added 4C
This commit is contained in:
parent
f8962a6d73
commit
b79ca1a6b7
2074 changed files with 451800 additions and 0 deletions
96
data/4C/FF/0B/4CFF0B7687FC117D2C1B51076A0B419B.xml
Normal file
96
data/4C/FF/0B/4CFF0B7687FC117D2C1B51076A0B419B.xml
Normal file
|
|
@ -0,0 +1,96 @@
|
|||
<document id="52471E3FABDBA4F5D8D58905BF0891E8" ID-DOI="http://dx.doi.org/10.3897/BDJ.4.e8013" ID-PMC="PMC4910507" ID-Pensoft-Pub="1314-2828-4-8013" ID-PubMed="27346954" ModsDocAuthor="" ModsDocDate="2016" ModsDocID="1314-2828-4-e8013" ModsDocOrigin="Biodiversity Data Journal 4" ModsDocTitle="Checklist of British and Irish Hymenoptera - Chalcidoidea and Mymarommatoidea" checkinTime="1465218162372" checkinUser="pensoft" docAuthor="Dale-Skey, Natalie, Askew, Richard R., Noyes, John S., Livermore, Laurence & Broad, Gavin R." docDate="2016" docId="4CFF0B7687FC117D2C1B51076A0B419B" docLanguage="en" docName="BiodivDatJour 4: e8013" docOrigin="Biodiversity Data Journal 4" docSource="http://dx.doi.org/10.3897/BDJ.4.e8013" docTitle="Platynocheilus cuprifrons Nees 1834" docType="treatment" docVersion="5" lastPageNumber="8013" masterDocId="FF9E1826DA315140A95C15484D367662" masterDocTitle="Checklist of British and Irish Hymenoptera - Chalcidoidea and Mymarommatoidea" masterLastPageNumber="8013" masterPageNumber="8013" pageNumber="8013" updateTime="1668123646042" updateUser="ExternalLinkService">
|
||||
<mods:mods id="CB7F5E2D4E39CC71345F1B2908D13A95" xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo id="DEA72F490BB7BB5D620964D513ECF5CD">
|
||||
<mods:title id="E0B2E604A01EB5D2447A8011C9AEC76B">Checklist of British and Irish Hymenoptera - Chalcidoidea and Mymarommatoidea</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name id="56FCCA2621D02F5573861DE627E6D1AE" type="personal">
|
||||
<mods:role id="7629203C8A08888B32723AED934980C0">
|
||||
<mods:roleTerm id="3B0866762BD270194392107F088A088C">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="646F996CFA6A7D8A15CBAC1D4B4035CD">Dale-Skey, Natalie</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:name id="BA3AB17E46ACF33201D476DC2D100D74" type="personal">
|
||||
<mods:role id="9AF62DB80AB7724C6E5C9EF72AB337C6">
|
||||
<mods:roleTerm id="BEF86D76F1FBD2E3BB64C5C0E7D5BEDC">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="7CC1CE3B0B473F3CC6688C9E85E23A52">Askew, Richard R.</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:name id="A003FF59799F28C1B23A9BD16D461C6B" type="personal">
|
||||
<mods:role id="11B3C18087E3AABF5E98861EE3AF76DF">
|
||||
<mods:roleTerm id="24E3543C3A8D7566A4EE7CB4B5483822">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="596627F8DA1669DB00C31ECE4A1F93DE">Noyes, John S.</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:name id="CA6D0725F7CEA652C3C7D0F6BC0A03E7" type="personal">
|
||||
<mods:role id="4C9ECD751E24DF825686EFF2E4CC10E4">
|
||||
<mods:roleTerm id="7460F06CB4B98AE55025E3ABE754DC77">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="5A4C90A89FBB8B8B60BF8EA66A4838A7">Livermore, Laurence</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:name id="F910879BC95BC98A233CD6DE9544F2BD" type="personal">
|
||||
<mods:role id="6D26E9A7135B5A41ECC50D0BE577D9F0">
|
||||
<mods:roleTerm id="342BC0D22614A5FA991EC7BB1985F488">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="C6D05876316845A3248D5FB4C7DF4858">Broad, Gavin R.</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource id="8D8B4EB5FB6F29AB9D259B87ADF295AA">text</mods:typeOfResource>
|
||||
<mods:relatedItem id="3DA0C48D87FCF93D968E405E69E36605" type="host">
|
||||
<mods:titleInfo id="212171D33B217F5ED4A42E531BB3DA78">
|
||||
<mods:title id="A9F0166E986469AF528666E85E00B733">Biodiversity Data Journal</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part id="F4F4BE9EA74992D424F4DC7521CD44B0">
|
||||
<mods:date id="90049432955790CDF80D318F3BF1C0AF">2016</mods:date>
|
||||
<mods:detail id="EA3482DD64D945A711D39FCCDE2543C1" type="volume">
|
||||
<mods:number id="538BCA2756DBBF6FD401156DC8CE3231">4</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent id="565BB3A5463FCA43B11839BDBDF7897A" unit="page">
|
||||
<mods:start id="81A8086858E435DD69BD7040A11D9D9F">8013</mods:start>
|
||||
<mods:end id="716C8CDA4335F60A30B622FCBAC02419">8013</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location id="FE9BBE7BD9A2F3DF05309473C9D8BC29">
|
||||
<mods:url id="063D4B2DD2D09B962C1B3A19E8A17EC0">http://dx.doi.org/10.3897/BDJ.4.e8013</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification id="23F73DFB6C89F17532BE2867CD668255">journal article</mods:classification>
|
||||
<mods:identifier id="11DCA9A31CBA3E204DDC69C89B2FA950" type="DOI">http://dx.doi.org/10.3897/BDJ.4.e8013</mods:identifier>
|
||||
<mods:identifier id="1C6CAD379704313139FB3207498883EA" type="Pensoft-Pub">1314-2828-4-8013</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment id="4CFF0B7687FC117D2C1B51076A0B419B" LSID="urn:lsid:plazi:treatment:4CFF0B7687FC117D2C1B51076A0B419B" httpUri="http://treatment.plazi.org/id/4CFF0B7687FC117D2C1B51076A0B419B" lastPageNumber="8013" pageId="0" pageNumber="8013">
|
||||
<subSubSection id="A7931E117CFEDD89B513E6EA93A55A38" pageId="0" pageNumber="8013" type="nomenclature">
|
||||
<paragraph id="178AAB8ADE7A980E5F5063A468778E0A" pageId="0" pageNumber="8013">
|
||||
<taxonomicName id="3B7E74E6279863D532131CD10069E4F7" ID-CoL="6VPSW" ID-ENA="108791" authority="Nees, 1834" authorityName="Nees" authorityYear="1834" class="Insecta" family="Tetracampidae" genus="Platynocheilus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Platynocheilus cuprifrons" order="Hymenoptera" pageId="0" pageNumber="8013" phylum="Arthropoda" rank="species" species="cuprifrons">Platynocheilus cuprifrons (Nees, 1834)</taxonomicName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="B1DE296B8C81EA73D26A9452177EB4BC" pageId="0" pageNumber="8013" type="reference_group">
|
||||
<paragraph id="B00A0375EE41237B9DF70340335A07FF" pageId="0" pageNumber="8013">
|
||||
<taxonomicName id="1941639947A00E9695BFBEC4556F4703" class="Insecta" family="Pteromalidae" genus="Pteromalus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pteromalus cuprifrons" order="Hymenoptera" pageId="0" pageNumber="8013" phylum="Arthropoda" rank="species" species="cuprifrons">Pteromalus cuprifrons</taxonomicName>
|
||||
Nees, 1834
|
||||
</paragraph>
|
||||
<paragraph id="2676F6097A9320E40CA021C28D053023" pageId="0" pageNumber="8013">
|
||||
<taxonomicName id="2EE4834788E3723D5D304B680892D6CB" genus="Chalcidoidea" lsidName="Chalcidoidea erichsonii" pageId="0" pageNumber="8013" rank="species" species="erichsonii">erichsonii</taxonomicName>
|
||||
Westwood, 1837
|
||||
</paragraph>
|
||||
<paragraph id="80D94BF09DEAAD39E4F9CDA05B4D3A16" pageId="0" pageNumber="8013">
|
||||
<taxonomicName id="1C99D9898EEFA08A2F96165F6C970EFF" genus="Chalcidoidea" lsidName="Chalcidoidea derceto" pageId="0" pageNumber="8013" rank="species" species="derceto">derceto</taxonomicName>
|
||||
(Walker, 1839,
|
||||
<taxonomicName id="594E1332FFDF1E75FF30DDF9809F4FEA" class="Insecta" family="Eupelmidae" genus="Stenocera" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Stenocera" order="Hymenoptera" pageId="0" pageNumber="8013" phylum="Arthropoda" rank="genus">Stenocera</taxonomicName>
|
||||
)
|
||||
</paragraph>
|
||||
<paragraph id="65B7729DB1857AE632D338405B8FE841" pageId="0" pageNumber="8013">
|
||||
<taxonomicName id="2D63F3A74EB6E9743BAC1B00D41255BA" genus="Chalcidoidea" lsidName="Chalcidoidea linearis" pageId="0" pageNumber="8013" rank="species" species="linearis">linearis</taxonomicName>
|
||||
(
|
||||
<normalizedToken id="7DFE9D1649F3F77212D7015FCDF6A41B" originalValue="Förster">Foerster</normalizedToken>
|
||||
, 1841, Pteroncoma)
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="F185AF22D59D185F5ACD8519446E9FAF" pageId="0" pageNumber="8013" type="distribution">
|
||||
<paragraph id="B01ECE0D21032D20BB879512F4919135" pageId="0" pageNumber="8013">Distribution</paragraph>
|
||||
<paragraph id="842B86CC0C764D3065CF15801FB9215B" pageId="0" pageNumber="8013">England, Scotland, Ireland</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="764EB41FA5313A633E6B84DD8C8067ED" pageId="0" pageNumber="8013" type="notes">
|
||||
<paragraph id="4E952CFA83082FB7E39A3CC20D7DE1E5" pageId="0" pageNumber="8013">Notes</paragraph>
|
||||
<paragraph id="A26ABFFE85D70C536D5418487CA9CBFC" pageId="0" pageNumber="8013">See Fig. 26 for habitus</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
74
data/4C/FF/1D/4CFF1D495EFB4804FEE5E4A863B58DFD.xml
Normal file
74
data/4C/FF/1D/4CFF1D495EFB4804FEE5E4A863B58DFD.xml
Normal file
|
|
@ -0,0 +1,74 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/BDJ.4.e7085" ID-PMC="PMC4822066" ID-Pensoft-Pub="1314-2828-4-7085" ID-PubMed="27099550" ModsDocAuthor="" ModsDocDate="2016" ModsDocID="1314-2828-4-e7085" ModsDocOrigin="Biodiversity Data Journal 4" ModsDocTitle="Checklist of aquatic and marshy Monocotyledons from the Araguaia River basin, Brazilian Cerrado" checkinTime="1457236643416" checkinUser="pensoft" docAuthor="Oliveira, Adriana & Bove, Claudia" docDate="2016" docId="4CFF1D495EFB4804FEE5E4A863B58DFD" docLanguage="en" docName="BiodivDatJour 4: e7085" docOrigin="Biodiversity Data Journal 4" docSource="http://dx.doi.org/10.3897/BDJ.4.e7085" docTitle="Anthurium lindmanianum Engl." docType="treatment" docVersion="4" lastPageNumber="7085" masterDocId="FFB5FFB8C632100DFF94FFC8FFE0FFC5" masterDocTitle="Checklist of aquatic and marshy Monocotyledons from the Araguaia River basin, Brazilian Cerrado" masterLastPageNumber="7085" masterPageNumber="7085" pageNumber="7085" updateTime="1668123460608" updateUser="ExternalLinkService">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Checklist of aquatic and marshy Monocotyledons from the Araguaia River basin, Brazilian Cerrado</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Oliveira, Adriana</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Bove, Claudia</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Biodiversity Data Journal</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2016</mods:date>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>4</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>7085</mods:start>
|
||||
<mods:end>7085</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/BDJ.4.e7085</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.4.e7085</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">1314-2828-4-7085</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment LSID="urn:lsid:plazi:treatment:4CFF1D495EFB4804FEE5E4A863B58DFD" httpUri="http://treatment.plazi.org/id/4CFF1D495EFB4804FEE5E4A863B58DFD" lastPageNumber="7085" pageId="0" pageNumber="7085">
|
||||
<subSubSection pageId="0" pageNumber="7085" type="nomenclature">
|
||||
<paragraph pageId="0" pageNumber="7085">
|
||||
<taxonomicName authority="Engl." class="Liliopsida" family="Araceae" genus="Anthurium" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Anthurium lindmanianum" order="Alismatales" pageId="0" pageNumber="7085" phylum="Tracheophyta" rank="species" species="lindmanianum">Anthurium lindmanianum Engl.</taxonomicName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="7085" type="materials_examined">
|
||||
<paragraph pageId="0" pageNumber="7085">Materials</paragraph>
|
||||
<paragraph pageId="0" pageNumber="7085">
|
||||
<materialsCitation collectionCode="R" collectorName="C. P. Bove et al." country="Brazil" latitude="-15.894311" location="Jussara-Aragarcas road, 100 Km from Jussara" longLatPrecision="1" longitude="-51.437378" pageId="0" pageNumber="7085" specimenCount="1" typeStatus="Other material">
|
||||
Type status:
|
||||
<typeStatus pageId="0" pageNumber="7085">Other material</typeStatus>
|
||||
. Occurrence: recordNumber: 168; recordedBy:
|
||||
<collectorName pageId="0" pageNumber="7085">C. P. Bove et al.</collectorName>
|
||||
; Location: country:
|
||||
<collectingCountry pageId="0" pageNumber="7085">Brazil</collectingCountry>
|
||||
; countryCode: BRA; stateProvince:
|
||||
<normalizedToken originalValue="Goiás">Goias</normalizedToken>
|
||||
; locality:
|
||||
<location LSID="urn:lsid:plazi:treatment:4CFF1D495EFB4804FEE5E4A863B58DFD:1392F864D7EFD97BA3E5EF5A914640F3" country="Brazil" latitude="-15.894311" longLatPrecision="1" longitude="-51.437378" name="Jussara-Aragarcas road, 100 Km from Jussara" pageId="0" pageNumber="7085">
|
||||
<normalizedToken originalValue="Jussara-Aragarças">Jussara-Aragarcas</normalizedToken>
|
||||
road, 100 Km from Jussara
|
||||
</location>
|
||||
; verbatimLatitude:
|
||||
<geoCoordinate direction="south" orientation="latitude" precision="1" value="-15.894311">15°53'39.52"S</geoCoordinate>
|
||||
; verbatimLongitude:
|
||||
<geoCoordinate direction="west" orientation="longitude" precision="1" value="-51.437378">51°26'14.56"W</geoCoordinate>
|
||||
; verbatimCoordinateSystem: degree minutes; Event: year: 1997; month: 5; day: 26; Record Level: institutionID: Museu Nacional Herbarium; institutionCode:
|
||||
<collectionCode pageId="0" pageNumber="7085">R</collectionCode>
|
||||
</materialsCitation>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
624
data/4C/FF/46/4CFF4682A8F45EE89F8DACE38737F83F.xml
Normal file
624
data/4C/FF/46/4CFF4682A8F45EE89F8DACE38737F83F.xml
Normal file
|
|
@ -0,0 +1,624 @@
|
|||
<document id="ADD685EB89ABB2BB42B4A5E1FAB05EF0" ID-DOI="10.3897/jhr.97.118567" ID-ZooBank="D7F62554-5C6E-4A64-98B2-628F2D94972B" ID-publisher-id="118567" URI-arpha="35E85EC6-59B0-52EC-95F3-00A2BD0AA3AC" URI-zoobank="http://zoobank.org/D7F62554-5C6E-4A64-98B2-628F2D94972B" XM.bibliography_approvedBy="admin" XM.materialsCitations_approvedBy="admin" XM.taxonomicNames_approvedBy="admin" article-type="research-article" checkinTime="1716999286593" checkinUser="pensoft" docAuthor="Sosa-Calvo, Jeffrey, Forshage, Mattias & Buffington, Matthew L." docDate="2024" docId="4CFF4682A8F45EE89F8DACE38737F83F" docLanguage="en" docName="Journal of Hymenoptera Research 97: 441-470" docOrigin="Journal of Hymenoptera Research 97" docSource="https://jhr.pensoft.net/article/118567/download/xml/" docStyle="DocumentStyle:PensoftTaxPub.0000.journal_article.generic" docStyleName="PensoftTaxPub.0000.journal_article.generic" docTitle="Ganaspis kimorum Sosa-Calvo & Forshage & Buffington 2024, sp. nov." docType="treatment" docVersion="3" dtd-version="3.0" lastPageNumber="470" masterDocId="35E85EC659B052EC95F300A2BD0AA3AC" masterDocTitle="Circumscription of the Ganaspis brasiliensis (Ihering, 1905) species complex (Hymenoptera, Figitidae), and the description of two new species parasitizing the spotted wing drosophila, Drosophila suzukii Matsumura, 1931 (Diptera, Drosophilidae)" masterLastPageNumber="470" masterPageNumber="441" pageNumber="441" updateTime="1717025202976" updateUser="admin">
|
||||
<mods:mods id="DD302CE5DD06E7892AE82904EA011C43" xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo id="8E67404E26684897475100657D7C6DA6">
|
||||
<mods:title id="1E3C1A4634AF34D885B1B28DF703FC3D">Circumscription of the Ganaspis brasiliensis (Ihering, 1905) species complex (Hymenoptera, Figitidae), and the description of two new species parasitizing the spotted wing drosophila, Drosophila suzukii Matsumura, 1931 (Diptera, Drosophilidae)</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name id="61EBDA8BE3A3960CE8CF5E37E5E3B375" type="personal">
|
||||
<mods:role id="9A21DEC5E4321C089912CF53D0C3FAD4">
|
||||
<mods:roleTerm id="F01612F4273894A62CACCF7747FD905F">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="AEB34932A0D2C71C5455EFBEF4440610">Sosa-Calvo, Jeffrey</mods:namePart>
|
||||
<mods:nameIdentifier id="64A4F475F42ABC16BE1FFFC1F744B0EA" type="ORCID">0000-0003-3995-7275</mods:nameIdentifier>
|
||||
<mods:affiliation id="0F85B428DCFA5858E7355BC34D08587E">Department of Entomology, Smithsonian NMNH, 10 th and Constitution Ave NW, Washington DC 20013, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name id="8B9338CFD93F73CA248BBA381E443DF6" type="personal">
|
||||
<mods:role id="C68D2C00AAD6233261C6273F1CE921EE">
|
||||
<mods:roleTerm id="9FA7F065C5FBBEFBF4EA6ACB1582C8C0">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="F1C540AAA6F14DCD6C9B2C6FD9511CF8">Forshage, Mattias</mods:namePart>
|
||||
<mods:affiliation id="005FEE6556305DD36DEDC62986377826">Naturhistoriska riksmuseet, Department of Zoology, Box 50007, SE- 104 05 Stockholm, Sweden</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name id="62BB447217F603F98E1FDD93FABDCA3F" type="personal">
|
||||
<mods:role id="9466DA59611EAC8393C28950F5E65032">
|
||||
<mods:roleTerm id="8518F89EB079A4B1B217FEB0FB994A7F">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="DD6B0822D931C96C20A581C597BEACE0">Buffington, Matthew L.</mods:namePart>
|
||||
<mods:nameIdentifier id="3115E8F89FDC9322E868987C03701058" type="ORCID">0000-0003-1900-3861</mods:nameIdentifier>
|
||||
<mods:affiliation id="027B7749494ACB47DF0D4F6B80D24937">Systematic Entomology Laboratory, USDA, c / o Smithsonian NMNH, 10 th and Constitution Ave NW, Washington DC 20013, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:typeOfResource id="4EEDF736DF4094349008B564FB6DE2E6">text</mods:typeOfResource>
|
||||
<mods:relatedItem id="55C49AC37C9C104B429F91029C276B96" type="host">
|
||||
<mods:titleInfo id="703CD74DE796E19A631FB9C10933EA11">
|
||||
<mods:title id="1AD1CA0D1E25EF6654CF6C4EFB941052">Journal of Hymenoptera Research</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part id="C4567DA13DB55B60196A682BAD07BDAC">
|
||||
<mods:date id="923A7CB35CB254654A2DA2D462772B90">2024</mods:date>
|
||||
<mods:detail id="0C8EC01E8194810395BFE2F0004FB052" type="pubDate">
|
||||
<mods:number id="8FC9B13BE07C10355577A44D27425B67">2024-05-29</mods:number>
|
||||
</mods:detail>
|
||||
<mods:detail id="7573AB31ED871B09D3DA3BB0D168CF09" type="volume">
|
||||
<mods:number id="200F206E9F5AE61C8D4E4FADC8CEA341">97</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent id="7A064BA972A1BE220B4C621D99C54EA9" unit="page">
|
||||
<mods:start id="026E1E0D5C7F9EF4F9A953DBD4960988">441</mods:start>
|
||||
<mods:end id="35D9EE78DF1C90C3BCA882E38B726005">470</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:classification id="FC9C47E3E0D9AB751DF96102FAB63092">journal article</mods:classification>
|
||||
<mods:identifier id="CB2E175EBBDEFC539DDE27A832DFA3DB" type="DOI">10.3897/jhr.97.118567</mods:identifier>
|
||||
<mods:identifier id="4C95644138F81E7A95039B8E6CC743CD" type="ZooBank">D7F62554-5C6E-4A64-98B2-628F2D94972B</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment id="4CFF4682A8F45EE89F8DACE38737F83F" ID-DOI="http://doi.org/10.5281/zenodo.11389675" ID-Zenodo-Dep="11389675" ID-arpha="4CFF4682-A8F4-5EE8-9F8D-ACE38737F83F" ID-zoobank="https://zoobank.org/330D215F-8FEA-4D7B-8D80-C409DC2C4199" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F" LSID-ZBK="urn:lsid:zoobank.org:act:330D215F-8FEA-4D7B-8D80-C409DC2C4199" httpUri="http://treatment.plazi.org/id/4CFF4682A8F45EE89F8DACE38737F83F">
|
||||
<subSubSection id="75155E1DBF731532F1B1D266A671A46A" type="nomenclature">
|
||||
<paragraph id="68D4F608E979F536534CDBB95E71B937">
|
||||
<taxonomicName id="06321FE807BA4E577236051CCB9DABEB" authority="Buffington" authorityName="Sosa-Calvo & Forshage & Buffington" authorityYear="2024" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="species" species="kimorum" status="sp. nov.">
|
||||
<emphasis id="E7BE2FB26E2673F1CA865C12AF489079" italics="true">Ganaspis kimorum</emphasis>
|
||||
Buffington
|
||||
</taxonomicName>
|
||||
<taxonomicNameLabel id="81BCC329204D4A3440E4BFEFBD69A0A0" rank="species">sp. nov.</taxonomicNameLabel>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="957DF9B2AE99EFBCB96440AA7FA449F9" type="description">
|
||||
<paragraph id="6B529BC2544395E56BB85F126E1ED73E">
|
||||
<figureCitation id="5519B4A787000C9DBDCE795843DA3312" captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Type-specimens of the species belonging to the G. brasiliensis species complex A brasiliensis, lectotype B kimorum, holotype C lupini, holotype." figureDoi="10.3897/jhr.97.118567.figure1" httpUri="https://binary.pensoft.net/fig/1058448">Figs 1 C</figureCitation>
|
||||
,
|
||||
<geoCoordinate id="50330DC3ACCB0CE558DE09CABF2BCA7D" degrees="2, 3" direction="east" orientation="longitude" precision="5555" value="2.3">
|
||||
<figureCitation id="5BD508451F7CA05E2C28AB334DCC6780" captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. External anatomy of Ganaspis kimorum, a member of the Ganaspis brasiliensis species complex A head and mesosoma, lateral view B head and mesosoma, dorsal view C femal antennae D metapectal-propodeal complex, lateral view E fore- and hindwings, female F propodeum, dorso-lateral view." figureDoi="10.3897/jhr.97.118567.figure2" httpUri="https://binary.pensoft.net/fig/1058451">2</figureCitation>
|
||||
,
|
||||
<figureCitation id="00D014F3EC3CE977DF36DF8BB654B729" captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Comparison of the scutellar morphology between G. brasiliensis (A, B), G. lupini (C, D) and G. kimorum (E, F). Black arrows indicate sculptured (A) and smooth (C, E) lateral aspect of scutellum." figureDoi="10.3897/jhr.97.118567.figure3" httpUri="https://binary.pensoft.net/fig/1058455">3 E, F</figureCitation>
|
||||
</geoCoordinate>
|
||||
,
|
||||
<figureCitation id="984823E960F18EDD9FFED9F488B42F5E" captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Comparison of the ovipositor clip between G. lupini (A, C) and G. kimorum (B, D). A G. lupini ovipositor tip, lateral view B G. kimorum, ovipositor tip, lateral view C G. lupini ventral of ovipositor showing ovipositor clip and membrane D G. kimorum ventral of ovipositor showing ovipositor clip and membrane. Black arrows indicate the location of the ovipositor clip." figureDoi="10.3897/jhr.97.118567.figure4" httpUri="https://binary.pensoft.net/fig/1058458">4 B, D, E</figureCitation>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="SECID0ELOBG" type="material">
|
||||
<paragraph id="6AC5657D557FEC58EF0DE026A477C68F">
|
||||
<heading id="253ACB216BC46428F468EE2C9B1613A0" reason="title">Material examined.</heading>
|
||||
</paragraph>
|
||||
<paragraph id="C5D0DC7C91E43A317B719EBF1591BD7E">
|
||||
<materialsCitation id="903CBC2A279BDB707E967A981D705850" collectingDate="2010-06" collectingDateMax="2015-07" collectingDateMin="2010-06" collectionCode="USNM" country="Japan" location="Kimura Lab" municipality="Kimura Lab" specimenCode="USNMENT 00877810" specimenCount="1" specimenCount-female="1" stateProvince="Tokyo" typeStatus="holotype">
|
||||
<typeStatus id="FCF003C9D9CF359333B5DC0A3F31AAFD" type="holotype">Holotype</typeStatus>
|
||||
.
