 32), mala without lamellate setal brush, maxillary stipes without setae curled at apices, female epipleuron broadly expanded and lacking emargination at apex (Fig. 84). + +Diagnosis (female only). +Length ~15.7 mm, color overall black, elytra black with iridescent bloom, head punctate and lacking setae, labrum bi-emarginate, mentum rounded in apical half and moderately bi-lobed at middle (Fig. 32), labial palpomere 2 not enlarged and not obviously dorsoventrally flattened (Fig. 32), mala without lamellate setal brush, maxillary stipes without setae curled at apices, female epipleuron broadly expanded and lacking emargination at apex (Fig. 84). - -Distribution. -India. + +Distribution. +India. \ No newline at end of file diff --git a/data/8F/D9/A1/8FD9A1978C5E2446708C0F2AE0DA8FBC.xml b/data/8F/D9/A1/8FD9A1978C5E2446708C0F2AE0DA8FBC.xml index cfff4195ee4..3e683740ea9 100644 --- a/data/8F/D9/A1/8FD9A1978C5E2446708C0F2AE0DA8FBC.xml +++ b/data/8F/D9/A1/8FD9A1978C5E2446708C0F2AE0DA8FBC.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus brunnipennis Benderitter, 1934 + + + +Peltonotus brunnipennis Benderitter, 1934 Figs 57, 73 - -Diagnosis (male and female). -Length 14.5-16.9 mm, color overall castaneous, elytra reddish-orange or black with iridescent bloom, head punctate and lacking setae, labrum deeply bi-lobed, mentum rounded in apical half, labial palpomere 2 enlarged and obviously dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes with some setae curled at apices, male protibia tridentate, form of parameres (Fig. 57), female epipleuron incised and with oval emargination (Fig. 73). + +Diagnosis (male and female). +Length 14.5-16.9 mm, color overall castaneous, elytra reddish-orange or black with iridescent bloom, head punctate and lacking setae, labrum deeply bi-lobed, mentum rounded in apical half, labial palpomere 2 enlarged and obviously dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes with some setae curled at apices, male protibia tridentate, form of parameres (Fig. 57), female epipleuron incised and with oval emargination (Fig. 73). - -Distribution. -Malaysia, Borneo Island (Sabah and Sarawak). + +Distribution. +Malaysia, Borneo Island (Sabah and Sarawak). \ No newline at end of file diff --git a/data/90/4B/C2/904BC299CC2E5B9EA5B5B35FABC01813.xml b/data/90/4B/C2/904BC299CC2E5B9EA5B5B35FABC01813.xml index cd11f7da260..4205f7bab05 100644 --- a/data/90/4B/C2/904BC299CC2E5B9EA5B5B35FABC01813.xml +++ b/data/90/4B/C2/904BC299CC2E5B9EA5B5B35FABC01813.xml @@ -1,1667 +1,1667 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius strigilatus (Bezzi, 1912) -Figs 22 -, 42 -, 65 -, 102 -, 123 -, 146 -, 172 -, 197 -, 203 -, 224 + + + +Mesembrius strigilatus (Bezzi, 1912) +Figs 22 +, 42 +, 65 +, 102 +, 123 +, 146 +, 172 +, 197 +, 203 +, 224 - - -Tubifera (Mesembrius) strigilata + + +Tubifera (Mesembrius) strigilata Bezzi, 1912: 436. - -Helophilus (Mesembrius) strigilatus + +Helophilus (Mesembrius) strigilatus - -Bezzi (1915) +Bezzi (1915) : 96 - -Curran and Bryan (1926) +Curran and Bryan (1926) : 82. - -Mesembrius strigilatus + +Mesembrius strigilatus - - -Herve-Bazin + +Herve-Bazin (1914a) : 481 - -Curran (1927) +Curran (1927) : 62 - -Curran (1939) +Curran (1939) : 10 - - -Szilady + +Szilady (1942) : 92 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius strigilatus + +Differential diagnosis. + + +Mesembrius strigilatus males lack an apical pile brush on the profemur and have a metatibia which is strongly curved. The metafemur is curved, has a patch of conspicuous black pile at the base and, perpendicular to this, a stretch of dense black pile on the ventroposterior side. Tergite II has a pair of very large and rounded maculae and a narrow black medial marking. The male is distinguished from any other species by the strongly curved metafemur and metatibia, except from - -M. nigriceps + +M. nigriceps though the metafemur and metatibia are less curved in the latter. It differs further from - -M. nigriceps + +M. nigriceps in the the colour of the face (white to yellow in - -M. strigilatus + +M. strigilatus ; black in - -M. nigriceps + +M. nigriceps ), in the size and shape of the maculae on tergite II which are large and rounded (small and nearly triangular in - -M. nigriceps + +M. nigriceps ) and by the narrow black medial marking on tergite II (broad in - + M -Mesembrius nigriceps +Mesembrius nigriceps ). Females have a frons which is pale pilose on the ventral half. Females of - -M. strigilatus + +M. strigilatus have a pair of yellow maculae on tergite II (fascia in the spined morph of - -M. caffer + +M. caffer and in - -M. capensis + +M. capensis ). Pro- and mesofemur are dark brown to black (yellow-brown in - -M. senegalensis + +M. senegalensis ), the metafemur lacks a ventral medial swelling (present in - -M. minor + +M. minor ), the face is not markedly produced downwards (produced downwards in - -M. vockerothi + +M. vockerothi sp. nov.) and the mesofemur has long black pile ventrally, especially on the distal half (very few and short black pile on distal end in the nominal morph of - -M. caffer + +M. caffer ). - - -Figures 127-130. - -Mesembrius + + +Figures 127-130. + +Mesembrius spp., right wing -127 - -M. arcuatus +127 + +M. arcuatus sp. nov. (♂) -128 - -M. caffer +128 + +M. caffer (Loew) (nominal morph) (♂) -129 - -M. capensis +129 + +M. capensis (Macquart) (♂) -130 - -M. chapini +130 + +M. chapini Curran (♂). - -Examined material. - - -Tubifera strigilata + +Examined material. + + +Tubifera strigilata Bezzi: - -Lectotype + +Lectotype (hereby designated), male, - + " -LECTOTYPUS +LECTOTYPUS " " -SYNTYPUS -♂ +SYNTYPUS +♂ // -Tubifera +Tubifera (Mesemb.) // -Tubifera strigilata +Tubifera strigilata // Bezzi, 1912" " -Congo +Congo Francese // Fernand-Vaz // IX-X.1902. L. fea" "RMCA PIC // 00033" "Museo Civico // di Genova" - + " -LECTOTYPUS +LECTOTYPUS " [MSNG] . - -Paralectotype + +Paralectotype , -4 males +4 males , " -SYNTYPUS -♂ +SYNTYPUS +♂ // -Tubifera +Tubifera (Mesemb.) // -Tubifera strigilata +Tubifera strigilata // Bezzi, 1912" " -Congo +Congo Francese" // Fernand-Vaz // IX-X.1902. L. fea" "Museo Civico // di Genova" "PARA- // -LECTOTYPUS +LECTOTYPUS " [MSNG] . - -Paralectotype + +Paralectotype , female, " -SYNTYPUS -♀ +SYNTYPUS +♀ " " -Tubifera +Tubifera (Mesemb.) // -Tubifera strigilata +Tubifera strigilata // Bezzi, 1912" "Museo Civico // di Genova" "PARA- // -LECTOTYPUS +LECTOTYPUS " [MSNG] . - - -Figures 131-134. - -Mesembrius + + +Figures 131-134. + +Mesembrius spp., right wing - -131 - -M. copelandi + +131 + +M. copelandi sp. nov. ( -♂ +♂ ) - -132 - -M. cyanipennis + +132 + +M. cyanipennis (Bezzi) ( -♂ +♂ ) - -133 - -M. ingratus + +133 + +M. ingratus (Loew) ( -♂ +♂ ) - -134 - -M. longipilosus + +134 + +M. longipilosus sp. nov. ( -♂ +♂ ). - -Other material - - -Benin + +Other material + + +Benin • -1♂ -1♀ +1♂ +1♀ ; - -Azaourisse + +Azaourisse ; - -7 Mar 2018 + +7 Mar 2018 ; -K. Jordaens +K. Jordaens leg.; KMMA • -1♂ +1♂ ; -Calavi +Calavi ; - -27 Jan 2017 + +27 Jan 2017 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; -Cotonou +Cotonou ; - -14 Dec 2013 + +14 Dec 2013 ; -G. Goergen +G. Goergen and -K. Jordaens +K. Jordaens leg.; KMMA • -1♀ +1♀ ; -Cotonou +Cotonou ; - -Feb 2003 + +Feb 2003 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; -Cotonou +Cotonou ; - -Dec 2003 + +Dec 2003 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; -Lokossa +Lokossa ; - -Jun 2006 + +Jun 2006 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; -Pahou +Pahou ; - -11 Jan 2014 + +11 Jan 2014 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -1♀ +1♂ +1♀ ; - -Pobe + +Pobe ; - -27 Jan 2016 + +27 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA • -2♂♂ +2♂♂ ; -Porto Novo +Porto Novo ; - -20 Jan 2018 + +20 Jan 2018 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -1♀ +1♂ +1♀ ; -Gblo Gblo +Gblo Gblo ; - -11 Sep 2014 + +11 Sep 2014 ; -G. Goergen +G. Goergen leg.; KMMA • -1♀ +1♀ ; -Pahou +Pahou ; - -11 Jan 2014 + +11 Jan 2014 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; -Porto Novo +Porto Novo ; - -27 Jan 2016 + +27 Jan 2016 ; -K. Jordaens +K. Jordaens leg.; KMMA • -7♂♂ +7♂♂ ; -Porto Novo +Porto Novo ; - -7 Mar 2018 + +7 Mar 2018 ; -K. Jordaens +K. Jordaens leg.; KMMA • -1♀ +1♀ ; - -Serou + +Serou ; - -Nov 2016 + +Nov 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ -3♀♀ +1♂ +3♀♀ ; - -Pobe + +Pobe ; - -12 Dec 2013 + +12 Dec 2013 ; -G. Goergen +G. Goergen and -K. Jordaens +K. Jordaens leg.; KMMA • -4♂♂ -4♀♀ +4♂♂ +4♀♀ ; - -Pobe + +Pobe ; -28 Jan 2016 +28 Jan 2016 ; G. Goergen and K. Jordaens leg.; KMMA. - -Burundi + +Burundi • -2♂♂ +2♂♂ ; -Bujumbura +Bujumbura ; - -21 Feb 2017 + +21 Feb 2017 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; -Nyanza-Lac +Nyanza-Lac ; - -14 Oct 2013 + +14 Oct 2013 ; -L. Ndayikeza +L. Ndayikeza leg.; OBPE • -1♀ +1♀ ; -Rusizi River +Rusizi River ; -10 Nov 2010 +10 Nov 2010 ; L. Ndayikeza leg.; OBPE. - -Cameroon + +Cameroon • -1♂ +1♂ ; -Batanga +Batanga ; collection date unknown; -A. I. Good +A. I. Good leg.; CNC • -5♂♂ -2♀♀ +5♂♂ +2♀♀ ; -Douala +Douala ; -9 Jul 1974 +9 Jul 1974 ; J.A.W. Lucas leg.; RMNH. - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -2♀♀ +2♀♀ ; -Haut-Katanga +Haut-Katanga ; - -4 Sep 1930 + +4 Sep 1930 ; -G.F. de Witte +G.F. de Witte leg.; KMMA • -1♀ +1♀ ; -Equateur +Equateur , - -Bamania + +Bamania ; -21 Jul 1924 +21 Jul 1924 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; -Equateur +Equateur , Bamania; - -24 Jul 1924 + +24 Jul 1924 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♂ +1♂ ; -Basoko +Basoko ; - -Oct 1948 + +Oct 1948 ; -P.L.G. Benoit +P.L.G. Benoit leg.; KMMA • -1♂ +1♂ ; -Bokuma +Bokuma ; - -Jul 1962 + +Jul 1962 ; -R.P. Lootens +R.P. Lootens leg.; KMMA • -1♀ +1♀ ; -Mai-Ndombe +Mai-Ndombe , -Bololo +Bololo , -Makamendulu +Makamendulu ; 1938; -H. Schouteden +H. Schouteden leg.; KMMA • -2♂♂ +2♂♂ ; -Boma +Boma ; - -Jul 1915 + +Jul 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♀ +1♀ ; -Boma +Boma ; - -16 Jun 1915 + +16 Jun 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♀ +1♀ ; -Boma +Boma ; - -17 Jun 1915 + +17 Jun 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♀ +1♀ ; -Boma +Boma ; - -18 Jun 1915 + +18 Jun 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -4♀♀ +4♀♀ ; -Boma +Boma ; - -4 Dec 1920 + +4 Dec 1920 ; -H. Schouteden +H. Schouteden leg.; KMMA • -1♀ +1♀ ; -Boma +Boma ; - -11 Jul 1920 + +11 Jul 1920 ; -H. Schouteden +H. Schouteden leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; -Boma +Boma ; - -12 Jul 1920 + +12 Jul 1920 ; -H. Schouteden +H. Schouteden leg.; KMMA • -1♀ +1♀ ; -Haut-Lomami +Haut-Lomami , -Bukama +Bukama ; - -8 Jun 1911 + +8 Jun 1911 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; -South-Kivu +South-Kivu , -Bukavu +Bukavu ; - -May 1949 + +May 1949 ; -H. Bomans +H. Bomans leg.; KMMA • -1♂ +1♂ ; -Equateur +Equateur , - -Eala + +Eala ; -Jul 1931 +Jul 1931 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; -Equateur +Equateur , - -Eala + +Eala ; -Nov 1931 +Nov 1931 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; -Equateur +Equateur , - -Eala + +Eala ; -7 Oct 1931 +7 Oct 1931 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♂ +1♂ ; -Equateur +Equateur , - -Eala + +Eala ; -Jul 1932 +Jul 1932 ; -A. Corbissier +A. Corbissier leg.; KMMA • -1♀ +1♀ ; -Equateur +Equateur , - -Eala + +Eala ; -Apr 1933 +Apr 1933 ; -A. Corbissier +A. Corbissier leg.; KMMA • -1♂ +1♂ ; -Equateur +Equateur , - -Eala + +Eala ; 1933; -A. Corbissier +A. Corbissier leg.; KMMA • -1♀ +1♀ ; -South-Kivu +South-Kivu , -Kabare +Kabare ; -1♀ +1♀ ; - -31 Jul 1914 + +31 Jul 1914 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; -Lomami +Lomami , -Kabinda +Kabinda ; date unknown; -Schwetz +Schwetz leg.; KMMA • -1♂ +1♂ ; -Kachichwe +Kachichwe ; - -17 Jan 1912 + +17 Jan 1912 ; -Dr. Bequaert +Dr. Bequaert leg.; KMMA • -1♀ +1♀ ; -Kalemie +Kalemie ; - -Dec 1918 + +Dec 1918 ; - + R. -Mayne +Mayne ; leg.; KMMA • -1♂ +1♂ ; -Lualaba +Lualaba ; -Kabombo +Kabombo ; - -29 Jun 1947 + +29 Jun 1947 ; -M. Poll +M. Poll leg.; KMMA • -1♀ +1♀ ; - -Leopoldville + +Leopoldville [= -Kinshasa +Kinshasa ] ; - -28 Oct 1951 + +28 Oct 1951 ; mevr. -Bequaert +Bequaert leg.; KMMA • -1♂ +1♂ ; -Tshopo +Tshopo , -Stanleyville +Stanleyville [= Kisangani] ; - -Apr 1915 + +Apr 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♂ +1♂ ; -Equateur +Equateur , Lukolela; - -17 Jul 1926 + +17 Jul 1926 ; -J. Bequaert +J. Bequaert leg.; KMMA • -2♂♂ +2♂♂ ; -Lomami +Lomami , -Luputa +Luputa ; - -Mar 1935 + +Mar 1935 ; -Bouvier +Bouvier leg.; KMMA • -1♀ +1♀ ; -Natl. Parc Albert +Natl. Parc Albert , -Rwindi +Rwindi , -St. Edouard +St. Edouard ; - -17 Apr 1936 + +17 Apr 1936 ; -L. Lippens +L. Lippens leg.; KMMA • -1♀ +1♀ ; -Tumbalunga +Tumbalunga , -Dibaya +Dibaya ; - -8 Nov 1930 + +8 Nov 1930 ; -G.F. de Witte +G.F. de Witte leg.; KMMA • -1♀ +1♀ ; -Ubani +Ubani , -Bosobolo +Bosobolo ; - -8-11 Jan 1932 + +8-11 Jan 1932 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; -Ubangi +Ubangi , -Tungu +Tungu ; - -4 Mar 1932 + +4 Mar 1932 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; -Uele +Uele , -Garamba +Garamba ; - -Jul 1912 + +Jul 1912 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; -Mai-Ndombe +Mai-Ndombe , -Wimbali +Wimbali ; -Jul 1913 +Jul 1913 ; P. Vanderijst leg.; KMMA • -1♀ +1♀ ; -30 Sep 1913 +30 Sep 1913 ; P. Vanderijst leg.; KMMA. - -Gabon + +Gabon • -1♀ +1♀ ; -Lolo River +Lolo River ; -22 May 1925 +22 May 1925 ; -J. Rodhain +J. Rodhain leg.; KMMA . - -Ghana + +Ghana • -1♀ +1♀ ; -Nsakjam +Nsakjam ; - -13 Sep 2016 + +13 Sep 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; -Tema +Tema ; - -19 Dec 2004 + +19 Dec 2004 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; -Kumasi +Kumasi ; -6 Nov 1946 +6 Nov 1946 ; J. Bowden leg.; NMSA. - -Kenya + +Kenya • -1♂ +1♂ ; -Kabete +Kabete ; - -12 Jun 1916 + +12 Jun 1916 ; -T.J. Anderson +T.J. Anderson leg.; NHMUK • -1♂ +1♂ ; -Merifano +Merifano ; - -Nov 1932 + +Nov 1932 ; -McArthur +McArthur leg.; NMK • -1♀ +1♀ ; -Mugura Forest +Mugura Forest ; - -2 May 1981 + +2 May 1981 ; -R.H. Markham +R.H. Markham leg.; NMK • -1♀ +1♀ ; -Zwani +Zwani ; date unknown; -van Someren +van Someren leg.; CNC . - -Madagascar + +Madagascar • -1♂ +1♂ ; -Antananarivo +Antananarivo ; -28 Feb 2016 +28 Feb 2016 ; G. Goergen leg.; IITA. - -Malawi + +Malawi • -4♂♂ -2♀♀ +4♂♂ +2♀♀ ; -Chiromo +Chiromo ; date unknown; -J.E.S. Old. +J.E.S. Old. leg.; NHMUK • -1♂ +1♂ ; -Mount -Mulanje +Mount +Mulanje ; - -4 Oct 1913 + +4 Oct 1913 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; -Monkey Bay +Monkey Bay ; - -12 Dec 1980 + +12 Dec 1980 ; -J.H.G. Londt +J.H.G. Londt leg.; NMSA • -3♂♂ +3♂♂ ; -Senga Hills +Senga Hills ; -1 Dec 1980 +1 Dec 1980 ; B.R. Stuckenberg leg.; NMSA. - -Mozambique + +Mozambique • -1♀ +1♀ ; - -Lourenco-Marques + +Lourenco-Marques [= -Maputo +Maputo ]; date unknown; -H.A. Junod +H.A. Junod leg.; NHMUK • -2♂♂ +2♂♂ ; -Sofala +Sofala , - -Gorongosa National Park + +Gorongosa National Park , -Chitengo +Chitengo ; -20-30 Apr 2004 +20-30 Apr 2004 ; -M. Hauser +M. Hauser leg. and -H. Rung +H. Rung leg.; CAS • -2♂♂ -1♀ +2♂♂ +1♀ ; -Sofala +Sofala , - -Gorongosa National Park + +Gorongosa National Park , -Chitengo +Chitengo ; - -16-30 Apr 2015 + +16-30 Apr 2015 ; -M. Hauser +M. Hauser and -H. Rung +H. Rung leg.; CAS • -6♂♂ +6♂♂ ; -Luabo +Luabo , -Lower Zambezi River +Lower Zambezi River ; - -1 Jun 1957 + +1 Jun 1957 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • -2♂♂ +2♂♂ ; -Luabo +Luabo , -Lower Zambezi River +Lower Zambezi River ; - -1 Jun 1957 + +1 Jun 1957 ; -P. Usher +P. Usher leg.; NMSA • -1♂ +1♂ ; -Luabo +Luabo , -Lower Zambezi River +Lower Zambezi River ; - -1 Aug 1957 + +1 Aug 1957 ; -P. Usher +P. Usher leg.; NMSA • -1♂ +1♂ ; -Siluwe Hills, W. +Siluwe Hills, W. of -Beira +Beira ; -3 Jun 1964 +3 Jun 1964 ; D. Cookson leg.; NMSA. - -Nigeria + +Nigeria • -1♂ +1♂ ; -Ibadan +Ibadan ; - -14 Jun 1957 + +14 Jun 1957 ; -G.H. Caswell +G.H. Caswell leg.; NHMUK • -1♂ +1♂ ; -Ibadan +Ibadan ; -Dec 1988 +Dec 1988 ; G. Goergen leg.; IITA. - -Senegal + +Senegal • -1♀ +1♀ ; - -Dassilame + +Dassilame , - -Serere + +Serere ; -30 Nov 2016 +30 Nov 2016 ; - + S. -Cavailles +Cavailles leg.; SCPC . - -South Africa + +South Africa • -1♂ +1♂ ; -Durban +Durban ; - -Jul 1903 + +Jul 1903 ; -G. Burn +G. Burn leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , - -Durban + +Durban , -Blue Lagoon +Blue Lagoon ; -25 May 1991 +25 May 1991 ; -J.A.W. Lucas +J.A.W. Lucas leg.; RMNH • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , - -Durban + +Durban ; -14 May 1903 +14 May 1903 ; -G.F. Leigh +G.F. Leigh leg.; NMSA • -2♂♂ +2♂♂ ; -KwaZulu-Natal +KwaZulu-Natal , - -Nseleni Nature Reserve + +Nseleni Nature Reserve ; -10 Jan 1994 +10 Jan 1994 ; -Natal Museum Staff +Natal Museum Staff leg.; NMSA • -2♂♂ +2♂♂ ; -KwaZulu-Natal +KwaZulu-Natal , - -St. Lucia -Park Reserve + +St. Lucia +Park Reserve ; - -2 Feb 1988 + +2 Feb 1988 ; -J.H.G. Londt +J.H.G. Londt leg.; NMSA • -5♂♂ +5♂♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Dukuduku Forest +Dukuduku Forest ; - -18 Jul 1981 + +18 Jul 1981 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Dukuduku Forest +Dukuduku Forest , -4♂♂ +4♂♂ W of - -St. Lucia + +St. Lucia ; -26 Nov 1971 +26 Nov 1971 ; -M.E. Irwin +M.E. Irwin leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Ndumu Game Reserve +Ndumu Game Reserve ; -26 Oct 1972 +26 Oct 1972 ; M.E. Irwin leg.; NMSA. - -Tanzania + +Tanzania • -1♂ +1♂ ; -Kahe +Kahe , -Usambara Mountains +Usambara Mountains ; -2 Jun 1916 +2 Jun 1916 ; -T.J. Anderson +T.J. Anderson leg.; NHMUK . - -Togo + +Togo • -1♀ +1♀ ; -Kloto Forest +Kloto Forest ; - -Mar 2004 + +Mar 2004 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; -Kloto Forest +Kloto Forest ; -May 2016 +May 2016 ; G. Goergen leg.; KMMA. - -Uganda + +Uganda • -1♀ +1♀ ; -Busoga +Busoga ; - -Mar 1906 + +Mar 1906 ; -A. Hodges +A. Hodges leg.; CNC • -1♂ +1♂ ; -Tero Forest +Tero Forest , -S.E. Buddu +S.E. Buddu ; -26-30 Sep 1911 +26-30 Sep 1911 ; S.A. Neave leg.; NHMUK. - -Zambia + +Zambia • -1♂ -1♀ +1♂ +1♀ ; -Lusaka Province +Lusaka Province , - -8.5 km + +8.5 km NW Katondwe ; -20 Apr 2016 +20 Apr 2016 ; M. Hauser leg.; CSCA. - - -Figures 135-138. - -Mesembrius + + +Figures 135-138. + +Mesembrius spp., right wing - -135 - -M. maculifer + +135 + +M. maculifer Hull ( -♀ +♀ ) - -136 - -M. madagascariensis + +136 + +M. madagascariensis Keiser ( -♂ +♂ ) - -137 - -M. minor + +137 + +M. minor (Bezzi) ( -♂ +♂ ) - -138 - -M. morio + +138 + +M. morio (Bezzi) ( -♀ +♀ ). - -Re-description male - - + +Re-description male + + (Fig. -22 +22 ). Body length: 11.2-12.5 mm. Wing length: 8.1-8.8 mm. - - -Figures 139-142. - -Mesembrius + + +Figures 139-142. + +Mesembrius spp., right wing -139 - -M. nigriceps +139 + +M. nigriceps Curran (♂) -140 - -M. perforatus +140 + +M. perforatus (Speiser) (♂) -141 - -M. platytarsis +141 + +M. platytarsis Curran syn. nov. (♂) -142 - -M. regulus +142 + +M. regulus (Hull) (♂). - -Head + +Head (Fig. -65 +65 ). Eyes bare; slightly dichoptic, distance between eyes approx. the width of ocellus. Face white with dark medial vitta; white pilose; white pollinose. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Occiput yellow; yellow pilose; yellow and white pollinose. Frontal triangle black; black pilose; ventral half weakly white pollinose. Frontal prominence shiny black. Antenna black; antennal arista brown. - - -Figures 143-146. - -Mesembrius + + +Figures 143-146. + +Mesembrius spp., right wing -143 - -M. rex +143 + +M. rex Curran (♂) -144 - -M. senegalensis +144 + +M. senegalensis (Macquart) (♂) -145 - -M. simplicipes +145 + +M. simplicipes Curran (♂) -146 - -M. strigilatus +146 + +M. strigilatus (Bezzi) (♂). - -Thorax. + +Thorax. Scutum black with dorsally a pair of weak yellow vittae which fade out posteriorly; with very faint lateral yellow vitta; yellow-rufous pilose. Scutellum uniformly yellow-brown; yellow-rufous pilose, with some short black pile interspersed, especially in the posterior half. - - -Figures 147-150. - -Mesembrius + + +Figures 147-150. + +Mesembrius spp., right wing -147 - -M. sulcus +147 + +M. sulcus sp. nov. (♂) -148 - -M. tarsatus +148 + +M. tarsatus (Bigot) (♂) -149 - -M. tibialis +149 + +M. tibialis sp. nov. (♂) -150 - -M. vockerothi +150 + +M. vockerothi sp. nov. (♂). - -Legs. + +Legs. Femora and entire metaleg dark brown to black; pro- and mesofemora and tarsi yellow-brown; tarsi without a small darkened medial patch. Proleg: Femur without apical pile brush; yellow pilose ventrally; with long black pile on anterodorsally; with shorter, black pile dorsally. Mesoleg: Femur similar as profemur, but with long, black pile posteriorly and posteroventrally; with black pile anterodorsally which is markedly longer in the proximal half. Metaleg (Fig. -197 +197 ): Femur with long, yellow pile anteriorly and anteroventrally; with long black pile on the posteroventral distal 1/3; thickened on distal 1/3; no swelling on the mid-section of the ventral side. Tibia strongly curved, especially from posterior view, flattened; with very long black pile dorsally and ventrally. - -Wing + +Wing (Fig. -146 +146 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -102 +102 ). Tergite II with a pair of very large yellow, rounded maculae; anterior black marking larger in size than posterior black marking, which mostly reach to the lateral tergite sides; medial black marking more or less parallel-sided; long yellow pilose; posterior black marking with short, stiff black pile which extend to the lateral sides. Tergite III with small, triangular to rounded black marking; long yellow pilose with some short thick black pile in medial posterior area; black marking usually strongly white pollinose. Tergite IV entirely dark brown to black, except for anterior 1/5 which is strongly white pollinose; long yellow pilose, the pile is strongly appressed on the lateral sides. Tergite V dark brown. - -Genitalia + +Genitalia (Fig. -224 +224 ). Epandrium: Dorsal lobe of surstylus strongly bent, sickle-shaped, short yellow pilose on distal half; with long, thick black setulae at bend ventrally; distal half dorsally convex; densely covered with long yellow pile and with some equally long, but thicker black pile interspersed. Ventral lobe of surstylus bare. - -Re-description female - - + +Re-description female + + (Fig. -42 +42 ). Body length: 11.3-15.0 mm. Wing length: 8.1-9.4 mm. - -Head. + +Head. Eyes bare; dichoptic. Face white with dark medial vitta; white pilose, white pollinose. Frons black on dorsal 2/5, yellow-white on ventral 3/5; black and white pilose on ocellar triangle and just ventrally of ocellar triangle, otherwise white pilose; strongly white pollinose on ventral 3/5, weak white pollinose on dorsal 2/5. Distance between lateral ocellus and eye margin slightly less than width of ocellus. Occiput yellow-white; yellow-white pilose; yellow-white pollinose. Frontal prominence shiny black. Antenna dark brown to black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum dark brown with a pair of dorsolateral yellow pollinose vittae which are connected posteriorly; with lateral, yellow pollinose vitta; sometimes with a fine medial white to yellow pollinose vitta; yellow pilose. Scutellum yellow-orange; yellow pilose. - -Legs. + +Legs. Proleg (Fig. -172 +172 ): Femur black, distal end orange-brown; yellow pilose, with short black pile interspersed. Tibia orange, darkened in distal 1/2; yellow pilose on dorsal proximal half, yellow and black pilose otherwise. Tarsi uniformly dark brown; black pilose dorsally, yellow pilose ventrally; especially the posterior side has very conspicuous thick black pile. Mesoleg: Femur black, distal end orange-brown; black and white pilose. Tibia orange-brown; orange-yellow pilose on dorsal side, black pilose on ventral side. Tarsi orange-brown with darkened dorsal medial area; black pilose. Metaleg: Femur black, distal end orange-brown; orange-yellow pilose, with short, black pile on dorsal distal end, with shorter and thicker black pile on ventral distal half; without ventral swelling in middle (Fig. -203 +203 ). Tibia orange-brown; orange-yellow pilose with some black pile interspersed at distal end. Tarsi black dorsally, orange ventrally; black pilose dorsally; densely orange pilose ventrally. - -Wing. + +Wing. Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Fig. -123 +123 ). Tergite II with a pair of very large, rounded yellow-orange maculae; black pilose on triangular posteromedial section, yellow pilose otherwise; posterior black marking extends to lateral tergite sides; medial part of black marking narrow, approx. 1/10 of tergal width; posterior black marking white pollinose. Tergite III with yellow-orange fascia which occupies entire tergal length on lateral sides and approx. 1/3 of tergal length in medial section; with triangular posterior black marking that extends to the lateral tergite sides; black pilose on triangular posteromedial section, yellow pilose otherwise; posterior black marking white pollinose. Tergite IV as tergite III, but with much narrower yellow-orange fascia (approx. 1/10 of tergal length in medial section). Tergite V with narrow anterior black board; with a pair of yellow-orange maculae in anterolateral corners, otherwise black; yellow pilose; black marking strongly white pollinose, especially in anterior half. - -Distribution. -Benin, Burundi, Cameroon, Democratic Republic of the Congo, Gabon, Ghana, Guinea-Bissau, Kenya, Madagascar, Malawi, Mozambique, Nigeria, Senegal, South Africa, Tanzania, Togo, Uganda and Zambia. + +Distribution. +Benin, Burundi, Cameroon, Democratic Republic of the Congo, Gabon, Ghana, Guinea-Bissau, Kenya, Madagascar, Malawi, Mozambique, Nigeria, Senegal, South Africa, Tanzania, Togo, Uganda and Zambia. - -Comments. - + +Comments. + See - -M. nigriceps + +M. nigriceps . diff --git a/data/91/83/61/91836166C33E05359248A75D158BD42D.xml b/data/91/83/61/91836166C33E05359248A75D158BD42D.xml index 23dcbe93640..9e5f1c2ba44 100644 --- a/data/91/83/61/91836166C33E05359248A75D158BD42D.xml +++ b/data/91/83/61/91836166C33E05359248A75D158BD42D.xml @@ -1,60 +1,60 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - - -Peltonotus + + + + +Peltonotus silvanus Jameson & Wada, 2004 Figs 68, 77 - -Diagnosis (male and female). -Length 16.3-17.8 mm, color overall castaneous, elytra castaneous, dark-brown, or black with weak iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 enlarged and obviously dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes lacking setae curled at apices, male protarsomeres 2-4 with apices expanded, male protibia bidentate, form of parameres (Fig. 68), female epipleuron incised and with oblong-oval emargination (Fig. 77). + +Diagnosis (male and female). +Length 16.3-17.8 mm, color overall castaneous, elytra castaneous, dark-brown, or black with weak iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 enlarged and obviously dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes lacking setae curled at apices, male protarsomeres 2-4 with apices expanded, male protibia bidentate, form of parameres (Fig. 68), female epipleuron incised and with oblong-oval emargination (Fig. 77). - -Distribution. -Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sarawak). + +Distribution. +Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sarawak). \ No newline at end of file diff --git a/data/91/8A/81/918A816BE60C525D80994D5B7E1A1DDE.xml b/data/91/8A/81/918A816BE60C525D80994D5B7E1A1DDE.xml index 67555b3fa21..85a938ae4f2 100644 --- a/data/91/8A/81/918A816BE60C525D80994D5B7E1A1DDE.xml +++ b/data/91/8A/81/918A816BE60C525D80994D5B7E1A1DDE.xml @@ -1,510 +1,510 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius minor (Bezzi, 1915) -Figs 14 -, 35 -, 57 -, 94 -, 116 -, 137 -, 173 -, 198 -, 204 -, 216 + + + +Mesembrius minor (Bezzi, 1915) +Figs 14 +, 35 +, 57 +, 94 +, 116 +, 137 +, 173 +, 198 +, 204 +, 216 - - -Helophilus (Mesembrius) minor + + +Helophilus (Mesembrius) minor Bezzi, 1915: 96. - -Mesembrius minor + +Mesembrius minor - -Bezzi (1921) +Bezzi (1921) : 7 - -Bezzi (1923) +Bezzi (1923) : 348 - -Curran (1927) +Curran (1927) : 64 - -Curran (1939) +Curran (1939) : 10 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius minor + +Differential diagnosis. + + +Mesembrius minor males lack an apical pile brush on the profemur and have an unmodified metatibia. The metafemur has a large patch of black pile at the proximal end and, distally, a smaller patch of black pile on the posteroventral side with, anterior to this, a small swelling. The metatibia is unmodified. The maculae on tergite II are very large and rounded and with a narrow black medial vitta. Males differ from males of - -M. strigilatus + +M. strigilatus in the straight metafemur and metatibia (curved in - -M. strigilatus + +M. strigilatus ) and from males of other species that lack an apical pile brush in the profemur which has very conspicuous and dense black pile on the ventral side of the metafemur (yellow and less dense in the other species). Females have a frons which is pale pilose on ventral half. Tergite II has a pair of yellow maculae (fascia in - -M. capensis + +M. capensis and spined morph of - -M. caffer + +M. caffer ) and the black posterior marking does not extend to the lateral margins (extends to lateral margins in - -M. strigilatus + +M. strigilatus ). The metafemur has a marked ventral swelling in the middle (absent in other species; present in - -M. regulus + +M. regulus , but in this species, the pile on the frons is black pilose on the ventral half, except laterally). The pro- and mesotarsi are brown with a darkened medial part, except in the basitarsus. - -Examined material. - - -Helophilus minor + +Examined material. + + +Helophilus minor - + Bezzi: -Lectotype +Lectotype (hereby designated), male, - + " -LECTOTYPUS +LECTOTYPUS " "Hel. (Mes.)// -♂ +♂ , Type// -Helophilus minor +Helophilus minor //Bezzi" -"Syn-//type" +"Syn-//type" "Pres. By//Impl. Bureau Ent.//1915-165." "Chintechi// -Nyasaland +Nyasaland /; -Dr.H.S. Stannus +Dr.H.S. Stannus " " -Mesembrius +Mesembrius // -Mesembrius minor +Mesembrius minor n.sp.//Type -♂ +♂ " " NHMUK 013428949" [NHMUK]. -Female +Female , -"Syn-//type" +"Syn-//type" "Hel. (Mes.)// -♀ +♀ , Type// -Mesembrius minor +Mesembrius minor //Bezzi"; " -Brit. E. Africa +Brit. E. Africa //N. of Mt. -Kenia +Kenia ,//nr. crater lake,// - -5700 ft. + +5700 ft. // -T.J. Anderson. +T.J. Anderson. // -15.II.1911 +15.II.1911 "; "Pres. By//Impl. Bureau Ent.//1915-165."; " -Mesembrius +Mesembrius // -Mesembrius minor +Mesembrius minor n.sp.//Type -♀ +♀ "; " NHMUK 013428950" [NHMUK]. Female, -"Syn-//type" +"Syn-//type" " -Brit. E. Africa +Brit. E. Africa //N. of Mt. -Kenia +Kenia ,//nr. crater lake,// - -5700 ft. + +5700 ft. // -T.J. Anderson. +T.J. Anderson. // -15.II.1911 +15.II.1911 " "H.(M.) -Mesembrius minor +Mesembrius minor Bezzi.// -Bezzi +Bezzi det.//1915." "Pres. By//Impl. Bureau Ent.//1915-165." " NHMUK 013428951" [NHMUK]. - -Other material - - -Benin + +Other material + + +Benin • -5♀♀ +5♀♀ ; - -Azaourisse + +Azaourisse ; -7 Mar 2018 +7 Mar 2018 ; -K. Jordaens +K. Jordaens leg.; KMMA • - -1♂ + +1♂ ; -Cotonou +Cotonou ; -Feb 2003 +Feb 2003 ; -G. Goergen +G. Goergen ; IITA • - -1♂ + +1♂ ; -Cotonou +Cotonou ; -14 Dec 2013 +14 Dec 2013 ; -G. Goergen +G. Goergen and -K. Jordaens +K. Jordaens leg.; KMMA • - -4♂♂ -5♀♀ + +4♂♂ +5♀♀ ; -Cotonou +Cotonou ; -28 Jan 2016 +28 Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • - -1♀ + +1♀ ; -Ouidah +Ouidah ; -Sep 2004 +Sep 2004 ; -G. Goergen +G. Goergen leg.; IITA • - -1♂ + +1♂ ; - -Pobe + +Pobe ; -16 Mar 2014 +16 Mar 2014 ; -G. Goergen +G. Goergen leg.; KMMA • - -1♂ + +1♂ ; - -Sedje + +Sedje ; -Sep 2012 +Sep 2012 ; -G. Goergen +G. Goergen leg.; IITA . - -Cameroon + +Cameroon • -1♀ +1♀ ; -Maroua +Maroua , -Meskina +Meskina ; -23 May 2018 +23 May 2018 ; - + M. -Azo'o +Azo'o Ela leg.; MAPC • - -1♂ + +1♂ ; -Douala +Douala ; -9 Jul 1974 +9 Jul 1974 ; -J.A.W. Lucas +J.A.W. Lucas leg.; RMNH . - -Chad + +Chad • -1♀ +1♀ ; -Bebedja +Bebedja ; date unknown; -F.A. Bink +F.A. Bink and -R.M. Bink-Moenen +R.M. Bink-Moenen leg.; RMNH . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♂ +1♂ ; -Kongo-Central +Kongo-Central , -Boma +Boma ; -16 Jun 1915 +16 Jun 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • - -1♂ + +1♂ ; -Haut-Lomami +Haut-Lomami , -Kitompo +Kitompo , -Fungwi +Fungwi ; -18 Jun 1911 +18 Jun 1911 ; -Dr. Bequaert +Dr. Bequaert leg.; KMMA . - -Mozambique + +Mozambique • -1♂ +1♂ ; -Lower Shire +Lower Shire R.; -24 Jun 1916 +24 Jun 1916 ; -R.C. Wood +R.C. Wood leg.; NHMUK . - -Re-description male - - + +Re-description male + + (Fig. -14 +14 ). Body length: 11.8-13.3 mm. Wing length: 8.0-9.8 mm. - -Head + +Head (Fig. -57 +57 ). Eyes bare; slightly dichoptic, distance between eyes approx. the width of ocellus. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black pilose; white pollinose in area before ocellar triangle. Distance between lateral ocellus and eye margin less than 1/2 width of ocellus. Occiput yellow; yellow pilose; yellow and white pollinose. Frontal triangle dark black pilose; strongly yellow pollinose on ventral half. Frontal prominence shiny black. Antenna black; antennal arista brown. - -Thorax. + +Thorax. Scutum black with, dorsally, a pair of well-demarcated yellow vittae and a faint yellow medial line; vittae and line are connected anteriorly and posteriorly; with lateral, yellow vitta; yellow-white pilose. Scutellum uniformly yellow-brown; yellow pilose. - -Legs. + +Legs. Femora and entire metaleg brown; pro- and mesofemora and tarsi yellow-brown; small darkened medial patch in all tarsi, except for the basitarsus. Proleg: Femur without apical pile brush; yellow pilose on anterior and ventral side; with shorter, black pile on dorsal and posterior side. Mesoleg: Femur similar to profemur, but also with a row on longer black pile ventrally. Metaleg (Fig. -198 +198 ): Femur with long, yellow pile on anterior side; with a basoventral patch of long, black pile and, somewhat more distally, a smaller patch of long, black pile on the posteroventral side; anterior to this black pile, a small swelling. Tibia unmodified; almost straight. - -Wing + +Wing (Fig. -137 +137 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -94 +94 ). Tergite II with pair of very large yellow rounded maculae; black marking hourglass-shaped, with anterior black marking larger than posterior black marking, the latter not reaching the lateral sides of the tergite. Medial black vitta more or less parallel-sided. Black tergal marking with short stiff black pile which does not extend to the lateral sides. Tergite III with small triangular to rounded black marking. Tergite IV with very large rounded black marking occupying most of the tergite; narrowly white pollinose anteriorly. The yellow pile of the abdomen is very short, except on tergite V, where it is not appressed to the lateral sides of the tergite. Tergite V black; strongly white pollinose. - -Genitalia + +Genitalia (Fig. -216 +216 ). Epandrium: Dorsal lobe of surstylus short, nearly circular; with short black spines on almost entire surface; long yellow pilose dorsally. Ventral lobe of surstylus straight; bare. Hypandrium markedly downwardly curved. - -Re-description female - - + +Re-description female + + (Fig. -35 +35 ). Body length: 10.6-13.5 mm. Wing length: 7.5-9.4 mm. - -Head. + +Head. Eyes bare; dichoptic. Face white with dark medial vitta; white pilose, white pollinose. Frons black on dorsal 2/5, yellow-white on ventral 3/5; black and white pilose on ocellar triangle and just ventrally of ocellar triangle, otherwise white pilose; strongly white pollinose on ventral 3/5, weak white pollinose on dorsal 2/5. Distance between lateral ocellus and eye margin slightly less than width of ocellus. Occiput yellow-white; yellow-white pilose; yellow-white pollinose. Frontal prominence shiny black. Antenna dark brown to black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum dark brown with a pair of dorsolateral yellow pollinose vittae which are connected posteriorly; with lateral, yellow pollinose vitta; sometimes with a fine medial white to yellow pollinose vita; yellow pilose. Scutellum yellow-orange; yellow pilose. - -Legs. + +Legs. Proleg (Fig. -173 +173 ): Femur black, distal end orange-brown; yellow pilose, with short black pile interspersed. Tibia orange, darkened in distal 1/2; yellow pilose on dorsal proximal half, yellow and black pilose otherwise. Tarsi orange-brown with darkened medial area; black pilose dorsally, yellow pilose ventrally; especially the posterior side has very conspicuous thick black pile. Mesoleg: Femur black, distal end orange-brown; black and white pilose. Tibia orange-brown; orange-yellow pilose on dorsal side, black pilose on ventral side. Tarsi orange-brown with darkened dorsal medial area; black pilose. Metaleg: Femur black, distal end orange-brown; orange-yellow pilose, with short, black pile on dorsal distal end, with shorter and thicker black pile on ventral distal half; with marked ventral swelling in middle (Fig. -204 +204 ). Tibia orange-brown; orange-yellow pilose with some black pile interspersed at distal end. Tarsi black dorsally, orange ventrally; black pilose dorsally; densely orange pilose ventrally. - -Wing. + +Wing. Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Fig. -116 +116 ). Tergite II with a pair of very large, rounded yellow-orange maculae; black pilose on triangular posteromedial section, yellow pilose otherwise; posterior black marking does not reach the lateral tergal sides; medial part of black marking narrow, approx. 1/10 of tergal width; posterior black marking white pollinose. Tergite III with yellow-orange fascia which occupies entire tergal length on lateral sides and approx. 1/3 of tergal length in medial section; with triangular posterior black marking that does not reach the lateral tergal sides; black pilose on triangular posteromedial section, yellow pilose otherwise; posterior black marking white pollinose. Tergite IV as tergite III but with much narrower yellow-orange fascia (approx. 1/10 of tergal length in medial section). Tergite V with narrow anterior black marking; with a pair of yellow-orange maculae in anterolateral corners, otherwise black; yellow pilose; black marking strongly white pollinose, especially in anterior half. - -Distribution. -Benin, Cameroon, Chad, Democratic Republic of the Congo, Malawi and Mozambique. + +Distribution. +Benin, Cameroon, Chad, Democratic Republic of the Congo, Malawi and Mozambique. - -Comments. - + +Comments. + Two female syntypes at the NHMUK (NHMUK-0103428950 and NHMUK-0103428951) are not - -M. minor + +M. minor as both lack the ventral swelling on the metafemur, the black marking on tergite II is not of the typical hourglass shape and the short black spines on the ventral side of the metafemur are restricted to the proximal half. Syntype NHMUK-0103428950 corresponds to the female of - -M. capensis + +M. capensis , while syntype NHMUK-0103428951 corresponds to the female of either - -M. strigilatus + +M. strigilatus or - -M. caffer + +M. caffer . diff --git a/data/92/B4/19/92B41985235A5D4C8A9900262C4BF2F1.xml b/data/92/B4/19/92B41985235A5D4C8A9900262C4BF2F1.xml index f091117adae..6724b6eb0c2 100644 --- a/data/92/B4/19/92B41985235A5D4C8A9900262C4BF2F1.xml +++ b/data/92/B4/19/92B41985235A5D4C8A9900262C4BF2F1.xml @@ -1,1116 +1,1116 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius tarsatus (Bigot, 1883) -Figs 2 -, 24 -, 44 -, 67 -, 81 -, 104 -, 125 -, 148 -, 159 -, 168 -, 189 -, 226 + + + +Mesembrius tarsatus (Bigot, 1883) +Figs 2 +, 24 +, 44 +, 67 +, 81 +, 104 +, 125 +, 148 +, 159 +, 168 +, 189 +, 226 - - -Prionotomyia tarsata + + +Prionotomyia tarsata Bigot, 1883: CXXI. - -Prionotomyia tarsata + +Prionotomyia tarsata - - -Kertesz + +Kertesz (1910) : 266 - -Speiser (1913) +Speiser (1913) : 128. - -Mesembrius tarsata + +Mesembrius tarsata - -Curran (1939) +Curran (1939) : 9. - -Mesembrius tarsatus + +Mesembrius tarsatus - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius tarsatus + +Differential diagnosis. + + +Mesembrius tarsatus males are holoptic, have a loose black apical pile brush on the profemur, a black scutum with, dorsally, a pair of weakly-demarcated yellow pollinose vittae, an orange probasitarsus with a tuft of black pile on the posterior side and two black spots on the most distal tarsomere and a slender metatibia with a swelling in the posterior medial half. It can be distinguished from any other species by the apical pile brush of the profemur which is loose and entirely black (black dorsally, yellow ventrally in - -M. arcuatus + +M. arcuatus sp. nov.; yellowish with some black pile interspersed in - -M. ingratus + +M. ingratus ) and by the rounded swelling on the metatibia (strongly compressed in - -M. arcuatus + +M. arcuatus sp. nov.; with a deep groove in - -M. ingratus + +M. ingratus ). Females have a frons which is black pilose on its entire length, except laterally. It can be distinguished from other such females (except from - -M. sulcus + +M. sulcus sp. nov.) by the black legs, including the tibiae (tibiae yellow-brown in other species). It differs from the female of - -M. sulcus + +M. sulcus sp. nov. in tergite II which has a pair of large yellow-orange maculae which, laterally, reach to almost the posterior end (small pair of yellow-orange maculae which, latteraly, reach to halfway of the tergite length - -M. sulcus + +M. sulcus sp. nov.) and in tergite III which has a pair of clear anterolateral yellow-orange maculae (vague pair of maculae in - -M. sulcus + +M. sulcus sp. nov.). - -Examined material. - - -Prionotomyia tarsata + +Examined material. + + +Prionotomyia tarsata - + Bigot: -Lectotype +Lectotype (hereby designated), male, - + " -LECTOTYPUS +LECTOTYPUS " "SYN- // TYPE" " -Prionotomyia +Prionotomyia // -Prionotomyia tarsata +Prionotomyia tarsata Big." " -Prionotomyia -♂ +Prionotomyia +♂ // -Prionotomyia tarsata +Prionotomyia tarsata Bigot // -Senegal +Senegal " "ex. coll. -Bigot +Bigot , // Press. by // -G.H. Verrall. +G.H. Verrall. // B.M. 1894234" "BMNH(E) # // 230741" " NHMUK 010369820" [NHMUK]. -Paralectotype +Paralectotype , male, "SYN- // TYPE" " -Prionotomyia +Prionotomyia // -Prionotomyia tarsata +Prionotomyia tarsata Big." " -Prionotomyia -♂ +Prionotomyia +♂ // -Prionotomyia tarsata +Prionotomyia tarsata Bigot // -Senegal +Senegal " "ex. coll. -Bigot +Bigot , // Press. by // -G.H. Verrall. +G.H. Verrall. // B.M. 1894234" "BMNH(E) # // 230742" " NHMUK 010369821" "PARA- // -LECTOTYPUS +LECTOTYPUS " [NHMUK] . - -Other material - - -Democratic Republic of the Congo + +Other material + + +Democratic Republic of the Congo • -1♀ +1♀ ; -Banningville +Banningville [= -Bandundu +Bandundu ], -Kwilu River +Kwilu River , -Panga +Panga ; -Aug 1945 +Aug 1945 ; -Fain +Fain leg.; RMNH • -1♀ +1♀ ; Haut-Katanga, Kasenga; -5 Mar 1912 +5 Mar 1912 ; -J. Bequaert +J. Bequaert leg.; KMMA • -1♂ +1♂ ; South-Kivu, Musingiro; -8 Oct 1922 +8 Oct 1922 ; -Ch. Seydel +Ch. Seydel leg.; KMMA • -1♀ +1♀ ; Tshibinda; -21-27 Aug 1931 +21-27 Aug 1931 ; -T.D.A. Cockerell +T.D.A. Cockerell leg.; NHMUK • -1♀ +1♀ ; Eala; -5 Oct 1935 +5 Oct 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; Eala; -Aug 1936 +Aug 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; Eala; -Mar 1935 +Mar 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; Eala; -Oct 1936 +Oct 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; Lulua, Kapanga; -Nov 1928 +Nov 1928 ; -Walker +Walker leg.; RMNH • -1♂ +1♂ ; Lulua, Kapanga; -Aug 1932 +Aug 1932 ; -F.G. Overlaet +F.G. Overlaet leg.; RMNH . - -Kenya + +Kenya • -1♂ +1♂ ; -Naivasha +Naivasha , - -Fisherman's + +Fisherman's Camp ; -14 Mar 1993 +14 Mar 1993 ; -M. De Meyer +M. De Meyer leg.; NMK • -4♂♂ -2♀♀ +4♂♂ +2♀♀ ; -Nairobi +Nairobi ; -Mar 1928 +Mar 1928 ; -van Someren +van Someren leg.; KMMA • -1♂ +1♂ ; -Nairobi +Nairobi ; -20 Mar 1921 +20 Mar 1921 ; -A.F.J. Gedye +A.F.J. Gedye leg.; NMK • -7♂♂ -2♀♀ +7♂♂ +2♀♀ ; -Nairobi +Nairobi , -Karura Forest +Karura Forest ; -23 Nov 2017 +23 Nov 2017 ; PINDIP course leg.; KMMA . - -Malawi + +Malawi • -1♂ +1♂ ; -Mulanje -Mountain +Mulanje +Mountain ; -26 Nov 1912 +26 Nov 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ -1♀ +1♂ +1♀ ; -Zomba +Zomba Plateau; -1 Dec 1911 +1 Dec 1911 ; collector unknown; NHMUK • -3♂♂ +3♂♂ ; -Zomba +Zomba Plateau; -24 Nov 1980 +24 Nov 1980 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • -2♂♂ +2♂♂ ; -Zomba +Zomba Plateau; date unknown; -H.S. Stannus +H.S. Stannus leg.; NHMUK • -1♂ +1♂ ; -Zomba +Zomba Plateau; -24-27 Nov 1980 +24-27 Nov 1980 ; -J.G.H. Londt +J.G.H. Londt and -B. Stuckenberg +B. Stuckenberg leg.; NMSA • -7♂♂ -6♀♀ +7♂♂ +6♀♀ ; -Zomba +Zomba , Kuchawe Trout Farm; -8-11 Nov 2016 +8-11 Nov 2016 ; -K. Jordaens +K. Jordaens leg.; KMMA . - -Senegal + +Senegal • -2♂♂ +2♂♂ ; locality and date unknown; -Bigot +Bigot leg.; NHMUK • -1♂ +1♂ ; -Nema Ba +Nema Ba ; -10 Nov 2016 +10 Nov 2016 ; - + S. -Cavailles +Cavailles leg.; SCPC . - -South Africa + +South Africa • -2♂♂ +2♂♂ ; -Barber Nature Reserve +Barber Nature Reserve ; -7 Oct 2015 +7 Oct 2015 ; - + A. -Vujic +Vujic et al. leg.; UNS • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Dukuduku Forest Reserve +Dukuduku Forest Reserve ; -18-19 Jul 1981 +18-19 Jul 1981 ; -J.G.H. Londt +J.G.H. Londt and -B. Stuckenberg +B. Stuckenberg leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Umlalazi Nature Reserve +Umlalazi Nature Reserve ; -8 Nov 1997 +8 Nov 1997 ; -J.G.H. Londt +J.G.H. Londt and -A. Londt +A. Londt leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Bluff Nature Reserve +Bluff Nature Reserve ; -3 Sep 2018 +3 Sep 2018 ; -J. Midgley +J. Midgley leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , Durban; -23 Apr 1920 +23 Apr 1920 ; -C.N. Barker +C.N. Barker leg.; DMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , Durban; -8 Feb 1919 +8 Feb 1919 ; -C.N. Barker +C.N. Barker leg.; DMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , Durban; Nov-Dec1945; -H.W. Bell Marley +H.W. Bell Marley leg.; DMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , Pietermaritzburg, Botanical Gardens; -15 Nov 2018 +15 Nov 2018 ; -J. Midgley +J. Midgley leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Ngoye Forest Reserve +Ngoye Forest Reserve ; -29 Jan 1968 +29 Jan 1968 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Ubombo Mountain Reserve +Ubombo Mountain Reserve ; -11 Oct 2019 +11 Oct 2019 ; -D. Brothers +D. Brothers leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Umlalazi Nature Reserve +Umlalazi Nature Reserve ; -8 Nov 1997 +8 Nov 1997 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA • -1♂ +1♂ ; -KwaZulu-Natal +KwaZulu-Natal , -Dukuduku Forest +Dukuduku Forest , -4♂♂ +4♂♂ W of - -St. Lucia + +St. Lucia ; -26 Nov 1971 +26 Nov 1971 ; -M.E. Irwin +M.E. Irwin leg.; NMSA . - -Uganda + +Uganda • -1♂ +1♂ ; between -Jinja +Jinja and -Bussia +Bussia ; -28 Jul-1 Aug 1911 +28 Jul-1 Aug 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♀ +1♀ ; -Jinja +Jinja ; -Oct 1930 +Oct 1930 ; -van Someren +van Someren leg.; NHMUK • -2♂♂ -1♀ +2♂♂ +1♀ ; between Sewiza and -Kampala +Kampala ; -27-31 Aug 1911 +27-31 Aug 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; Entebbe; -17 Aug 1911 +17 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ -2♀♀ +1♂ +2♀♀ ; Entebbe; -21 Aug 1911 +21 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; Entebbe; -31 Aug 1911 +31 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; Entebbe; -18-20 Nov 1911 +18-20 Nov 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; Entebbe; -11 Aug 1912 +11 Aug 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; Entebbe; -16 Aug 1912 +16 Aug 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -2♂♂ +2♂♂ ; Entebbe; -17 Aug 1912 +17 Aug 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -2♂♂ +2♂♂ ; Entebbe; -27 May 1912 +27 May 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -3♂♂ -1♀ +3♂♂ +1♀ ; Entebbe; -7-9 May 1912 +7-9 May 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -2♂♂ -2♀♀ +2♂♂ +2♀♀ ; Entebbe; -3 Nov 1912 +3 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ -1♀ +1♂ +1♀ ; Entebbe; -14 Nov 1912 +14 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -6♂♂ -1♀ +6♂♂ +1♀ ; Entebbe; -18-20 Nov 1912 +18-20 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; Entebbe; -13 Oct 1912 +13 Oct 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ -1♀ +1♂ +1♀ ; Entebbe; -16 Oct 1912 +16 Oct 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; Entebbe; -3 Sep 1912 +3 Sep 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; Entebbe; -18-20 Nov 1911 +18-20 Nov 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; Entebbe; -1-14 Sep 1912 +1-14 Sep 1912 ; -C.A. Wiggins +C.A. Wiggins leg.; NHMUK • -1♂ +1♂ ; Entebbe; -1-11 Sep 1911 +1-11 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; -South of Maseka +South of Maseka , -Katera Forest +Katera Forest ; -May 1972 +May 1972 ; -E.B. Babyetagara +E.B. Babyetagara leg.; CNC • -5♂♂ -2♀♀ +5♂♂ +2♀♀ ; N.W. shores of Vic. Nyanza; -12-15 Sep 1911 +12-15 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -5♂♂ -3♀♀ +5♂♂ +3♀♀ ; -Northern Buddu +Northern Buddu ; -16-18 Sep 1911 +16-18 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; -Nsoje River +Nsoje River ; -2 Mar 1911 +2 Mar 1911 ; -van Someren +van Someren leg.; NHMUK • -1♂ +1♂ ; -N. Ankole +N. Ankole , Nyrbthozi; -21 Jan 1975 +21 Jan 1975 ; -M.K. Paulus +M.K. Paulus leg.; CNC • -1♀ +1♀ ; -South of Lake George +South of Lake George ; -17-19 Oct 1911 +17-19 Oct 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; -S.E. Ankole +S.E. Ankole ; -4-8 Oct 1911 +4-8 Oct 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; -Tero Forest +Tero Forest ; -8 Jul 1912 +8 Jul 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -2♂♂ +2♂♂ ; -S.E. Buddu +S.E. Buddu , -Tero Forest +Tero Forest ; -26-30 Sep 1911 +26-30 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♀ +1♀ ; Toro, -Duro River +Duro River ; -6 Mar 1911 +6 Mar 1911 ; -van Someren +van Someren leg.; NHMUK • -1♂ -1♀ +1♂ +1♀ ; Toro, -Duro River +Duro River ; -12 Mar 1911 +12 Mar 1911 ; -van Someren +van Someren leg.; NHMUK • -1♂ +1♂ ; -Tororo +Tororo ; -25 Jan 1967 +25 Jan 1967 ; -F.K. Masasai +F.K. Masasai leg.; NHMUK • -1♂ +1♂ ; District West - -Uganda + +Uganda , -W. Ankole +W. Ankole ; -19-24 Apr 1973 +19-24 Apr 1973 ; -H. Falke +H. Falke leg.; CNC • -1♂ +1♂ ; -District West +District West - -Uganda + +Uganda , W. -Ankole +Ankole ; -30 Dec 1975 +30 Dec 1975 ; -M.K. Paulus +M.K. Paulus leg.; CNC • -1♀ +1♀ ; locality and date unknown; -R.C. Bradley +R.C. Bradley leg.; NHMUK . - -Zambia + +Zambia • -1♂ +1♂ ; -Lake Bangweulu +Lake Bangweulu , -Kapola, N. +Kapola, N. of -Kapata +Kapata ; -27 Oct 1946 +27 Oct 1946 ; collector unknown; NHMUK . - -Zimbabwe + +Zimbabwe • -1♂ +1♂ ; -Mporokoso +Mporokoso ; -2 Aug 1909 +2 Aug 1909 ; -S.A. Neave +S.A. Neave leg.; OXUM . - -Re-description male - - + +Re-description male + + (Fig. -24 +24 ). Body length: 13.1-15.4 mm. Wing length: 9.7-10.9 mm. - -Head + +Head (Fig. -67 +67 ). Eyes bare; holoptic, eye contiguity somewhat shorter than length of ocellar triangle. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black; black pilose; yellow pollinose on ventral half. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Occiput yellow; yellow pilose, with some shorter and thicker black pile near eye margin; yellow and white pollinose. Frontal triangle short; yellow-white; with some long, black pile; yellow pollinose. Frontal prominence shiny black with orange-brown apex. Antenna black; postpedicel white pollinose; antennal arista reddish-brown. - - -Figures 151-154. - -Mesembrius + + +Figures 151-154. + +Mesembrius , proleg, dorsal view -151 - -M. chapini +151 + +M. chapini Curran (♂) -152 - -M. perforatus +152 + +M. perforatus (Speiser) (♂) -153 - -M. regulus +153 + +M. regulus (Hull) (♂) -154 - -M. rex +154 + +M. rex Curran (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Thorax. + +Thorax. Scutum black with, dorsally, a pair of weakly-demarcated yellow pollinose vittae which fade out posteriorly; lateral yellow pollinose vitta very faint to absent; yellow and black pilose. Scutellum dark brown to black with a lighter posterior border; with long yellow pile and shorter black pile, the latter most prominent in the posterior half. - - -Figures 155-158. - -Mesembrius + + +Figures 155-158. + +Mesembrius , proleg, dorsal view -155 - -M. sulcus +155 + +M. sulcus sp. nov. (♂) -156 - -M. tibialis +156 + +M. tibialis sp. nov. (♂) -157 - -M. arcuatus +157 + +M. arcuatus sp. nov. (♂) -158 - -M. ingratus +158 + +M. ingratus (Loew) (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Legs + +Legs (Fig. -168 +168 ). All legs black, but protarsus reddish-brown; black pilose. Proleg (Fig. -159 +159 ): Femur dorsoventrally flattened; posterodorsal side with yellow, long pile and some long black pile in proximal half; with apical pile brush of long, relatively loose and curved black pile; with long black pile anteroventrally. Basitarsus orange; with a tuft of black pile on posterior side and two black spots on the most distal tarsomere. Mesoleg: Femur with long yellow and black pile. Metaleg (Fig. -189 +189 ): Femur with long and thin yellow pile; with some black pile towards distal end; with a patch of shorter and thicker black pile ventroproximally. Tibia with long black pile, especially in distal 2/3; ventrally with a swelling on distal 1/3. - - -Figures 159-162. - -Mesembrius + + +Figures 159-162. + +Mesembrius spp., proleg, dorsal view -159 - -M. tarsatus +159 + +M. tarsatus (Bigot) (♂) -160 - -M. capensis +160 + +M. capensis (Macquart) (♂) -161 - -M. senegalensis +161 + +M. senegalensis (♂) -162 - -M. longipilosus +162 + +M. longipilosus sp. nov. (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Wing + +Wing (Fig. -148 +148 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -104 +104 ). Tergite II with a pair of very large yellow-orange rounded maculae; black marking hourglass-shaped; posterior black marking equal in size to anterior black marking and with a medial white pollinose area; yellow pilose, but black pilose on posterior black marking and on posterolateral corners. Tergite III and IV with broad yellow-orange fascia, with large black, white pollinose marking on posterior 2/3; black pilose on black marking and adjacent parts of yellow-orange fascia, yellow pilose on remainder of yellow fascia and on lateral sides. - - -Figures 163-165. - -Mesembrius + + +Figures 163-165. + +Mesembrius spp., proleg, dorsal view -163 - -M. perforatus +163 + +M. perforatus (Speiser) (♂) -164 - -M. sulcus +164 + +M. sulcus sp. nov. (♂) -165 - -M. tibialis +165 + +M. tibialis sp. nov. (♂). Abbreviations: bt-basitarsus, tib-tibia. - -Genitalia + +Genitalia (Fig. -226 +226 ). Epandrium: Dorsal lobe of surstylus broadly rounded; with short black spines on almost entire surface; dorsally long yellow pilose. Ventral lobe of surstylus straight; bare. - -Description female - - + +Description female + + (Fig. -44 +44 ). Body length: 11.0-13.2 mm. Wing length: 12.7-15.6 mm. Similar to the female of - -M. sulcus + +M. sulcus sp. nov., but the maculae on abdominal tergite II are larger and triangular (Fig. -125 +125 ). Head as in Fig. -81 +81 . - -Distribution. -Democratic Republic of the Congo, Kenya, Malawi, Senegal, South Africa, Uganda, Zambia and Zimbabwe. - - -Figures 166-171. - -Mesembrius + +Distribution. +Democratic Republic of the Congo, Kenya, Malawi, Senegal, South Africa, Uganda, Zambia and Zimbabwe. + + +Figures 166-171. + +Mesembrius spp., proleg, dorsal view -166 - -M. simplicipes +166 + +M. simplicipes Curran (♂) -167 - -M. platytarsis +167 + +M. platytarsis Curran syn. nov. (♂) -168 - -M. tarsatus +168 + +M. tarsatus (Bigot) (♀) -169 - -M. chapini +169 + +M. chapini Curran (♀) -170 - -M. rex +170 + +M. rex Curran (♀) -171 - -M. regulus +171 + +M. regulus (Hull) (♀). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. - -Comments. - + +Comments. + See - -M. sulcus + +M. sulcus sp. nov. - - -Figures 172-176. - -Mesembrius + + +Figures 172-176. + +Mesembrius spp., proleg, dorsal view -172 - -M. strigilatus +172 + +M. strigilatus (Bezzi) (♀) -173 - -M. minor +173 + +M. minor (Bezzi) (♀) -174 - -M. senegalensis +174 + +M. senegalensis (Macquart) (♀) -175 - -M. caffer +175 + +M. caffer (Loew) (♀). Mesoleg, posterior view -176 - -M. sulcus +176 + +M. sulcus sp. nov. (♂). Abbreviations: bt-basitarsus, fem-femur, tib-tibia. diff --git a/data/97/52/E2/9752E2CB8BAA28232F9B22B3D41B3E7A.xml b/data/97/52/E2/9752E2CB8BAA28232F9B22B3D41B3E7A.xml index 7feaf1377c9..ec75bee5c55 100644 --- a/data/97/52/E2/9752E2CB8BAA28232F9B22B3D41B3E7A.xml +++ b/data/97/52/E2/9752E2CB8BAA28232F9B22B3D41B3E7A.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus rubripennis Miyake & Yamaya, 1994 + + + +Peltonotus rubripennis Miyake & Yamaya, 1994 Figs 49, 67, 85 - -Diagnosis (male and female). -Length 12.0-12.5 mm, color overall castaneous, elytral disc brown with iridescent bloom, head with unisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 slightly enlarged and not obviously dorsoventrally flattened, mala lacking lamellate setal brush, maxillary stipes lacking setae curled at apices, male protibia tridentate with basal tooth weakly developed (Fig. 49), form of parameres (Fig. 67), female epipleuron simple and lacking emargination at apex (Fig. 85). + +Diagnosis (male and female). +Length 12.0-12.5 mm, color overall castaneous, elytral disc brown with iridescent bloom, head with unisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 slightly enlarged and not obviously dorsoventrally flattened, mala lacking lamellate setal brush, maxillary stipes lacking setae curled at apices, male protibia tridentate with basal tooth weakly developed (Fig. 49), form of parameres (Fig. 67), female epipleuron simple and lacking emargination at apex (Fig. 85). - -Distribution. -Malaysia, Borneo Island (Sabah and Sarawak). + +Distribution. +Malaysia, Borneo Island (Sabah and Sarawak). \ No newline at end of file diff --git a/data/9D/AE/2A/9DAE2ACD56DC6F56B490A3D964DD2E28.xml b/data/9D/AE/2A/9DAE2ACD56DC6F56B490A3D964DD2E28.xml index 9dd26afba0c..3967ab1630b 100644 --- a/data/9D/AE/2A/9DAE2ACD56DC6F56B490A3D964DD2E28.xml +++ b/data/9D/AE/2A/9DAE2ACD56DC6F56B490A3D964DD2E28.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus nethis Jameson & Wada, 2004 + + + +Peltonotus nethis Jameson & Wada, 2004 Figs 31, 83 - -Diagnosis (female only). -Length ~13.7 mm, color overall black, elytra black with iridescent bloom, head with unisetigerous punctures or lacking setae, labrum bi-emarginate, mentum rounded in apical half (Fig. 31), labial palpomere 2 greatly enlarged and dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes without setae curled at apices, female epipleuron simple, not incised (Fig. 83). + +Diagnosis (female only). +Length ~13.7 mm, color overall black, elytra black with iridescent bloom, head with unisetigerous punctures or lacking setae, labrum bi-emarginate, mentum rounded in apical half (Fig. 31), labial palpomere 2 greatly enlarged and dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes without setae curled at apices, female epipleuron simple, not incised (Fig. 83). - -Distribution. -Malaysia, Borneo Island (Sabah). + +Distribution. +Malaysia, Borneo Island (Sabah). \ No newline at end of file diff --git a/data/A5/90/79/A59079FF0C9DDC3A35FB7AEA6DB2CC6C.xml b/data/A5/90/79/A59079FF0C9DDC3A35FB7AEA6DB2CC6C.xml index 18041c15d48..d1c7d35fe96 100644 --- a/data/A5/90/79/A59079FF0C9DDC3A35FB7AEA6DB2CC6C.xml +++ b/data/A5/90/79/A59079FF0C9DDC3A35FB7AEA6DB2CC6C.xml @@ -1,64 +1,64 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus gracilipodus Jameson & Wada, 2004 + + + +Peltonotus gracilipodus Jameson & Wada, 2004 Figs 26, 62, 77 - -Diagnosis (male and female). -Length 14.4-16.8 mm, color overall castaneous, elytra castaneous with weak iridescent bloom, head with some multisetigerous punctures, labrum deeply bi-lobed, mentum rounded in apical half (Fig. 26), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 26), mala with lamellate setal brush, maxillary stipes with some setae curled at apices, male protibia bidentate, form of parameres (Fig. 62), female epipleuron incised and with oblong-oval emargination (Fig. 77). + +Diagnosis (male and female). +Length 14.4-16.8 mm, color overall castaneous, elytra castaneous with weak iridescent bloom, head with some multisetigerous punctures, labrum deeply bi-lobed, mentum rounded in apical half (Fig. 26), labial palpomere 2 enlarged and obviously dorsoventrally flattened (Fig. 26), mala with lamellate setal brush, maxillary stipes with some setae curled at apices, male protibia bidentate, form of parameres (Fig. 62), female epipleuron incised and with oblong-oval emargination (Fig. 77). - -Distribution. -Indonesia, Sumatra Island. + +Distribution. +Indonesia, Sumatra Island. - -Remarks. - -Peltonotus gracilipodus + +Remarks. + +Peltonotus gracilipodus and -Peltonotus podocrassus +Peltonotus podocrassus (distributed in peninsular Malaysia) have quite similar male parameres and females have quite similar epipleura, perhaps indicating recent isolation of ancestral populations. diff --git a/data/B0/71/1A/B0711A06958FBB7D38191EF71BF7032E.xml b/data/B0/71/1A/B0711A06958FBB7D38191EF71BF7032E.xml index 3e32d19372e..21b532242d0 100644 --- a/data/B0/71/1A/B0711A06958FBB7D38191EF71BF7032E.xml +++ b/data/B0/71/1A/B0711A06958FBB7D38191EF71BF7032E.xml @@ -1,69 +1,69 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus nasutus Arrow, 1910 + + + +Peltonotus nasutus Arrow, 1910 Figs 14-15, 23, 30, 52, 66, 82, 92 - -Diagnosis (male and female). - + +Diagnosis (male and female). + Length 19.6-20.6 mm, color overall black or castaneous, elytra black or castaneous and shining (Fig. 14-15), head with unisetigerous punctures and apex of clypeus with weak tubercle medially (Fig. 23), labrum weakly sinuate -( +( Fig. 23), mentum quadrate in apical half (Fig. 30), labial palpomere 2 not enlarged and not dorsoventrally flattened, mala lacking lamellate setal brush, maxillary stipes without setae curled at apices, male protibia tridentate with well developed basal tooth, male protibial claw greatly enlarged (Fig. 52), form of male parameres (Fig. 66), female epipleuron weakly, quadrately incised (Fig. 82) and with well developed dorsal pillow. - -Distribution -(Fig. 92). Cambodia, China (southern), Laos, Myanmar, Thailand, Vietnam. + +Distribution +(Fig. 92). Cambodia, China (southern), Laos, Myanmar, Thailand, Vietnam. - - -Remarks + + +Remarks . - -Peltonotus nasutus + +Peltonotus nasutus is the most common species in the genus and the only species with an apicomedial tubercle on the clypeus (male only). diff --git a/data/B0/7F/D5/B07FD56EA0F63FFE7B84CE6E65E58BC0.xml b/data/B0/7F/D5/B07FD56EA0F63FFE7B84CE6E65E58BC0.xml index 2baf4180b9f..c73771078f9 100644 --- a/data/B0/7F/D5/B07FD56EA0F63FFE7B84CE6E65E58BC0.xml +++ b/data/B0/7F/D5/B07FD56EA0F63FFE7B84CE6E65E58BC0.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus animus Jameson & Wada, 2009 + + + +Peltonotus animus Jameson & Wada, 2009 Figs 1, 36, 45, 56 - -Diagnosis (male only). -Length ~16.5 mm, color overall castaneous, elytra castaneous with weak iridescent bloom (Fig. 1), frons with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 enlarged and dorsoventrally flattened, mala with dense lamellate setal brush (Fig. 36), maxillary stipes with some setae curled at apices (Fig. 36), male protibia tridentate with basal tooth obsolete (Fig. 45), and male parameres (Fig. 56). + +Diagnosis (male only). +Length ~16.5 mm, color overall castaneous, elytra castaneous with weak iridescent bloom (Fig. 1), frons with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 enlarged and dorsoventrally flattened, mala with dense lamellate setal brush (Fig. 36), maxillary stipes with some setae curled at apices (Fig. 36), male protibia tridentate with basal tooth obsolete (Fig. 45), and male parameres (Fig. 56). - -Distribution. -Indonesia, Sumatra Island. + +Distribution. +Indonesia, Sumatra Island. \ No newline at end of file diff --git a/data/B1/BC/8B/B1BC8B6B34F8A1F88C47954721D95D11.xml b/data/B1/BC/8B/B1BC8B6B34F8A1F88C47954721D95D11.xml index cf38f768c6f..965c0ee5402 100644 --- a/data/B1/BC/8B/B1BC8B6B34F8A1F88C47954721D95D11.xml +++ b/data/B1/BC/8B/B1BC8B6B34F8A1F88C47954721D95D11.xml @@ -1,86 +1,86 @@ - - - -A revision of the Chinese Gasteruptiidae (Hymenoptera, Evanioidea) + + + +A revision of the Chinese Gasteruptiidae (Hymenoptera, Evanioidea) - - -Author + + +Author -Zhao, Ke-xin +Zhao, Ke-xin - - -Author + + +Author -Achterberg, Cornelis van +Achterberg, Cornelis van - - -Author + + +Author -Xu, Zai-fu +Xu, Zai-fu -text - - -ZooKeys +text + + +ZooKeys - -2012 - -237 + +2012 + +237 - -1 -123 + +1 +123 - -http://dx.doi.org/10.3897/zookeys.237.3956 + +http://dx.doi.org/10.3897/zookeys.237.3956 -journal article -http://dx.doi.org/10.3897/zookeys.237.3956 -1313-2970-237-1 +journal article +http://dx.doi.org/10.3897/zookeys.237.3956 +1313-2970-237-1 - - - -Gasteruptiidae Ashmead, 1900 + + + +Gasteruptiidae Ashmead, 1900 - -Diagnosis. - + +Diagnosis. + Body length between 5.0-20.0 mm; female antenna 14-segmented, male 13-segmented, very rarely 14-segmented; eye relatively long, extending almost to mandible; mandibles short and not broadly overlapping when closed; maxillary palp 6-segmented, labial palp 4-segmented; propleuron neck-like, more or less as long as mesoscutum in front of tegulae; propodeum with or without longitudinal carina; fore wing with discal cell small or absent; trochantellus of hind leg distinctly differentiated, hind tibia (or metatibia) clavate; metasoma inserted very high on propodeum; ovipositor varies from not exposed (in -Pseudofoenus +Pseudofoenus ) to more than twice as long as the body ( -Jennings and Austin 2002 +Jennings and Austin 2002 ; -Macedo 2009 +Macedo 2009 ; -2011 +2011 ). - + Gasteruptiidae includes two extant subfamilies, -Hyptiogastrinae +Hyptiogastrinae and -Gasteruptiinae +Gasteruptiinae . -Gasteruptiinae +Gasteruptiinae is distinguished from -Hyptiogastrinae +Hyptiogastrinae mainly by mandible short, prefemur present, female subgenital sternite notched or slit ( -Jennings and Austin 2002 +Jennings and Austin 2002 ). - + In China only the genus -Gasteruption +Gasteruption belonging to the subfamily -Gasteruptiinae +Gasteruptiinae occurs. diff --git a/data/B3/2B/AE/B32BAEF0179C51C69292EAA6D1C2F139.xml b/data/B3/2B/AE/B32BAEF0179C51C69292EAA6D1C2F139.xml index 149a25ca3fa..8ca8278125b 100644 --- a/data/B3/2B/AE/B32BAEF0179C51C69292EAA6D1C2F139.xml +++ b/data/B3/2B/AE/B32BAEF0179C51C69292EAA6D1C2F139.xml @@ -1,1310 +1,1310 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius cyanipennis (Bezzi, 1915) -Figs 10 -, 32 -, 53 -, 71 -, 90 -, 112 -, 113 -, 132 -, 212 + + + +Mesembrius cyanipennis (Bezzi, 1915) +Figs 10 +, 32 +, 53 +, 71 +, 90 +, 112 +, 113 +, 132 +, 212 - - -Helophilus cyanipennis -Herve-Bazin + + +Helophilus cyanipennis +Herve-Bazin , 1914a: 297. Nomen nudum. - -Helophilus (Mesembrius) cyanipennis + +Helophilus (Mesembrius) cyanipennis Bezzi, 1915: 97. - -Helophilus cyanipennis + +Helophilus cyanipennis - -Curran (1927) +Curran (1927) : 60 - -Brunetti (1926) +Brunetti (1926) : 166 - -Curran (1939) +Curran (1939) : 9 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius cyanipennis + +Differential diagnosis. + + +Mesembrius cyanipennis males are dichoptic, have a black face, no apical pile brush on the profemur, an unmodified metatibia, have short, but conspicuously dense dark pile on the anterior proximal half of all femora, a dark scutum without vittae and a largely yellow-orange abdomen. - -Mesembrius cyanipennis + +Mesembrius cyanipennis is one of the two species with a black face and differs from - -M. nigriceps + +M. nigriceps in the absence of conspicuous thick black pile on the ventral side of the metafemur. Females have a black face (as in - -M. morio + +M. morio ), but tergite II has a pair of large orange maculae and the other tergites are to a various extent orange (tergites entirely black in - -M. morio + +M. morio ). All other species have a white to yellow face with a medial dark vitta. - -Examined material. - - -Helophilus cyanipennis + +Examined material. + + +Helophilus cyanipennis Bezzi: - -Lectotype + +Lectotype (hereby designated), male, - + " -SYNTYPUS +SYNTYPUS " -"Syn-//type" +"Syn-//type" " -Hel. +Hel. ( -Mes. +Mes. )// -♂ -Type +♂ +Type // -Helophilus cyanipennis +Helophilus cyanipennis // -Bezzi +Bezzi " " -Pres. By +Pres. By // -Impl. Bureau Ent. +Impl. Bureau Ent. //1915-165." " -Uganda -Prot. +Uganda +Prot. ,// -Entebbe. +Entebbe. // -1-11 Sep1911 +1-11 Sep1911 .// -S.A. Neave. +S.A. Neave. " " -Mesembrius +Mesembrius // -Mesembrius cyanipennis +Mesembrius cyanipennis //n.sp//Type -♂ +♂ " " NHMUK 013428968" [NHMUK] . - -Paralectotype + +Paralectotype , female, -"Syn-//type" +"Syn-//type" "Hel. (Mes.)// -♀ +♀ Type// -Mesembrius cyanipennis +Mesembrius cyanipennis //Bezzi" "Ashanti.//Obuasi.//7.xiii.06// -W.M. Graham. +W.M. Graham. //1907-74." " -Mesembrius +Mesembrius // -Mesembrius cyanipennis +Mesembrius cyanipennis //Type -♀ +♀ n.sp." " NHMUK 013428969" [NHMUK] . - -Paralectotype + +Paralectotype , female, -"Syn-//type" +"Syn-//type" , "H.(M.) -Mesembrius cyanipennis +Mesembrius cyanipennis , -Bezzi +Bezzi // -Bezzi +Bezzi det.//1915.)" "caught on flower" " -Obuasi +Obuasi ,// -Ashanti +Ashanti ,// -20.vii.1907 +20.vii.1907 ,// -Dr. W.M. Graham. +Dr. W.M. Graham. //1908-245." " NHMUK 013428970" [NHMUK]. Paralectoype, female, -"Syn-//type" +"Syn-//type" , "H.(M.) -Mesembrius cyanipennis +Mesembrius cyanipennis , Bezzi// -Bezzi +Bezzi det.//1915.)" "caught on flower" "Obuasi,//Ashanti,// -21.vi.1907 +21.vi.1907 ,// -Dr. W.M. Graham +Dr. W.M. Graham //1908-245." " NHMUK 013428971" [NHMUK] . - -Paralectotype + +Paralectotype , female, -"Syn-//type" +"Syn-//type" , "H.(M.) -Mesembrius cyanipennis +Mesembrius cyanipennis , -Bezzi +Bezzi // -Bezzi +Bezzi det.//1915.)" " -Caught +Caught on umbelli-//ferus flowers in//swamp." " -Obuasi +Obuasi ,// -Ashanti +Ashanti ,// -28.vi.1907 +28.vi.1907 ,// -Dr. W.M. Graham +Dr. W.M. Graham //1908-245." " NHMUK 013428972" [NHMUK] . - -Other material - - -Benin + +Other material + + +Benin • -1♂ -1♀ +1♂ +1♀ ; - -Ifangni-range + +Ifangni-range ; -6 Jun 2015 +6 Jun 2015 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Ifangni-range + +Ifangni-range ; -6 May 2016 +6 May 2016 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ -1♀ +1♂ +1♀ ; - -Ifangni-range + +Ifangni-range ; -19 Mar 2017 +19 Mar 2017 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Lokossa + +Lokossa ; -Oct 2005 +Oct 2005 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Niaouli + +Niaouli ; -10 Dec 2013 +10 Dec 2013 ; -G. Goergen +G. Goergen and -K. Jordaens +K. Jordaens leg.; KMMA • -1♂ -3♀♀ +1♂ +3♀♀ ; - -Niaouli + +Niaouli ; -2 Feb 2014 +2 Feb 2014 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - - -Pobe + + +Pobe ; -13 Jun 2015 +13 Jun 2015 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - - -Pobe + + +Pobe ; -28 Jan 2016 +28 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - - -Pobe + + +Pobe ; -27 Jan 2016 +27 Jan 2016 ; -G. Goergen +G. Goergen leg.; KMMA . - -Cameroon + +Cameroon • -1♀ +1♀ ; - - + + Abong -M'Bang +M'Bang District ; -1-30 Apr 1936 +1-30 Apr 1936 ; -F.G. Merfield +F.G. Merfield leg.; NHMUK . - -Democratic Republic of the Congo + +Democratic Republic of the Congo • -1♀ +1♀ ; - - -Haut-Uele + + +Haut-Uele , -Arebi +Arebi ; date unknown; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; - - -Bas-Uele + + +Bas-Uele , -Bambesi +Bambesi ; -15 Sep 1933 +15 Sep 1933 ; - + H.J. -Bredo +Bredo leg.; KMMA • -1♀ +1♀ ; - - -Bas-Uele + + +Bas-Uele , -Bambili +Bambili ; date unknown; -J. Rodhain +J. Rodhain leg.; KMMA • -1♀ +1♀ ; - -Lulua + +Lulua , -Kapanga +Kapanga ; -Nov 1932 +Nov 1932 ; -G.F. Overlaet +G.F. Overlaet leg.; KMMA • -1♀ +1♀ ; - -Katanga + +Katanga ; -Mar 1933 +Mar 1933 ; -G.F. Overlaet +G.F. Overlaet leg.; KMMA • -1♀ +1♀ ; - -Ituri + +Ituri , -Kilo +Kilo , -Kere-Kere +Kere-Kere ; -Mar 1948 +Mar 1948 ; -Turco +Turco leg.; KMMA • -1♀ +1♀ ; - -Tshopo + +Tshopo , -Stanleyville +Stanleyville [= Kisangani]; 1914; -J. Bequaert +J. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Tshopo + +Tshopo , -Stanleyville +Stanleyville [= Kisangani]; -4 Apr 1915 +4 Apr 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♀ +1♀ ; - -Tshopo + +Tshopo , -Stanleyville +Stanleyville [= Kisangani]; -7 Apr 1915 +7 Apr 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♀ +1♀ ; - -Tshopo + +Tshopo , -Stanleyville +Stanleyville [= Kisangani]; -8 Apr 1915 +8 Apr 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♀ +1♀ ; - -Tshopo + +Tshopo , -Stanleyville +Stanleyville [= Kisangani]; -9 Apr 1915 +9 Apr 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; - -Tshopo + +Tshopo , -Stanleyville +Stanleyville [= Kisangani]; -Mar 1915 +Mar 1915 ; -Lang +Lang and -Chapin +Chapin leg.; KMMA • -1♂ -1♀ +1♂ +1♀ ; - -Elisabethville + +Elisabethville [= Lubumbashi]; -11 Apr 1921 +11 Apr 1921 ; -M. Bequaert +M. Bequaert leg.; KMMA • -1♀ +1♀ ; - -Lomami + +Lomami , -Mutombo +Mutombo ; -Mar 1931 +Mar 1931 ; - + P. -Quarre +Quarre leg.; KMMA • -1♀ +1♀ ; - -Haut-Lomami + +Haut-Lomami , -Sankisia +Sankisia ; -4 Apr 1911 +4 Apr 1911 ; -Dr. Bequaert +Dr. Bequaert leg.; KMMA • -1♂ +1♂ ; - - -Uele + + +Uele ; date unknown; -J. Rodhain +J. Rodhain leg.; KMMA • -1♂ +1♂ ; - -Eala + +Eala ; -Apr 1935 +Apr 1935 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; - -Eala + +Eala ; -Feb 1936 +Feb 1936 ; - + J. -Ghesquiere +Ghesquiere leg.; RMNH • -1♀ +1♀ ; - -Eala + +Eala ; -Nov 1935 +Nov 1935 ; -G.F. Overlaet +G.F. Overlaet leg.; RMNH • -1♀ +1♀ ; - -Eala + +Eala , -Bambesa +Bambesa ; -30 Oct 1933 +30 Oct 1933 ; -J. Leroy +J. Leroy leg.; RMNH • -1♀ +1♀ ; - -Lulua + +Lulua , -Kapanga +Kapanga ; -Nov 1932 +Nov 1932 ; -G.F. Overlaet +G.F. Overlaet leg.; RMNH . - -Ghana + +Ghana • -1♂ +1♂ ; - -Wati Waterfalls + +Wati Waterfalls ; -Feb 2003 +Feb 2003 ; -G. Goergen +G. Goergen leg.; IITA . - -Nigeria + +Nigeria • -1♀ +1♀ ; - -Ibadan + +Ibadan , IITA station; -3 Feb 2000 +3 Feb 2000 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Ikotobo + +Ikotobo ; -10 Nov 1913 +10 Nov 1913 ; -J.W.S. ScottMacie +J.W.S. ScottMacie leg.; NHMUK . - -Sierra Leone + +Sierra Leone • -1♂ -1♀ +1♂ +1♀ ; - -Kamakoni + +Kamakoni ; -22 Apr 1912 +22 Apr 1912 ; -J.J. Simpson +J.J. Simpson leg.; NHMUK . - -South Africa + +South Africa • -1♂ +1♂ ; - -KwaZulu-Natal + +KwaZulu-Natal , -Manguzi Forest Reserve +Manguzi Forest Reserve ; -13-16 Dec 2010 +13-16 Dec 2010 ; -J.G.H. Londt +J.G.H. Londt leg.; NMSA . - -Togo + +Togo • -1♀ +1♀ ; - -Kloto Forest + +Kloto Forest ; -Dec 2007 +Dec 2007 ; -G. Goergen +G. Goergen leg.; IITA • -1♀ +1♀ ; - -Kloto Forest + +Kloto Forest ; -Nov 2007 +Nov 2007 ; -G. Goergen +G. Goergen leg.; IITA • -1♂ +1♂ ; - -Kloto Forest + +Kloto Forest ; -Feb 2016 +Feb 2016 ; -G. Goergen +G. Goergen leg.; IITA • -2♀♀ +2♀♀ ; - -Kloto Forest + +Kloto Forest ; -21-24 Jun 2015 +21-24 Jun 2015 ; -G. Goergen +G. Goergen leg.; KMMA • -1♀ +1♀ ; - -Kloto Forest + +Kloto Forest ; -Feb 2016 +Feb 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -1♀ +1♀ ; - -Kloto Forest + +Kloto Forest ; -Nov 2016 +Nov 2016 ; -G. Goergen +G. Goergen leg.; KMMA • -2♂♂ -2♀♀ +2♂♂ +2♀♀ ; - -Kloto Forest + +Kloto Forest ; -Feb 2017 +Feb 2017 ; -G. Goergen +G. Goergen leg.; KMMA • -1♂ +1♂ ; - -Kloto Forest + +Kloto Forest ; -Mar 2017 +Mar 2017 ; -G. Goergen +G. Goergen leg.; KMMA • -1♀ +1♀ ; - - + + Kuma -Adame +Adame ; -22-24 Jan 2016 +22-24 Jan 2016 ; -G. Goergen +G. Goergen leg.; IITA . - -Uganda + +Uganda • -2♂♂ -1♀ +2♂♂ +1♀ ; - -Entebbe + +Entebbe ; -9 Aug 1911 +9 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; - -Entebbe + +Entebbe ; -11 Aug 1911 +11 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -14 Aug 1911 +14 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ -1♀ +1♂ +1♀ ; - -Entebbe + +Entebbe ; -16 Aug 1911 +16 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -2♂♂ +2♂♂ ; - -Entebbe + +Entebbe ; -17 Aug 1911 +17 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -4♂♂ -2♀♀ +4♂♂ +2♀♀ ; - -Entebbe + +Entebbe ; -21 Aug 1911 +21 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -31 Aug 1911 +31 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; - -Entebbe + +Entebbe ; -17 Jul 1911 +17 Jul 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ • - -Entebbe + +Entebbe ; -28 Jul 1911 +28 Jul 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ -3♀♀ +1♂ +3♀♀ ; - -Entebbe + +Entebbe ; -12-13 Dec 1912 +12-13 Dec 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -3♀♀ +3♀♀ ; - -Entebbe + +Entebbe ; -3-4 Dec 1912 +3-4 Dec 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♂ +1♂ ; - -Entebbe + +Entebbe ; -27 May 1912 +27 May 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -3 Nov 1912 +3 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -3♀♀ +3♀♀ ; - -Entebbe + +Entebbe ; -14 Nov 1912 +14 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -9♀♀ +9♀♀ ; - -Entebbe + +Entebbe ; -18-20 Nov 1912 +18-20 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -16 Oct 1912 +16 Oct 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -3 Sep 1912 +3 Sep 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • -6♂♂ -9♀♀ +6♂♂ +9♀♀ ; - -Entebbe + +Entebbe ; -1-11 Sep 1911 +1-11 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♂ +1♂ ; - -Entebbe + +Entebbe ; -7-9 May 1912 +7-9 May 1912 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -18 May 1912 +18 May 1912 ; collector unknown; NHMUK • -1♂ -1♀ +1♂ +1♀ ; - -Entebbe + +Entebbe ; -7 Mar 1973 +7 Mar 1973 ; -H. Falke +H. Falke leg.; RMNH • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -7 Mar 1973 +7 Mar 1973 ; -H. Falke +H. Falke leg.; RMNH • -1♀ +1♀ ; - -Entebbe + +Entebbe ; -7 Oct 1971 +7 Oct 1971 ; -H. Falke +H. Falke leg.; RMNH • -1♀ +1♀ ; - -Entebbe + +Entebbe , -Kisubi Forest +Kisubi Forest ; -8-9 Jun 1976 +8-9 Jun 1976 ; -M.K. Paulus +M.K. Paulus leg.; CNC • - -1♀ + +1♀ ; -Kenya -Coast +Kenya +Coast , -Gedi +Gedi for - -Malindi + +Malindi ; -May 1973 +May 1973 ; -H. Falke +H. Falke leg.; CNC • -1♀ +1♀ ; - + W. shores of -Vic. Nyanza +Vic. Nyanza ; -19-25 Sep 1911 +19-25 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • -2♀♀ +2♀♀ ; locality and date unknown; C.C. Gowdey leg.; NHMUK. Country unknown • -1♂ +1♂ ; - -Ruwengo + +Ruwengo ; -14 May 1911 +14 May 1911 ; collector unknown; NHMUK . - -Re-description male - - + +Re-description male + + (Fig. -10 +10 ). Body length: 11.0-13.2 mm. Wing length: 9.6-10.5 mm. - -Head + +Head (Fig. -53 +53 ). Eyes bare; dichoptic, distance between eyes approx. -11/2 +11/2 x width of ocellus. Face dark brown to black; white pilose; white pollinose. Vertical triangle black; black pilose, yellow pilose on vertex; yellow pollinose until just before anterior ocellus. Distance between lateral ocellus and eye margin 1/2 width of ocellus. Frontal triangle brown, area near eye margin yellow; white pilose; white pollinose. Frontal prominence shiny black, reddish-brown at apex; black pilose. Occiput black; white pilose with some shorter, thicker, black pile near dorsal eye margin. Antenna, scape and pedicel reddish-brown; postpedicel black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black; without vitta; pile short, yellow and black. Scutellum, anterior half dark brown, posterior half lighter; yellow pilose with some shorter black pile interspersed. - -Legs. + +Legs. Legs predominantly dark brown to black. Pile on posterior side of pro- and mesofemur and on proximal distal 1/4 yellow, pile otherwise black; black pile on ventral side of femora gradually becoming longer towards distal end; ventral side of metatibia with carina. - -Wing + +Wing (Fig. -132 +132 ). Entire wing uniformly, very densely microtrichose; anterior medial part and posterior half of cell bm brownish. - -Abdomen + +Abdomen (Fig. -90 +90 ). Tergite II with large, yellow fascia, interrupted in anterior 2/3; with T-shaped black marking; yellow pilose, with short thick black pile interspersed, especially in posteromedial section. Tergite III and IV yellow-orange; yellow pilose. - -Genitalia + +Genitalia (Fig. -212 +212 ). Epandrium: Dorsal lobe of surstylus very long and thin, with pointed apex and with distal end bent upwards; with short, black spines at apex and long yellow pilose on dorsal side. Ventral lobe of surstylus convex. - -Re-description female - - + +Re-description female + + (Fig. -32 +32 ). Body length: 12.2-13.1 mm. Wing length: 8.6-11.0 mm. - -Head + +Head (Fig. -71 +71 ). Eyes bare; dichoptic. Face black; black and white pilose; white pollinose. Frons black; black pilose; lower half white pollinose. Vertex black; black pilose; grey pollinose. Distance between lateral ocellus and eye margin approx. the width of ocellus. Occiput black; yellow and black pilose dorsally, yellow pilose ventrally; grey pollinose. Frontal prominence shiny brown-black; black pilose. Antenna black; arista reddish-brown. - -Thorax. + +Thorax. Scutum and scutellum black; without vitta; short white and black pilose. - -Legs. + +Legs. Dark reddish-brown to black; short black and white pilose. - -Wing. + +Wing. Entire wing uniformly, very densely microtrichose; anterior medial part and posterior half of cell bm brownish. - -Abdomen + +Abdomen (Figs -112 +112 , -113 +113 ). Second tergite with a pair of large orange maculae and without (Fig. -112 +112 ) or with (Fig. -113 +113 ) distinct posterior black marking. Tergite III from largely orange with a vague medial black marking (Fig. -112 +112 ) to black with a pair of large, orange maculae (Fig. -113 +113 ). Tergite IV from entirely orange (Fig. -112 +112 ) to orange with a posterior black fascia (Fig. -113 +113 ). Tergite V orange. All tergites short yellow-white and black pilose. - -Distribution. -Benin, Cameroon, Democratic Republic of the Congo, Ghana, Nigeria, Sierra Leone, South Africa, Togo and Uganda. + +Distribution. +Benin, Cameroon, Democratic Republic of the Congo, Ghana, Nigeria, Sierra Leone, South Africa, Togo and Uganda. - -Comments. - - -Herve-Bazin + +Comments. + + +Herve-Bazin (1914a) was the first to use the name - -Mesembrius cyanipennis + +Mesembrius cyanipennis (as - -Helophilus cyanipennis + +Helophilus cyanipennis Bezzi). Since he did not provide a description of the species, but mentions -that the species will be described later by Mr. Prof. Bezzi +that the species will be described later by Mr. Prof. Bezzi [p. 297: "Cette -espece +espece sera prochainement -decrite +decrite par M. le Prof Bezzi"], the name should be considered as a -nomen nudum +nomen nudum . -Bezzi (1915) +Bezzi (1915) is the first to provide an adequate description for the species. diff --git a/data/B4/D5/BB/B4D5BBABE37552608730D81C09E0A398.xml b/data/B4/D5/BB/B4D5BBABE37552608730D81C09E0A398.xml index c9b044d018a..03bf3a7e35c 100644 --- a/data/B4/D5/BB/B4D5BBABE37552608730D81C09E0A398.xml +++ b/data/B4/D5/BB/B4D5BBABE37552608730D81C09E0A398.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus similis Arrow, 1931 + + + +Peltonotus similis Arrow, 1931 Figs 33, 53, 69, 86 - -Diagnosis (male and female). -Length 18.0-20.9 mm, color overall dark brown or black, elytra dark brown or black with or without iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half (Fig. 33), labial palpomere 2 slightly enlarged and not obviously dorsoventrally flattened (Fig. 33), mala without lamellate setal brush, maxillary stipes without setae curled at apices, protarsomere 5 of male with internomedial protuberance (Fig. 53), male protibia bidentate, form of parameres (Fig. 69), female epipleuron incised and with rounded emargination (Fig. 86). + +Diagnosis (male and female). +Length 18.0-20.9 mm, color overall dark brown or black, elytra dark brown or black with or without iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half (Fig. 33), labial palpomere 2 slightly enlarged and not obviously dorsoventrally flattened (Fig. 33), mala without lamellate setal brush, maxillary stipes without setae curled at apices, protarsomere 5 of male with internomedial protuberance (Fig. 53), male protibia bidentate, form of parameres (Fig. 69), female epipleuron incised and with rounded emargination (Fig. 86). - -Distribution. -Malaysia, Borneo Island (Sabah). + +Distribution. +Malaysia, Borneo Island (Sabah). \ No newline at end of file diff --git a/data/B7/3D/5F/B73D5FE46AF8CF00B9BD9362FEAB9180.xml b/data/B7/3D/5F/B73D5FE46AF8CF00B9BD9362FEAB9180.xml index 5245d796a4a..76d566ce5ee 100644 --- a/data/B7/3D/5F/B73D5FE46AF8CF00B9BD9362FEAB9180.xml +++ b/data/B7/3D/5F/B73D5FE46AF8CF00B9BD9362FEAB9180.xml @@ -1,57 +1,57 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus deltamentum Jameson & Wada, 2004 + + + +Peltonotus deltamentum Jameson & Wada, 2004 Figs 25, 38, 54, 59 - -Diagnosis (male only). -Length ~16.6 mm, color overall castaneous, elytra castaneous with weak iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum triangular in apical half (Fig. 25), labial palpomere 2 enlarged and dorsoventrally flattened, mala with dense lamellate setal brush (Fig. 38), maxillary stipes with setae curled at apices (Fig. 38), male protibia tridentate with basal tooth weakly developed, male proclaw strongly arcuate in ventral view (Fig. 54), form of parameres (Fig. 59). + +Diagnosis (male only). +Length ~16.6 mm, color overall castaneous, elytra castaneous with weak iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum triangular in apical half (Fig. 25), labial palpomere 2 enlarged and dorsoventrally flattened, mala with dense lamellate setal brush (Fig. 38), maxillary stipes with setae curled at apices (Fig. 38), male protibia tridentate with basal tooth weakly developed, male proclaw strongly arcuate in ventral view (Fig. 54), form of parameres (Fig. 59). - -Distribution. -Indonesia, Borneo Island (Kalimantan). + +Distribution. +Indonesia, Borneo Island (Kalimantan). \ No newline at end of file diff --git a/data/B7/53/B4/B753B42C5DE8B3DE75587F8BAAF0C63E.xml b/data/B7/53/B4/B753B42C5DE8B3DE75587F8BAAF0C63E.xml index b625aaca602..66d06fc279a 100644 --- a/data/B7/53/B4/B753B42C5DE8B3DE75587F8BAAF0C63E.xml +++ b/data/B7/53/B4/B753B42C5DE8B3DE75587F8BAAF0C63E.xml @@ -1,68 +1,68 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus kyojinus Jameson & Wada, 2004 + + + +Peltonotus kyojinus Jameson & Wada, 2004 Figs 27, 78 - -Diagnosis (female only). - + +Diagnosis (female only). + Length 21.3 mm, color overall castaneous, elytral disc brown with iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half (Fig. 27), labial palpomere 2 not enlarged and not obviously -dorsoventrally +dorsoventrally flattened, mala without lamellate setal brush, maxillary stipes without setae curled at apices, female epipleuron simple, not incised and lacking emargination (Fig. 78). - -Distribution. -Indonesia, Borneo Island (Kalimantan). + +Distribution. +Indonesia, Borneo Island (Kalimantan). - -Remarks. - -Peltonotus kyojinus + +Remarks. + +Peltonotus kyojinus is the largest species of -Peltonotus +Peltonotus . diff --git a/data/D5/20/30/D52030DCE1285B958D89CA6C069F82ED.xml b/data/D5/20/30/D52030DCE1285B958D89CA6C069F82ED.xml index ad7d0d3756d..ee1859e6dd4 100644 --- a/data/D5/20/30/D52030DCE1285B958D89CA6C069F82ED.xml +++ b/data/D5/20/30/D52030DCE1285B958D89CA6C069F82ED.xml @@ -1,200 +1,200 @@ - - - -? Addendum to a minimalist revision of Costa Rican Braconidae: 28 new species and 23 host records + + + +? Addendum to a minimalist revision of Costa Rican Braconidae: 28 new species and 23 host records - - -Author + + +Author -Sharkey, Michael J. -https://orcid.org/0000-0001-6201-7340 -The Hymenoptera Institute, 116 Franklin Ave., Redlands, CA, 92373, USA -msharkey@uky.edu +Sharkey, Michael J. +https://orcid.org/0000-0001-6201-7340 +The Hymenoptera Institute, 116 Franklin Ave., Redlands, CA, 92373, USA +msharkey@uky.edu - - -Author + + +Author -Baker, Austin -https://orcid.org/0000-0002-4728-726X -The Hymenoptera Institute, 116 Franklin Ave., Redlands, CA, 92373, USA & Department of Entomology, University of California, Riverside, CA 92521, USA +Baker, Austin +https://orcid.org/0000-0002-4728-726X +The Hymenoptera Institute, 116 Franklin Ave., Redlands, CA, 92373, USA & Department of Entomology, University of California, Riverside, CA 92521, USA - - -Author + + +Author -McCluskey, Kathryn -https://orcid.org/0000-0001-9862-0491 -Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA +McCluskey, Kathryn +https://orcid.org/0000-0001-9862-0491 +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA - - -Author + + +Author -Smith, Alex -https://orcid.org/0000-0002-8650-2575 -Department of Integrative Biology, University of Guelph and Biodiversity Institute of Ontario, Guelph, Canada +Smith, Alex +https://orcid.org/0000-0002-8650-2575 +Department of Integrative Biology, University of Guelph and Biodiversity Institute of Ontario, Guelph, Canada - - -Author + + +Author -Naik, Suresh -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Naik, Suresh +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Ratnasingham, Sujeevan -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Ratnasingham, Sujeevan +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Manjunath, Ramya -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Manjunath, Ramya +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Perez, Kate -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Perez, Kate +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Sones, Jayme -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Sones, Jayme +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -D'Souza, Michelle -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +D'Souza, Michelle +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Jacques, Brianne St. -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Jacques, Brianne St. +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Hebert, Paul -Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada +Hebert, Paul +Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada - - -Author + + +Author -Hallwachs, Winnie -Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA +Hallwachs, Winnie +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA - - -Author + + +Author -Janzen, Daniel -Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA +Janzen, Daniel +Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-12-07 + +2021 + +2021-12-07 - -1075 + +1075 - -77 -136 + +77 +136 - -http://dx.doi.org/10.3897/zookeys.1075.72197 + +http://dx.doi.org/10.3897/zookeys.1075.72197 -journal article -http://dx.doi.org/10.3897/zookeys.1075.72197 -1313-2970-1075-77 -3202711B0DEF4B4D95A536FF1D233FA4 -40F7184856D8509D94AD685F47FA7BC6 +journal article +http://dx.doi.org/10.3897/zookeys.1075.72197 +1313-2970-1075-77 +3202711B0DEF4B4D95A536FF1D233FA4 +40F7184856D8509D94AD685F47FA7BC6 - - - + + + ? -Amputoearinus alafumidus Lindsay & Sharkey, 2006 +Amputoearinus alafumidus Lindsay & Sharkey, 2006 - -Diagnostics. - + +Diagnostics. + Figure -8 +8 . - -BOLD data. -There is no BIN for this specimen because the barcode is too short to merit a BIN code. The short barcode follows: -ATATTTATTTAATTTTTGGAATTTGATCAGG-ATTTTAGGATTATCAATAAGAATAATTATTCGTATAGAATTAAGAATGGGGGGAAATTTTATTGGTAATGATCAAATTTATAATAGAATTGTT-CTGCTCATGCATTTATTATAATTTTTTTTAAAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGGCCCAGAAAAAGCTTTCCCCCGAATAAATAATATAAAATTTTGAT + +BOLD data. +There is no BIN for this specimen because the barcode is too short to merit a BIN code. The short barcode follows: +ATATTTATTTAATTTTTGGAATTTGATCAGG-ATTTTAGGATTATCAATAAGAATAATTATTCGTATAGAATTAAGAATGGGGGGAAATTTTATTGGTAATGATCAAATTTATAATAGAATTGTT-CTGCTCATGCATTTATTATAATTTTTTTTAAAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGGCCCAGAAAAAGCTTTCCCCCGAATAAATAATATAAAATTTTGAT - -Morphological data. - + +Morphological data. + This specimen was identified based on morphological criteria from the key in -Lindsay and Sharkey (2006) +Lindsay and Sharkey (2006) . - -Reared specimen + +Reared specimen :?: Costa Rica: Guanacaste, Area de -Conservacion +Conservacion Guanacaste, Sector Del Oro, Puente Mena, 280 m, -11.04562 --85.45742 +11.04562 +-85.45742 ; host caterpillar collection date: 11/07/2007, parasitoid eclosion: 27/07/2007; depository CNC, voucher code: DHJPAR0028287. - -Reared specimens host data + +Reared specimens host data : - -Dysodia spissicornis + +Dysodia spissicornis ( -Thyrididae +Thyrididae ) a leaf-roller feeding on - -Heisteria concinna + +Heisteria concinna ( -Olacaceae +Olacaceae ), caterpillar voucher code: 07-SRNP-22487. - -Note. -This is the first host record for this wasp genus. - - -Figure 8. - -Amputoearinus alafumidus + +Note. +This is the first host record for this wasp genus. + + +Figure 8. + +Amputoearinus alafumidus , holotype. diff --git a/data/D6/8C/11/D68C114EABBE50678F1529F49480749B.xml b/data/D6/8C/11/D68C114EABBE50678F1529F49480749B.xml index 2f848cad9d9..88e15ebf0bb 100644 --- a/data/D6/8C/11/D68C114EABBE50678F1529F49480749B.xml +++ b/data/D6/8C/11/D68C114EABBE50678F1529F49480749B.xml @@ -1,767 +1,767 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius madagascariensis Keiser, 1971 -Figs 13 -, 34 -, 56 -, 93 -, 115 -, 136 -, 180 -, 215 + + + +Mesembrius madagascariensis Keiser, 1971 +Figs 13 +, 34 +, 56 +, 93 +, 115 +, 136 +, 180 +, 215 - - -Mesembrius madagascariensis + + +Mesembrius madagascariensis Keiser, 1971: 261. - -Mesembrius madagascariensis + +Mesembrius madagascariensis - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius madagascariensis + +Differential diagnosis. + + +Mesembrius madagascariensis males lack an apical pile brush on the profemur and have an unmodified metatibia. The profemur is dorsally flattened and the metabasitarsus does not have a lobe as in some males of - -M. simplicipes + +M. simplicipes . The male of - -M. madagascariensis + +M. madagascariensis cannot be confused with any other species by the strong difference in the pile colour and length between the proximal and distal part of the mesotibia which is long and yellow pile in the proximal 2/3 and short and black in the distal 1/3. The female of - -M. madagascariensis + +M. madagascariensis can be distinguished from any other species (except from - -M. simplicipes + +M. simplicipes ) by the nearly black abdomen (clearly yellow to orange and black in other species). It can be distinguished from - -M. simplicipes + +M. simplicipes by the pro- and mesolegs which are extensively brown and black (reddish-brown in - -M. simplicipes + +M. simplicipes ). - -Examined material. - - -Mesembrius madagascariensis + +Examined material. + + +Mesembrius madagascariensis - + Keiser: -Holotype +Holotype , male, -Madagascar +Madagascar , -Antananarivo +Antananarivo , M, -13 Dec 1957 +13 Dec 1957 , -F. Keiser +F. Keiser (MNHN: type not studied; see comments). - - -Mesembrius madagascariensis + + +Mesembrius madagascariensis - + Keiser: -Allotype +Allotype , female, "ALLO // TYPUS" " -Madagascar +Madagascar . TAN. // -Tananarive +Tananarive // -13.XII.1957 +13.XII.1957 // F. KEISER" " -Mesembrius +Mesembrius // madagascar- // iensis" [NMB]. - - - - -Paratypes + + + + +Paratypes : -Madagascar +Madagascar • -7♂♂ -21♀ +7♂♂ +21♀ ; -Tananarive +Tananarive ; -13 Dec 1975 +13 Dec 1975 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Lac Kavitaha +Lac Kavitaha , -Ampefy +Ampefy ; -20 Mar 1958 +20 Mar 1958 ; -F. Keiser +F. Keiser ; NMB • - -4♂♂ -2♀♀ + +4♂♂ +2♀♀ ; -Ambalavao +Ambalavao , -Fianarantsoa +Fianarantsoa ; -28-29 Jan 1958 +28-29 Jan 1958 ; -F. Keiser +F. Keiser ; NMB • - -9♂♂ -2♀♀ + +9♂♂ +2♀♀ ; -Tzimbazaza Park +Tzimbazaza Park , -Antananarivo +Antananarivo ; -7-8 Feb 1968 +7-8 Feb 1968 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Station Agric. +Station Agric. , -Alaotra +Alaotra , -District Anbatondrakzaka +District Anbatondrakzaka ; -24 Dec 1957 +24 Dec 1957 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA • - -4♂♂ -2♀♀ + +4♂♂ +2♀♀ ; -Antananarivo +Antananarivo ; -1 Jan 1958 +1 Jan 1958 ; -B.R. Stuckenberg +B.R. Stuckenberg leg.; NMSA . - -Other material - - -Madagascar + +Other material + + +Madagascar • -1♀ +1♀ ; -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -16 Oct 1993 +16 Oct 1993 ; -M. Hauser +M. Hauser leg.; CAS • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CAS • - -1♂ -1♀ + +1♂ +1♀ ; -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -16-22 Oct 1993 +16-22 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; CNC • - -1♂ + +1♂ ; -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -14 Oct 1993 +14 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; NHMUK • - -1♀ + +1♀ ; -Antananarivo +Antananarivo , -Tsimbazaza +Tsimbazaza ; -26 Oct 1993 +26 Oct 1993 ; -C. Kassebeer +C. Kassebeer leg.; NHMUK • - -1♀ + +1♀ ; -Atsimo +Atsimo , -Andrefana +Andrefana ; -6-16 Jul 2012 +6-16 Jul 2012 ; -M. Irwin +M. Irwin and - + R. -Harin'Hala +Harin'Hala leg.; CAS • - -1♀ + +1♀ ; -Atsimo +Atsimo , -Andrefana +Andrefana ; -31 May 2012 +31 May 2012 ; -M. Irwin +M. Irwin and - + R. -Harin'Hala +Harin'Hala leg.; CAS • - -1♀ + +1♀ ; -Tananarive +Tananarive ; -13 Dec 1957 +13 Dec 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Tananarive +Tananarive ; -15 Dec 1957 +15 Dec 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -1♂ -1♀ + +1♂ +1♀ ; -Tananarive +Tananarive ; -29 Dec 1957 +29 Dec 1957 ; -F. Keiser +F. Keiser leg.; NMB • - -1♀ + +1♀ ; -Tananarive +Tananarive ; -17 Apr 1958 +17 Apr 1958 ; -F. Keiser +F. Keiser leg.; NMB • - -2♀♀ + +2♀♀ ; -Tananarive +Tananarive ; -26-30 Apr 1968 +26-30 Apr 1968 ; -K.M. Guichard +K.M. Guichard leg.; NHMUK . - -Re-description male - - + +Re-description male + + (Fig. -13 +13 ). Body length: 13.7-14.6 mm. Wing length: 9.6-10.5 mm. - -Head + +Head (Fig. -56 +56 ). Eyes bare; holoptic, length of eye contiguity approx. length of ocellar triangle. Face white with dark medial vitta; white pilose; white pollinose. Vertical triangle black pilose on ventral half and at ocellar triangle, yellow pilose on dorsal half; yellow pollinose until just before anterior ocellus. Lateral ocellus touching eye margin. Occiput yellow; yellow pilose; yellow and white pollinose. Frontal prominence shiny black; black pilose. Antenna, scape and pedicel reddish-brown; postpedicel black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black; dorsally with a pair of well-demarcated yellow vittae and a faint yellow medial line; vittae and medial line become faint posteriorly; yellow vague lateral vitta; yellow pilose. Scutellum uniformly yellow-brown; yellow pilose. - -Legs. + +Legs. All legs dark chocolate-brown to black, except for pro- and mesotibiae and basitarsi which are reddish-brown. Proleg: Femur dark chocolate-brown to black; without apical pile brush; pile inconspicuous, except for long yellow pile on the anterodorsal side which, dorsally, is bordered with a row of largely spaced black pile. Tibia reddish-brown; yellow pilose with some short black pile on distal end dorsally. Basitarsus orange-brown; black pilose with some longer yellow pile posteriorly. Other tarsi black; black pilose, with some longer yellow pile posteriorly, except on the two most distal tarsi. Mesoleg (Fig. -180 +180 ): Femur with predominantly long yellow pile on ventral and posteroventral side, with shorter black pile on anterodorsal side. Tibia reddish-brown; proximal half with a comb of long, curved yellow pile on proximal half; with much shorter, yellow and black pile on distal half. Basitarsus orange-brown; black pilose with some longer yellow pile posteriorly. Other tarsi black; black pilose, with some longer yellow pile posteriorly, except on the two most distal tarsi. Metaleg: Femur dark chocolate-brown to black; with long, thin yellow pile, especially anteriorly; ventrally with less black pile. Tibia dark chocolate-brown to black; unmodified; with short, black pile throughout and short, yellow pile on anteroproximal half. Basitarsus and second tarsomere orange-brown, other tarsi black; black pilose. - -Wing + +Wing (Fig. -136 +136 ). Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Fig. -93 +93 ). Tergite II with a pair of yellow-orange, rounded maculae; black marking broadly hourglass-shaped; yellow pilose, except for posterior half of posterior black marking where pile is black; with a stretch of yellow pollinosity on anterior part of black marking. Tergite III with a pair of small, anterolateral maculae; yellow-white pilose; white pollinose on posterior half. Tergite IV dark chocolate-brown; yellow-white pilose; white pollinose. - -Genitalia + +Genitalia (Fig. -215 +215 ). Epandrium: Dorsal lobe of surstylus club-shaped; distal end densely covered with black spines; proximal half ( -'stalk' +'stalk' ) long yellow pilose dorsally and with some shorter, thicker black pile laterally. Ventral lobe of surstylus with one very long and thick black setula distally. - -Re-description female - + +Re-description female + (Fig. -34 +34 ). Body length: 12.5-13.5 mm. Wing length: 8.7-9.3 mm. - - -Head + + +Head . Eyes bare; dichoptic. Face white with dark medial vitta; white pilose, white pollinose. Frons black, but strongly white pollinose on ventral 4/5; black pilose on ocellar triangle and just ventral of ocellar triangle; white pilose. Distance between lateral ocellus and eye margin approx. -11/2 +11/2 x width of ocellus. Occiput yellow-white; yellow-white pilose; yellow-white pollinose. Frontal prominence shiny black, orange-brown at distal end. Antenna, scape and pedicel orange-brown; postpedicel black, white pollinose; antennal arista yellow-orange. - -Thorax. + +Thorax. Scutum dark brown to black with a pair of dorsolateral white-grey pollinose vittae; with lateral grey pollinose vague vitta; yellow and black pilose. Scutellum yellow-brown; yellow and black pilose. - - -Figures 46-51. - -Mesembrius + + +Figures 46-51. + +Mesembrius spp., head, frontal view -46 - -M. arcuatus +46 + +M. arcuatus sp. nov. (♂) -47 - -M. caffer +47 + +M. caffer (Loew) (nominal morph) (♂) -48 - -M. caffer +48 + +M. caffer (Loew) (spined morph) (♂) -49 - -M. ctenifer +49 + +M. ctenifer Hull syn. nov. (♂) -50 - -M. capensis +50 + +M. capensis (Macquart) (♂) -51 - -M. chapini +51 + +M. chapini Curran (♂). - -Legs. + +Legs. Pro- and mesoleg: Femur black, distal end reddish-brown; short black and longer yellow pilose. Tibia reddish-brown; yellow and black pilose dorsally; yellow pilose ventrally. Basitarsus reddish-brown; black pilose dorsally; orange-yellow pilose ventrally. Other tarsi black; black pilose dorsally, orange-yellow pilose ventrally. Metaleg: Femur black, distal 1/5 reddish-brown; yellow-white pilose, with scarce very short black pile ventrally. Tibia reddish-brown; white pilose, short black pilose posteriorly. Basitarsus dark reddish-brown; black pilose dorsally, yellow and black pilose ventrally. Other tarsi black; predominantly black pilose dorsally, densely yellow-orange pilose ventrally. - - -Figures 52-57. - -Mesembrius + + +Figures 52-57. + +Mesembrius spp., head, frontal view -52 - -M. copelandi +52 + +M. copelandi sp. nov. (♂) -53 - -M. cyanipennis +53 + +M. cyanipennis (Bezzi) (♂) -54 - -M. ingratus +54 + +M. ingratus (Loew) (♂) -55 - -M. longipilosus +55 + +M. longipilosus sp. nov. (♂) -56 - -M. madagascariensis +56 + +M. madagascariensis Keiser (♂) -57 - -M. minor +57 + +M. minor (Bezzi) (♂). - -Wing. + +Wing. Entire wing uniformly microtrichose. - - -Figures 58-63. - -Mesembrius + + +Figures 58-63. + +Mesembrius spp., head, frontal view -58 - -M. nigriceps +58 + +M. nigriceps Curran (♂) -59 - -M. perforatus +59 + +M. perforatus (Speiser) (♂) -60 - -M. platytarsis +60 + +M. platytarsis Curran syn. nov. (♂) -61 - -M. regulus +61 + +M. regulus (Hull) (♂) -62 - -M. rex +62 + +M. rex Curran (♂) -63 - -M. senegalensis +63 + +M. senegalensis (Macquart) (♂). - -Abdomen + +Abdomen (Fig. -115 +115 ). Dark brown to black; largely white pollinose, except for anterior border and medial area of tergite II and posterior half of tergite V; short black and white pilose, except for non-pollinose areas with white pilose only. - - -Figures 64-69. - -Mesembrius + + +Figures 64-69. + +Mesembrius spp., head, frontal view -64 - -M. simplicipes +64 + +M. simplicipes Curran (♂) -65 - -M. strigilatus +65 + +M. strigilatus (Bezzi) (♂) -66 - -M. sulcus +66 + +M. sulcus sp. nov. (♂) -67 - -M. tarsatus +67 + +M. tarsatus (Bigot) (♂) -68 - -M. tibialis +68 + +M. tibialis sp. nov. (♂) -69 - -M. vockerothi +69 + +M. vockerothi sp. nov. (♂). - -Distribution. -Madagascar. - - -Figures 70-74. - -Mesembrius + +Distribution. +Madagascar. + + +Figures 70-74. + +Mesembrius spp., head, frontal view -70 - -M. capensis +70 + +M. capensis (Macquart) (♀) -71 - -M. cyanipennis +71 + +M. cyanipennis (Bezzi) (♀) -72 - -M. chapini +72 + +M. chapini Curran (♀) -73 - -M. maculifer +73 + +M. maculifer Hull (♀) -74 - -M. morio +74 + +M. morio (Bezzi) (♀). - -Comments. - + +Comments. + The type series comprises more than 50 specimens of both sexes collected from a dozen of sites from the central and eastern domains of Madagascar ( -Keiser 1971 +Keiser 1971 ). The holotype of the species should be in the collection at MNHN ( -Keiser 1971 +Keiser 1971 ), but neither could we trace the holotype in the MNHN collection, nor is it listed on the MNHN entomology collection webpages. - - -Figures 75-78. - -Mesembrius + + +Figures 75-78. + +Mesembrius spp., head, frontal view -75 - -M. platytarsis +75 + +M. platytarsis Curran syn. nov. (♀) -76 - -M. regulus +76 + +M. regulus (Hull) (♂) -77 - -M. rex +77 + +M. rex Curran (♂) -78 - -M. senegalensis +78 + +M. senegalensis (Macquart) (♂). - - -Figures 79-82. - -Mesembrius + + +Figures 79-82. + +Mesembrius spp., head, frontal view -79 - -M. simplicipes +79 + +M. simplicipes Curran (♂) -80 - -M. sulcus +80 + +M. sulcus sp. nov. (♀) -81 - -M. tarsatus +81 + +M. tarsatus (Bigot) (♀) -82 - -M. vockerothi +82 + +M. vockerothi sp. nov. (♀). diff --git a/data/D9/17/96/D91796943ED85D2C91DE9239C5FAB526.xml b/data/D9/17/96/D91796943ED85D2C91DE9239C5FAB526.xml index a293c573b93..698477fb917 100644 --- a/data/D9/17/96/D91796943ED85D2C91DE9239C5FAB526.xml +++ b/data/D9/17/96/D91796943ED85D2C91DE9239C5FAB526.xml @@ -1,59 +1,59 @@ - - - -Notes on Ichneumoninae (Hymenoptera, Ichneumonidae) from southern China, with descriptions of one new genus and twelve new species + + + +Notes on Ichneumoninae (Hymenoptera, Ichneumonidae) from southern China, with descriptions of one new genus and twelve new species - - -Author + + +Author -Riedel, Matthias -https://orcid.org/0000-0001-5747-1223 -Blumenlage 22 C, D- 29683 Bad Fallingbostel, Germany -mamaflo.riedel@t-online.de +Riedel, Matthias +https://orcid.org/0000-0001-5747-1223 +Blumenlage 22 C, D- 29683 Bad Fallingbostel, Germany +mamaflo.riedel@t-online.de -text - - -Contributions to Entomology +text + + +Contributions to Entomology - -2023 - -2023-12-08 + +2023 + +2023-12-08 - -73 + +73 - -2 + +2 - -223 -248 + +223 +248 - -http://dx.doi.org/10.3897/contrib.entomol.73.e107542 + +http://dx.doi.org/10.3897/contrib.entomol.73.e107542 -journal article -http://dx.doi.org/10.3897/contrib.entomol.73.e107542 -2511-6428-2-223 -7FD0965E3F374137A55EA7F0C1A98659 -37C8C471EE2F591F8806F196018A347E +journal article +http://dx.doi.org/10.3897/contrib.entomol.73.e107542 +2511-6428-2-223 +7FD0965E3F374137A55EA7F0C1A98659 +37C8C471EE2F591F8806F196018A347E - + -Rugichneumon +Rugichneumon gen. nov. Type species. - + Rugichneumon tricolor sp. nov. diff --git a/data/DF/44/BA/DF44BA57885C50E8951B8C915B0E3D6B.xml b/data/DF/44/BA/DF44BA57885C50E8951B8C915B0E3D6B.xml index 63eb8300824..fddaad53692 100644 --- a/data/DF/44/BA/DF44BA57885C50E8951B8C915B0E3D6B.xml +++ b/data/DF/44/BA/DF44BA57885C50E8951B8C915B0E3D6B.xml @@ -1,609 +1,609 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius senegalensis (Macquart, 1842) -Figs 20 -, 40 -, 63 -, 78 -, 100 -, 121 -, 144 -, 161 -, 174 -, 181 -, 200 -, 222 + + + +Mesembrius senegalensis (Macquart, 1842) +Figs 20 +, 40 +, 63 +, 78 +, 100 +, 121 +, 144 +, 161 +, 174 +, 181 +, 200 +, 222 - - -Helophilus senegalensis + + +Helophilus senegalensis Macquart, 1842: 121. - -Tubifera senegalensis + +Tubifera senegalensis - - -Kertesz + +Kertesz (1910) : 260. - -Mesembrius senegalensis + +Mesembrius senegalensis - -Curran (1927) +Curran (1927) : 65 - -Curran (1939) +Curran (1939) : 10 - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Helophilus africanus + +Helophilus africanus Verrall, 1898: 416. syn. nov. - -Tubifera africana + +Tubifera africana - - -Kertesz + +Kertesz (1910) : 249. - -Helophilus (Mesembrius) africanus + +Helophilus (Mesembrius) africanus - -Bezzi (1915) +Bezzi (1915) : 97. - -Mesembrius africanus + +Mesembrius africanus - -Smith and Vockeroth (1980) +Smith and Vockeroth (1980) : 504. - -Differential diagnosis. - - -Mesembrius senegalensis + +Differential diagnosis. + + +Mesembrius senegalensis males lack an apical pile brush on the profemur and have an unmodified metatibia. The proximal ventral part of the profemur lacks black pile and the metafemur is covered with long, thin yellow pile and has a band of very short, thicker, black pile on the posteroventral side and some scattered short black pile ventrally. The yellow-orange maculae on tergite II are very large and rectangular and the anterior and posterior black markings are narrow and perpendicular to the narrow medial black vitta. The male is distinguished from morphologically similar species in the shape of the maculae on tergite II which are rectangular (rounded to triangular in other species) and the band of short thick black pile on the posteroventral side of the metafemur (fewer in - -M. longipilosus + +M. longipilosus sp. nov.; much denser and longer in - -M. copelandi + +M. copelandi sp. nov., - -M. minor + +M. minor and - -M. strigilatus + +M. strigilatus ). Apart from the shape of the maculae, it also differs from - -M. longipilosus + +M. longipilosus sp. nov. with the absence of equally long black pile amongst the long yellow pile on the proximal ventral end of the metafemur (several in - -M. longipilosus + +M. longipilosus sp. nov.). Females have a frons which is pale pilose on the ventral half. Tergite II has a pair of yellow maculae (fascia in - -M. capensis + +M. capensis and spined morph of - -M. caffer + +M. caffer ). The black markings on the abdomen are strongly reduced because of the strong white pollinosity (clearly visible in all other species). The pro- and metafemur, as well as the pro- and metatibia are yellow-brown (largely dark brown to black in other species) and the metafemur has no ventral swelling in the middle (swelling present in - -M. minor + +M. minor ). - -Examined material. - - -Helophilus senegalensis + +Examined material. + + +Helophilus senegalensis Macquart: -Lectotype +Lectotype (hereby designated), male, - + " -SYNTYPE +SYNTYPE " " MNHN, Paris // ED6788" " -1 ♂ -Helophilus +1 ♂ +Helophilus // -Helophilus senegalensis +Helophilus senegalensis Macq // C.F. Kassebeer 1999" [MNHN]. -Paralectotype +Paralectotype , female, - + " -SYNTYPE +SYNTYPE " " MNHN, Paris // ED6789" [MNHN] [the female is indicated as male on MNHN website] [a -paralectotype +paralectotype is present at the MNHN, but could only be studied from the pictures on the website; see comments]. - - -Helophilus africanus + + +Helophilus africanus Verrall: - -Lectotype + +Lectotype (hereby designated), male, "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 23.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 413." "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 23.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 416." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 413." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 416." "TYPE Dipt: 105 1/4 // -Helophilus +Helophilus // -Mesembrius africanus +Mesembrius africanus // Verrall // HOPE DEPT. OXFORD" "1899 // 7645" "RMCA PIC // 00012" - + " -LECTOTYPUS +LECTOTYPUS " [OXUM] . - -Paralectotype + +Paralectotype , male, "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 23.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 413." "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 23.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 416." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 413." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 416." "TYPE Dipt: 105 3/4 // -Helophilus +Helophilus // -Mesembrius africanus +Mesembrius africanus // Verrall // HOPE DEPT. OXFORD" "1899 // 7646" "RMCA PIC // 00013" "PARA- // -LECTOTYPUS +LECTOTYPUS " [OXUM] . - -Paralectotype + +Paralectotype , female, "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 24.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 413." "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 24.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 416." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 413." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 416." "TYPE Dipt: 105 4/4 // -Helophilus +Helophilus // -Mesembrius africanus +Mesembrius africanus // Verrall // HOPE DEPT. OXFORD" "1899 // 7650" "RMCA PIC // 00015" "PARA- // -LECTOTYPUS +LECTOTYPUS " [OXUM] . - -Paralectotype + +Paralectotype , female, "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 23.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 413." "S.W. ARABIA // - - -19 m + + +19 m . fr. Aden, // Haithalhim. // Capt. Mar. 23.95 // & press. 1899 by // -J.W. Yerbury. +J.W. Yerbury. // Trans. Ent. Soc., // 1898, page 416." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 413." "TYPE. // G.H. VERRALL // Trans. Ent. Soc., // 1898, page 416." "TYPE Dipt: 105 5/4 // -Helophilus +Helophilus // -Mesembrius africanus +Mesembrius africanus // Verrall // HOPE DEPT. OXFORD" "1899 // 7648" "RMCA PIC // 00016" "PARA- // -LECTOTYPUS +LECTOTYPUS " [OXUM] . - -Paralectotype + +Paralectotype , female, "Haithalhim // 23.3.95 // -Col. Yerb. +Col. Yerb. " "VC-TYPE 33 // -Helophilus -♀ +Helophilus +♀ // -Mesembrius africanus +Mesembrius africanus // -Verrall +Verrall " - + " -Haithalhim +Haithalhim " "PARA- // -LECTOTYPUS +LECTOTYPUS " [OXUM] . - -Other material - - -Benin + +Other material + + +Benin • -1♂ +1♂ ; -Cotonou +Cotonou ; -Feb 2003 +Feb 2003 ; -G. Goergen +G. Goergen leg.; IITA • - -2♀♀ + +2♀♀ ; -Cotonou +Cotonou ; -14 Jan 2013 +14 Jan 2013 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • - -1♂ -1♀ + +1♂ +1♀ ; -Cotonou +Cotonou ; -28 Jan 2016 +28 Jan 2016 ; -K. Jordaens +K. Jordaens and -G. Goergen +G. Goergen leg.; KMMA • - -1♂ + +1♂ ; -Togbin +Togbin ; -Dec 2005 +Dec 2005 ; -G. Goergen +G. Goergen leg.; IITA . - -Chad + +Chad • -1♀ +1♀ ; -Bebedja +Bebedja ; date unknown; -F.A. Brink +F.A. Brink and -R.M. Brink-Moenen +R.M. Brink-Moenen leg.; RMNH . - -Kenya + +Kenya • -2♂♂ -7♀♀ +2♂♂ +7♀♀ ; -Jipe +Jipe , -Taita-Taveta +Taita-Taveta ; -27 Jan 2017 +27 Jan 2017 ; -M. Reemer +M. Reemer leg.; RMNH • - -2♂♂ -2♀♀ + +2♂♂ +2♀♀ ; -Jipe +Jipe ; -Taita-Taveta +Taita-Taveta ; -27 Jan 2017 +27 Jan 2017 ; -X. Mengual +X. Mengual leg.; ZFMK • - -1♀ + +1♀ ; -Nairobi +Nairobi , ICIPE campus; -6 May 2014 +6 May 2014 ; -R. Copeland +R. Copeland leg.; ICIPE • - -1♂ + +1♂ ; -Taita -Hills +Taita +Hills ; 2017; -A. Ssymank +A. Ssymank leg.; ASPC • - -1♀ + +1♀ ; -Makindu +Makindu ; -5-7 Apr 1911 +5-7 Apr 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK . - -Oman + +Oman • -1♂ +1♂ ; -Dhofar +Dhofar , -Ayun +Ayun pools; -8 Oct 1977 +8 Oct 1977 ; -K.M. Guichard +K.M. Guichard leg.; NHMUK . - -Re-description male - - + +Re-description male + + (Fig. -20 +20 ). Body length: 12.0-13.8 mm. Wing length: 9.2-10.2 mm. - -Head + +Head (Fig. -63 +63 ). Eyes bare; slightly dichoptic, distance between eyes approx. 1/2 width of ocellus. Face yellow with dark medial vitta; yellow pilose; yellow pollinose. Vertical triangle with yellow pile and yellow pollinosity in lower half, black in upper half; distance between lateral ocellus and eye margin less than 1/2 width of ocellus. Occiput yellow; yellow pilose with interspersed short, black setulae; yellow and white pollinose. Frontal triangle yellow; yellow pilose; yellow pollinose. Frontal prominence shiny black; yellow pilose. Antenna black; antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black with three dorsal, well-demarcated yellow vittae which are connected anteriorly and posteriorly; with lateral, yellow vitta; pile rufous. Scutellum yellow-brown; yellow pilose. - -Legs. + +Legs. All legs light- to dark brown. Proleg (Fig. -161 +161 ) and mesoleg (Fig. -181 +181 ): profemur without apical pile brush; yellow pilose, pile ventrally long in proximal half, shorter in distal half; with shorter black pile on distal half. Tibia yellow and black pilose. Tarsi black pilose dorsally, yellow pilose ventrally; with some thick black pile posterodorsally. Metaleg: Femur anteriorly and dorsally with long and posteriorly with shorter, yellow pile; ventral yellow pile scarce, except for a row of long, thin pale pile; with band of short black pile posteroventrally. Tibia unmodified; long yellow pilose; ventrally with much shorter and thicker black pile. Tarsi black pilose dorsally, yellow pilose ventrally. - -Wing + +Wing (Fig. -144 +144 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -100 +100 ). Tergite II with a pair of very large, yellow to orange rectangular maculae; medial black markings very narrow and perpendicular to anterior and posterior narrow, black marking; posterior black marking with short, stiff black setulae which do not extend to the lateral tergite sides; white pollinose. Tergite III and IV with very large, yellow fascia; yellow pilose; with large medial black marking; with short black stiff setulae posterior to medial dark spot, these setulae not reaching the lateral tergite sides. Tergite III white pollinose in medial part. Tergite IV entirely white pollinose. - -Genitalia + +Genitalia (Fig. -222 +222 ). Epandrium: Dorsal lobe of surstylus distally broadly rounded, with characteristic upwardly pointed projection; long pilose dorsally; with shorter, dense black pile ventrally and laterally. Ventral lobe of surstylus with a row of approx. 10 long black setulae. - -Re-description female - - + +Re-description female + + (Fig. -40 +40 ). Body length: 11.5-14.4 mm. Wing length: 8.3-10.4 mm. As male, except for the following character states: Eyes dichoptic (Fig. -78 +78 ). Frons yellow pilose in ventral 2/3, black and yellow pilose on dorsal 1/3 (ocellar triangle and surrounding area); strongly yellow pollinose. Pile on legs shorter (Figs -174 +174 , -200 +200 ). Abdomen as in Fig. -121 +121 . - -Distribution. -Benin, Chad, Kenya, Oman and Yemen. + +Distribution. +Benin, Chad, Kenya, Oman and Yemen. - -Comments. - -Verrall (1898) + +Comments. + +Verrall (1898) already suggests that - -M. africanus + +M. africanus could be conspecific to - -M. senegalensis + +M. senegalensis (Macquart, 1842), but he did not study the type of the latter. We have studied the syntypes of both species and confirm -Verrall's +Verrall's suggestion that both species are conspecific and, therefore, we consider - -M. africanus + +M. africanus (Verrall, 1898) a junior synonym of - -M. senegalensis + +M. senegalensis (Macquart, 1842). A paralectotype of - -M. senegalensis + +M. senegalensis (at the MNHN) is on loan and several requests to the borrower to return the specimen were left unanswered. diff --git a/data/E0/39/92/E0399246B03058489FF01EE8B740D122.xml b/data/E0/39/92/E0399246B03058489FF01EE8B740D122.xml index 859d5801d79..267dd8822ae 100644 --- a/data/E0/39/92/E0399246B03058489FF01EE8B740D122.xml +++ b/data/E0/39/92/E0399246B03058489FF01EE8B740D122.xml @@ -1,429 +1,429 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius arcuatus Jordaens, Goergen & De Meyer -sp. nov. -Figs 3 -, 46 -, 83 -, 127 -, 157 -, 191 -, 205 + + + +Mesembrius arcuatus Jordaens, Goergen & De Meyer +sp. nov. +Figs 3 +, 46 +, 83 +, 127 +, 157 +, 191 +, 205 - -Differential diagnosis. - + +Differential diagnosis. + The male of - -Mesembrius arcuatus + +Mesembrius arcuatus sp. nov. is holoptic, has a profemur with a loose, black apical pile brush and a strongly curved metatibia which is dorsoventrally compressed in the middle third. It can be distinguished from any other species by the apical pile brush of the profemur which is loose and black dorsally and yellow ventrally (yellowish with some black pile interspersed in - -M. ingratus + +M. ingratus ; black in - -M. tarsatus + +M. tarsatus ) and by the strongly compressed metatibia (with deep groove in - -M. ingratus + +M. ingratus ; with a rounded swelling in - -M. tarsatus + +M. tarsatus ). The female is unknown. - -Examined material. - - -Mesembrius arcuatus + +Examined material. + + +Mesembrius arcuatus - + Jordaens, Goergen & De Meyer: -Holotype +Holotype , male, - + " -HOLOTYPUS +HOLOTYPUS " " -Entebbe +Entebbe , // -Uganda +Uganda .//21.8.11. // -C.C. Gowdey. +C.C. Gowdey. //1912-100." " -Mesembrius arcuatus +Mesembrius arcuatus // - -Det. K. Jordaens + +Det. K. Jordaens , 2019" " NHMUK 010369965" [NHMUK]. - - - - -Paratypes + + + + +Paratypes : -Uganda +Uganda • -1♂ +1♂ ; -Entebbe +Entebbe ; -11 Aug 1911 +11 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -14 Aug 1911 +14 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -2♂♂ + +2♂♂ ; -Entebbe +Entebbe ; -14 Aug 1911 +14 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -2♂♂ + +2♂♂ , -Entebbe +Entebbe ; -16 Aug 1911 +16 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -17 Aug 1911 +17 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -3♂♂ + +3♂♂ ; -Entebbe +Entebbe ; -21 Aug 1911 +21 Aug 1911 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -3-4 Dec 1912 +3-4 Dec 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -1♂ + +1♂ ; -Entebbe +Entebbe ; -13 Nov 1912 +13 Nov 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -2♂♂ + +2♂♂ ; -Entebbe +Entebbe ; -16 Oct 1912 +16 Oct 1912 ; -C.C. Gowdey +C.C. Gowdey leg.; NHMUK • - -5♂♂ + +5♂♂ ; -Entebbe +Entebbe ; -1-11 Sep 1911 +1-11 Sep 1911 ; -S.A. Neave +S.A. Neave leg.; NHMUK • - -1♂ + +1♂ ; N.E. -Side of Lake Albert +Side of Lake Albert ; 1906; -A. Hodges +A. Hodges leg.; NHMUK • - -1♂ + +1♂ ; near -Entebbe +Entebbe ; -5 Mar 1972 +5 Mar 1972 ; -H. Falke +H. Falke leg.; CNC • - -1♂ + +1♂ ; near -Entebbe +Entebbe ; -1-14 Feb 1973 +1-14 Feb 1973 ; -H. Falke +H. Falke leg.; CNC • - -1♂ + +1♂ ;? -Kanue +Kanue ; -3 May 1911 +3 May 1911 ; collector unknown; NHMUK • - -1♂ + +1♂ ; -Mbarara +Mbarara ; -29 May 1911 +29 May 1911 ; collector unknown; NHMUK ; - -1♂ + +1♂ ; -Central Region +Central Region , -Wakisa District +Wakisa District , -Mabamba Swamps +Mabamba Swamps ; -16 Dec 2018 +16 Dec 2018 ; -X. Mengual +X. Mengual ; ZFMK • - -2♂♂ + +2♂♂ , -Central Region +Central Region , -Wakisa District +Wakisa District , -Mabamba Swamps +Mabamba Swamps ; -16 Dec 2018 +16 Dec 2018 ; -M. Reemer +M. Reemer leg.; RMNH • - -1♂ + +1♂ ; -Central Region +Central Region , -Wakisa District +Wakisa District , -Mabamba Swamps +Mabamba Swamps -1♂ +1♂ ; -16 Dec 2018 +16 Dec 2018 ; K. Jordaens leg.; KMMA. - -Description male - - + +Description male + + (Fig. -3 +3 ). Body length: 13.7-14.2 mm. Wing length: 9.8-10.4 mm. - -Head + +Head (Fig. -46 +46 ). Eyes bare; holoptic, length of eye contiguity equal to approx. the length of ocellar triangle. Face dark with dark medial vitta; white pilose; white pollinose. Vertical triangle black pilose; white pollinose in dorsal half. Ocellar triangle dark; black pilose; white pollinose; distance between lateral ocellus and eye margin 1/2 width of ocellus. Occiput yellow; white pilose; yellow and white pollinose. Frontal triangle orange-brown; white pilose. Frontal prominence shiny black; black pilose. Antenna dark brown to black; postpedicel white pollinose; antennal arista reddish-brown. - - -Thorax + + +Thorax . Scutum black with a pair of dorsal, well-demarcated grey pollinose vittae; yellow and black pilose. Scutellum uniformly light yellow-brown; yellow pilose throughout, black pilose on posterior 2/3. - - -Legs + + +Legs . All femora and tibiae with long, loose, yellow pile and, especially at distal end, loose, black pile. Proleg (Fig. -157 +157 ): Femur dark brown to black; with a loose, apical pile brush which is black pilose dorsally, yellow pilose ventrally; with long, yellow pile posterodorsally and with shorter, black pile anterodorsally and anteroventrally. Tibia with long, black pile, except dorsally. Basitarsus orange-brown; with long, black pile posteriorly. Other tarsi orange-brown; yellow and black pilose dorsally; orange pilose ventrally. Mesoleg: Dark brown to black, except for tarsi which are reddish-brown; black pilose dorsally, orange pilose ventrally. Metaleg (Fig. -191 +191 ): Femur dark brown to black; very slender; covered with long, thin yellow pile, except on ventral side which is almost bare; with shorter, black pile on posteroventral proximal 2/3; with a series of thick, black setulae at distal 1/3; with thick, black pile at distal end. Tibia curved; strongly dorsoventrally compressed in middle 1/3; with long, yellow and black pile, except in the flattened posterior section. Tarsi yellow and black pilose, except ventrally where orange pilose. - -Wing + +Wing (Fig. -127 +127 ). Entire wing uniformly microtrichose. - -Abdomen + +Abdomen (Fig. -83 +83 ). Tergite II with a pair of very large, yellow triangular to rounded maculae; yellow pilose; black markings hourglass-shaped; posterior black marking equal in size or somewhat narrower than anterior black marking, with a medial white pollinose area; posterior black marking with black pile that posterolaterally