|
||||
<emphasis id="BD708C4619410F234B5ACF14E97F5226" bold="true">
|
||||
<collectingCountry id="CEF9BF1E7FB7A63D8B6D66AC43F396FE" name="Japan">Japan</collectingCountry>
|
||||
</emphasis>
|
||||
:
|
||||
<collectingRegion id="551A69A4AE626C4FB75FE7AACFEE7B53" country="Japan" name="Tokyo">Tokyo</collectingRegion>
|
||||
<collectingMunicipality id="1BDAFB58CBC4E6F03AEDA46D487796B8">Kimura Lab</collectingMunicipality>
|
||||
, field collected
|
||||
<taxonomicName id="83F4117F4E8D6F7DA28CDF214BD0D8D4" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="subSpecies" species="xanthopoda" subSpecies="suzukii">
|
||||
<emphasis id="C70A9C756A2C70B3669F5C19257C862C" italics="true">G. xanthopoda</emphasis>
|
||||
‘
|
||||
<emphasis id="B9130322B303413B88D6AADA5EC82DE2" italics="true">suzukii</emphasis>
|
||||
</taxonomicName>
|
||||
type’ Collected
|
||||
<date id="CB4713DEF430A6F7E2BE5411AE9A8161" value="2010-06">
|
||||
<collectingDate id="2A9B65E9D5B04CBE77D3DA665BB25D22" value="2010-06">June 2010</collectingDate>
|
||||
</date>
|
||||
Received
|
||||
<named-content id="01E2FD202C3F0CC4FE6DBE39E77ACF22" content-type="dwc:institutional_code" xlink_href="http://grbio.org/institution/smithsonian-institution-national-museum-natural-history-0" xlink_title="National Museum of Natural History, Smithsonian Institution">USNM</named-content>
|
||||
<date id="70529D80F9C5CCAA148DD0D5FF4529EB" value="2015-07">
|
||||
<collectingDate id="A350389D84D3E9FE5A3F26F2E3DF7A62" value="2015-07">July 2015</collectingDate>
|
||||
</date>
|
||||
;
|
||||
<specimenCount id="35433FDC8E74B83FB3C1440D103ECAD9" type="female">female</specimenCount>
|
||||
,
|
||||
<ext-link id="497C13F008D73D1198684B101880AC20" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT00877810" xlink_type="simple">
|
||||
<specimenCode id="4D679862C9A261DEF637240A063FF15D">USNMENT 00877810</specimenCode>
|
||||
</ext-link>
|
||||
. Deposited in
|
||||
<named-content id="8B36BAD55106EFD36F6EBBCB5270F1D3" content-type="dwc:institutional_code" xlink_href="http://grbio.org/institution/smithsonian-institution-national-museum-natural-history-0" xlink_title="National Museum of Natural History, Smithsonian Institution">
|
||||
<collectionCode id="F873518E303BA7C625C33BFDD319507F" country="USA" httpUri="http://biocol.org/urn:lsid:biocol.org:col:34871" lsid="urn:lsid:biocol.org:col:34871" name="Smithsonian Institution, National Museum of Natural History" type="Museum">USNM</collectionCode>
|
||||
</named-content>
|
||||
</materialsCitation>
|
||||
.
|
||||
<materialsCitation id="AF779D463A7D7C3F018AF29B4715CBBF" collectingDate="2010-06" collectingDateMax="2015-07" collectingDateMin="2010-06" collectionCode="USNMENT" country="Japan" location="Kimura Lab" municipality="Kimura Lab" specimenCode="USNMENT 00877811, USNMENT 00877772, USNMENT 00877823" specimenCount="1" stateProvince="Tokyo" typeStatus="paratype">
|
||||
<typeStatus id="A2071DDD22D52E87031E9116164C5252" type="paratype">Paratypes</typeStatus>
|
||||
:
|
||||
<emphasis id="58F67231CEF2EDED61F8FE8B96829615" bold="true">
|
||||
<collectingCountry id="49A85CBAC8E2A3A83380BBD3C9CECF08" name="Japan">Japan</collectingCountry>
|
||||
</emphasis>
|
||||
:
|
||||
<collectingRegion id="91FD9323CDDF353B1A93E2300D8392D3" country="Japan" name="Tokyo">Tokyo</collectingRegion>
|
||||
<collectingMunicipality id="CD08A17A82314A7F03A339B8DD715203">Kimura Lab</collectingMunicipality>
|
||||
, field collected
|
||||
<taxonomicName id="710279BC894568A3C758D0624E0F2DBF" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="subSpecies" species="xanthopoda" subSpecies="suzukii">
|
||||
<emphasis id="1C2618660FBCDB5EFF77D734754D2733" italics="true">G. xanthopoda</emphasis>
|
||||
‘
|
||||
<emphasis id="97FB84585F3A84C2AA95B1EF09B9FB65" italics="true">suzukii</emphasis>
|
||||
</taxonomicName>
|
||||
type’ Collected
|
||||
<date id="220351963A435C05E530510799DB5B1B" value="2010-06">
|
||||
<collectingDate id="DB63824A164052652A6A5863669FA8A4" value="2010-06">June 2010</collectingDate>
|
||||
</date>
|
||||
Received
|
||||
<named-content id="C84A75C93117E1524A893A0905D99BEA" content-type="dwc:institutional_code" xlink_href="http://grbio.org/institution/smithsonian-institution-national-museum-natural-history-0" xlink_title="National Museum of Natural History, Smithsonian Institution">USNM</named-content>
|
||||
<date id="4EDA9F7B11F72F3E8550E754B354D88E" value="2015-07">
|
||||
<collectingDate id="A69505330078A56561CFF458CEAA09A6" value="2015-07">July 2015</collectingDate>
|
||||
</date>
|
||||
;
|
||||
<ext-link id="C5A78A4F00F11A363A49F5531C862D77" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT00877811" xlink_type="simple">
|
||||
<specimenCode id="6F876E626FD0852628374F07865A308E">USNMENT 00877811</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="CBAB9412F044A3C13891711044FA99CE" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT00877772" xlink_type="simple">
|
||||
<specimenCode id="2C19BAE0B38D6D56B295997915DE3EE0">USNMENT 00877772</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="1C7A44BCBADC988BBC49635A2B50FF5D" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT00877823" xlink_type="simple">
|
||||
<specimenCode id="0CB17AE59F600D0744E7A578FC349F0E">USNMENT 00877823</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
;
|
||||
<materialsCitation id="1D81C6D87039D9AD66DE4CFB9FA7BA61" collectedFrom="Ex larva of Drosophila suzukii Coll" collectingDate="2015-06-03" collectionCode="USNMENT" collectorName="N. Ris & P. Girod" latitude="35.63667" location="Naganuma Park" longLatPrecision="19" longitude="139.365" municipality="Hachioji" specimenCode="USNMENT 01025537, USNMENT 01025541" specimenCount="1" stateProvince="Kanto Province">
|
||||
<collectingRegion id="8CC288E3E01CA5328AE31AF3FCF490FC" inferredBySuffix="true">Kanto Province</collectingRegion>
|
||||
,
|
||||
<collectingRegion id="3E6FCFCF2E02A2368858543EDEF37530" country="Japan" name="Tokyo">Tokyo district</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="F31770FF8A51C1D2575103484C6673E0">Hachioji</collectingMunicipality>
|
||||
,
|
||||
<location id="A93941874F8C2297EFDCA529E3C263F3" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:A93941874F8C2297EFDCA529E3C263F3" latitude="35.63667" longLatPrecision="19" longitude="139.365" municipality="Hachioji" name="Naganuma Park" stateProvince="Kanto Province">Naganuma Park</location>
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0EFRBG" specific-use="{"type":"Point","coordinates":[139.365000,35.636667]}">
|
||||
<geoCoordinate id="2B2D78B581AB24E99113E839824D2A8C" degrees="35" direction="north" minutes="38" orientation="latitude" precision="15" seconds="12" value="35.63667">35 ° 38 ' 12 " N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="29362EFD0F5E564C9335BBBB379CD988" degrees="139" direction="east" minutes="21" orientation="longitude" precision="15" seconds="54" value="139.365">139 ° 21 ' 54 " E</geoCoordinate>
|
||||
</named-content>
|
||||
<collectedFrom id="B3BD0355F3144C121D1CF9983A0A98FC">
|
||||
Ex larva of
|
||||
<taxonomicName id="DE313E9AE4E7B26F50870B0079E7CDC3" authority="Coll." authorityName="Coll." class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="515F9C933C58A84584A56209B5F7866A" italics="true">Drosophila suzukii</emphasis>
|
||||
Coll.
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
<date id="5B212EEC55EDFAE34A08ACCDDC05195B" value="2015-06-03">
|
||||
<collectingDate id="01DD20D6DC4B76185D791B87428C1842" value="2015-06-03">3. VI. 2015</collectingDate>
|
||||
</date>
|
||||
, Leg.
|
||||
<collectorName id="7561B036804169C5FAB304F218032282">N. Ris</collectorName>
|
||||
&
|
||||
<collectorName id="5961E32AF4A5073706997F2FF97F4BA0">P. Girod</collectorName>
|
||||
;
|
||||
<specimenCode id="6EF33AD5B99186F45CA70BF0D5B590AE">
|
||||
USNMENT
|
||||
<ext-link id="FA41CD38BC7084E877F8CB1F43A51076" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025537" xlink_type="simple">01025537</ext-link>
|
||||
</specimenCode>
|
||||
–
|
||||
<ext-link id="D39C497B5135A6CBDBB38D3C5666E4A6" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025541" xlink_type="simple">
|
||||
<specimenCode id="712511988CB7F7E4D573122C2C824394">USNMENT 01025541</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
;
|
||||
<materialsCitation id="AF796F9B15A3F70A411C5105D8380EB2" collectedFrom="ex D. suzukii on Prunus serrulata" collectingDate="2017-06-16" collectionCode="USNMENT" collectorName="Girod" latitude="35.6368" location="Naganuma Park" longLatPrecision="6" longitude="139.3647" municipality="Hachioji" specimenCode="USNMENT 01867459, USNMENT 01867458, USNMENT 01025536" specimenCount="1" stateProvince="Tokyo">
|
||||
<collectingRegion id="8505E81F08A656AEB8A0E266A5648E9A" country="Japan" name="Tokyo">Tokyo</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="64D98D6FAA79B04FA0E33521B43591CA">Hachioji</collectingMunicipality>
|
||||
<location id="A43069092948A906AAFA12309B9EA0A7" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:A43069092948A906AAFA12309B9EA0A7" latitude="35.6368" longLatPrecision="6" longitude="139.3647" municipality="Hachioji" name="Naganuma Park" stateProvince="Tokyo">Naganuma Park</location>
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0ECSBG" specific-use="{"type":"Point","coordinates":[139.364700,35.636800]}">
|
||||
<geoCoordinate id="D8E65162A9CEC9D7FBE6490A42B480FE" degrees="35.6368" direction="north" orientation="latitude" precision="5" value="35.6368">35.6368 ° N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="61B4D76C38202E021372CC398B3B3698" degrees="139.3647" direction="east" orientation="longitude" precision="5" value="139.3647">139.3647 ° E</geoCoordinate>
|
||||
</named-content>
|
||||
,
|
||||
<collectedFrom id="0D17B1AEFF1EB8844A28AC21EBE2A06A">
|
||||
ex
|
||||
<taxonomicName id="4C26C7A9B03B39E823312C2DF574058D" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="29A0FD6E162AD748FB8E08444B30840D" italics="true">D. suzukii</emphasis>
|
||||
</taxonomicName>
|
||||
on
|
||||
<taxonomicName id="83907341394B88C608EDA3D23BDFBBBE" class="Magnoliopsida" family="Rosaceae" genus="Prunus" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="serrulata">
|
||||
<emphasis id="C0E4846D7C0362474C303E85162EBDD3" italics="true">Prunus serrulata</emphasis>
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
<date id="0D24455761658F2210A40A37AFCBC44B" value="2017-06-16">
|
||||
<collectingDate id="437687DE7864C9E8D37F5636A33EE4EA" value="2017-06-16">16 Jun 2017</collectingDate>
|
||||
</date>
|
||||
;
|
||||
<collectorName id="D1D4660315C8B22F6A7C58213B7448A7">Girod</collectorName>
|
||||
, collector CABI colony voucher G 1 _ Tokyo;
|
||||
<ext-link id="B385370C5867A3F01DAE789684B35176" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867459" xlink_type="simple">
|
||||
<specimenCode id="9128DE47749A3CC61E623D21E00DC85E">USNMENT 01867459</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="960825DCEA595BA4D104B57FCCFCEC7E" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867458" xlink_type="simple">
|
||||
<specimenCode id="1C14C4F3CF8436725DFF114584BDB6AE">USNMENT 01867458</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="BFA16EC65CE8AFE8145D8345B6361C6D" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025536" xlink_type="simple">
|
||||
<specimenCode id="F8B7A44425C64233CCA8922C04E4F2DC">USNMENT 01025536</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
.
|
||||
<materialsCitation id="4D84DF82461D949086B0E88DF1DAD315" collectedFrom="Ex larva of Drosophila suzukii Coll" collectingDate="2015-06-03" collectionCode="USNMENT" collectorName="M. Kenis" country="China" latitude="25.128056" location="Kunming" longLatPrecision="21" longitude="102.747215" municipality="Kunming district" specimenCode="USNMENT 01025542, USNMENT 01025546" specimenCount="1" stateProvince="Yunnan Province">
|
||||
<emphasis id="6B7D873352C8B992263804C1C597AE45" bold="true">
|
||||
<collectingCountry id="528FD506510F3B40EECDC96EBE0B1CF8" name="China">China</collectingCountry>
|
||||
</emphasis>
|
||||
:
|
||||
<collectingRegion id="9B24081C998D7C92AA978DA31267B533" country="China" name="Yunnan">Yunnan Province</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="95914DFB18777D0B52D84F4792E17FA9">Kunming district</collectingMunicipality>
|
||||
,
|
||||
<location id="859926FCB415E0762DAD5539BB280186" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:859926FCB415E0762DAD5539BB280186" country="China" latitude="25.128056" longLatPrecision="21" longitude="102.747215" municipality="Kunming district" name="Kunming" stateProvince="Yunnan Province">Kunming</location>
|
||||
,
|
||||
<location id="730DEEE41A8E206C32A2B4D607C68A84" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:730DEEE41A8E206C32A2B4D607C68A84" country="China" latitude="25.128056" longLatPrecision="21" longitude="102.747215" municipality="Kunming district" name="Yunnan Agricultural University" stateProvince="Yunnan Province">Yunnan Agricultural University</location>
|
||||
,
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0ERTBG" specific-use="{"type":"Point","coordinates":[102.747222,25.128056]}">
|
||||
<geoCoordinate id="D5387099DC854DEAD32655C9D94C8BBE" degrees="25" direction="north" minutes="07" orientation="latitude" precision="15" seconds="41" value="25.128056">25 ° 07 ' 41 " N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="A43E8176F4405267588C2893EA0057E0" degrees="102" direction="east" minutes="44" orientation="longitude" precision="15" seconds="50" value="102.747215">102 ° 44 ' 50 " E</geoCoordinate>
|
||||
</named-content>
|
||||
,
|
||||
<collectedFrom id="FCAAC645B6703C04FF22265D097E97A1">
|
||||
Ex larva of
|
||||
<taxonomicName id="E5AE8A573556738D2CA4890685AECFE7" authority="Coll." authorityName="Coll." class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="021976F02D14C58B4BE4F78C6EE59790" italics="true">Drosophila suzukii</emphasis>
|
||||
Coll.
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
<date id="52EACD502ADC76215BDD0EA3C653064B" value="2015-06-03">
|
||||
<collectingDate id="5F3372296FBE44895192F325DD264A1C" value="2015-06-03">3. VI. 2015</collectingDate>
|
||||
</date>
|
||||
, Leg.
|
||||
<collectorName id="73821D067C2A165EE79A295A90CB9B84">M. Kenis</collectorName>
|
||||
;
|
||||
<ext-link id="CFE52A7BCECA9505E2B22DAC9EB262EB" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025542" xlink_type="simple">
|
||||
<specimenCode id="22FBC2453A91C4E43ECE9E545D5E3271">USNMENT 01025542</specimenCode>
|
||||
</ext-link>
|
||||
–
|
||||
<ext-link id="040E9075BADBC8A22E0C05B61586DECB" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025546" xlink_type="simple">
|
||||
<specimenCode id="6897CA7629E0EFB786B9896617877D13">USNMENT 01025546</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
;
|
||||
<materialsCitation id="EF18352BB2292D9C89868A8E7FB3E1A0" collectedFrom="Ex larva of Drosophila suzukii Coll" collectingDate="2015-06-06" collectionCode="USNMENT" collectorName="M. Kenis" latitude="23.6875" location="Shiping" longLatPrecision="21" longitude="102.54806" municipality="Honghe district" specimenCode="USNMENT 01025547, USNMENT 01025551" specimenCount="1" stateProvince="Yunnan Province">
|
||||
<collectingRegion id="96805390F9A0E553670A6AD73F0E96C4" country="China" name="Yunnan">Yunnan Province</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="25AB015DD8042F5CE24BD6A6DB78C857">Honghe district</collectingMunicipality>
|
||||
,
|
||||
<location id="B50F75D39CB665FEB2EA3462CB861130" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:B50F75D39CB665FEB2EA3462CB861130" latitude="23.6875" longLatPrecision="21" longitude="102.54806" municipality="Honghe district" name="Shiping" stateProvince="Yunnan Province">Shiping</location>
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0EOUBG" specific-use="{"type":"Point","coordinates":[102.548056,23.687500]}">
|
||||
<geoCoordinate id="3519D93EA4F2ABBA6393E20BB8120746" degrees="23" direction="north" minutes="41" orientation="latitude" precision="15" seconds="15" value="23.6875">23 ° 41 ' 15 " N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="EC7B9C8EDD82ACBC504EEE4001DF8246" degrees="102" direction="east" minutes="32" orientation="longitude" precision="15" seconds="53" value="102.54806">102 ° 32 ' 53 " E</geoCoordinate>
|
||||
</named-content>
|
||||
<collectedFrom id="EE57341B3F4C2D6C5388A89E8294C0FD">
|
||||
Ex larva of
|
||||
<taxonomicName id="66BAB04C9E0D2C668C6A79C84DB930B1" authority="Coll." authorityName="Coll." class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="FEF4BA8B3A707D9A22FDE8A15255A830" italics="true">Drosophila suzukii</emphasis>
|
||||
Coll.
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
<date id="36B9CF121811BCA2FAA906E03790C1D1" value="2015-06-06">
|
||||
<collectingDate id="C5ACB477F65C5111BFA1A0AF99C35765" value="2015-06-06">6. VI. 2015</collectingDate>
|
||||
</date>
|
||||
, Leg.
|
||||
<collectorName id="ADC1D93300618CF9300855149327C77D">M. Kenis</collectorName>
|
||||
;
|
||||
<ext-link id="D5E1F0A10D4FF00C5A62EF03373DD835" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025547" xlink_type="simple">
|
||||
<specimenCode id="C0B9B096257556D679750B0C888150E9">USNMENT 01025547</specimenCode>
|
||||
</ext-link>
|
||||
–
|
||||
<ext-link id="634420A74C3F59532CBFAE84A0E80949" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025551" xlink_type="simple">
|
||||
<specimenCode id="49C4ED91C895B6410616CE604730725F">USNMENT 01025551</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
;
|
||||
<materialsCitation id="17C63816A692A3270487F7F64E33BB76" collectedFrom="Ex larva of Drosophila suzukii Coll" collectingDate="2015-06-03" collectionCode="USNMENT" collectorName="M. Kenis" latitude="25.128056" location="Kunming" longLatPrecision="21" longitude="102.747215" municipality="Kunming district" specimenCode="USNMENT 01025552, USNMENT 01025553, USNMENT 01734709" specimenCount="1" stateProvince="Yunnan Province">
|
||||
<collectingRegion id="6699B0B5C67F86ADFCB86CD11F97AEB1" country="China" name="Yunnan">Yunnan Province</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="9040AEA156572FBA5D896A6AF888A242">Kunming district</collectingMunicipality>
|
||||
,
|
||||
<location id="3CDA511C71589B8AFD90C9807F5B3633" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:3CDA511C71589B8AFD90C9807F5B3633" latitude="25.128056" longLatPrecision="21" longitude="102.747215" municipality="Kunming district" name="Kunming" stateProvince="Yunnan Province">Kunming</location>
|
||||
,
|
||||
<location id="30FA7F07DEFCF0CAB07BC15DF825C93B" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:30FA7F07DEFCF0CAB07BC15DF825C93B" latitude="25.128056" longLatPrecision="21" longitude="102.747215" municipality="Kunming district" name="Yunnan Agricultural University" stateProvince="Yunnan Province">Yunnan Agricultural University</location>
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0ELVBG" specific-use="{"type":"Point","coordinates":[102.747222,25.128056]}">
|
||||
<geoCoordinate id="13886E152A1E9A2EB2EBF4B97E925147" degrees="25" direction="north" minutes="07" orientation="latitude" precision="15" seconds="41" value="25.128056">25 ° 07 ' 41 " N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="A036C9F459037A903228A91341AF816C" degrees="102" direction="east" minutes="44" orientation="longitude" precision="15" seconds="50" value="102.747215">102 ° 44 ' 50 " E</geoCoordinate>
|
||||
</named-content>
|
||||
<collectedFrom id="77684D90C616FD79977068AB200AC211">
|
||||
Ex larva of
|
||||
<taxonomicName id="14A0C3A2104080162A1BA6F6D0AA90B1" authority="Coll." authorityName="Coll." class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="7384EC82A5C6923EB77230D79B719CC4" italics="true">Drosophila suzukii</emphasis>
|
||||
Coll.
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
<date id="71A128CC9F50A1DA1E420E2E58689575" value="2015-06-03">
|
||||
<collectingDate id="F52AE5B4CBFF00E75428826EF3CBBC39" value="2015-06-03">3. VI. 2015</collectingDate>
|
||||
</date>
|
||||
, Leg.
|
||||
<collectorName id="1C217275F33717B1333ECC44941E092C">M. Kenis</collectorName>
|
||||
;
|
||||
<ext-link id="50D189BB492559CE7C85842F81E9EFDA" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025552" xlink_type="simple">
|
||||
<specimenCode id="DCFF07A7A2D0BD330A5F963D5344CB12">USNMENT 01025552</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="0E1B3054A996E01289F1D75D160E9303" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025553" xlink_type="simple">
|
||||
<specimenCode id="6F91FFFB652A0C0CC96ACEAC91DD7AB6">USNMENT 01025553</specimenCode>
|
||||
</ext-link>
|
||||
;
|
||||
<ext-link id="609D38DA90833E20DF54ADFF0B1D6D66" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01734709" xlink_type="simple">
|
||||
<specimenCode id="1833795F3588F25C41A7F5A88F8002EC">USNMENT 01734709</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
;
|
||||
<materialsCitation id="B3F189EB8A8104DE1F4C5CCB29B3FE90" collectedFrom="ex D. suzukii / D. pulchrella; on Prunus sp" collectingDate="2017-05-17" collectionCode="USNMENT" collectorName="Kenis" latitude="25.1072" location="Kunming Xining Temple" longLatPrecision="7" longitude="102.7167" municipality="Kunming Xining Temple" specimenCode="USNMENT 01867468, USNMENT 01867467, USNMENT 01867454, USNMENT 01867457, USNMENT 01025528" specimenCount="1" stateProvince="Yunnan">
|
||||
<collectingRegion id="63C974DCAE2DE2020B071744131BE727" country="China" name="Yunnan">Yunnan</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="116C009EA14B321F3822B9F867148BC5">Kunming Xining Temple</collectingMunicipality>
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0ENWBG" specific-use="{"type":"Point","coordinates":[102.716700,25.107200]}">
|
||||
<geoCoordinate id="BE9A4B007BE1FBB54F39F60F52A3119C" degrees="25.1072" direction="north" orientation="latitude" precision="5" value="25.1072">25.1072 ° N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="F3AA98B163DC27DDF0D60ECECF8317A9" degrees="102.7167" direction="east" orientation="longitude" precision="5" value="102.7167">102.7167 ° E</geoCoordinate>
|
||||
</named-content>
|
||||
,
|
||||
<collectedFrom id="20501E58C4FFBB67C79FEC953EE87DC8">
|
||||
ex
|
||||
<emphasis id="CE74F8665896D842D8E38EE11712C31A" italics="true">
|
||||
<taxonomicName id="600B2B383E1CD649F7A4A0BA3BEE0181" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">D. suzukii</taxonomicName>
|
||||
/
|
||||
<taxonomicName id="B82C7B8F9197AB4BE5306E8129C5AFEB" authorityName="Tan, Hsu & Sheng" authorityYear="1949" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="pulchrella">D. pulchrella</taxonomicName>
|
||||
</emphasis>
|
||||
; on
|
||||
<taxonomicName id="B4A94401D00EACED4E65E93B608CA75E" class="Magnoliopsida" family="Rosaceae" genus="Prunus" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="undetermined">
|
||||
<emphasis id="EF29FEAE862392700E29EA5EE838270A" italics="true">Prunus</emphasis>
|
||||
sp.
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
;
|
||||
<date id="F621FFDAB983D3F008F51E3C804B6387" value="2017-05-17">
|
||||
<collectingDate id="BF390DFBBDBBFBD9ABDB264E1C2587B4" value="2017-05-17">17 May 2017</collectingDate>
|
||||
</date>
|
||||
<collectorName id="D240FE6F41CAEB0C8777B8C3CEFCDC08">Kenis</collectorName>
|
||||
, collector CABI colony voucher G 1 _ Yunnan;
|
||||
<ext-link id="8D9A2AF001D7D9227B9624F6391439CE" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867468" xlink_type="simple">
|
||||
<specimenCode id="0A1E8FD2C476EB48C4069E095FDD222B">USNMENT 01867468</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="9ACC96679D018CFA711439E6A6B2BE6E" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867467" xlink_type="simple">
|
||||
<specimenCode id="434A4F774AC70DE12EDF35D8E6AD9127">USNMENT 01867467</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="03E2A368030910443CE677876EABB71E" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867454" xlink_type="simple">
|
||||
<specimenCode id="D10BB041899852DAA3785753A4BE0CAE">USNMENT 01867454</specimenCode>
|
||||
</ext-link>
|
||||
–
|
||||
<ext-link id="C1A43E9AFFDD769F7A44C0254814DECC" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867457" xlink_type="simple">
|
||||
<specimenCode id="23C1D1B16CEF92727503830730FB40B1">USNMENT 01867457</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="60E555C38379CD62DA0948CE52D58D44" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025528" xlink_type="simple">
|
||||
<specimenCode id="4A475030F02CC792241BC27F80649077">USNMENT 01025528</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
.
|
||||
<materialsCitation id="E61967FC98A4215DC27508A9B848EC8F" collectedFrom="Ex larva of Drosophila suzukii Coll" collectingDate="2015-06-06" collectionCode="USNMENT" collectorName="M. Kenis" latitude="23.6875" location="Shiping" longLatPrecision="21" longitude="102.54806" municipality="Honghe district" specimenCode="USNMENT 01734706, USNMENT 01734705, USNMENT 01025530, USNMENT 01734714" specimenCount="1" stateProvince="Yunnan Province">
|
||||
<collectingRegion id="9D13ABD182D38A06E67770406467B93B" country="China" name="Yunnan">Yunnan Province</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="E2213E9E901D4A86D8212A19E1AFC3A8">Honghe district</collectingMunicipality>
|
||||
,
|
||||
<location id="A6306CBF55E6F20BC08602C644009202" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:A6306CBF55E6F20BC08602C644009202" latitude="23.6875" longLatPrecision="21" longitude="102.54806" municipality="Honghe district" name="Shiping" stateProvince="Yunnan Province">Shiping</location>
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0EKYBG" specific-use="{"type":"Point","coordinates":[102.548056,23.687500]}">
|
||||
<geoCoordinate id="4101390F1BE080AF4C4E41795C29799F" degrees="23" direction="north" minutes="41" orientation="latitude" precision="15" seconds="15" value="23.6875">23 ° 41 ' 15 " N</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate id="DF58CD7EC5C75A9CAD12DE047E9A1F20" degrees="102" direction="east" minutes="32" orientation="longitude" precision="15" seconds="53" value="102.54806">102 ° 32 ' 53 " E</geoCoordinate>
|
||||
</named-content>
|
||||
<collectedFrom id="42DBA7C3052D3284676A140BA8549376">
|
||||
Ex larva of
|
||||
<taxonomicName id="EA9676553B43D36951DEBA4D9749C479" authority="Coll." authorityName="Coll." class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="7B5B1213C7310E1CCCA09BA863F3F82A" italics="true">Drosophila suzukii</emphasis>
|
||||
Coll.
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
<date id="F38F2ADE47AE0B99A44B0B81B034C7F8" value="2015-06-06">
|
||||
<collectingDate id="FD09F80FE5F51413F4A67FC39A1229EF" value="2015-06-06">6. VI. 2015</collectingDate>
|
||||
</date>
|
||||
, Leg.
|
||||
<collectorName id="CA531699ABDE8F958A0221F2B4BB1559">M. Kenis</collectorName>
|
||||
;
|
||||
<ext-link id="C7BF224C4FB702AF487E4A623EAD291C" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01734706" xlink_type="simple">
|
||||
<specimenCode id="A94398A0A14909BA1ABC74C0619D4F4F">USNMENT 01734706</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="CD3807F687C0E43D7F1CA097A6936655" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01734705" xlink_type="simple">
|
||||
<specimenCode id="D1AFC3A6949710D4AE09950972FB77C4">USNMENT 01734705</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="B1B57C421CA8FCD4DCBD38A348D4B9A0" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025530" xlink_type="simple">
|
||||
<specimenCode id="77F6A7D4D367351227ABC422AC7A5D35">USNMENT 01025530</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="E268BC8342C0C50C70432EB619B4C3B2" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01734714" xlink_type="simple">
|
||||
<specimenCode id="619D51D7ABBE3BEA94C2BAB84875C059">USNMENT 01734714</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
.
|
||||
<materialsCitation id="2B82E9526210ACCF034317EB68D14A44" collectedFrom="ex D. suzukii on Sambucus adnata" collectingDate="2016-07-25" collectingDateMax="2016-08-24" collectingDateMin="2016-07-25" collectionCode="DSZ, USNMENT" collectorName="Giorgino & Guerreiri" elevation="2239" latitude="25.098602" location="Dong Da Cun" longLatPrecision="1" longitude="102.835" municipality="Kunming" specimenCode="DSZ 118, DSZ 137, DSZ 188, USNMENT 01025531, USNMENT 01025533" specimenCount="1" stateProvince="Yunnan">
|
||||
<collectingRegion id="6634FBA11A19DBDBC8FD4BF50D1BD1E6" country="China" name="Yunnan">Yunnan</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="0CD474C50FDC813F6C34C1D7F0D97833">Kunming</collectingMunicipality>
|
||||
,
|
||||
<location id="009AB95C6DA737858914677D4A660E7D" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:009AB95C6DA737858914677D4A660E7D" latitude="25.098602" longLatPrecision="1" longitude="102.835" municipality="Kunming" name="Dong Da Cun" stateProvince="Yunnan">Dong Da Cun</location>
|
||||
,
|
||||
<location id="F3B8ACBB98D49200FE2E5ED0C72322CE" LSID="urn:lsid:plazi:treatment:4CFF4682A8F45EE89F8DACE38737F83F:F3B8ACBB98D49200FE2E5ED0C72322CE" latitude="25.098602" longLatPrecision="1" longitude="102.835" municipality="Kunming" name="Pan Long District" stateProvince="Yunnan">Pan Long District</location>
|
||||
,
|
||||
<named-content content-type="dwc:verbatimCoordinates" id="NCID0ERZBG" specific-use="{"type":"Point","coordinates":[102.835000,25.098602]}">
|
||||
<geoCoordinate id="1FDD40B4FCB22EA9DE9E762EC930EE5C" degrees="25.098602" direction="north" orientation="latitude" precision="1" value="25.098602">25.098602 ° N</geoCoordinate>
|
||||
<geoCoordinate id="1123B49A67C34FAB635D535AE19F9F37" degrees="102.835000" direction="east" orientation="longitude" precision="1" value="102.835">102.835000 ° E</geoCoordinate>
|
||||
</named-content>
|
||||
,
|
||||
<quantity id="17C617886D7D2B8C4630493CC66E74DD" metricMagnitude="3" metricUnit="m" metricValue="2.239" unit="m" value="2239.0">
|
||||
<elevation id="60B53919A5F08CFFF81F42F10F64D9BF" metricMagnitude="3" metricUnit="m" metricValue="2.239" unit="m" value="2239.0">2239 m</elevation>
|
||||
</quantity>
|
||||
,
|
||||
<collectedFrom id="E262349113771B24504FEFED2274B978">
|
||||
ex
|
||||
<taxonomicName id="5A4802F39D0B6248EAE51CB3C9D89298" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="6E79ADAC8688C8D3D7C319E7B475A34C" italics="true">D. suzukii</emphasis>
|
||||
</taxonomicName>
|
||||
on
|
||||
<taxonomicName id="54686AF556C9676C9F12C3D80E0113DB" class="Magnoliopsida" family="Viburnaceae" genus="Sambucus" kingdom="Plantae" order="Dipsacales" phylum="Tracheophyta" rank="species" species="adnata">
|
||||
<emphasis id="56A9FAF619555D98C391A7CD536279C8" italics="true">Sambucus adnata</emphasis>
|
||||
</taxonomicName>
|
||||
</collectedFrom>
|
||||
; collected
|
||||
<date id="42F5BD20E57D0AFFE019CA2076478A01" value="2016-07-25">
|
||||
<collectingDate id="E2D43FEECE0304EB19F4DA14BF5F49A9" value="2016-07-25">25. VII. 2016</collectingDate>
|
||||
</date>
|
||||
, emerged
|
||||
<date id="70C7D25886A8202A1E392B6EAA63DA38" value="2016-08-24">
|
||||
<collectingDate id="2F68FEB1B012D03B28ADC302BBA744AB" value="2016-08-24">24. VIII. 2016</collectingDate>
|
||||
</date>
|
||||
<collectorName id="E6F50C87457C6F81660866AF81B8C564">Giorgino</collectorName>
|
||||
and
|
||||
<collectorName id="00BC266057CC58BFE76F40177FBCC2CD">Guerreiri</collectorName>
|
||||
<specimenCode id="184159FECBC53F2EB6456CD164B4D1A4">DSZ 118</specimenCode>
|
||||
,
|
||||
<specimenCode id="F4406A25722262AE5692DB2AF41E868A">DSZ 137</specimenCode>
|
||||
,
|
||||
<specimenCode id="0BF1927BD4C137C1636721E6E8FD621C">DSZ 188</specimenCode>
|
||||
;
|
||||
<ext-link id="9F95B65C4A0C3B6A687CD0397C12EBC7" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025531" xlink_type="simple">
|
||||
<specimenCode id="AD009E5C0CEB353D9CAA0A550DBFCD29">USNMENT 01025531</specimenCode>
|
||||
</ext-link>
|
||||
–
|
||||
<ext-link id="408EF0F7BF0E732E89265F0CF2C62B3A" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01025533" xlink_type="simple">
|
||||
<specimenCode id="D8947BBD2039B959FA0CB39439F73B91">USNMENT 01025533</specimenCode>
|
||||
</ext-link>
|
||||
</materialsCitation>
|
||||
;
|
||||
<materialsCitation id="1EC9805731B9ABF2A8755394F26BCF62" collectedFrom="ex D. suzukii / Sambucus williamsii" collectingDate="2017-06-16" collectionCode="USNM" collectorName="Kenis" location="Dali" municipality="Dali" specimenCode="USNMENT 01867465, USNMENT 01867466" specimenCount="1" stateProvince="Yunnan">
|
||||
<collectingRegion id="90238B892EECD75712DDB8FE12441E91" country="China" name="Yunnan">Yunnan</collectingRegion>
|
||||
,
|
||||
<collectingMunicipality id="3BC173034E30A52DB023D7E518B35887">Dali</collectingMunicipality>
|
||||
,
|
||||
<collectedFrom id="E0A5711C1C30003EB41EC62DBD55D975">
|
||||
ex
|
||||
<emphasis id="3761A0214955F19205793FB87D4262E0" italics="true">
|
||||
<taxonomicName id="031B9E6924B3203F7745CB0AF7919698" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">D. suzukii</taxonomicName>
|
||||
/
|
||||
<taxonomicName id="1936E2EB508EAEC963EE57F69403B1F7" class="Magnoliopsida" family="Viburnaceae" genus="Sambucus" kingdom="Plantae" order="Dipsacales" phylum="Tracheophyta" rank="species" species="williamsii">Sambucus williamsii</taxonomicName>
|
||||
</emphasis>
|
||||
</collectedFrom>
|
||||
;
|
||||
<date id="E35A2FDB39F4A4B811DD95E07364299F" value="2017-06-16">
|
||||
<collectingDate id="D5B0E21D0E8DA88310B7A2D87CDA584F" value="2017-06-16">16 Jun 2017</collectingDate>
|
||||
</date>
|
||||
<collectorName id="E37C283DCF61DBBD737E5C2CF1B5F0C6">Kenis</collectorName>
|
||||
, collector CABI colony voucher G 1 _ Dali;
|
||||
<ext-link id="5533E89DF093C2D81BDAB915BC578776" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867465" xlink_type="simple">
|
||||
<specimenCode id="82E8985C914CB464A6BCEE7DFCDCF7AB">USNMENT 01867465</specimenCode>
|
||||
</ext-link>
|
||||
,
|
||||
<ext-link id="33FFAD882F13D90B4CA66ABF45AE4DCB" ext-link-type="uri" xlink_href="https://mbd-db.osu.edu/hol/search_results?&search_type=fast&q=USNMENT01867466" xlink_type="simple">
|
||||
<specimenCode id="F6FB1F40CB9457408CA0C09F7C5A71FC">USNMENT 01867466</specimenCode>
|
||||
</ext-link>
|
||||
. Paratypes deposited in
|
||||
<named-content id="07D33E5F6F5C083EE772020759DE7B45" content-type="dwc:institutional_code" xlink_href="http://grbio.org/institution/smithsonian-institution-national-museum-natural-history-0" xlink_title="National Museum of Natural History, Smithsonian Institution">
|
||||
<collectionCode id="9E3D5263D7D1D59C7225B27A3A0ABCF9" country="USA" httpUri="http://biocol.org/urn:lsid:biocol.org:col:34871" lsid="urn:lsid:biocol.org:col:34871" name="Smithsonian Institution, National Museum of Natural History" type="Museum">USNM</collectionCode>
|
||||
</named-content>
|
||||
</materialsCitation>
|
||||
.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="SECID0EX2BG" type="diagnosis">
|
||||
<paragraph id="6C849FFB6A6F62EDB801CEB1AD2F0FB9">
|
||||
<heading id="23BD13F9B899255C919862CB4FB157C5" reason="title">Diagnosis.</heading>
|
||||
</paragraph>
|
||||
<paragraph id="7F5511E4CA3F819B87703DDB7CA78A5E">
|
||||
Separated from
|
||||
<taxonomicName id="A38B7ECEE7F2E85060F057B56EA1AF9D" baseAuthorityName="Ihering" baseAuthorityYear="1905" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="species" species="brasiliensis">
|
||||
<emphasis id="4932C28ADE385825B83A7872D7F90BD9" italics="true">G. brasiliensis</emphasis>
|
||||
</taxonomicName>
|
||||
by the completely smooth lateral aspect of the scutellum (Fig.
|
||||
<figureCitation id="22236C7D79FC93941085920C75BEE679" captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Comparison of the scutellar morphology between G. brasiliensis (A, B), G. lupini (C, D) and G. kimorum (E, F). Black arrows indicate sculptured (A) and smooth (C, E) lateral aspect of scutellum." figureDoi="10.3897/jhr.97.118567.figure3" httpUri="https://binary.pensoft.net/fig/1058455">3 E</figureCitation>
|
||||
). Separated from
|
||||
<taxonomicName id="4BAAD64BC1F0AB948E892E7D4EFC54A3" authorityName="Sosa-Calvo & Forshage & Buffington" authorityYear="2024" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="species" species="lupini">
|
||||
<emphasis id="99C9548E3D27629DEAC9CAF5839FB3CC" italics="true">G. lupini</emphasis>
|
||||
</taxonomicName>
|
||||
by the less-developed ovipositor clip that does not extend past the midwidth of the ovipositor valve (Fig.
|
||||
<figureCitation id="F30D8BF7063344C95FE092917351EFE6" captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Comparison of the ovipositor clip between G. lupini (A, C) and G. kimorum (B, D). A G. lupini ovipositor tip, lateral view B G. kimorum, ovipositor tip, lateral view C G. lupini ventral of ovipositor showing ovipositor clip and membrane D G. kimorum ventral of ovipositor showing ovipositor clip and membrane. Black arrows indicate the location of the ovipositor clip." figureDoi="10.3897/jhr.97.118567.figure4" httpUri="https://binary.pensoft.net/fig/1058458">4 B, E</figureCitation>
|
||||
). In
|
||||
<taxonomicName id="75AF5139E11AB8FF04497FFE39D26404" authorityName="Sosa-Calvo & Forshage & Buffington" authorityYear="2024" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="species" species="lupini">
|
||||
<emphasis id="F9508C505B32F02FAEE5CDF498441D00" italics="true">G. lupini</emphasis>
|
||||
</taxonomicName>
|
||||
the ovipositor clip expands across more than half the width of the ovipositor valve (Fig.
|
||||
<figureCitation id="65ECABFEC80A4C50CFC261EA0CEF6D06" captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Comparison of the ovipositor clip between G. lupini (A, C) and G. kimorum (B, D). A G. lupini ovipositor tip, lateral view B G. kimorum, ovipositor tip, lateral view C G. lupini ventral of ovipositor showing ovipositor clip and membrane D G. kimorum ventral of ovipositor showing ovipositor clip and membrane. Black arrows indicate the location of the ovipositor clip." figureDoi="10.3897/jhr.97.118567.figure4" httpUri="https://binary.pensoft.net/fig/1058458">4 C</figureCitation>
|
||||
).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="SECID0EK4BG" type="description">
|
||||
<paragraph id="570EAAC10BB3CE3998CDE58BCD033A8C">
|
||||
<heading id="524D2D9B98545F0AFBF862EBD2B08A83" reason="title">Description.</heading>
|
||||
</paragraph>
|
||||
<paragraph id="49FF2E293F1B6408BCE10534EF45118C">
|
||||
As in description for
|
||||
<taxonomicName id="0CC13655867B92A86EE3C520FF1B6157" baseAuthorityName="Ihering" baseAuthorityYear="1905" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="species" species="brasiliensis">
|
||||
<emphasis id="AA99118A42AFC60CB586CE5370A33DD4" italics="true">G. brasiliensis</emphasis>
|
||||
</taxonomicName>
|
||||
species complex, but with the lateral aspect of scutellum completely smooth; ovipositor clip reduced, not extending beyond the halfway point across the fused ovipositor valve. Previous studies referencing ‘ Gb G 1 ’ or ‘ G 1 ’ refer to this species (
|
||||
<bibRefCitation id="00AF62DDAD992123988FB65FBE66A03D" DOI="10.1007/s13355-017-0493-0" author="Nomano" etAl="et al." firstAuthor="Nomano" journalOrPublisher="Applied Entomology and Zoology" pagination="429-437" refId="B45" refString="Nomano FY, Kasuya N, Matsuura A, Suwito A, Mitsui H, Buffington ML, Kimura MT (2017) Genetic differentiation of Ganaspis brasiliensis (Hymenoptera: Figitidae) from East and Southeast Asia. Applied Entomology and Zoology 52: 429–437. https://doi.org/10.1007/s13355-017-0493-0" title="Genetic differentiation of Ganaspis brasiliensis (Hymenoptera: Figitidae) from East and Southeast Asia." volume="52" year="2017">Nomano et al. 2017</bibRefCitation>
|
||||
; Giorgini et al. 2018;
|
||||
<bibRefCitation id="F48C59F95ED37F3BDEF3C588C83C371B" DOI="10.1093/jee/toab237" author="Abram" etAl="et al." firstAuthor="Abram" journalOrPublisher="Journal of Economic Entomology" pagination="922-942" refId="B2" refString="Abram PK, Wang X, Hueppelsheuser T, Franklin MT, Daane KM Lee JC, Lue CH, Girod P, Carrillo J, Wong WHL, Kula RR, Gates MW, Hogg B, Moffat CE, Hoelmer KA, Sial AA, Buffington ML (2022) A Coordinated Sampling and Identification Methodology for Larval Parasitoids of Spotted-Wing Drosophila. Journal of Economic Entomology 115: 922–942. https://doi.org/10.1093/jee/toab237" title="A Coordinated Sampling and Identification Methodology for Larval Parasitoids of Spotted-Wing Drosophila." volume="115" year="2022">Abram et al. 2022</bibRefCitation>
|
||||
).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="SECID0ED5BG" type="etymology">
|
||||
<paragraph id="3618A8D2E9160A3F2E59FE12ED220CD0">
|
||||
<heading id="20ADC0D34E9D61AB02C231F79CCC387D" reason="title">Etymology.</heading>
|
||||
</paragraph>
|
||||
<paragraph id="735366F0CE01FC253585566C1D28F0A0">
|
||||
Named in honor of Prof. Kimura (
|
||||
<collectingRegion id="9B1FD3135C4A7D609C67AC26BB4C51D1" country="Japan" name="Hokkaido">Hokkaido</collectingRegion>
|
||||
University, retired) and Dr Kim Hoelmer (
|
||||
<collectionCode id="4A55A9F6F9CC24007F0F1F32249757A2">USDA-ARS</collectionCode>
|
||||
, retired). The name is a combination of Kimura and Kim Hoelmer.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="SECID0EI5BG" type="Cytochrome c oxidase subunit I (COI) Barcode region">
|
||||
<paragraph id="15BE4E63F2B548CAA93FDBDD3C421917">
|
||||
<heading id="8B5A03943962BC4BB751C30275C75355" reason="title">
|
||||
Cytochrome c oxidase subunit I (
|
||||
<abbrev id="ABBRID0EN5BG" xlink_title="cytochrome oxidase I">
|
||||
<collectionCode id="BE3BCB95AFECC973B88F796F710F6E0B" country="Portugal" lsid="urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" type="Herbarium">COI</collectionCode>
|
||||
</abbrev>
|
||||
) Barcode region.