extends into the yellow maculae. Tergite III with yellow-orange fascia and a large, black and strongly white pollinose triangular marking; pile short, stiff and black, except on the lateral sides where it is longer, thinner and yellow. Tergite IV strongly white pollinose anteriorly, with a large posterior, rounded, white pollinose black marking; pile short, thick and black, except on the lateral sides where it is longer, thinner and yellow. - -Genitalia + +Genitalia (Fig. -205 +205 ). Epandrium: Dorsal lobe of surstylus short and stout, with a very long, sharp expansion on distal end; short black spinose on apex and long brown pilose on dorsal surface. Ventral lobe of surstylus strongly convex; bare. - -Female. -Unknown. + +Female. +Unknown. - -Distribution. -Uganda. + +Distribution. +Uganda. - -Comments. -This is a new species to the Afrotropical Region and only collected from Uganda. The female remains unknown, despite the fact that 28 males were collected or encountered in various collections. + +Comments. +This is a new species to the Afrotropical Region and only collected from Uganda. The female remains unknown, despite the fact that 28 males were collected or encountered in various collections. - -Etymology. - + +Etymology. + The specific epithet - -Mesembrius arcuatus + +Mesembrius arcuatus (Latin) means bent like a bow and was chosen with reference to the strongly curved metatibia. It is to be treated as an adjective (nominative singular masculine). diff --git a/data/E1/C1/12/E1C1120FC3FFB4437562CAD772D9CCE1.xml b/data/E1/C1/12/E1C1120FC3FFB4437562CAD772D9CCE1.xml index c2c58362b44..8efe203403b 100644 --- a/data/E1/C1/12/E1C1120FC3FFB4437562CAD772D9CCE1.xml +++ b/data/E1/C1/12/E1C1120FC3FFB4437562CAD772D9CCE1.xml @@ -1,63 +1,63 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus favonius Jameson & Wada, 2009 + + + +Peltonotus favonius Jameson & Wada, 2009 Figs 4, 39, 51, 60, 75 - -Diagnosis (male and female). -Length ~14.6 mm, color overall black, elytra black or dark reddish brown with iridescent bloom (Fig. 4), head with simple punctures (lacking setae), labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 not enlarged or obviously dorsoventrally flattened, mala lacking lamellate setal brush (Fig. 39), maxillary stipes without setae curled at apices (Fig. 39), male protibia bidentate (Fig. 51), form of parameres (Fig. 60), female epipleuron broadly expanded, weakly convex, extending from base to metacoxa, lacking incised apex (Fig. 75). + +Diagnosis (male and female). +Length ~14.6 mm, color overall black, elytra black or dark reddish brown with iridescent bloom (Fig. 4), head with simple punctures (lacking setae), labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 not enlarged or obviously dorsoventrally flattened, mala lacking lamellate setal brush (Fig. 39), maxillary stipes without setae curled at apices (Fig. 39), male protibia bidentate (Fig. 51), form of parameres (Fig. 60), female epipleuron broadly expanded, weakly convex, extending from base to metacoxa, lacking incised apex (Fig. 75). - -Distribution. -Vietnam and Myanmar. + +Distribution. +Vietnam and Myanmar. - -Remarks. - + +Remarks. + This species is most similar to -Peltonotus pruinosus +Peltonotus pruinosus , a species for which only the female holotype is known. Previously, this species was only known from the male holotype specimen from Vietnam. diff --git a/data/E9/19/AC/E919ACAC9E1A2509A5468E5FE9F75E5A.xml b/data/E9/19/AC/E919ACAC9E1A2509A5468E5FE9F75E5A.xml index ba9c5c419b6..7cc065c029a 100644 --- a/data/E9/19/AC/E919ACAC9E1A2509A5468E5FE9F75E5A.xml +++ b/data/E9/19/AC/E919ACAC9E1A2509A5468E5FE9F75E5A.xml @@ -1,61 +1,61 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus tigerus Jameson & Wada, 2009 + + + +Peltonotus tigerus Jameson & Wada, 2009 Figs 17, 44, 90 - -Diagnosis (female only). -Length ~13.7 mm, overall color black or castaneous, elytra reddish-brown with weak iridescent bloom (Fig. 17), head with some punctures multisetigerous, labrum bi-emarginate, labial palpomere 2 enlarged and dorsoventrally flattened, mala with well developed lamellate setal brush (Fig. 44), maxillary stipes without setae curled at apices (Fig. 44), female epipleuron incised with a round or oval emargination (Fig. 90). + +Diagnosis (female only). +Length ~13.7 mm, overall color black or castaneous, elytra reddish-brown with weak iridescent bloom (Fig. 17), head with some punctures multisetigerous, labrum bi-emarginate, labial palpomere 2 enlarged and dorsoventrally flattened, mala with well developed lamellate setal brush (Fig. 44), maxillary stipes without setae curled at apices (Fig. 44), female epipleuron incised with a round or oval emargination (Fig. 90). - -Distribution. -Thailand. + +Distribution. +Thailand. - -Remarks. -We hypothesize that males of this species will possess reddish-brown elytra, similar to the coloration of the female. + +Remarks. +We hypothesize that males of this species will possess reddish-brown elytra, similar to the coloration of the female. \ No newline at end of file diff --git a/data/E9/1C/2C/E91C2C6F38A2FAF164B64FAB5E476AD2.xml b/data/E9/1C/2C/E91C2C6F38A2FAF164B64FAB5E476AD2.xml index a1e14bdd3b8..6599a8eb55b 100644 --- a/data/E9/1C/2C/E91C2C6F38A2FAF164B64FAB5E476AD2.xml +++ b/data/E9/1C/2C/E91C2C6F38A2FAF164B64FAB5E476AD2.xml @@ -1,60 +1,60 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - - -Peltonotus + + + + +Peltonotus suehirogarus Jameson & Wada, 2004 Fig. 88 - -Diagnosis (female only). -Length 16.9-18.0 mm, color overall black, elytra black with iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 enlarged and obviously dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes with some setae weakly curled at apices, female epipleuron incised and with oblong-oval emargination (Fig. 88). + +Diagnosis (female only). +Length 16.9-18.0 mm, color overall black, elytra black with iridescent bloom, head with some multisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 enlarged and obviously dorsoventrally flattened, mala with lamellate setal brush, maxillary stipes with some setae weakly curled at apices, female epipleuron incised and with oblong-oval emargination (Fig. 88). - -Distribution. -Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sarawak). + +Distribution. +Indonesia, Borneo Island (Kalimantan); Malaysia, Borneo Island (Sarawak). \ No newline at end of file diff --git a/data/EB/0E/1A/EB0E1ADA963B5287991F97C8F5258A02.xml b/data/EB/0E/1A/EB0E1ADA963B5287991F97C8F5258A02.xml index 7d02205cd30..ff1116226db 100644 --- a/data/EB/0E/1A/EB0E1ADA963B5287991F97C8F5258A02.xml +++ b/data/EB/0E/1A/EB0E1ADA963B5287991F97C8F5258A02.xml @@ -1,259 +1,259 @@ - - - -Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data + + + +Revision of the Afrotropical species of the hover fly genus Mesembrius Rondani (Diptera, Syrphidae) using morphological and molecular data - - -Author + + +Author -Jordaens, Kurt -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -kurt.jordaens@africamuseum.be +Jordaens, Kurt +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +kurt.jordaens@africamuseum.be - - -Author + + +Author -Goergen, Georg -https://orcid.org/0000-0003-4496-0495 -International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin +Goergen, Georg +https://orcid.org/0000-0003-4496-0495 +International Institute for Tropical Agriculture (IITA), Biodiversity Centre, 08 BP 0932 Tri Postal, Cotonou, Benin - - -Author + + +Author -Skevington, Jeffrey H. -https://orcid.org/0000-0002-1445-9870 -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Skevington, Jeffrey H. +https://orcid.org/0000-0002-1445-9870 +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Kelso, Scott -Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada +Kelso, Scott +Canadian National Collection of Insects, Arachnids and Nematodes, Agriculture and Agri-Food Canada, K. W. Neatby Building, 960 Carling Avenue, Ottawa, ON K 1 A 0 C 6, Canada - - -Author + + +Author -Meyer, Marc De -https://orcid.org/0000-0003-0755-2898 -Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium +Meyer, Marc De +https://orcid.org/0000-0003-0755-2898 +Royal Museum for Central Africa, Invertebrates Section and JEMU, Leuvensesteenweg 13, B- 3080 Tervuren, Belgium -text - - -ZooKeys +text + + +ZooKeys - -2021 - -2021-06-21 + +2021 + +2021-06-21 - -1046 + +1046 - -1 -141 + +1 +141 - -http://dx.doi.org/10.3897/zookeys.1046.57052 + +http://dx.doi.org/10.3897/zookeys.1046.57052 -journal article -http://dx.doi.org/10.3897/zookeys.1046.57052 -1313-2970-1046-1 -66E61C4EFAFE45DE9145DB38199BDEC3 -DBC42C98E4DA5074B86525CF2FB2FA64 +journal article +http://dx.doi.org/10.3897/zookeys.1046.57052 +1313-2970-1046-1 +66E61C4EFAFE45DE9145DB38199BDEC3 +DBC42C98E4DA5074B86525CF2FB2FA64 - - - -Mesembrius longipilosus Jordaens, Goergen & De Meyer -sp. nov. -Figs 12 -, 55 -, 92 -, 134 -, 162 -, 214 + + + +Mesembrius longipilosus Jordaens, Goergen & De Meyer +sp. nov. +Figs 12 +, 55 +, 92 +, 134 +, 162 +, 214 - -Differential diagnosis. - - -Mesembrius longipilosus + +Differential diagnosis. + + +Mesembrius longipilosus sp. nov. males lack an apical pile brush on the profemur and have an unmodified metatibia. The proximal ventral section of the profemur has 3-4 long black pile and the metafemur is covered with long, thin yellow pile and some shorter and thicker black pile on the ventral side, except on the extreme distal end where the black and yellow pile is equally long. The pair of maculae on tergite II are very large and rounded. The species resembles - -M. senegalensis + +M. senegalensis , but differs in the shape of the maculae on tergite II (rounded in - -M. longipilosus + +M. longipilosus sp. nov.; rectangular in - -M. senegalensis + +M. senegalensis ) and the presence of some long black pile on the proximal ventral side of the metafemur (absent in - -M. senegalensis + +M. senegalensis ). The female is unknown. - -Examined material. - - -Mesembrius longipilosus + +Examined material. + + +Mesembrius longipilosus - + Jordaens, Goergen & De Meyer: -Holotype +Holotype , male - + " -HOLOTYPUS +HOLOTYPUS " " -Entebbe +Entebbe , -UGANDA +UGANDA // -2.III.1972 +2.III.1972 // -H. Falke +H. Falke // -In forest +In forest " " -Mesembrius +Mesembrius // sp. 7 // -Det J.R. Vockeroth +Det J.R. Vockeroth " " -Mesembrius longipilosus +Mesembrius longipilosus // - -Det. K. Jordaens + +Det. K. Jordaens , 2019" " -Barcode of Life +Barcode of Life // DNA voucher specimen // -Smple +Smple | CNC -DIPTERA +DIPTERA 102305 // BOLD Proc. ID: CNCDB1109-11" " CNC -DIPTERA +DIPTERA // # 102305" [CNC]. - - - - -Paratype + + + + +Paratype : -Uganda +Uganda • -1♂ +1♂ ; near -Entebbe +Entebbe ; -23-31 Jan 1972 +23-31 Jan 1972 ; - -1160 m + +1160 m ; -H. Falke +H. Falke leg.; CNC -Diptera +Diptera 102306 (head and abdomen lost) [CNC] . - -Description male - - + +Description male + + (Fig. -12 +12 ). Body length: 8.6 mm. Wing length: 7.2-7.7 mm. - -Head + +Head (Fig. -55 +55 ). Eyes bare; dichoptic, distance between eyes approx. the width of ocellus. Face yellow with dark medial vitta; white pilose; white pollinose. Vertical triangle black with yellow and black pile; yellow pollinose on lower half. Distance between lateral ocellus and eye margin approx. 1/2 width of ocellus. Frontal triangle black; white pilose; white pollinose. Frontal prominence shiny black. Occiput yellow; yellow pilose with interspersed short, black setulae; yellow and white pollinose. Antenna black; postpedicel white pollinose, antennal arista reddish-brown. - -Thorax. + +Thorax. Scutum black; white pilose, with three dorsal, well-demarcated yellow-white pollinose vitta which are connected at posterior end; with lateral, yellow-white pollinose vitta. Scutellum yellow-brown; yellow pilose. - -Legs. + +Legs. Femora dark chocolate-brown, tibia and tarsi orange-brown. Proleg (Fig. -162 +162 ): Femur without apical pile brush; yellow pile ventrally long in proximal half, shorter in distal half; ventrally 3-4 black pile at basal 1/3. Tibia yellow and black pilose. Tarsi black pilose dorsally, yellow-orange pilose ventrally. Mesoleg: Similar to proleg; with black and yellow pile on basitarsus. Metaleg: Femur with long yellow pile anteriorly and shorter pile, posteriorly; ventral pile scarce, yellow and black, the black pile is longer at proximal half than at distal half. Tibia unmodified; with long, yellowish pile and scarce black pile on distal half. Tarsi black pilose dorsally, orange pilose ventrally. - -Wing + +Wing (Fig. -134 +134 ). Entire wing uniformly dense microtrichose. - -Abdomen + +Abdomen (Fig. -92 +92 ). Tergite II with pair of very large, yellow to orange rounded maculae; black marking hourglass-shaped, but the posterior part is smaller compared to the anterior part; yellow pilose. Tergite III almost entirely orange with small medial black maculae; yellow pilose. Tergite IV with anterior white pollinose band; black on posterior 1/3; yellow pilose. - -Genitalia + +Genitalia (Fig. -214 +214 ). Epandrium: Dorsal lobe of surstylus elongated, more or less rectangular with upwardly curved apex, with short, black spines in distal half; dorsolaterally with a few longer, black setulae; dorsally and laterally with long, yellow pile. Ventral lobe of surstylus with large expansion ventrally, with, on ventral side of the expansion, short black setulae. - -Female. -Unknown. + +Female. +Unknown. - -Distribution. -Uganda. + +Distribution. +Uganda. - -Comments. - - -Mesembrius longipilosus + +Comments. + + +Mesembrius longipilosus sp. nov. is a new species which is only known from two male specimens from Uganda (Entebbe). The male genitalia look similar to those of - -M. capensis + +M. capensis , but the black setulae on the ventral expansion of the ventral lobe of the surstylus are fewer in number and much shorter. No DNA barcodes are available. - -Etymology. - + +Etymology. + The specific epithet - -Mesembrius longipilosus + +Mesembrius longipilosus (Latin for hairy, covered with long pili) refers to the long, thin yellow pile on the metalegs. It is to be treated as an adjective (nominative singular masculine). diff --git a/data/F2/7B/75/F27B751B55B22956DA07B00CEE21FC99.xml b/data/F2/7B/75/F27B751B55B22956DA07B00CEE21FC99.xml index b62c3c1401b..a80da64e32a 100644 --- a/data/F2/7B/75/F27B751B55B22956DA07B00CEE21FC99.xml +++ b/data/F2/7B/75/F27B751B55B22956DA07B00CEE21FC99.xml @@ -1,60 +1,60 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - - -Peltonotus + + + + +Peltonotus vittatus Arrow, 1910 Figs 18-19, 22, 72, 91 - -Diagnosis (male and female). -Length 12.3-14.4 mm, color overall black or castaneous with pronotum reddish or black and with dark discal maculae, elytra reddish and with dark discal maculae and iridescent bloom (Figs 18-19), head with some multisetigerous punctures, labrum bi-emarginate (Fig. 22), mentum rounded in apical half, labial palpomere 2 not enlarged and not obviously dorsoventrally flattened, mala without lamellate setal brush, maxillary stipes without setae curled at apices, male protibia bidentate (or tridentate with basal tooth weakly developed), form of parameres (Fig. 72), female epipleuron narrowly incised (Fig. 91) with well developed dorsal pillow. + +Diagnosis (male and female). +Length 12.3-14.4 mm, color overall black or castaneous with pronotum reddish or black and with dark discal maculae, elytra reddish and with dark discal maculae and iridescent bloom (Figs 18-19), head with some multisetigerous punctures, labrum bi-emarginate (Fig. 22), mentum rounded in apical half, labial palpomere 2 not enlarged and not obviously dorsoventrally flattened, mala without lamellate setal brush, maxillary stipes without setae curled at apices, male protibia bidentate (or tridentate with basal tooth weakly developed), form of parameres (Fig. 72), female epipleuron narrowly incised (Fig. 91) with well developed dorsal pillow. - -Distribution. -Malaysia, Borneo Island (Sabah and Sarawak). + +Distribution. +Malaysia, Borneo Island (Sabah and Sarawak). \ No newline at end of file diff --git a/data/FF/95/C2/FF95C2962C699F543895845AEC9A3D27.xml b/data/FF/95/C2/FF95C2962C699F543895845AEC9A3D27.xml index cd0e96d8eb0..f48463f382e 100644 --- a/data/FF/95/C2/FF95C2962C699F543895845AEC9A3D27.xml +++ b/data/FF/95/C2/FF95C2962C699F543895845AEC9A3D27.xml @@ -1,68 +1,68 @@ - - - -Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data + + + +Aroid scarabs in the genus Peltonotus Burmeister (Coleoptera, Scarabaeidae, Dynastinae): key to species and new distributional data - - -Author + + +Author -Jameson, Mary Liz +Jameson, Mary Liz - - -Author + + +Author -Drumont, Alain +Drumont, Alain -text - - -ZooKeys +text + + +ZooKeys - -2013 - -320 + +2013 + +320 - -63 -95 + +63 +95 - -http://dx.doi.org/10.3897/zookeys.320.5352 + +http://dx.doi.org/10.3897/zookeys.320.5352 -journal article -http://dx.doi.org/10.3897/zookeys.320.5352 -1313-2970-320-63 +journal article +http://dx.doi.org/10.3897/zookeys.320.5352 +1313-2970-320-63 - - - -Peltonotus mushiyaus Jameson & Wada, 2009 + + + +Peltonotus mushiyaus Jameson & Wada, 2009 Figs 13, 42, 81 - -Diagnosis (female only). - + +Diagnosis (female only). + Length ~11.8 mm, overall color castaneous, elytral disc orangish-tan with castaneous maculae and iridescent bloom (Fig. 13), head with some unisetigerous punctures, labrum bi-emarginate, mentum rounded in apical half, labial palpomere 2 not enlarged or obviously dorsoventrally flattened, mala lacking lamellate -setal +setal brush (Fig. 42), maxillary stipes without setae curled at apices (Fig. 42), female epipleuron simple, not expanded (Fig. 81). - -Distribution. -Malaysia, Borneo Island (Sabah). + +Distribution. +Malaysia, Borneo Island (Sabah). - -Remarks. - -Peltonotus mushiyaus + +Remarks. + +Peltonotus mushiyaus is the smallest species in the genus. We hypothesize that males of this species will possess orangish-tan elytra with castaneous maculae, similar to males of -Peltonotus vittatus +Peltonotus vittatus .