|
||||
</heading>
|
||||
</paragraph>
|
||||
<paragraph id="B20E9128568C0BA6C389760B2BE71F27">> Ganaspis _ kimorum _ BBP 857</paragraph>
|
||||
<paragraph id="CA920DAB6E63583ECB61B31125F507AF">NATATTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGATCAAGTTTAAGAATAATTATTCGATTA GAATTAGGAACCCCTTCACAATTAATTAATAATGATCAAATTTATAATACAATTGTTACTACTCATGC ATTTGTAATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGAAATTACTTAATTCCTT TAATATTATCTGCTCCTGATATATCATTCCCTCGTCTTAATAATATAAGATTTTGATTATTAATCCCT TCTTTAATTTTAATAATTTCAAGTATATTTATTGATGAAGGGTCTGGAACTGGATGAACAGTTTATCC TCCTTTATCACTAAATAAGTCCCACCCAGGAATCTCAACTGACTTAGTAATTTTTTCTCTTCATCTTA GAGGAATTTCTTCAATTTTAGGATCAATTAATTTTATTACAACTATTCTAAATATACGACCAAATTTA ATAAGTATAGATAAAATTTCTTTATTTACTTGATCCATTTTTCTTACCACTATTTTATTATTATTATC TTTACCAGTATTAGCAGGTGGAATCACTATATTACTTTTTGACCGAAATATTAATACATCTTTTTATG ACCCAATAGGAGGAGGAGACCCAATTCTATACCAACACTTATTT</paragraph>
|
||||
<paragraph id="C1A9744DD00138700CF2931C27C12959">> Ganaspis _ kimorum _ 233137974 _ E 02 (partial sequence, 592 bp)</paragraph>
|
||||
<paragraph id="3942C845CC2416FB761AC02972CD951D">ATTAGAATTAGGAACCCCTTCACAATTAATTAATAATGATCAAATTTATAATACAATTGTTACTACTCAT GCATTTGTAATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGAAATTACTTAATTCC TTTAATATTATCTGCTCCTGATATATCATTCCCTCGTCTTAATAATATAAGATTTTGATTATTAATCC CTTCTTTAATTTTAATAATTTCAAGTATATTTATTGATGAAGGGTCTGGAACTGGATGAACAGTTTAT CCTCCTTTATCACTAAATAAGTCCCACCCAGGAATCTCAACTGACTTAGTAATTTTTTCTCTTCATCT TAGAGGAATTTCTTCAATTTTAGGATCAATTAATTTTATTACAACTATTCTAAATATACGACCAAATT TAATAAGTATAGATAAAATTTCTTTATTTACTTGATCCATTTTTCTTACCACTATTTTATTATTATTA TCTTTACCAGTATTAGCAGGTGGAATCACTATATTACTTTTTGACCGAAATATTAATACATCTTTTTA TGACCCAATAGGAGGAGGAGACCCAATTCTATACCAACACTTATTT</paragraph>
|
||||
<paragraph id="8C7799062722F8A95664C27EF599A2AF">> Ganaspis _ kimorum _ 233137957 _ F 06</paragraph>
|
||||
<paragraph id="08AB224C726F556EB943FA8EA18E36A6">NATATTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGATCAAGTTTAAGAATAATTATTCGATTA GAATTAGGAACCCCTTCACAATTAATTAATAATGATCAAATTTATAATACAATTGTTACTACTCATGC ATTTGTAATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGACATTACTTAATTCCTT TAATATTATCTGCTCCTGATATATCATTCCCTCGTCTTAATAATATAAGATTTTGATTATTAATCCCT TCTTTAATTTTAACAATTTCAAGTATATTTATTGATGAAGGATCTGGAACCGGATGAACAGTTTATCC TCCTTTATCACTAAATAAGTCCCACCCAGGAATCTCAACTGACTTAGTAATTTTTTCTCTTCATCTTA GAGGAATTTCTTCAATTTTAGGATCAATTAATTTTATTACAACTATTCTAAATATACGACCAAATTTA ATAAGTATAGATAAAATTTCTTTATTTACTTGATCCATTTTTCTTACCACTATTTTATTATTATTATC TTTACCAGTATTAGCAGGTGGAATCACTATATTACTTTTTGACCGAAATATTAATACATCTTTTTATG ACCCAATAGGAGGAGGAGACCCAATTCTATACCAACACTTATTT</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="SECID0EX5BG" type="biology">
|
||||
<paragraph id="AB6EA84918615212B522324CFDA31088">
|
||||
<heading id="8AF7509A1DD4E5F9A269699484C8298B" reason="title">Biology.</heading>
|
||||
</paragraph>
|
||||
<paragraph id="73104D5F7825FE66DCAE7B7322089685">
|
||||
Koinobiont endoparasitoid of
|
||||
<taxonomicName id="1618285DFDEDB21ED3ED4D6729C181B1" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="suzukii">
|
||||
<emphasis id="32D0A6E444BBDBAEDF02447B60323FD7" italics="true">Drosophila suzukii</emphasis>
|
||||
</taxonomicName>
|
||||
(
|
||||
<bibRefCitation id="F8A2F0E405441DC11210AE4DEB61A7AE" DOI="10.1007/s13355-017-0493-0" author="Nomano" etAl="et al." firstAuthor="Nomano" journalOrPublisher="Applied Entomology and Zoology" pagination="429-437" refId="B45" refString="Nomano FY, Kasuya N, Matsuura A, Suwito A, Mitsui H, Buffington ML, Kimura MT (2017) Genetic differentiation of Ganaspis brasiliensis (Hymenoptera: Figitidae) from East and Southeast Asia. Applied Entomology and Zoology 52: 429–437. https://doi.org/10.1007/s13355-017-0493-0" title="Genetic differentiation of Ganaspis brasiliensis (Hymenoptera: Figitidae) from East and Southeast Asia." volume="52" year="2017">Nomano et al. 2017</bibRefCitation>
|
||||
; Girod et al. 2018 b; Wang et al. 2018;
|
||||
<bibRefCitation id="B46003BAD04105F4CA11B8B97E497F35" DOI="10.1038/s41598-020-76180-5" author="Seehausen" etAl="et al." firstAuthor="Seehausen" refId="B50" refString="Seehausen ML, Ris N, Driss L, Racca A, Girod P, Warot S, Borowiec N, Toševski I, Kenis M (2020) Evidence for a cryptic parasitoid species reveals its suitability as a biological control agent. Scientific Reports 10: 19096. https://doi.org/10.1038/s41598-020-76180-5" year="2020">Seehausen et al. 2020</bibRefCitation>
|
||||
; Daane et al. 2021).
|
||||
<bibRefCitation id="553DC906BA0B60F470EB322A2E83D2FB" DOI="10.1038/s41598-020-76180-5" author="Seehausen ML & Ris N & Driss L & Racca A & Girod P & Warot S & Borowiec N & Toševski I & Kenis M" etAl="et al." firstAuthor="Seehausen" refId="B50" refString="Seehausen ML, Ris N, Driss L, Racca A, Girod P, Warot S, Borowiec N, Toševski I, Kenis M (2020) Evidence for a cryptic parasitoid species reveals its suitability as a biological control agent. Scientific Reports 10: 19096. https://doi.org/10.1038/s41598-020-76180-5" year="2020">Seehausen et al. (2020)</bibRefCitation>
|
||||
found ‘
|
||||
<taxonomicName id="3457978E5597F6EB61189AA4D9F8ECA9" baseAuthorityName="Ihering" baseAuthorityYear="1905" class="Insecta" family="Figitidae" genus="Ganaspis" higherTaxonomySource="GBIF" isUncertain="true" kingdom="Animalia" order="Hymenoptera" phylum="Arthropoda" rank="species" species="brasiliensis">
|
||||
<emphasis id="34E8BEABCBBAEB0B097FFEE536B38D94" italics="true">Ganaspis</emphasis>
|
||||
cf.
|
||||
<emphasis id="4A26DCA5D535622E80E875EDDC857A8F" italics="true">brasiliensis</emphasis>
|
||||
</taxonomicName>
|
||||
’ G 1 could successfully parasitize
|
||||
<taxonomicName id="3FF34FB20500C75C9FCC41383A983D46" authorityName="Meigen" authorityYear="1830" class="Insecta" family="Drosophilidae" genus="Drosophila" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="melanogaster">
|
||||
<emphasis id="59D5D67AB3CC79E9069A262F45D7398A" italics="true">D. melanogaster</emphasis>
|
||||
</taxonomicName>
|
||||
in lab culture.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
600
data/4C/FF/52/4CFF520477DFAD7AC75B7906CE22F3BF.xml
Normal file
600
data/4C/FF/52/4CFF520477DFAD7AC75B7906CE22F3BF.xml
Normal file
|
|
@ -0,0 +1,600 @@
|
|||
<document ID-CLB-Dataset="292613" ID-GBIF-Dataset="c96d5a1d-dd88-4361-8a13-5b22df0d6ba6" checkinTime="1706642255376" checkinUser="plazi" docAuthor="Info Flora" docDate="2021" docId="4CFF520477DFAD7AC75B7906CE22F3BF" docLanguage="de" docName="InfoFlora.Rosaceae.xml" docOrigin="https://www.infoflora.ch/de/flora/rosaceae.html (accessed 2023-10-20)" docSource="https://www.infoflora.ch/de/flora/rosaceae.html" docTitle="Fragaria viridis Duchesne" docType="treatment" docVersion="7" id="B4627A703C6D1F85635275F08B0D617D" masterDocId="5616F1D28F70E070F7AD119202FEF7FB" masterDocTitle="Info Flora Schweiz - Rosaceae" updateTime="1712196730753" updateUser="ExternalLinkService">
|
||||
<mods:mods id="44DF5F1168D8A7FE5247E419539328B7" xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo id="EDC433243F32ACA5C3885988EF84FD32">
|
||||
<mods:title id="308651A079038612E2B6FD63E8D859B6">Info Flora Schweiz - Rosaceae</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name id="2009EEBC710DB5DE7E0A5AAFE72B5221" type="personal">
|
||||
<mods:role id="E832394F74BEBA3E0B1B8D31FEBAC03F">
|
||||
<mods:roleTerm id="44495F3191702CF752416E054E8262AD">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="4497714427B5ABBFC08B2D28883A9858">Info Flora</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource id="123243B7CD3BA8EAC4D7896AA96AC168">text</mods:typeOfResource>
|
||||
<mods:originInfo id="853EC309CD069948D5F2B8B327FAC8CB">
|
||||
<mods:dateIssued id="EF16DAEE051ED28AE0D7BAA2F7E5DBB7">2021</mods:dateIssued>
|
||||
<mods:dateCaptured id="6F10F81BF7E6D3AEE7623FD51AFFDEC6">2023-10-20</mods:dateCaptured>
|
||||
<mods:publisher id="85E56290A6B79F2289138872DEF0C28E">Info Flora Schweiz</mods:publisher>
|
||||
<mods:place id="60EE29FB327D44C008C39CC588DA73DF">
|
||||
<mods:placeTerm id="83AF22294E67B7BF23560AF8F148C5FD">Geneve</mods:placeTerm>
|
||||
</mods:place>
|
||||
</mods:originInfo>
|
||||
<mods:location id="0B6B79C747F3933FB4D1E54B7E525F80">
|
||||
<mods:url id="C5C1C9C9C6DB7E17BA6B144CFD2A64B5">https://www.infoflora.ch/de/flora/rosaceae.html</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification id="B888184D6EB374F6B96C30E6177354B0">url</mods:classification>
|
||||
</mods:mods>
|
||||
<treatment id="4CFF520477DFAD7AC75B7906CE22F3BF" ID-DOI="http://doi.org/10.5281/zenodo.10915968" ID-GBIF-Taxon="224779216" ID-Zenodo-Dep="10915968" LSID="urn:lsid:plazi:treatment:4CFF520477DFAD7AC75B7906CE22F3BF" httpUri="http://treatment.plazi.org/id/4CFF520477DFAD7AC75B7906CE22F3BF">
|
||||
<subSubSection id="EB4E59E79FD44807ED9228B430B26B9B" type="nomenclature">
|
||||
<paragraph id="5A5110C848B17448FCA43C82542E10CF">
|
||||
<taxonomicName id="CB57286E318F4426769832B413C95A22" ID-CoL="6JK5H" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">
|
||||
<emphasis id="82D4D7C2E89C73A8CD2CABB3E79CA9E3" italics="true">Fragaria viridis</emphasis>
|
||||
Duchesne
|
||||
</taxonomicName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="9E55D044676EB4050D1D503DC6878B42" type="vernacular_names">
|
||||
<paragraph id="E2FE86D936EB6A33BEF51A550F13F8E7">
|
||||
<vernacularName id="1D945896072092B8C58D2A4287CC8016">
|
||||
<normalizedToken id="ED6EBF6C11A839A316B7701D55CF64F7" originalValue="Hügel-Erdbeere">Huegel-Erdbeere</normalizedToken>
|
||||
</vernacularName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="EBE59DEE0F911B0286B539C01EA625E8" type="multiple">
|
||||
<paragraph id="01FDA49205D48D31838E24246899DCE9">
|
||||
Art ISFS: 173900 Checklist: 1019930
|
||||
<taxonomicName id="667AF611ADC1CBD9894B0664B3020781" class="Magnoliopsida" family="Rosaceae" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="family">Rosaceae</taxonomicName>
|
||||
<taxonomicName id="2E947BDDC91117854CAC2C0CAE6D2EB1" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="genus">Fragaria</taxonomicName>
|
||||
<taxonomicName id="93F8CED2436EE30A16009B657278C1D7" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</paragraph>
|
||||
<paragraph id="12CA33859D9E75458A0733D38DBF3893">
|
||||
<heading id="4AD8ECE3C0B0FAE52B1B2792524D390C">Zusammenfassung</heading>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="1F3D130B01C7012D3114B356CF64112F" type="description">
|
||||
<paragraph id="E8062F88D174B806F28DFD977F884AC0">
|
||||
Artbeschreibung
|
||||
<emphasis id="A9BB1B534BAD26BCFE84B697D023835A" italics="true">
|
||||
(nach
|
||||
<bibRefCitation id="2EC6FE529FD9B431318F696F4E37FAB7" ID-ISBN="978-3-258-08047-5" author="Lauber, K. & Wagner, G. & Gygax, A." location="Bern" publisher="Haupt Verlag" refString="Lauber, K., Wagner, G., Gygax, A. 2018. Flora Helvetica. Haupt Verlag, Bern. ISBN: 978-3-258-08047-5." title="Flora Helvetica" year="2018">Lauber & al. 2018</bibRefCitation>
|
||||
)
|
||||
</emphasis>
|
||||
:
|
||||
<normalizedToken id="8F24DB2E127C007E86006DA371E57AD3" originalValue="Ähnlich">Aehnlich</normalizedToken>
|
||||
wie
|
||||
<taxonomicName id="2ADAC5BE2C7713391AC71011B8CE56D4" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="vesca">
|
||||
<emphasis id="5C16BD5985FA4EDDF0EED93DFD883EC2" italics="true">F. vesca</emphasis>
|
||||
</taxonomicName>
|
||||
, aber
|
||||
<normalizedToken id="2DF427D07D806F092BEBCE4EC0B38F6C" originalValue="Teilblätter">Teilblaetter</normalizedToken>
|
||||
bis
|
||||
<quantity id="355B14EF15851494353A293666609719" metricMagnitude="-2" metricUnit="m" metricValue="9.0" unit="cm" value="9.0">9 cm</quantity>
|
||||
lang, Endzahn kleiner als die benachbarten
|
||||
<normalizedToken id="4161C5A425D007B5FFEB4BE440E800E1" originalValue="Zähne">Zaehne</normalizedToken>
|
||||
,
|
||||
<emphasis id="F91F6D53076F65A9CD1FA176A05139B8" bold="true">
|
||||
Blattunterseite
|
||||
<normalizedToken id="A500C6E6E4DA64A63E9EB7C203DF2B9F" originalValue="angedrückt">angedrueckt</normalizedToken>
|
||||
seidig behaart
|
||||
</emphasis>
|
||||
,
|
||||
<emphasis id="51DFE28CE1BF360338FA1ABEF98E1C76" bold="true">
|
||||
innere
|
||||
<normalizedToken id="347C8454607CD3D812F662852D66D766" originalValue="Kelchblätter">Kelchblaetter</normalizedToken>
|
||||
die reife Frucht umschliessend
|
||||
</emphasis>
|
||||
, beim
|
||||
<normalizedToken id="B42C870FC5533492D41A741CA90688EE" originalValue="Pflücken">Pfluecken</normalizedToken>
|
||||
mit dieser knackend abreissend. Alle
|
||||
<normalizedToken id="CBC6FA1B39B7742BD0B12C2449C9DEE7" originalValue="Tragblätter">Tragblaetter</normalizedToken>
|
||||
ganzrandig, 0,5-
|
||||
<quantity id="80241C081C6D000CC5998A1602690F2E" metricMagnitude="-3" metricUnit="m" metricValue="2.0" unit="mm" value="2.0">2 mm</quantity>
|
||||
breit (bei
|
||||
<taxonomicName id="03D5E73EFD45B7C9B298F9D3930460B7" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="vesca">
|
||||
<emphasis id="BFB7A10E3DA042391637888300D8B431" italics="true">F. vesca</emphasis>
|
||||
</taxonomicName>
|
||||
unterstes Tragblatt geteilt bis
|
||||
<normalizedToken id="E0AFBEE0B11F8B9EDA39A91C3D2D5296" originalValue="gezähnt">gezaehnt</normalizedToken>
|
||||
,>
|
||||
<quantity id="3AAD8051E41E7EDA343CAC1A1937F931" metricMagnitude="-3" metricUnit="m" metricValue="3.0" unit="mm" value="3.0">3 mm</quantity>
|
||||
breit).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="49ADD08FFFDB90EAFA273525DAF0B40C" type="biology_ecology">
|
||||
<paragraph id="D96F5C369E6FA3226E58C8BC852398C9">
|
||||
<normalizedToken id="650A4C7942F615E053C703302B3BDD54" originalValue="Blütezeit">Bluetezeit</normalizedToken>
|
||||
<emphasis id="8F9AC36C948BA2BD2E8F2968778916F2" italics="true">
|
||||
(nach
|
||||
<bibRefCitation id="2FB1089DECFDBA5CF1908B4FE109A7A2" ID-ISBN="978-3-258-08047-5" author="Lauber, K. & Wagner, G. & Gygax, A." location="Bern" publisher="Haupt Verlag" refString="Lauber, K., Wagner, G., Gygax, A. 2018. Flora Helvetica. Haupt Verlag, Bern. ISBN: 978-3-258-08047-5." title="Flora Helvetica" year="2018">Lauber & al. 2018</bibRefCitation>
|
||||
)
|
||||
</emphasis>
|
||||
: 4-5
|
||||
</paragraph>
|
||||
<paragraph id="474B50744655AF73FE1D9EE6EBEA80CD">
|
||||
Standort und Verbreitung in der Schweiz
|
||||
<emphasis id="EA572BEA149EEDAC46E0D24936546BB8" italics="true">
|
||||
(nach
|
||||
<bibRefCitation id="863BF99C237ED85F9B70D22D0139F944" ID-ISBN="978-3-258-08047-5" author="Lauber, K. & Wagner, G. & Gygax, A." location="Bern" publisher="Haupt Verlag" refString="Lauber, K., Wagner, G., Gygax, A. 2018. Flora Helvetica. Haupt Verlag, Bern. ISBN: 978-3-258-08047-5." title="Flora Helvetica" year="2018">Lauber & al. 2018</bibRefCitation>
|
||||
)
|
||||
</emphasis>
|
||||
: Trockenwiesen,
|
||||
<normalizedToken id="34CC24532199B26F9E4969B25B2513D4" originalValue="Föhren-">Foehren-</normalizedToken>
|
||||
und
|
||||
<normalizedToken id="C599966E1DC81DAEAB122F721161EF80" originalValue="Laubmischwälder">Laubmischwaelder</normalizedToken>
|
||||
/ kollin-montan / CH zerstreut (besonders VS,
|
||||
<normalizedToken id="F09E8CDCDC98558AFF69EB3F11D1BDE7" originalValue="südliches">suedliches</normalizedToken>
|
||||
TI, SH)
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="B5A6DF9196AF4604CCA6FEF3F6711C31" type="distribution">
|
||||
<paragraph id="43F6E89562EC0525754324410951AB32">
|
||||
Verbreitung global
|
||||
<emphasis id="E6176E26497B02661CE280712E6AA2AC" italics="true">
|
||||
(nach
|
||||
<bibRefCitation id="55BF578CBF2874CFDE1C6663C6C37A25" ID-ISBN="978-3-258-08047-5" author="Lauber, K. & Wagner, G. & Gygax, A." location="Bern" publisher="Haupt Verlag" refString="Lauber, K., Wagner, G., Gygax, A. 2018. Flora Helvetica. Haupt Verlag, Bern. ISBN: 978-3-258-08047-5." title="Flora Helvetica" year="2018">Lauber & al. 2018</bibRefCitation>
|
||||
)
|
||||
</emphasis>
|
||||
: Eurasiatisch
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="8C417F8E12A92DC16D8F1E63CEADF2D8" type="biology_ecology">
|
||||
<paragraph id="9C0AAAB127A8FBA5ADDDB28E2F11E79F">
|
||||
<normalizedToken id="5FFD82ABB5C734FFBC8B0DDA781848F9" originalValue="Ökologische">Oekologische</normalizedToken>
|
||||
Zeigerwerte
|
||||
<emphasis id="D5C27BB123F4D9964BF8B30B01B49478" italics="true">
|
||||
(nach
|
||||
<bibRefCitation id="C85BB39402AAF4B5B2D4F017BCBAE842" author="Landolt, E. & Bäumler, B. & Erhardt, A. & Hegg, O. & Klötzli, F. & Lämmler, W. & Nobis, M. & Rudmann-Maurer, K. & Theurillat, J.P. & Urmi, E. & Vust, M. & Wohlgemuth, T." publicationUrl="https://www.dora.lib4ri.ch/wsl/islandora/object/wsl%3A9966" refString="Landolt, E., Bäumler, B., Erhardt, A., Hegg, O., Klötzli, F., Lämmler, W., Nobis, M., Rudmann-Maurer, K., Theurillat, J.P., Urmi, E., Vust, M., Wohlgemuth, T. 2010. Flora indicativa. Ökologische Zeigerwerte und biologische Kennzeichen zur Flora der Schweiz und der Alpen (2nd ed.). https://www.dora.lib4ri.ch/wsl/islandora/object/wsl%3A9966" title="Flora indicativa. Ökologische Zeigerwerte und biologische Kennzeichen zur Flora der Schweiz und der Alpen" year="2010">Landolt & al. 2010</bibRefCitation>
|
||||
)
|
||||
</emphasis>
|
||||
244-34 + 4.h.2n=14
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="08942DC31A1090B9F5D4B9D3D5A58C69" type="multiple">
|
||||
<paragraph id="D1134ABBFB0B996334904ADAA8346D49">Status</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="1C2CFC6904A87FB64EB73817696A8B3C" type="conservation">
|
||||
<paragraph id="A1BC048BD9884F464B1CEC5F5BB9D540">
|
||||
<heading id="EBA77D2453222A46063963FA574A3D61">Status IUCN</heading>
|
||||
: Potenziell
|
||||
<normalizedToken id="6FC506741B0BCEC1F2269017EEB81711" originalValue="gefährdet">gefaehrdet</normalizedToken>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="E65239203499DCC13E3B01807EA9F8C0" type="multiple">
|
||||
<paragraph id="24356671EB90125890BC590D05216B43">
|
||||
<heading id="98AB43D0CEB297C7995D83ACB37DAAF8">
|
||||
<normalizedToken id="2E2ED9FB9755C341276EF700CC599FB6" originalValue="Ökologie">Oekologie</normalizedToken>
|
||||
</heading>
|
||||
</paragraph>
|
||||
<paragraph id="B6A6F37E216370FA1B02FADE84F4F9DF">
|
||||
Lebensform
|
||||
<normalizedToken id="3B34517CE16929897C6A8B3C4FC41437" originalValue="Mehrjähriger">Mehrjaehriger</normalizedToken>
|
||||
Hemikryptophyt
|
||||
</paragraph>
|
||||
<paragraph id="803320D3988FD5C941C985562C38D35B">
|
||||
<heading id="CE34852560A2ACC6CEA1A21456033CE2">Lebensraum Lebensraum</heading>
|
||||
nach
|
||||
<bibRefCitation id="990E924D8C905D54059A36F7F453E998" author="Delarze, R. & Gonseth, Y. & Eggenberger, S. & Vust, M." location="Bad Hersfeld, Germany" publisher="Ott Verlag" refString="Delarze, R., Gonseth, Y., Eggenberger, S., Vust, M. 2015. Lebensräume der Schweiz: Oekologie – Gefährdung – Kennarten (3rd edition). Ott Verlag, Bad Hersfeld, Germany, 456 pp." title="Lebensräume der Schweiz: Oekologie – Gefährdung – Kennarten (3rd edition)" year="2015">Delarze & al. 2015</bibRefCitation>
|
||||
</paragraph>
|
||||
<paragraph id="EE56B84A43F6326AD8EDD62037CBC75D">
|
||||
<table id="ACCC78B132A41660A22BAD35AC3DD886" class="table" inLine="true">
|
||||
<tr id="668F38231F39E69E2E42F22A6161BFE2">
|
||||
<td id="78332166BE377E655710C442F40EF1AE">
|
||||
<tbody id="4EF85B0AA13A3CB937D4A6CB6FBE5323">
|
||||
5.1.1 - Trockenwarmer Krautsaum (
|
||||
<emphasis id="10D043D0B41C8EA5864B2261764FEB63" italics="true">
|
||||
<taxonomicName id="D8E6052B544E34455E5428C11A5609FD" class="Magnoliopsida" family="Geraniaceae" genus="Geranion" higherTaxonomySource="GBIF" kingdom="Plantae" order="Geraniales" phylum="Tracheophyta" rank="genus">Geranion</taxonomicName>
|
||||
sanguinei
|
||||
</emphasis>
|
||||
)
|
||||
</tbody>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</paragraph>
|
||||
<paragraph id="83D48E97B09F8C65DA638E795E75F03C">
|
||||
<tableNote id="96CAF7A4CA352F9D27224CF85A829C01">
|
||||
<emphasis id="253759E42183892F5CFD46D59D7ACBE6" bold="true">fett</emphasis>
|
||||
<emphasis id="B8D66F22D469E91B4E8AF744818AB5D1" italics="true">
|
||||
Dominante Art, welche das Aussehen des Lebensraumes
|
||||
<normalizedToken id="2819A393B4E0C02AA6F9CD1BCDA0324F" originalValue="mitprägt">mitpraegt</normalizedToken>
|
||||
</emphasis>
|
||||
<emphasis id="F760D6E5A9CD53DD2804F0D62E5C5051" italics="true">Charakterart</emphasis>
|
||||
<emphasis id="596DBA577DE63D8C9312DC79C6525E1F" italics="true">Weniger strikt an den Lebensraum gebundene Art</emphasis>
|
||||
</tableNote>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="240D95461AC3751CCD777B5853E275AB" type="biology_ecology">
|
||||
<paragraph id="15E43CD710847D191C0A7EFE312F8386">
|
||||
<normalizedToken id="9AC436A734A8831BE68235D0C0F6912A" originalValue="Ökologische">Oekologische</normalizedToken>
|
||||
Zeigerwerte nach
|
||||
<bibRefCitation id="D41E51B514F6ECBC4F4A7730B136D45E" author="Landolt, E. & Bäumler, B. & Erhardt, A. & Hegg, O. & Klötzli, F. & Lämmler, W. & Nobis, M. & Rudmann-Maurer, K. & Theurillat, J.P. & Urmi, E. & Vust, M. & Wohlgemuth, T." publicationUrl="https://www.dora.lib4ri.ch/wsl/islandora/object/wsl%3A9966" refString="Landolt, E., Bäumler, B., Erhardt, A., Hegg, O., Klötzli, F., Lämmler, W., Nobis, M., Rudmann-Maurer, K., Theurillat, J.P., Urmi, E., Vust, M., Wohlgemuth, T. 2010. Flora indicativa. Ökologische Zeigerwerte und biologische Kennzeichen zur Flora der Schweiz und der Alpen (2nd ed.). https://www.dora.lib4ri.ch/wsl/islandora/object/wsl%3A9966" title="Flora indicativa. Ökologische Zeigerwerte und biologische Kennzeichen zur Flora der Schweiz und der Alpen" year="2010">Landolt & al. (2010)</bibRefCitation>
|
||||
</paragraph>
|
||||
<paragraph id="0B597BDAF5ABD69F10C32824DB08A6E2">
|
||||
<table id="DC213D95142F802C7D1972D26D1112A6" class="table" inLine="true">
|
||||
<tbody id="550A10FEF2157C0E322F0A5C7C5B1039">
|
||||
<tr id="050DBC127E2EC2AC0F47BBDD0D92EE46">
|
||||
<th id="6CB7F1CC0BE7710C3E5C1C9A26EC9A31" colspan="2">
|
||||
<emphasis id="921DC0A22B3813E1AF645CAF8141AB35" bold="true">Bodenfaktoren</emphasis>
|
||||
</th>
|
||||
<th id="86E0C05E9DEADBBF37E024BEFCFF229C" colspan="2">
|
||||
<emphasis id="87E38479D8EFFCAFA57CEC6E1620CCE8" bold="true">Klimafaktoren</emphasis>
|
||||
</th>
|
||||
<th id="FE699362BB16C89876A766C43046110F" colspan="2">
|
||||
<emphasis id="12D206586454C93B9852789DBA88C418" bold="true">Salztoleranz</emphasis>
|
||||
</th>
|
||||
</tr>
|
||||
<tr id="B12000C963683BBC7C57ACD6D8BC48BB">
|
||||
<td id="D8016153C1A6D4F4182440E9762DDBE0">Feuchtezahl F</td>
|
||||
<td id="CB0769E4CF12A2FCDFB2B40D6415700C" style="text-align:left;width:100px">
|
||||
<normalizedToken id="493E9F89F32F35B99CEC3A216C46E328" originalValue="mässig">maessig</normalizedToken>
|
||||
trocken
|
||||
</td>
|
||||
<td id="3963CDF7311BF55C17FC92EB0ED9AB25">Lichtzahl L</td>
|
||||
<td id="5556EDD37FEAB30AE12F8D72F7D84F6C" style="text-align:left;width:60px">halbschattig</td>
|
||||
<td id="3E8FA84392530D353168EE8818242629">Salzzeichen</td>
|
||||
<td id="0DB255622B163653C24888C4B329D5CE" style="text-align:left;width:60px">--</td>
|
||||
</tr>
|
||||
<tr id="DF929E7FA5BE09EDB3891372A1080C63">
|
||||
<td id="1A2B605BEDA4214E0F39B5597B53B786">Reaktionszahl R</td>
|
||||
<td id="247904C8B74FC63942C34740688EC933" style="text-align:left">neutral bis basisch (pH 5.5-8.5)</td>
|
||||
<td id="14274E597294376FEF01099CC0F93E9E">Temperaturzahl T</td>
|
||||
<td id="64787C04161BAFFAC5C2E7DBD569AFDA" style="text-align:left">warm-kollin</td>
|
||||
</tr>
|
||||
<tr id="21FABDED972C076EC7766B20B7292803">
|
||||
<td id="16CA2FB99ADE8EB017F92D7BFE3A671B">
|
||||
<normalizedToken id="6B8BF014B01801DFCDA4F5DA3156F7F0" originalValue="Nährstoffzahl">Naehrstoffzahl</normalizedToken>
|
||||
N
|
||||
</td>
|
||||
<td id="E157785B2BF1057B9221A457A18CB5A2" style="text-align:left">
|
||||
<normalizedToken id="413D0A92946DA9E0A8ABBD89417E75A5" originalValue="nährstoffreich">naehrstoffreich</normalizedToken>
|
||||
</td>
|
||||
<td id="DE22E7075F9BDDB3F1B6B3093E638C53">
|
||||
<normalizedToken id="0E19FE57AF918CDBD026FE53E776CB79" originalValue="Kontinentalitätszahl">Kontinentalitaetszahl</normalizedToken>
|
||||
K
|
||||
</td>
|
||||
<td id="5075FFB99DCF6715688BC2A6BE776B5D" style="text-align:left">subkontinental (niedrige relative Luftfeuchtigkeit, grosse Temperaturschwankungen, eher kalte Winter)</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="6E41F6C29B06EE5A8F18F19C624F083A" type="reference_group">
|
||||
<paragraph id="42D326F462467A83DD48DD8D63157F28">
|
||||
<heading id="02A576EA011754F7D454BC07F4EEFEE7">Nomenklatur</heading>
|
||||
</paragraph>
|
||||
<paragraph id="C6B287DB7FFEEC54A603D9E1E59F1216">
|
||||
<treatmentCitation id="611DFA94D945C713CD85C83FDBB4EDC1">
|
||||
<heading id="DAF989CFC96D6550397229B42EB9C1B7">
|
||||
<normalizedToken id="CEEFF7C287257B4245D064C5FCB33018" originalValue="Gültiger">Gueltiger</normalizedToken>
|
||||
Name (
|
||||
<bibRefCitation id="A30F30D38F2E47C1DA3818C95BB44207" author="Juillerat, P. & Bäumler, B. & Bornand, C. & Gygax, A. & Jutzi, M. & Möhl, A. & Nyffeler, R. & Sager, L. & Santiago, H. & Eggenberg, S." publicationUrl="https://doi.org/10.5281/zenodo.10680266" publisher="Info Flora" refString="Juillerat, P., Bäumler, B., Bornand, C., Gygax, A., Jutzi, M., Möhl, A., Nyffeler, R., Sager, L., Santiago, H., and Eggenberg, S. (2017). Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera. Info Flora. DOI: https://doi.org/10.5281/zenodo.10680266" title="Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera" year="2017">Checklist 2017</bibRefCitation>
|
||||
)
|
||||
</heading>
|
||||
:
|
||||
<taxonomicName id="8EF3AA86D087B822E9442DAD0972357A" ID-CoL="6JK5H" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">
|
||||
<emphasis id="DE161C30AE5D88E1F65A833FB6F49916" italics="true">Fragaria viridis</emphasis>
|
||||
Duchesne
|
||||
</taxonomicName>
|
||||
</treatmentCitation>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="5FCD4952AB1198694ECE59876D347A4D" type="vernacular_names">
|
||||
<paragraph id="015C5858E06928B0067C5DD75C785F2F">
|
||||
Volksname Deutscher Name:
|
||||
<vernacularName id="FB0712BC3629D69DB5C9C23DEB92269F" language="deu">
|
||||
<normalizedToken id="D1694702CF4452BE56E36BE6C7DBCDC3" originalValue="Hügel-Erdbeere">Huegel-Erdbeere</normalizedToken>
|
||||
</vernacularName>
|
||||
,
|
||||
<vernacularName id="B7715D92F57C1DFF459A0733C2DC918A" language="deu">Knackbeere</vernacularName>
|
||||
Nom
|
||||
<normalizedToken id="71E5C5EE2D8E46E27DB0539967F67661" originalValue="français">francais</normalizedToken>
|
||||
:
|
||||
<vernacularName id="657764E3805178F8FFE4707C7A84A986" language="fra">Fraisier vert</vernacularName>
|
||||
Nome italiano:
|
||||
<vernacularName id="C8C0D7A36F6A6D845A2213AE5B368077" language="ita">Fragola verde</vernacularName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="0BB232ED7E74F193AB885944A9AE146B" type="reference_group">
|
||||
<paragraph id="664DE0B9B3BC42FE213D4BDA559C98E5">
|
||||
<normalizedToken id="28BC61FEF6017B06D5385B80B8DE95C4" originalValue="Übereinstimmung">Uebereinstimmung</normalizedToken>
|
||||
mit anderen Referenzwerken
|
||||
</paragraph>
|
||||
<paragraph id="D7100594B6C41A942C80B8F042611E5A">
|
||||
<table id="53491847EB1C914C4E85F1C1AFCDF87D" class="table table-condensed" inLine="true">
|
||||
<tbody id="5861AD92EF2AC5F4139239B0D237678C">
|
||||
<tr id="5185E3A892873BDDD47884436060F8E2">
|
||||
<th id="28C170B036636E5AD9FEF1506739403D" width="80px">Relation</th>
|
||||
<th id="00B15A6D981B606EC6A916347FC3EBF2">Nom</th>
|
||||
<th id="ED08F4A29D812C3939ED5CBD0F73FA1C">Referenzwerke</th>
|
||||
<th id="A60AA5FD3A2992CF17DD08247EAE2103" width="90px">No</th>
|
||||
</tr>
|
||||
<tr id="E3407E594F602A8354E56F847F19AE72">
|
||||
<td id="DC583D0AA13E627F538E0D7D3B5B8DAB" class="taxon-relation">=</td>
|
||||
<td id="BE5E4E88E7BAC96040946C769B18FC74">
|
||||
<taxonomicName id="358F939BB2B43D36BD78761F66E059AB" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="117E2D75BB02C56E6C4855F565E748B3">
|
||||
<treatmentCitation id="C4A422C42C7DB4AE31A2C2410D9446B9">
|
||||
<bibRefCitation id="4AA6E58F3E11A77291E9768EE0E167FB" author="Juillerat, P. & Bäumler, B. & Bornand, C. & Gygax, A. & Jutzi, M. & Möhl, A. & Nyffeler, R. & Sager, L. & Santiago, H. & Eggenberg, S." publicationUrl="https://doi.org/10.5281/zenodo.10680266" publisher="Info Flora" refString="Juillerat, P., Bäumler, B., Bornand, C., Gygax, A., Jutzi, M., Möhl, A., Nyffeler, R., Sager, L., Santiago, H., and Eggenberg, S. (2017). Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera. Info Flora. DOI: https://doi.org/10.5281/zenodo.10680266" title="Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera" year="2017">Checklist 2017</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="ADBD302453471A4523357709E55A4E4C">173900</td>
|
||||
</tr>
|
||||
<tr id="19D9AC5D7A1F65516AA8775CA7F1C8CD">
|
||||
<td id="1298DA432E43B26F31D8BAFAB15B6FCE" class="taxon-relation">=</td>
|
||||
<td id="BCE34BF291B3355B953013B4ED5D3803">
|
||||
<taxonomicName id="4806CF875A0A7B9F33C561E7A6347BD0" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="5EFCBDB69E6BBA228170EFA8993D9830">
|
||||
<treatmentCitation id="FA340D59BD528001D1D5EA1118EC6B99">
|
||||
<bibRefCitation id="803A67301115BF3F95CC09833705FA46">Flora Helvetica 2001</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="D947E02F6C68E1177B2F1AA8F71CC395">974</td>
|
||||
</tr>
|
||||
<tr id="551C0C5198AE7DBB26CF16CE6A918989">
|
||||
<td id="3DD74E5137B80E3638E92D1164BEBD77" class="taxon-relation">=</td>
|
||||
<td id="1CAE4BBE149892127A08A38D61A48EC3">
|
||||
<taxonomicName id="A280DE2BE2241077B2617D2C15D5A0DC" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="2D0D14A9A9C8ECFD13ADA939556F5698">
|
||||
<treatmentCitation id="5FDE1F65EEEA5A2930AFC5D6C2A0A01C">
|
||||
<bibRefCitation id="C774FC97D4005F4C20CE076CC8A6F07B">Flora Helvetica 2012</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="CED27526F3B182C42DE38601E79B3FC6">450</td>
|
||||
</tr>
|
||||
<tr id="FCE7AB15D67B0B25A836361343C118B2">
|
||||
<td id="55F4BCEB2950C73F418E624F3646FEE5" class="taxon-relation">=</td>
|
||||
<td id="B80D805C42C591FA60D04C5ECEEDF55B">
|
||||
<taxonomicName id="20E235CF2F37800CB160E5F5566A4BA5" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="1DCC897E36AAB917CFA1FABB00B184C5">
|
||||
<treatmentCitation id="97C5E7DBB52DCE62F36CE46EFB9B183A" httpUri="http://treatment.plazi.org/id/AF76ED02984606A31EFA8781A9F17FB2">
|
||||
<bibRefCitation id="1E7086872CA4001FE591003B641D2FA7">Flora Helvetica 2018</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="85092FAA6EDA1C7E7981AA86A4CAB3AD">450</td>
|
||||
</tr>
|
||||
<tr id="06F1B70019DF8070E9DA7410A0E7C7DC">
|
||||
<td id="689651980DF0FF11D224905B2732A7C2" class="taxon-relation">=</td>
|
||||
<td id="2E34C46D18844512A2B365E16B34AC7D">
|
||||
<taxonomicName id="FBAF8C442CE81986FCCC166B20EDC060" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="39E984FB7991417D5070B67959FACB94">
|
||||
<treatmentCitation id="CB0F9A76BCC1174F997ACBA8CA867407">
|
||||
<bibRefCitation id="F6C68CC1B2F1DC97C3AA219D72DC04F9">Index synonymique 1996</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="0C1E6E7B54FF40DFC80678DB1C72699F">173900</td>
|
||||
</tr>
|
||||
<tr id="1C3B354D962EC4A340C15D422164B483">
|
||||
<td id="7441983FD6924E439DBAD2C0A9013CD8" class="taxon-relation">=</td>
|
||||
<td id="3C76B180291F6D3B9FB23E515C446BC7">
|
||||
<taxonomicName id="C828CD99BAA23C0674E1C4ECADEB9041" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="0E318B98647F2E90A49C029B06BA33B6">
|
||||
<treatmentCitation id="D5206E7D313289669C69BFCAABD9D4EC">
|
||||
<bibRefCitation id="B7DC8F92FA17FE3CACA54D9013D92A4D">Landolt 1977</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="3EEE72168520D66F1E48F36F62E3AB33">1567</td>
|
||||
</tr>
|
||||
<tr id="82BC430A1763E9DB76A2B22CCEE640FF">
|
||||
<td id="DCA350F769212B715B23A4E8FEA1DF56" class="taxon-relation">=</td>
|
||||
<td id="9A526A77AD0EB5771AE58CFE4984F702">
|
||||
<taxonomicName id="6841F5CC945DA3337A39E6BA243BE61F" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="E01A953DC07FDADB4B3445E6A9AF0006">
|
||||
<treatmentCitation id="E50F7077AD08AB6CA65AB94C560CEE33">
|
||||
<bibRefCitation id="AFB1EBCA78CE17166B44FFBF84DA3022">Landolt 1991</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="72973C1D7A2252B8F464F9A9BFDA098F">1310</td>
|
||||
</tr>
|
||||
<tr id="B4579548CFE96803640F02CC0915569F">
|
||||
<td id="6EFF8BF5FFDEB71C9064912E2A8BD324" class="taxon-relation">=</td>
|
||||
<td id="8FED9E76F527CDBDB790514BAA97D1CA">
|
||||
<taxonomicName id="D945BA05E375A817C33093A2C0A97BB1" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="3C81B1CD3E8718B785A67B9933F39766">
|
||||
<treatmentCitation id="AE616BD594BDAA0787F67DC632F38DE5">
|
||||
<bibRefCitation id="5939625887D32DABEA1D5D7EBD869633">SISF/ISFS 2</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="56D12A85C9DC49EC465571362AEE7192">173900</td>
|
||||
</tr>
|
||||
<tr id="A84EBC9621208D13ECBF2F0F2BF40054">
|
||||
<td id="8E8C0A37B71485A0E0374C2DFFA6289D" class="taxon-relation">=</td>
|
||||
<td id="3122439413530047FFF3857F8F157111">
|
||||
<taxonomicName id="0B0049864A62C968B8661C018881D5EF" authority="Duchesne" authorityName="Duchesne" class="Magnoliopsida" family="Rosaceae" genus="Fragaria" kingdom="Plantae" order="Rosales" phylum="Tracheophyta" rank="species" species="viridis">Fragaria viridis Duchesne</taxonomicName>
|
||||
</td>
|
||||
<td id="DA88DB6CB9AF709233EB222718A75AE1">
|
||||
<treatmentCitation id="820FD18E5D991364D6E911121F365AFB">
|
||||
<bibRefCitation id="C27AEB9B740F3400DF9C06FE9A12FA4A">Welten & Sutter 1982</bibRefCitation>
|
||||
</treatmentCitation>
|
||||
</td>
|
||||
<td id="E82C9CD70158B6206A31FF48ABC9A713">743</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</paragraph>
|
||||
<paragraph id="CD86323EBFA76C505DCB080FB8260DEE">
|
||||
<tableNote id="5612838742DFC3B5A70F093C30A2A8B9">
|
||||
= Taxon stimmt mit akzeptiertem Taxon
|
||||
<normalizedToken id="3EAE1AC74159DE78784825FDD984AFCD" originalValue="überein">ueberein</normalizedToken>
|
||||
(
|
||||
<bibRefCitation id="EDD371E62E165D6241DF3BD4DEC9601E" author="Juillerat, P. & Bäumler, B. & Bornand, C. & Gygax, A. & Jutzi, M. & Möhl, A. & Nyffeler, R. & Sager, L. & Santiago, H. & Eggenberg, S." publicationUrl="https://doi.org/10.5281/zenodo.10680266" publisher="Info Flora" refString="Juillerat, P., Bäumler, B., Bornand, C., Gygax, A., Jutzi, M., Möhl, A., Nyffeler, R., Sager, L., Santiago, H., and Eggenberg, S. (2017). Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera. Info Flora. DOI: https://doi.org/10.5281/zenodo.10680266" title="Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera" year="2017">Checklist 2017</bibRefCitation>
|
||||
) <Taxon ist im akzeptierten Taxon (
|
||||
<bibRefCitation id="BA141364E0793AD20AFA9D4AC421B564" author="Juillerat, P. & Bäumler, B. & Bornand, C. & Gygax, A. & Jutzi, M. & Möhl, A. & Nyffeler, R. & Sager, L. & Santiago, H. & Eggenberg, S." publicationUrl="https://doi.org/10.5281/zenodo.10680266" publisher="Info Flora" refString="Juillerat, P., Bäumler, B., Bornand, C., Gygax, A., Jutzi, M., Möhl, A., Nyffeler, R., Sager, L., Santiago, H., and Eggenberg, S. (2017). Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera. Info Flora. DOI: https://doi.org/10.5281/zenodo.10680266" title="Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera" year="2017">Checklist 2017</bibRefCitation>
|
||||
) enthalten> Taxon
|
||||
<normalizedToken id="6FC4DC1BD6CE18D75B8B780A1ECD5663" originalValue="enthält">enthaelt</normalizedToken>
|
||||
(neben anderen) auch das akzeptierte Taxon (
|
||||
<bibRefCitation id="C42BA3794D2113E2190B7F872C4410FA" author="Juillerat, P. & Bäumler, B. & Bornand, C. & Gygax, A. & Jutzi, M. & Möhl, A. & Nyffeler, R. & Sager, L. & Santiago, H. & Eggenberg, S." publicationUrl="https://doi.org/10.5281/zenodo.10680266" publisher="Info Flora" refString="Juillerat, P., Bäumler, B., Bornand, C., Gygax, A., Jutzi, M., Möhl, A., Nyffeler, R., Sager, L., Santiago, H., and Eggenberg, S. (2017). Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera. Info Flora. DOI: https://doi.org/10.5281/zenodo.10680266" title="Checklist 2017 der Gefässpflanzenflora der Schweiz / de la flore vasculaire de la Suisse / della flora vascolare della Svizzera" year="2017">Checklist 2017</bibRefCitation>
|
||||
)
|
||||
</tableNote>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="F9FDFAF028F63AC9F3004A0191CD8855" type="conservation">
|
||||
<paragraph id="BDDE0BC5C3715831DAC9647B5D2F10ED">
|
||||
<heading id="B6CA349952D4E6D45C3F2890B382AB85">Status Indigenat</heading>
|
||||
: Indigen
|
||||
</paragraph>
|
||||
<paragraph id="A250D96DC1137E90266A01DDFA6D0023">
|
||||
<emphasis id="44C2A58317930D8C0BF43158BB2DF761" bold="true">
|
||||
<heading id="DC767D44F5940766DAF911792F02223D">
|
||||
Liste der
|
||||
<normalizedToken id="6D3CB7FADBCC3B7BBF7ABB7894A82BB1" originalValue="gefährdeten">gefaehrdeten</normalizedToken>
|
||||
Pflanzen IUCN
|
||||
</heading>
|
||||
(nach
|
||||
<bibRefCitation id="6DE1FBC708648BF1455164C35A036B27" author="Walter, K.S. & Gillett, H.J." location="Gland, Switzerland and Cambridge, UK" publicationUrl="https://doi.org/10.5962/bhl.title.44833" publisher="IUCN" refString="Walter, K.S. and Gillett, H.J. (editors). 1998. 1997 IUCN Red List of Threatened Plants. IUCN, Gland, Switzerland and Cambridge, UK. DOI: https://doi.org/10.5962/bhl.title.44833" title="IUCN Red List of Threatened Plants" year="1997">Walter & Gillett 1997</bibRefCitation>
|
||||
):
|
||||
</emphasis>
|
||||
Nein
|
||||
</paragraph>
|
||||
<paragraph id="09C8397B209EB40BFAE7E2DD8B94B81D">
|
||||
<heading id="98F491426FE8A9EDEA128339E97990A6">Status Rote Liste national 2016</heading>
|
||||
</paragraph>
|
||||
<paragraph id="290E5C46161FECE798DCCBE477E77D90">
|
||||
<heading id="F23E32B7193B3EDB0811C8F55F72604D">Status IUCN</heading>
|
||||
: Potenziell
|
||||
<normalizedToken id="5AE688E5F0B7DC6831DB422477A6FFFF" originalValue="gefährdet">gefaehrdet</normalizedToken>
|
||||
</paragraph>
|
||||
<paragraph id="BD946948CB5C44DBDECF92F9E4A1BC41">
|
||||
<heading id="7CBAE4B28258081F4422E775C6C4C577">
|
||||
<normalizedToken id="0FFC0D0AE6B6DE21C1FA4E2919B19BDA" originalValue="Zusätzliche">Zusaetzliche</normalizedToken>
|
||||
Informationen
|
||||
</heading>
|
||||
Kriterien IUCN: A3c; B2b(iii,iv)
|
||||
</paragraph>
|
||||
<paragraph id="9F2CB23FD8A0806D4507681E861EDF83">
|
||||
<heading id="6F48A45362135BF442E47DFB1837AD15">Status Rote Liste regional 2019</heading>
|
||||
</paragraph>
|
||||
<paragraph id="DDFCF0BFE0D8363304DA694A82A0DBEB">
|
||||
<table id="E88D6C7725F24E47F90F0FDDD44673D4" class="table table-condensed" inLine="true">
|
||||
<tbody id="4335DF6052DE578E0E48269C4D9099C0">
|
||||
<tr id="D64650FE2741E8E6B2AE904C4FAB03F9">
|
||||
<th id="0EA0499A63F1A0B4EA4CF40A36F6BFBE">Biogeografische Regionen</th>
|
||||
<th id="CF525648E2754B37163616A14FCBB357">Status</th>
|
||||
<th id="FA76C16A025DCDDA719318DEFB2ED106">Kriterien IUCN</th>
|
||||
</tr>
|
||||
<tr id="779F3CAB18127788FDE9FC928722606A">
|
||||
<td id="565A2C8E9B0F9B319475B8F0349D1D26" class="regional_status">Jura (JU)</td>
|
||||
<td id="2BAE6102EB8A06FF166CB663636E2AF5">
|
||||
potenziell
|
||||
<normalizedToken id="119449AAAA0EFFFA4267C119E2870878" originalValue="gefährdet">gefaehrdet</normalizedToken>
|
||||
(Near Threatened)
|
||||
</td>
|
||||
<td id="BFCD1FB0C58BE70E895E60D4F175BB64">A3c; B2b(iii)</td>
|
||||
</tr>
|
||||
<tr id="0D94126896D591AB59F50BD0960B69D8">
|
||||
<td id="CC183F169AA6AD88BCF4D9B88776760D" class="regional_status">Mittelland (MP)</td>
|
||||
<td id="51B31F899D8F3C2ACA3F33041648FAA5">verletzlich (Vulnerable)</td>
|
||||
<td id="3E46267F77695044719878462738373E">A3c</td>
|
||||
</tr>
|
||||
<tr id="F94073E7C640BC174EFFC4258C991622">
|
||||
<td id="2A2BE68172C94D53C68DBA22C8C37525" class="regional_status">Alpennordflanke (NA)</td>
|
||||
<td id="F4C853732AC788337007CB628A034520">verletzlich (Vulnerable)</td>
|
||||
<td id="121057CF680690CCEE947A0FFEB9E486">A3c</td>
|
||||
</tr>
|
||||
<tr id="F7AC0B200CCC16D1AD50EB1B76BF5305">
|
||||
<td id="1FBCD57F18E0A52F9D9E8561A551FD47" class="regional_status">
|
||||
<normalizedToken id="2AEFCEC37C8CAC63008674883CECE91F" originalValue="Alpensüdflanke">Alpensuedflanke</normalizedToken>
|
||||
(SA)
|
||||
</td>
|
||||
<td id="075157C8993BFB557874A5188D00FBD5">
|
||||
potenziell
|
||||
<normalizedToken id="7E5311EB919120191D1C36963F5FED51" originalValue="gefährdet">gefaehrdet</normalizedToken>
|
||||
(Near Threatened)
|
||||
</td>
|
||||
<td id="8CE6F42F252656F80F706FB851B83C55">A3c; B2b(iii)</td>
|
||||
</tr>
|
||||
<tr id="B0B600AA7644438C17DBF7EEED9E2111">
|
||||
<td id="E5E2082DC241ACD32D3178D1CFD60CAF" class="regional_status">
|
||||
<normalizedToken id="68AFFD4EC76ADA8D5F04D14085FCBDBA" originalValue="Östliche">Oestliche</normalizedToken>
|
||||
Zentralalpen (EA)
|
||||
</td>
|
||||
<td id="6F2293414D8AFF4D8259B339E7B0526A">
|
||||
potenziell
|
||||
<normalizedToken id="F676481B08844FF92BE6DCB1D6DA0B37" originalValue="gefährdet">gefaehrdet</normalizedToken>
|
||||
(Near Threatened)
|
||||
</td>
|
||||
<td id="70DF8583D69206BEF74C1AFE80C4A15A">B2b(iii,iv)</td>
|
||||
</tr>
|
||||
<tr id="980B35E52E1294A6D705EF8F10072DF8">
|
||||
<td id="E956079C690CB24A2CF3FC0DFD92A02D" class="regional_status">Westliche Zentralalpen (WA)</td>
|
||||
<td id="58A29AB57EB8D569B7BE5324F54DA944">
|
||||
potenziell
|
||||
<normalizedToken id="973C013FA5CCCE48F5826A839114D7B9" originalValue="gefährdet">gefaehrdet</normalizedToken>
|
||||
(Near Threatened)
|
||||
</td>
|
||||
<td id="E4554D4C4C4CF529786DB1D3031952DC">A3c; B2b(iii)</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</paragraph>
|
||||
<paragraph id="BCE8630CCC205D45CE48C1C126DC4A32">
|
||||
<heading id="E917E8AD45C0F80B0821AD55564FB4F0">
|
||||
Status nationale
|
||||
<normalizedToken id="5554F8EE14957098A37B3F28CED66F24" originalValue="Priorität">Prioritaet</normalizedToken>
|
||||
/Verantwortung
|
||||
</heading>
|
||||
</paragraph>
|
||||
<paragraph id="DDEF308B62FECCAC92C9D33C68391B6C">
|
||||
<table id="B3CFC9EA7E158D87670D0D8EDDB0714E" class="table" inLine="true">
|
||||
<tr id="4972BDB8AB94207728EAE49AEFA5C995">
|
||||
<td id="C7804A606E79EC064380566832E0CB45">
|
||||
Keine nationale
|
||||
<normalizedToken id="E084D77E59592C08FFDAA5E7781D14FE" originalValue="Priorität">Prioritaet</normalizedToken>
|
||||
oder internationale Verantwortung
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</paragraph>
|
||||
<paragraph id="7BA5E5C5C7701C0473CA2DA355579FF5">
|
||||
<heading id="165F9EF317E5A4A8737DAC18804662CC">Schutzstatus</heading>
|
||||
</paragraph>
|
||||
<paragraph id="EDA0A4CE50D1DE51092A6D3957CF6BF1">
|
||||
<table id="F6D7F13F61F83FD73287DBE8306A4453" class="table table-condensed" inLine="true">
|
||||
<tbody id="71BBF50E99513E152813D571B5C5EC93">
|
||||
<tr id="63ECA5D13DC075F43E409053FA1A3002">
|
||||
<td id="9FB8D70BAE9E37DD851206D89A0D59FF" colspan="2">
|
||||
<emphasis id="0F950D92D90370ECA6CF9D50B1FB93AA" bold="true">International (Berner Konvention)</emphasis>
|
||||
</td>
|
||||
<td id="E027F7C24DD87B372AB82AF1401750E5" width="90px">Nein</td>
|
||||
</tr>
|
||||
<tr id="CADBD802C63054092D06A3B0F4BB3D13">
|
||||
<td id="33797AA76D7313EBD18B609060CD0928">
|
||||
<emphasis id="032AC34EDB5049CE32B76B3DE81E55E4" bold="true">VD</emphasis>
|
||||
</td>
|
||||
<td id="2BDB7911418107BF52F740F3DC1AB652" width="150px">
|
||||
<normalizedToken id="86F5BC5BF3DF04E7A2863805A93C6FE7" originalValue="Vollständig">Vollstaendig</normalizedToken>
|
||||
<normalizedToken id="52D77C1F1B5235D4004A128610142EDB" originalValue="geschützt">geschuetzt</normalizedToken>
|
||||
</td>
|
||||
<td id="EA9053C41686A133B8444FDFF8D85E97">(02.03.2005)</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</paragraph>
|
||||
<paragraph id="73B3760EC58A0495E6AB7E638EC93749">
|
||||
<table id="2659ACC7BFBA11D8D2CB2520F6E5DB09" class="table table-condensed" inLine="true">
|
||||
<tr id="839C00033D8DAB3F491FDD8123B40E1B">
|
||||
<tbody id="47214B2F523E8977B863DB85FE272F29">
|
||||
<td id="208AE150EB5623F3D985729759D01597">
|
||||
<emphasis id="49D3652AEE8F896AF6A51C52F0FA6544" bold="true">Schweiz</emphasis>
|
||||
</td>
|
||||
<td id="DFF72521B8AE136479A525B7F354B858" width="150px">--</td>
|
||||
</tbody>
|
||||
</tr>
|
||||
</table>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="7B6C9E193228851A46E56EA58843B8EE" type="multiple">
|
||||
<paragraph id="E64943A6A8CB33188D3696970410E5C3">
|
||||
Erhalten/
|
||||
<normalizedToken id="F6284F4E9FB5466A201E88FA757B4638" originalValue="Fördern">Foerdern</normalizedToken>
|
||||
In-situ Massnahmen Close
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
906
data/4C/FF/A2/4CFFA2D7DEBB58A09186E3DA99DD4CC7.xml
Normal file
906
data/4C/FF/A2/4CFFA2D7DEBB58A09186E3DA99DD4CC7.xml
Normal file
|
|
@ -0,0 +1,906 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.866.35394" ID-GBIF-Dataset="4f3c8ff0-c68c-4b0e-a2bd-cab653d0f8fe" ID-PMC="PMC6669213" ID-Pensoft-Pub="1313-2970-866-1" ID-Pensoft-UUID="ECA044C40A7255A0B8F1935457F2E629" ID-PubMed="31388320" ID-ZooBank="EDAEA22F45824B1DB5CB46302E7AA43F" ModsDocID="1313-2970-866-1" checkinTime="1564043551668" checkinUser="pensoft" docAuthor="Tauber, Catherine A." docDate="2019" docId="4CFFA2D7DEBB58A09186E3DA99DD4CC7" docLanguage="en" docName="ZooKeys 866: 1-18" docOrigin="ZooKeys 866" docSource="http://dx.doi.org/10.3897/zookeys.866.35394" docTitle="Nothochrysa ehrenbergi Tauber, sp. nov." docType="treatment" docUuid="528B2ED3-82DF-4A61-8DF2-DD9DD5D77FED" docUuidSource="ZooBank" docVersion="5" lastPageNumber="13" masterDocId="456EE02CFFB9FFED2E1AFF84754DFFF1" masterDocTitle="South American Nothochrysinae (Neuroptera, Chrysopidae): I. Description of Nothochrysa ehrenbergi sp. nov." masterLastPageNumber="18" masterPageNumber="1" pageNumber="4" updateTime="1668167617226" updateUser="ExternalLinkService">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>South American Nothochrysinae (Neuroptera, Chrysopidae): I. Description of Nothochrysa ehrenbergi sp. nov.</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Tauber, Catherine A.</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>ZooKeys</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2019</mods:date>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>866</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>1</mods:start>
|
||||
<mods:end>18</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/zookeys.866.35394</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.866.35394</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">1313-2970-866-1</mods:identifier>
|
||||
<mods:identifier type="ZooBank">EDAEA22F45824B1DB5CB46302E7AA43F</mods:identifier>
|
||||
<mods:identifier type="Pensoft-UUID">ECA044C40A7255A0B8F1935457F2E629</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment ID-GBIF-Taxon="159292916" LSID="urn:lsid:zoobank.org:act:528B2ED3-82DF-4A61-8DF2-DD9DD5D77FED" httpUri="http://treatment.plazi.org/id/4CFFA2D7DEBB58A09186E3DA99DD4CC7" lastPageId="12" lastPageNumber="13" pageId="3" pageNumber="4">
|
||||
<subSubSection pageId="3" pageNumber="4" type="nomenclature">
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
<taxonomicName LSID="4cffa2d7-debb-58a0-9186-e3da99dd4cc7" authority="Tauber" class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="ehrenbergi">Nothochrysa ehrenbergi Tauber</taxonomicName>
|
||||
<taxonomicNameLabel pageId="3" pageNumber="4">sp. nov.</taxonomicNameLabel>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="3" pageNumber="4" type="type material">
|
||||
<paragraph pageId="3" pageNumber="4">Type material.</paragraph>
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
The
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">holotype</emphasis>
|
||||
(a male) is in the California Academy of Sciences (CAS). Its labels read: [1] "CHILE: Nuble [
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
] / Las Trancas / 20/25-II-1980 / Luis E. Pena [
|
||||
<normalizedToken originalValue="Peña]”">Pena]"</normalizedToken>
|
||||
; [2] "
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Suarius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Suarius" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="genus">Suarius</taxonomicName>
|
||||
/
|
||||
<taxonomicName lsidName="flavescens" pageId="3" pageNumber="4" rank="species" species="flavescens">flavescens</taxonomicName>
|
||||
/ (Blanchard) / det. N. Penny, 1988"; [3] "HOLOTYPE /
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="genus">Nothochrysa</taxonomicName>
|
||||
/
|
||||
<taxonomicName lsidName="ehrenbergi" pageId="3" pageNumber="4" rank="species" species="ehrenbergi">ehrenbergi</taxonomicName>
|
||||
</emphasis>
|
||||
/
|
||||
<bibRefCitation pageId="3" pageNumber="4" refId="B22">Tauber 2019</bibRefCitation>
|
||||
" (
|
||||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Male genitalia, cleared, and specimen labels (Penny's identification label not included) (a) gonarcal complex, dorsal (b) gonarcal complex, frontal, tilted (c) gonarcal complex, posterior (d) gonarcal complex, lateral (e) hypandrium internum (f) labels. c comes g. a. gonarcal apodeme g. b. gonarcal bridge g. p. gonarcal process gse gonosetae on membranous gonosaccus mu mediuncus." figureDoi="10.3897/zookeys.866.35394.figure7" httpUri="https://binary.pensoft.net/fig/319512" pageId="3" pageNumber="4">Fig. 7f</figureCitation>
|
||||
).
|
||||
</paragraph>
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
This single specimen was found in the CAS collection among the unidentified chrysopids. A subsequent search of the collection did not yield additional examples. Norm
|
||||
<normalizedToken originalValue="Penny’s">Penny's</normalizedToken>
|
||||
ID label remains on the specimen but was not included in
|
||||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Male genitalia, cleared, and specimen labels (Penny's identification label not included) (a) gonarcal complex, dorsal (b) gonarcal complex, frontal, tilted (c) gonarcal complex, posterior (d) gonarcal complex, lateral (e) hypandrium internum (f) labels. c comes g. a. gonarcal apodeme g. b. gonarcal bridge g. p. gonarcal process gse gonosetae on membranous gonosaccus mu mediuncus." figureDoi="10.3897/zookeys.866.35394.figure7" httpUri="https://binary.pensoft.net/fig/319512" pageId="3" pageNumber="4">Fig. 7f</figureCitation>
|
||||
. It refers to
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Suarius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Suarius flavescens" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="flavescens">
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">Suarius flavescens</emphasis>
|
||||
</taxonomicName>
|
||||
, a species that now is placed in
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Chrysopodes" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Chrysopodes (Neosuarius)" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="subGenus" subGenus="Neosuarius">Chrysopodes (Neosuarius)</taxonomicName>
|
||||
, and with which the new species shares similar coloration and appearance (see
|
||||
<bibRefCitation DOI="https://doi.org/10.3897/zookeys.44.387" author="Tauber, CA" journalOrPublisher="Records of the Indian Museum, Calcutta" pageId="14" pageNumber="15" refId="B21" refString="Tauber, CA, 2010. . https://doi.org/10.3897/zookeys.44.387" url="https://doi.org/10.3897/zookeys.44.387" year="2010">Tauber 2010</bibRefCitation>
|
||||
).
|
||||
</paragraph>
|
||||
<paragraph pageId="3" pageNumber="4">When discovered, the specimen was discolored, and its wings were loosely folded around its body. One pair of wings was removed for study and is now attached with water-soluble hide glue to a card mounted on the pin below the specimen. The other pair fell off and was reattached to the specimen with hide glue. The abdomen was cleared and dissected; it is preserved in glycerin within a genitalia vial attached to the pin.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection lastPageId="6" lastPageNumber="7" pageId="3" pageNumber="4" type="diagnosis">
|
||||
<paragraph pageId="3" pageNumber="4">Diagnosis.</paragraph>
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
Subfamily: This specimen exhibits the following diagnostic features of adult
|
||||
<taxonomicName lsidName="" pageId="3" pageNumber="4" rank="subfamily" subfamily="Nothochrysinae">Nothochrysinae</taxonomicName>
|
||||
(cf.:
|
||||
<bibRefCitation pageId="3" pageNumber="4" refId="B25">Tjeder 1966</bibRefCitation>
|
||||
, as
|
||||
<taxonomicName lsidName="" pageId="3" pageNumber="4" rank="subfamily" subfamily="Dictyochrysinae">Dictyochrysinae</taxonomicName>
|
||||
;
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation author="Brooks, SJ" journalOrPublisher="Bulletin of the British Museum of Natural History, Entomology" pageId="13" pageNumber="14" pagination="117 - 286" refId="B8" refString="Brooks, SJ, Barnard, PC, 1990. The green lacewings of the world: a generic review (Neuroptera: Chrysopidae). . Bulletin of the British Museum of Natural History, Entomology 59: 117 - 286" title="The green lacewings of the world: a generic review (Neuroptera: Chrysopidae)." volume="59" year="1990">Brooks and Barnard 1990</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation author="Breitkreuz, LCV" journalOrPublisher="PhD Thesis, University of Kansas, Lawrence" pageId="13" pageNumber="14" refId="B6" refString="Breitkreuz, LCV, 2018. Systematics and evolution of the family Chrysopidae (Neuroptera), with an emphasis on their morphology. . PhD Thesis, University of Kansas, Lawrence" title="Systematics and evolution of the family Chrysopidae (Neuroptera), with an emphasis on their morphology." year="2018">Breitkreuz 2018</bibRefCitation>
|
||||
): (i) wing-coupling mechanism consisting of a large jugal lobe on the forewing (here, folded ventrally;
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="3" pageNumber="4">Fig. 1</figureCitation>
|
||||
) and a frenulum on the hindwing (here, broken off); (ii) base of the forewing without tympanal organ (
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="3" pageNumber="4">Fig. 1</figureCitation>
|
||||
); (iii) forewing (and hindwing) with stem of the media extending basally, adjacent to the radius and not fused with it (
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="3" pageNumber="4">Fig. 1a, b</figureCitation>
|
||||
; cf.
|
||||
<bibRefCitation DOI="https://doi.org/10.1206/3890.1" author="Breitkreuz, LCV" journalOrPublisher="American Museum Novitates" pageId="13" pageNumber="14" pagination="1 - 44" refId="B7" refString="Breitkreuz, LCV, Winterton, SL, Engel, MS, 2017. Wing tracheation in Chrysopidae and other Neuropterida (Insecta): a resolution of the confusion about vein fusion. . American Museum Novitates 3890: 1 - 44" title="Wing tracheation in Chrysopidae and other Neuropterida (Insecta): a resolution of the confusion about vein fusion." url="https://doi.org/10.1206/3890.1" volume="3890" year="2017">Breitkreuz et al. 2017</bibRefCitation>
|
||||
: 32); (iv) first intramedian cell triangular, with boundaries formed by the MA, the MP, and the crossvein 1ma-mp ("pseudotriangular", sensu
|
||||
<bibRefCitation DOI="https://doi.org/10.1206/3890.1" author="Breitkreuz, LCV" journalOrPublisher="American Museum Novitates" pageId="13" pageNumber="14" pagination="1 - 44" refId="B7" refString="Breitkreuz, LCV, Winterton, SL, Engel, MS, 2017. Wing tracheation in Chrysopidae and other Neuropterida (Insecta): a resolution of the confusion about vein fusion. . American Museum Novitates 3890: 1 - 44" title="Wing tracheation in Chrysopidae and other Neuropterida (Insecta): a resolution of the confusion about vein fusion." url="https://doi.org/10.1206/3890.1" volume="3890" year="2017">Breitkreuz et al. 2017</bibRefCitation>
|
||||
); (v) pseudomedia ill-defined or appearing to merge with inner (not outer) series of gradates (
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="3" pageNumber="4">Fig. 2</figureCitation>
|
||||
); (vi) pseudocubitus appearing to merge with outer series of gradates (
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="3" pageNumber="4">Fig. 2</figureCitation>
|
||||
); (vii) forewing with basal subcostal crossvein present (
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="3" pageNumber="4">Fig. 2</figureCitation>
|
||||
); (viii) second m-cu crossvein stemming from the proximal half of the first intramedian cell (
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="3" pageNumber="4">Fig. 2</figureCitation>
|
||||
); (ix) each flagellomere having five or six whorls of setae (
|
||||
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Head and prothorax (a) head, frontal (b) head and prothorax, dorsal (c) head and prothorax, lateral (d, e) base of antennae, dorsal, lateral (f) flagellar segments, mid antenna." figureDoi="10.3897/zookeys.866.35394.figure3" httpUri="https://binary.pensoft.net/fig/319508" pageId="3" pageNumber="4">Figs 3e</figureCitation>
|
||||
,
|
||||
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Head and prothorax (a) head, frontal (b) head and prothorax, dorsal (c) head and prothorax, lateral (d, e) base of antennae, dorsal, lateral (f) flagellar segments, mid antenna." figureDoi="10.3897/zookeys.866.35394.figure3" httpUri="https://binary.pensoft.net/fig/319508" pageId="3" pageNumber="4">3f</figureCitation>
|
||||
); and (x) anterodorsal surface of the metascutum displaying small, convex protrusion (
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Habitus (a) antenna, head, and thorax, lateral (b) mesothorax, metathorax, dorsal (c) metatarsus, dorsal (d) metatarsus, ventral (e) mesotarsus, lateral. p raised metascutal protuberance l. e. mesoscutellar lobate expansion." figureDoi="10.3897/zookeys.866.35394.figure4" httpUri="https://binary.pensoft.net/fig/319509" pageId="3" pageNumber="4">Fig. 4b</figureCitation>
|
||||
; cf.
|
||||
<bibRefCitation author="Breitkreuz, LCV" journalOrPublisher="PhD Thesis, University of Kansas, Lawrence" pageId="13" pageNumber="14" refId="B6" refString="Breitkreuz, LCV, 2018. Systematics and evolution of the family Chrysopidae (Neuroptera), with an emphasis on their morphology. . PhD Thesis, University of Kansas, Lawrence" title="Systematics and evolution of the family Chrysopidae (Neuroptera), with an emphasis on their morphology." year="2018">Breitkreuz 2018</bibRefCitation>
|
||||
,
|
||||
<bibRefCitation pageId="3" pageNumber="4" refId="B22">Tauber 2019</bibRefCitation>
|
||||
).
|
||||
</paragraph>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="3" pageNumber="4" start="Figure 1" startId="F1">
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
Figure 1.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Venation at base of wings (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">a</emphasis>
|
||||
) left forewing, (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">b</emphasis>
|
||||
) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing.
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">A1, A2, A3</emphasis>
|
||||
first, second, third anal veins
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">Cu</emphasis>
|
||||
cubitus
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">
|
||||
Cu
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">f</emphasis>
|
||||
</emphasis>
|
||||
furcation (division) of cubitus
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">Ju</emphasis>
|
||||
jugal lobe
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">M</emphasis>
|
||||
media
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">MA</emphasis>
|
||||
media anterior
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">m-cu</emphasis>
|
||||
media-cubital crossvein
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">R</emphasis>
|
||||
radius
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">RP</emphasis>
|
||||
radius posterior.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="3" pageNumber="4" start="Figure 2" startId="F2">
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
Figure 2.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Wings with selected features labeled (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">a</emphasis>
|
||||
) left forewing, (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">b</emphasis>
|
||||
) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell.
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">A1, A2, A3</emphasis>
|
||||
first, second, third anal veins
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">CuA, CuP</emphasis>
|
||||
anterior, posterior branches of cubitus
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">icu1</emphasis>
|
||||
,
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">icu3</emphasis>
|
||||
</emphasis>
|
||||
first, third intracubital cells
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">ig</emphasis>
|
||||
inner gradate
|
||||
<emphasis bold="true" italics="true" pageId="3" pageNumber="4">im1, im2</emphasis>
|
||||
first, second intramedian cells
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">Ju</emphasis>
|
||||
jugal lobe
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">MA</emphasis>
|
||||
media anterior
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">MP</emphasis>
|
||||
media posterior
|
||||
<emphasis bold="true" italics="true" pageId="3" pageNumber="4">mcua, mpcua</emphasis>
|
||||
second and third medial cells
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">
|
||||
M
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">f</emphasis>
|
||||
</emphasis>
|
||||
furcation of media
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">og</emphasis>
|
||||
outer gradate
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">Psc</emphasis>
|
||||
pseudocubitus
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">Psm</emphasis>
|
||||
pseudomedia
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">
|
||||
R
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">f</emphasis>
|
||||
</emphasis>
|
||||
furcation of radius
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">RP</emphasis>
|
||||
radius posterior
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">RP1</emphasis>
|
||||
first branch of radius posterior
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">1sc-r</emphasis>
|
||||
first crossvein between subcosta and radius
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">2m-cu</emphasis>
|
||||
second crossvein between media and cubitus.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure3" httpUri="https://binary.pensoft.net/fig/319508" pageId="3" pageNumber="4" start="Figure 3" startId="F3">
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
Figure 3.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Head and prothorax (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">a</emphasis>
|
||||
) head, frontal (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">b</emphasis>
|
||||
) head and prothorax, dorsal (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">c</emphasis>
|
||||
) head and prothorax, lateral (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">d, e</emphasis>
|
||||
) base of antennae, dorsal, lateral
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">(f)</emphasis>
|
||||
flagellar segments, mid antenna.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure4" httpUri="https://binary.pensoft.net/fig/319509" pageId="3" pageNumber="4" start="Figure 4" startId="F4">
|
||||
<paragraph pageId="3" pageNumber="4">
|
||||
Figure 4.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="3" pageNumber="4">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Habitus (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">a</emphasis>
|
||||
) antenna, head, and thorax, lateral (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">b</emphasis>
|
||||
) mesothorax, metathorax, dorsal (
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">c</emphasis>
|
||||
) metatarsus, dorsal
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">(d)</emphasis>
|
||||
metatarsus, ventral
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">(e)</emphasis>
|
||||
mesotarsus, lateral.
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">p</emphasis>
|
||||
raised metascutal protuberance
|
||||
<emphasis bold="true" pageId="3" pageNumber="4">l.e.</emphasis>
|
||||
mesoscutellar lobate expansion.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<paragraph pageId="4" pageNumber="5">
|
||||
<pageBreakToken pageId="4" pageNumber="5" start="start">Genus</pageBreakToken>
|
||||
placement: The Chilean specimen under study here falls into the genus
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="4" pageNumber="5">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
on the basis of the following features of its wings (
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="4" pageNumber="5">Figs 1</figureCitation>
|
||||
,
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="4" pageNumber="5">2</figureCitation>
|
||||
): (i) forewing and hindwing having well developed pseudomedia and pseudocubitus; (ii) forewing and hindwing with two regular series of gradate veins (inner and outer); (iii) intramedian cell of forewing triangular, elongate, occupying approximately half the width between the pseudomedia and pseudocubitus; (iv) RP of forewing with 10 or more branches (
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin 2015</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation author="Breitkreuz, LCV" journalOrPublisher="PhD Thesis, University of Kansas, Lawrence" pageId="13" pageNumber="14" refId="B6" refString="Breitkreuz, LCV, 2018. Systematics and evolution of the family Chrysopidae (Neuroptera), with an emphasis on their morphology. . PhD Thesis, University of Kansas, Lawrence" title="Systematics and evolution of the family Chrysopidae (Neuroptera), with an emphasis on their morphology." year="2018">Breitkreuz 2018</bibRefCitation>
|
||||
: 200). [Note: Some specimens of
|
||||
<taxonomicName lsidName="N. californica" pageId="4" pageNumber="5" rank="species" species="californica">
|
||||
<emphasis italics="true" pageId="4" pageNumber="5">N. californica</emphasis>
|
||||
</taxonomicName>
|
||||
are known to have only eight or nine branches from the RP.]
|
||||
</paragraph>
|
||||
<paragraph lastPageId="6" lastPageNumber="7" pageId="4" pageNumber="5">
|
||||
Species placement: Apart from being the only known
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="4" pageNumber="5">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species reported from South America,
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="4" pageNumber="5" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="4" pageNumber="5">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
is distinguishable from other species of
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="4" pageNumber="5">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
on the basis of a number of wing characters (
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="4" pageNumber="5">Figs 1</figureCitation>
|
||||
,
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="4" pageNumber="5">2</figureCitation>
|
||||
; cf.
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation pageId="4" pageNumber="5" refId="B4">
|
||||
<normalizedToken originalValue="Aspöck">Aspoeck</normalizedToken>
|
||||
et al. 1980
|
||||
</bibRefCitation>
|
||||
<pageBreakToken pageId="5" pageNumber="6" start="start">:</pageBreakToken>
|
||||
figs 154, 155;
|
||||
<bibRefCitation DOI="https://doi.org/10.1080/00379271.2007.10697507" author="Kovanci, B" journalOrPublisher="Annales de la Societe Entomologique de France (NS)" pageId="14" pageNumber="15" pagination="165 - 168" refId="B13" refString="Kovanci, B, Canbulat, S, 2007. A new species of the genus Nothochrysa McLachlan 1868 from northwestern Turkey (Neuroptera: Chrysopidae) with a key to western Palaearctic species. . Annales de la Societe Entomologique de France (NS) 43: 165 - 168" title="A new species of the genus Nothochrysa McLachlan 1868 from northwestern Turkey (Neuroptera: Chrysopidae) with a key to western Palaearctic species." url="https://doi.org/10.1080/00379271.2007.10697507" volume="43" year="2007">Kovanci and Canbulat 2007</bibRefCitation>
|
||||
: fig. 2): (i) the first anal vein is not forked; (ii) the basal subcostal crossvein is slightly distal to the furcation of the radius; (iii) as in most
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="5" pageNumber="6">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species, the first intramedian cell is more wedge shaped
|
||||
<pageBreakToken pageId="6" pageNumber="7" start="start">than</pageBreakToken>
|
||||
truly quadrangular or triangular (i.e., the MA and MP meet basally at a broadly acute angle); and (iv) the third medial cell (directly below
|
||||
<emphasis italics="true" pageId="6" pageNumber="7">im1</emphasis>
|
||||
,
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="6" pageNumber="7">Fig. 2a</figureCitation>
|
||||
) is elongate and extends toward the pseudocubitus well beyond the distal edge of first intramedial cell.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection lastPageId="10" lastPageNumber="11" pageId="6" pageNumber="7" type="description">
|
||||
<paragraph pageId="6" pageNumber="7">Morphological characteristics.</paragraph>
|
||||
<paragraph lastPageId="7" lastPageNumber="8" pageId="6" pageNumber="7">
|
||||
Head (
|
||||
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Head and prothorax (a) head, frontal (b) head and prothorax, dorsal (c) head and prothorax, lateral (d, e) base of antennae, dorsal, lateral (f) flagellar segments, mid antenna." figureDoi="10.3897/zookeys.866.35394.figure3" httpUri="https://binary.pensoft.net/fig/319508" pageId="6" pageNumber="7">Fig. 3</figureCitation>
|
||||
): Width 1.6 mm (including eyes); ratio of head width to eye width = 3.0: 1. Vertex raised, round; surface pitted anteriorly, with few or no setae, lacking prominent posterior fold. Distance between scapes 0.09 mm; distance between tentorial pits 0.36 mm; length of frons (midway between scapes - midway between tentorial pits) 0.33 mm. Frons relatively wide, with broad longitudinal ridge mesally; surface smooth, shiny, slightly rounded below toruli and at insertion of mouthparts; margin above clypeus straight. Clypeus tapering, with rounded sculpturing basally, indented mesally, slightly expanded distally, with distal margin straight to slightly convex; dorsal surface shiny, smooth, sculptured. Labrum about same width as clypeal margin, with small longitudinal ridge mesally; dorsal surface
|
||||
<pageBreakToken pageId="7" pageNumber="8" start="start">sculptured</pageBreakToken>
|
||||
, shiny; distal margin bilobed, bearing numerous long setae distally. Antenna 9.7-9.8 mm long (~0.5
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
length of forewing); scape shorter than wide (0.23 mm long, 0.33 mm wide), lateral margin straight, mesal margin strongly convex, surface with short setae throughout; pedicel 0.17 mm long, 0.13 mm wide, with numerous short setae; flagellum with basal flagellomeres distinct, somewhat elongate (0.12-0.14 mm long, 0.07-0.08 mm wide), midantennal flagellomeres twice as long as broad (0.15 mm long, 0.07 mm wide), basal two flagellomeres with 4-5 partially indistinct whorls of thickset brown setae extending distally, third flagellomere and others distally all with five distinct whorls of thickset, brown setae extending distally, 0.3
|
||||
<normalizedToken originalValue="–0.5×">-0.5x</normalizedToken>
|
||||
width of flagellomere, distal whorl with one or two slender, elongate (~0.75
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
width of flagellomere), pale setae extending laterally.
|
||||
</paragraph>
|
||||
<paragraph lastPageId="8" lastPageNumber="9" pageId="7" pageNumber="8">
|
||||
<emphasis italics="true" pageId="7" pageNumber="8">Head coloration</emphasis>
|
||||
: Scape cream, with reddish spot on distolateral tip; pedicel, flagellum cream, unmarked; thickset setae in whorls mostly brown, elongate setae pale. Vertex cream, possibly tinged red laterally; dorsal torulus yellow to cream, apparently
|
||||
<pageBreakToken pageId="8" pageNumber="9" start="start">unmarked</pageBreakToken>
|
||||
. Frons cream, probably with reddish tinge laterally below torulus; torulus cream, unmarked. Clypeus cream, possibly tinged red laterally; basal, distal margins straight. Genal mark dark red/brown throughout, extending to tentorial pit. Labrum probably cream. Palpomeres probably mostly cream, somewhat darkened distally.
|
||||
</paragraph>
|
||||
<paragraph pageId="8" pageNumber="9">
|
||||
Thorax (
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Habitus (a) antenna, head, and thorax, lateral (b) mesothorax, metathorax, dorsal (c) metatarsus, dorsal (d) metatarsus, ventral (e) mesotarsus, lateral. p raised metascutal protuberance l. e. mesoscutellar lobate expansion." figureDoi="10.3897/zookeys.866.35394.figure4" httpUri="https://binary.pensoft.net/fig/319509" pageId="8" pageNumber="9">Fig. 4</figureCitation>
|
||||
): Cervix not visible. Dorsal thoracic surface with pale longitudinal stripe mesally, probably with broad reddish or brownish stripes or coloration laterally. Prothorax broad, 0.9 mm long, 1.5 mm wide, ratio of length to width = 0.63: 1; pronotum well sclerotized, with textured surface, transverse fold mesally, few or no setae. Legs elongate, slender, probably cream, unmarked, lacking prominent tibial spurs. Tarsus with basal three tarsomeres appearing coalesced, bearing spurs, setae intermixed along undersurface; middle three tarsomeres with expanded lateral lobes bearing spurs, setae in irregular rows; distal tarsomere narrow basally, enlarged distally, bearing numerous elongate, slender, dark setae laterally, distally, terminus bearing pair of claws laterally, large pad mesally; claw amber, with basal enlargement, acute slender hook terminally.
|
||||
</paragraph>
|
||||
<paragraph pageId="9" pageNumber="10">
|
||||
<pageBreakToken pageId="9" pageNumber="10" start="start">Wings</pageBreakToken>
|
||||
(
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="9" pageNumber="10">Figs 1</figureCitation>
|
||||
,
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="9" pageNumber="10">2</figureCitation>
|
||||
,
|
||||
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings, color slightly enhanced to emphasize pattern of vein markings (a) forewing (b) hindwing." figureDoi="10.3897/zookeys.866.35394.figure5" httpUri="https://binary.pensoft.net/fig/319510" pageId="9" pageNumber="10">5</figureCitation>
|
||||
):
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">Forewing</emphasis>
|
||||
18.5 mm long, 6.5 mm wide (at widest point); ratio of length to maximum width = 2.9: 1. Membrane clear, lacking markings; microtrichia present below base of every major vein, pale. Trichosors (sensu
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
: 140-142) absent. Costal area relatively enlarged; tallest costal cell (7th from base of wing) 1.8 mm tall, 2.7
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
width of cell, 0.28
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
height of wing; costal crossveins simple, six before 1sc-r, twelve after 1sc-r and before stigma, one (very small) after stigma, none within stigma. Sc extending into stigma, fading but not appearing to merge with C or RA; no crossveins in stigma; first sc-r crossvein slightly distal to R
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">f</emphasis>
|
||||
, slightly basal to M
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">f</emphasis>
|
||||
; RA with one very short veinlet extending to wing margin after stigma. Radial area between RA and RP with single row of ten closed cells; tallest cell (3rd from base of wing) 0.6
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
as tall as wide. Intramedian cell (
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">im1</emphasis>
|
||||
=
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">mamp1</emphasis>
|
||||
) prominent, elongate, triangular, formed by MA, crossvein 1ma-mp, and two abscissae of MP, occupying approximately half the space between MA and CuA, with M
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">f</emphasis>
|
||||
broadly acute, long sides (MA, MP) roughly parallel for most of span; crossvein 2m-cu proximal to midpoint of
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">im1</emphasis>
|
||||
. Three medial cells present (
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">mcu, mcua, mpcua</emphasis>
|
||||
), second, third of these elongate, with roughly parallel sides; MP merging into Psc well beyond
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">im1</emphasis>
|
||||
. Two series of gradate veins parallel basally, diverging slightly medially, converging distally. Approximately nine inner gradates in regular, sinuous series, continuing from Psm in zigzag pattern across center of wing; approximately ten outer gradates continuing from Psc in regular, upturned series. RP with nine marginal forks beyond Psc. Cu furcated after m-cu crossvein, with two closed, four open
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">icu</emphasis>
|
||||
cells. CuA with three furcations before meeting MP; CuP furcated below
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">icu2</emphasis>
|
||||
; thus cubital trace having five terminal veinlets (three from CuA, two from CuP). A1, A2, A3 simple, unforked; a1-a2 and a2-a3 crossveins present; distal part of
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">a3</emphasis>
|
||||
and jugal lobe with dense patch of microtrichia. Jugal lobe large, quadrate, folded beneath third anal cell, without internal vein; margin bearing long, slender setae basally.
|
||||
</paragraph>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure5" httpUri="https://binary.pensoft.net/fig/319510" pageId="9" pageNumber="10" start="Figure 5" startId="F5">
|
||||
<paragraph pageId="9" pageNumber="10">
|
||||
Figure 5.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="9" pageNumber="10" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Wings, color slightly enhanced to emphasize pattern of vein markings (
|
||||
<emphasis bold="true" pageId="9" pageNumber="10">a</emphasis>
|
||||
) forewing (
|
||||
<emphasis bold="true" pageId="9" pageNumber="10">b</emphasis>
|
||||
) hindwing.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<paragraph pageId="9" pageNumber="10">
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">Hindwing</emphasis>
|
||||
: 12.4 mm long, 4.2 mm wide. Costal area not enlarged; at least 15 c-sc crossveins before stigma, none within or after stigma. Radial area containing single row of eleven closed cells between RA and RP. Gradate veins in two roughly parallel series, slightly divergent distally; approximately seven inner gradates beyond Psm; approximately 11 outer gradates beyond Psc. Psc with nine marginal forks. MA aligned with RP for approximately one-third length of
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">im1</emphasis>
|
||||
. CuA with two furcations before meeting MP; CuP undivided; thus, wing margin having three cubital veinlets (two from CuA, one from CuP). A1, A2, A3 simple, unforked; a1-a2 and a2-a3 crossveins present. Jugal lobe without internal vein, basal margin bearing long, slender setae.
|
||||
</paragraph>
|
||||
<paragraph pageId="9" pageNumber="10">
|
||||
<emphasis italics="true" pageId="9" pageNumber="10">Coloration of forewing, hindwing</emphasis>
|
||||
(
|
||||
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings, color slightly enhanced to emphasize pattern of vein markings (a) forewing (b) hindwing." figureDoi="10.3897/zookeys.866.35394.figure5" httpUri="https://binary.pensoft.net/fig/319510" pageId="9" pageNumber="10">Fig. 5</figureCitation>
|
||||
): Membrane clear, somewhat glossy. Stigma slightly opaque, without coloration. Costal, subcostal, radial veins brownish; all other longitudinal veins pale with black marks at intersections and (forewing) at bases of setae. Forewing with posterior veinlets extensively marked black; basal inner gradates pale, others becoming increasingly marked black until entirely black distally; outer gradates mostly black. Hindwing with basal inner gradates pale, marked with black at intersections; outer gradates mostly black.
|
||||
</paragraph>
|
||||
<paragraph pageId="10" pageNumber="11">
|
||||
<pageBreakToken pageId="10" pageNumber="11" start="start">Abdomen</pageBreakToken>
|
||||
(Male,
|
||||
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Abdomen, cleared (a) midsection-terminus, lateral (b) T 8 (distal), T 9, and ectoproct, lateral (c) terminal abdominal segments, lateral (d) terminal abdominal segments, ventral. apo dorsal apodeme extending below T 8 cc callus cerci ect ectoproct k distal knob extending from S 8 + 9 sr spiracle S 4, S 7 fourth, seventh strenites S 8, S 9 partially coalesced eighth and ninth sternites T 7, T 8, T 9 seventh, eighth, ninth tergites." figureDoi="10.3897/zookeys.866.35394.figure6" httpUri="https://binary.pensoft.net/fig/319511" pageId="10" pageNumber="11">Fig. 6</figureCitation>
|
||||
; female unknown): Sclerites, integument of pleural region somewhat soft, flexible; tergites, sternites, pleural region covered with setae of uniformly short length; microsetae present, no microtholi. T6: length 0.78 mm, ~1.8
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
height; T7: length 0.80 mm, ~1.6
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
height; S6: length 0.67 mm, 0.72
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
height; S7: length 0.68 mm, ~0.70
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
height. Tergites roughly rectangular, edges acute or slightly rounded, ventral margins straight or slightly concave mesally. Spiracles located approximately in center of lateral membrane, roughly circular externally, not enlarged; atria slightly enlarged, rounded, with bifurcated tracheae. Coloration: body somewhat discolored; setae pale. Tergites probably green, without markings; pleuron mostly tan; sternites with green longitudinal stripe dorsally, tan ventrally; callus cerci white.
|
||||
</paragraph>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure6" httpUri="https://binary.pensoft.net/fig/319511" pageId="10" pageNumber="11" start="Figure 6" startId="F6">
|
||||
<paragraph pageId="10" pageNumber="11">
|
||||
Figure 6.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="10" pageNumber="11" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="10" pageNumber="11">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Abdomen, cleared (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">a</emphasis>
|
||||
) midsection-terminus, lateral (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">b</emphasis>
|
||||
) T8 (distal), T9, and ectoproct, lateral (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">c</emphasis>
|
||||
) terminal abdominal segments, lateral (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">d</emphasis>
|
||||
) terminal abdominal segments, ventral.
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">apo</emphasis>
|
||||
dorsal apodeme extending below T8
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">cc</emphasis>
|
||||
callus cerci
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">ect</emphasis>
|
||||
ectoproct
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">k</emphasis>
|
||||
distal knob extending from S8+9
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">sr</emphasis>
|
||||
spiracle
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">S4, S7</emphasis>
|
||||
fourth, seventh strenites
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">S8, S9</emphasis>
|
||||
partially coalesced eighth and ninth sternites
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">T7, T8, T9</emphasis>
|
||||
seventh, eighth, ninth tergites.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<paragraph pageId="10" pageNumber="11">
|
||||
Male terminalia (
|
||||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Male genitalia, cleared, and specimen labels (Penny's identification label not included) (a) gonarcal complex, dorsal (b) gonarcal complex, frontal, tilted (c) gonarcal complex, posterior (d) gonarcal complex, lateral (e) hypandrium internum (f) labels. c comes g. a. gonarcal apodeme g. b. gonarcal bridge g. p. gonarcal process gse gonosetae on membranous gonosaccus mu mediuncus." figureDoi="10.3897/zookeys.866.35394.figure7" httpUri="https://binary.pensoft.net/fig/319512" pageId="10" pageNumber="11">Fig. 7</figureCitation>
|
||||
): T8 broadly wedge shaped, with dorsal surface slightly rounded, length 0.83 mm, height 0.49 mm, considerably longer than dorsal surfaces of either T9 or ectoproct; lateral margins tapering inward ventrally, ventral margin roughly straight. T9 and ectoproct separate, not fused; callus cerci ovate, protruding basally from posterior margin of ectoproct, 0.18 mm length, 0.10 mm width, with ~30 trichobothria of various lengths. T9 rectangular, with distoventral margin rounded; elongate, lightly sclerotized ventral apodeme along ventral margin, extending proximally to midsection of A8. Ectoproct dome shaped, rounded distally, slightly convex basally, tightly curved ventrally, sloping dorsally; callus cerci situated on lower proximal margin. S8 and S9 partially fused, without internal ridge; S9 more heavily sclerotized than S8, posterior margin slightly more sclerotized than remainder of sternite. S8+9 (lateral view) with proximal margin straight ventrally, becoming broadly rounded dorsally, distal margin short, straight, ventral margin straight; terminal knob extending well beyond edge of S9, with elongate setae on ventral margin; dorsal surface of knob contiguous with heavy recurrent membrane attached to elongate gonarcal membrane. Subanal plate not found.
|
||||
</paragraph>
|
||||
<caption doi="10.3897/zookeys.866.35394.figure7" httpUri="https://binary.pensoft.net/fig/319512" pageId="10" pageNumber="11" start="Figure 7" startId="F7">
|
||||
<paragraph pageId="10" pageNumber="11">
|
||||
Figure 7.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="10" pageNumber="11" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="10" pageNumber="11">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov. (
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile; Male, CAS): Male genitalia, cleared, and specimen labels (
|
||||
<normalizedToken originalValue="Penny’s">Penny's</normalizedToken>
|
||||
identification label not included) (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">a</emphasis>
|
||||
) gonarcal complex, dorsal (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">b</emphasis>
|
||||
) gonarcal complex, frontal, tilted (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">c</emphasis>
|
||||
) gonarcal complex, posterior (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">d</emphasis>
|
||||
) gonarcal complex, lateral (
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">e</emphasis>
|
||||
) hypandrium internum
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">(f)</emphasis>
|
||||
labels.
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">c</emphasis>
|
||||
comes
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">g.a.</emphasis>
|
||||
gonarcal apodeme
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">g.b.</emphasis>
|
||||
gonarcal bridge
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">g.p.</emphasis>
|
||||
gonarcal process
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">gse</emphasis>
|
||||
gonosetae on membranous gonosaccus
|
||||
<emphasis bold="true" pageId="10" pageNumber="11">mu</emphasis>
|
||||
mediuncus.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<paragraph pageId="10" pageNumber="11">
|
||||
Gonarcus delicate, slender, broadly arcuate; lateral apodemes slender, quadrate (lateral view), rounded distally, with short, contiguous processes mesally, extending forward. Mediuncus closely attached to dorsal surface of gonarcal arch, flat, recurved into an almost fully circular hood, with two internal sclerotized
|
||||
<normalizedToken originalValue="“rods”">"rods"</normalizedToken>
|
||||
extending roughly in parallel from mediuncal base to tip, converging slightly at tip; base of mediuncus quadrate (dorsal view), occupying approximately one-fourth span of gonarcal bridge; terminus of mediuncus with expanded lateral wings, rounded mesal protrusion. Gonosaccus transparent, immediately beneath gonarcal arch and mediuncus, with approximately 32 short setae on distinct setal bases uniformly distributed in two equal patches. Hypandrium internum small, located on delicate membrane extending well below gonosaccus, consisting of paired, curved lateral arms meeting mesally at narrow, rounded apex; comes lightly sclerotized, extending forward beyond apex. Gonapsis, gonocristae absent.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection lastPageId="11" lastPageNumber="12" pageId="10" pageNumber="11" type="biology_ecology">
|
||||
<paragraph pageId="10" pageNumber="11">Biology.</paragraph>
|
||||
<paragraph pageId="10" pageNumber="11">
|
||||
Nothing is known about the biology or larval morphology of this species. The gut of the
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="10" pageNumber="11" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="10" pageNumber="11">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
specimen did not contain noteworthy contents.
|
||||
</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
<pageBreakToken pageId="11" pageNumber="12" start="start">Larval</pageBreakToken>
|
||||
descriptions of several
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species are available for comparison if
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="11" pageNumber="12" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
larval specimens were to become available (see
|
||||
<bibRefCitation DOI="https://doi.org/10.1603/AN13163" author="Tauber, CA" journalOrPublisher="Annals of the Entomological Society of America" pageId="14" pageNumber="15" pagination="295 - 314" refId="B23" refString="Tauber, CA, Tauber, MJ, Albuquerque, GS, 2014. Debris-carrying in larval Chrysopidae: unraveling its evolutionary history. . Annals of the Entomological Society of America 107: 295 - 314" title="Debris-carrying in larval Chrysopidae: unraveling its evolutionary history." url="https://doi.org/10.1603/AN13163" volume="107" year="2014">Tauber et al. 2014</bibRefCitation>
|
||||
).
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
larvae generally are considered debris-carriers, but their packets of debris are small, and their morphology is only moderately modified for debris-carrying. In addition, detailed information on aspects of the developmental and reproductive biology of
|
||||
<taxonomicName lsidName="N. californica" pageId="11" pageNumber="12" rank="species" species="californica">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. californica</emphasis>
|
||||
</taxonomicName>
|
||||
is available (
|
||||
<bibRefCitation DOI="https://doi.org/10.3733/hilg.v36n11p391" author="Toschi, CA" journalOrPublisher="Hilgardia" pageId="14" pageNumber="15" pagination="391 - 433" refId="B26" refString="Toschi, CA, 1965. The taxonomy, life histories, and mating behavior of the green lacewings of Strawberry Canyon (Neuroptera, Chrysopidae). . Hilgardia 36: 391 - 433" title="The taxonomy, life histories, and mating behavior of the green lacewings of Strawberry Canyon (Neuroptera, Chrysopidae)." url="https://doi.org/10.3733/hilg.v36n11p391" volume="36" year="1965">Toschi 1965</bibRefCitation>
|
||||
).
|
||||
</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
For generic-level comparisons, larval descriptions for genera within
|
||||
<taxonomicName lsidName="" pageId="11" pageNumber="12" rank="subfamily" subfamily="Nothochrysinae">Nothochrysinae</taxonomicName>
|
||||
(
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Kimochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Kimochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Kimochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
,
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Pimachrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pimachrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Pimachrysa</emphasis>
|
||||
</taxonomicName>
|
||||
,
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Dictyochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Dictyochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Dictyochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
, and
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Hypochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hypochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Hypochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
) have been published (see
|
||||
<bibRefCitation DOI="https://doi.org/10.1603/AN13163" author="Tauber, CA" journalOrPublisher="Annals of the Entomological Society of America" pageId="14" pageNumber="15" pagination="295 - 314" refId="B23" refString="Tauber, CA, Tauber, MJ, Albuquerque, GS, 2014. Debris-carrying in larval Chrysopidae: unraveling its evolutionary history. . Annals of the Entomological Society of America 107: 295 - 314" title="Debris-carrying in larval Chrysopidae: unraveling its evolutionary history." url="https://doi.org/10.1603/AN13163" volume="107" year="2014">Tauber et al. 2014</bibRefCitation>
|
||||
). Unfortunately, larvae of
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Asthenochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Asthenochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">Asthenochrysa</taxonomicName>
|
||||
,
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Leptochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Leptochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">Leptochrysa</taxonomicName>
|
||||
, Pamochrysa
|
||||
</emphasis>
|
||||
, and
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Triplochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Triplochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Triplochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
are not described.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="11" pageNumber="12" type="distribution">
|
||||
<paragraph pageId="11" pageNumber="12">Known distribution.</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
Currently, this species has only been reported from the type locality, which presumably is the Valle Las Trancas in the region of
|
||||
<normalizedToken originalValue="Ñuble">Nuble</normalizedToken>
|
||||
, Chile.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection lastPageId="12" lastPageNumber="13" pageId="11" pageNumber="12" type="etymology">
|
||||
<paragraph pageId="11" pageNumber="12">Etymology.</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">This species is named in honor of Ronald G. Ehrenberg, Irving M. Ives Professor of Industrial and Labor Relations and Economics at Cornell University, an esteemed and cherished colleague of the author and her late husband (Maurice J. Tauber).</paragraph>
|
||||
<subSection lastPageId="12" lastPageNumber="13" pageId="11" pageNumber="12" type="characteristics shared with archaeochrysa species">
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
Characteristics shared with
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species
|
||||
</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
As shown above,
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="11" pageNumber="12" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
shares many features with other extant
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species, and its inclusion in the genus is well supported. However, the species also expresses many features that differ from
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
and that are shared by at least some of the five species in the fossil genus
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
. I discuss four below:
|
||||
</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
First, in the
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="11" pageNumber="12" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
forewing, vein A1 is not forked, whereas it is forked in all other
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species (
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
;
|
||||
<bibRefCitation pageId="11" pageNumber="12" refId="B4">
|
||||
<normalizedToken originalValue="Aspöck">Aspoeck</normalizedToken>
|
||||
et al. 1980
|
||||
</bibRefCitation>
|
||||
: figs 154, 155;
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
: 135, 136). The feature is variable in
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
specimens where A1 is visible. It is not forked in two species (
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
: 237), forked in two species (
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
: 230,
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
: 135), and missing from the specimen of the fifth species (
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin 2015</bibRefCitation>
|
||||
: 363).
|
||||
</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
Second, in
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="11" pageNumber="12" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
the basal sc-r crossvein arises distal to the furcation of the radius and almost directly above the furcation of the media. Both of these character states are shared with the fossil genus
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
(
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
,
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
), but not with other known
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species.
|
||||
</paragraph>
|
||||
<paragraph pageId="11" pageNumber="12">
|
||||
Third, in
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="11" pageNumber="12" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
the distinction between the inner gradate series and the pseudomedia as well as between the outer gradate series and the pseudocubitus is indistinct. Rather, the gradate series and their respective pseudoveins tend to run together more smoothly as a curve, rather than at an angle as in other
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species. Again, this feature of
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="11" pageNumber="12" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
is shared most closely with
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species (
|
||||
<bibRefCitation author="Adams, PA" journalOrPublisher="Bulletin of the Museum of Comparative Zoology" pageId="13" pageNumber="14" pagination="215 - 238" refId="B1" refString="Adams, PA, 1967. A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae). . Bulletin of the Museum of Comparative Zoology 135: 215 - 238" title="A review of the Mesochrysinae and Nothochrysinae (Neuroptera: Chrysopidae)." volume="135" year="1967">Adams 1967</bibRefCitation>
|
||||
,
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
,
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin 2015</bibRefCitation>
|
||||
).
|
||||
</paragraph>
|
||||
<paragraph lastPageId="12" lastPageNumber="13" pageId="11" pageNumber="12">
|
||||
Fourth, currently the primary feature used to distinguish between
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
and
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
is the presence or absence of a crossvein between RP and MA in the basal part of the hindwing. The crossvein is present in all known
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species and is reported to be absent from
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="11" pageNumber="12" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="11" pageNumber="12">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
(
|
||||
<bibRefCitation DOI="https://doi.org/10.1666/12-052R.1" author="Makarkin, VN" journalOrPublisher="Journal of Paleontology" pageId="14" pageNumber="15" pagination="123 - 146" refId="B16" refString="Makarkin, VN, Archibald, SB, 2013. A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America. . Journal of Paleontology 87: 123 - 146" title="A diverse new assemblage of green lacewings (Insecta, Neuroptera, Chrysopidae) from the Early Eocene Okanagan Highlands, western North America." url="https://doi.org/10.1666/12-052R.1" volume="87" year="2013">Makarkin and Archibald 2013</bibRefCitation>
|
||||
: 134).
|
||||
<pageBreakToken pageId="12" pageNumber="13" start="start">In</pageBreakToken>
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
, MA aligns with RP for about one-third the length of the upper margin of the
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">im1</emphasis>
|
||||
cell, and no crossvein is present (
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F1" captionText="Figure 1. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Venation at base of wings (a) left forewing, (b) left hindwing. Note the absence of a tympanal organ at the base of R in the forewing, the independent origin and trajectory of M along the base of R (arrows pointing downward, both wings), and the alignment of RP and MA in the hindwing. A 1, A 2, A 3 first, second, third anal veins Cu cubitus Cu f furcation (division) of cubitus Ju jugal lobe M media MA media anterior m-cu media-cubital crossvein R radius RP radius posterior." figureDoi="10.3897/zookeys.866.35394.figure1" httpUri="https://binary.pensoft.net/fig/319506" pageId="12" pageNumber="13">Figs 1b</figureCitation>
|
||||
,
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="12" pageNumber="13">2b</figureCitation>
|
||||
). However, even with this character there appears to be a possible exception.
|
||||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Nothochrysa ehrenbergi sp. nov. (Nuble, Chile; Male, CAS): Wings with selected features labeled (a) left forewing, (b) left hindwing. Marginal traces of major veins demarcated; arrow (hindwing) indicates alignment of RP and MA along upper margin of first intramedian cell. A 1, A 2, A 3 first, second, third anal veins CuA, CuP anterior, posterior branches of cubitus icu 1, icu 3 first, third intracubital cells ig inner gradate im 1, im 2 first, second intramedian cells Ju jugal lobe MA media anterior MP media posterior mcua, mpcua second and third medial cells M f furcation of media og outer gradate Psc pseudocubitus Psm pseudomedia R f furcation of radius RP radius posterior RP 1 first branch of radius posterior 1 sc-r first crossvein between subcosta and radius 2 m-cu second crossvein between media and cubitus." figureDoi="10.3897/zookeys.866.35394.figure2" httpUri="https://binary.pensoft.net/fig/319507" pageId="12" pageNumber="13">Figure 2</figureCitation>
|
||||
accompanying the original description of
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa turcica" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="species" species="turcica">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa turcica</emphasis>
|
||||
</taxonomicName>
|
||||
Kovanci and Canbulat shows a short crossvein between RP and MA; confirmation of the accuracy of this drawing is necessary.
|
||||
</paragraph>
|
||||
</subSection>
|
||||
<subSection pageId="12" pageNumber="13" type="phylogenetic position of nothochrysa ehrenbergi sp. nov">
|
||||
<paragraph pageId="12" pageNumber="13">
|
||||
Phylogenetic position of
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov.
|
||||
</paragraph>
|
||||
<paragraph pageId="12" pageNumber="13">
|
||||
Given the above,
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">
|
||||
Archibald and
|
||||
<normalizedToken originalValue="Makarkin’s">Makarkin's</normalizedToken>
|
||||
(2015)
|
||||
</bibRefCitation>
|
||||
discussion of the phylogeny of
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species is worthy of consideration here. Their paper evaluates how the various
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species express three features; each feature has several conditions ranging from presumably plesiomorphic to more derived. Below, the three features are considered, relative to their expression by
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species, especially
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
.
|
||||
</paragraph>
|
||||
<paragraph pageId="12" pageNumber="13">
|
||||
(1)
|
||||
<emphasis bold="true" pageId="12" pageNumber="13">
|
||||
The shape of the
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">im1</emphasis>
|
||||
cell.
|
||||
</emphasis>
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin (2015)</bibRefCitation>
|
||||
describe two configurations for this character;
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
expresses the second (more advanced) condition in which the sides of the
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">im1</emphasis>
|
||||
cell are almost parallel for most of their span and converge basally at a relatively steep angle. The extant species of
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
, including
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
, share this feature with two species of
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
.
|
||||
</paragraph>
|
||||
<paragraph pageId="12" pageNumber="13">
|
||||
(2)
|
||||
<emphasis bold="true" pageId="12" pageNumber="13">The position of crossvein 2m-cu.</emphasis>
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin (2015)</bibRefCitation>
|
||||
list six conditions for this character, each one considered more evolutionarily advanced than the preceding.
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa ehrenbergi" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
falls into Condition 5, a derived condition in which 2m-cu is located distinctly in the proximal part of
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">im1</emphasis>
|
||||
(as shown in fig. 2C of
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin 2015</bibRefCitation>
|
||||
). This character state is typical of at least two
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species,
|
||||
<taxonomicName lsidName="A. creedi" pageId="12" pageNumber="13" rank="species" species="creedi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">A. creedi</emphasis>
|
||||
</taxonomicName>
|
||||
(Adams) and
|
||||
<taxonomicName lsidName="A. paranervis" pageId="12" pageNumber="13" rank="species" species="paranervis">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">A. paranervis</emphasis>
|
||||
</taxonomicName>
|
||||
(Adams), as well as several other extant genera in
|
||||
<taxonomicName lsidName="" pageId="12" pageNumber="13" rank="subfamily" subfamily="Nothochrysinae">Nothochrysinae</taxonomicName>
|
||||
, including
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
.
|
||||
</paragraph>
|
||||
<paragraph pageId="12" pageNumber="13">
|
||||
(3)
|
||||
<emphasis bold="true" pageId="12" pageNumber="13">The crossveins of Psc.</emphasis>
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin (2015</bibRefCitation>
|
||||
: 366) describe and illustrate four character states for this feature; interested readers are referred to the original paper. Suffice it to say here,
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
, as well as three
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species but no other
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species, fall into the second of the four conditions. This position is considered plesiomorphic among
|
||||
<taxonomicName lsidName="" pageId="12" pageNumber="13" rank="subfamily" subfamily="Nothochrysinae">Nothochrysinae</taxonomicName>
|
||||
, both fossil and extant (
|
||||
<bibRefCitation DOI="https://doi.org/10.4039/tce.2014.53" author="Archibald, SB" journalOrPublisher="Canadian Entomologist" pageId="13" pageNumber="14" pagination="359 - 369" refId="B3" refString="Archibald, SB, Makarkin, VN, 2015. A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada. . Canadian Entomologist 147: 359 - 369" title="A new species of Archaeochrysa Adams (Neuroptera: Chrysopidae) from the early Eocene of Driftwood Canyon, British Columbia, Canada." url="https://doi.org/10.4039/tce.2014.53" volume="147" year="2015">Archibald and Makarkin 2015</bibRefCitation>
|
||||
).
|
||||
</paragraph>
|
||||
<paragraph pageId="12" pageNumber="13">
|
||||
On the basis of the above information, it appears that
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
shares a very close phylogenetic relationship with the fossil genus
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
. At this point, only one character (the absence of a crossvein between the RP and the MA above the first intramedial cell of the hindwing) supports its exclusion from
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
, and this character may have exceptions within
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
. Indeed, there does not appear to be a synapomorphic character that consistently differentiates
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Nothochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nothochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Nothochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
from
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
. Thus, given the overall similarity between
|
||||
<taxonomicName lsidName="N. ehrenbergi" pageId="12" pageNumber="13" rank="species" species="ehrenbergi">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">N. ehrenbergi</emphasis>
|
||||
</taxonomicName>
|
||||
and the known
|
||||
<taxonomicName class="Insecta" family="Chrysopidae" genus="Archaeochrysa" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Archaeochrysa" order="Neuroptera" pageId="12" pageNumber="13" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="12" pageNumber="13">Archaeochrysa</emphasis>
|
||||
</taxonomicName>
|
||||
species, I recommend that future studies examine the validity of maintaining the generic separation.
|
||||
</paragraph>
|
||||
</subSection>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
55
data/4C/FF/D6/4CFFD62B3840AEDCA438162375523540.xml
Normal file
55
data/4C/FF/D6/4CFFD62B3840AEDCA438162375523540.xml
Normal file
|
|
@ -0,0 +1,55 @@
|
|||
<document ENCODING="UTF-8" ID-DOI="https://doi.org/10.5962/bhl.title.542" ID-GBIF-Dataset="57ea6fdb-2533-44e5-b60b-736758a88d19" ID-Zenodo-Dep="3922206" ID-ZooBank="2C6327E1-5560-4DB4-B9CA-76A0FA03D975" checkinTime="1593218702860" checkinUser="admin" docAuthor="Linnaeus, Carolus" docDate="1758" docId="4CFFD62B3840AEDCA438162375523540" docLanguage="de" docName="Linnaeus1758Treatments.xml" docOrigin="Stockholm: Laurentius Salvius" docSource="https://archive.org/download/mobot31753000798865/mobot31753000798865.pdf" docTitle="Papilio lampetia Linnaeus, 1758, spec. nov." docType="treatment" docUuid="792D49D7-2823-411A-BCD5-5278244A8FA0" docUuidSource="ZooBank" docVersion="13" lastPageNumber="476" masterDocId="3F896AFC21C459639D0D71D9EDB8875C" masterDocTitle="Systema Naturae per regna tria naturae: secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis" pageNumber="476" updateTime="1643600433100" updateUser="ExternalLinkService">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Systema Naturae per regna tria naturae: secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Linnaeus, Carolus</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:originInfo>
|
||||
<mods:dateIssued>1758</mods:dateIssued>
|
||||
<mods:publisher>Laurentius Salvius</mods:publisher>
|
||||
<mods:place>
|
||||
<mods:placeTerm>Stockholm</mods:placeTerm>
|
||||
</mods:place>
|
||||
</mods:originInfo>
|
||||
<mods:location>
|
||||
<mods:url>https://archive.org/download/mobot31753000798865/mobot31753000798865.pdf</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>book</mods:classification>
|
||||
<mods:identifier type="ZooBank">2C6327E1-5560-4DB4-B9CA-76A0FA03D975</mods:identifier>
|
||||
<mods:identifier type="DOI">https://doi.org/10.5962/bhl.title.542</mods:identifier>
|
||||
<mods:identifier type="Zenodo-Dep">3922206</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment ID-DOI="http://doi.org/10.5281/zenodo.3915892" ID-GBIF-Taxon="164812642" ID-Zenodo-Dep="3915892" LSID="urn:lsid:zoobank.org:act:792D49D7-2823-411A-BCD5-5278244A8FA0" httpUri="http://treatment.plazi.org/id/4CFFD62B3840AEDCA438162375523540" lastPageNumber="476" pageNumber="476" sourcePageUrl="https://www.biodiversitylibrary.org/page/727387">
|
||||
<subSubSection type="nomenclature">
|
||||
<paragraph pageNumber="476">
|
||||
<taxonomicName LSID="urn:lsid:zoobank.org:act:792D49D7-2823-411A-BCD5-5278244A8FA0" authorityName="Linnaeus" authorityYear="1758" class="Insecta" family="Papilionidae" genus="Papilio" kingdom="Animalia" order="Lepidoptera" phylum="Arthropoda" rank="species" species="lampetia" status="spec. nov." zbkClass="Insecta" zbkKingdom="Animalia" zbkOrder="Lepidoptera">Papilio lampetia</taxonomicName>
|
||||
[
|
||||
<taxonomicNameLabel rank="species">spec. nov.</taxonomicNameLabel>
|
||||
]
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection type="description">
|
||||
<paragraph pageNumber="476">
|
||||
P. N. alis crenatis: primoribus fuscescentibus fascia flava; posticis supra ocellis sex.
|
||||
<emphasis italics="true">M. L. U.</emphasis>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection type="distribution">
|
||||
<paragraph pageNumber="476">
|
||||
<emphasis italics="true">Habitat in</emphasis>
|
||||
Indiis.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection type="description">
|
||||
<paragraph pageNumber="476">
|
||||
<emphasis italics="true">Ocelli intra marginem posticum concatenati sunt.</emphasis>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
172
data/4C/FF/FF/4CFFFF3E7FBFA6F26061378BDA068BE7.xml
Normal file
172
data/4C/FF/FF/4CFFFF3E7FBFA6F26061378BDA068BE7.xml
Normal file
|
|
@ -0,0 +1,172 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.804.28988" ID-GBIF-Dataset="f4a65643-a4cf-4e4a-b06a-5ec49f5d9ffc" ID-PMC="PMC6297208" ID-Pensoft-Pub="1313-2970-804-1" ID-PubMed="30584389" ID-ZBK="5D24427CBC394FCAB2D72499C444A09F" ModsDocAuthor="" ModsDocDate="2018" ModsDocID="1313-2970-804-1" ModsDocOrigin="ZooKeys 804" ModsDocTitle="The incredible diversity of Labiobaetis Novikova & Kluge in New Guinea revealed by integrative taxonomy (Ephemeroptera, Baetidae)" checkinTime="1545315530609" checkinUser="pensoft" docAuthor="Kaltenbach, Thomas & Gattolliat, Jean-Luc" docDate="2018" docId="4CFFFF3E7FBFA6F26061378BDA068BE7" docLanguage="en" docName="ZooKeys 804: 1-136" docOrigin="ZooKeys 804" docSource="http://dx.doi.org/10.3897/zookeys.804.28988" docTitle="Labiobaetis paravitilis Kaltenbach & Gattolliat, 2018, sp. n." docType="treatment" docUuid="1C21C5E7-497F-4B35-9D10-CD119B22DE01" docUuidSource="ZooBank" docVersion="5" lastPageNumber="76" masterDocId="FF82FFD5D7468A24CC2DA908B80AFF9B" masterDocTitle="The incredible diversity of Labiobaetis Novikova & Kluge in New Guinea revealed by integrative taxonomy (Ephemeroptera, Baetidae)" masterLastPageNumber="136" masterPageNumber="1" pageNumber="73" updateTime="1668166564538" updateUser="ExternalLinkService">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>The incredible diversity of Labiobaetis Novikova & Kluge in New Guinea revealed by integrative taxonomy (Ephemeroptera, Baetidae)</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Kaltenbach, Thomas</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Gattolliat, Jean-Luc</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>ZooKeys</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2018</mods:date>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>804</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>1</mods:start>
|
||||
<mods:end>136</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/zookeys.804.28988</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.804.28988</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">1313-2970-804-1</mods:identifier>
|
||||
<mods:identifier type="ZBK">5D24427CBC394FCAB2D72499C444A09F</mods:identifier>
|
||||
<mods:identifier type="ZooBank">5D24427CBC394FCAB2D72499C444A09F</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment ID-GBIF-Taxon="154126533" LSID="urn:lsid:zoobank.org:act:1C21C5E7-497F-4B35-9D10-CD119B22DE01" httpUri="http://treatment.plazi.org/id/4CFFFF3E7FBFA6F26061378BDA068BE7" lastPageId="75" lastPageNumber="76" pageId="72" pageNumber="73">
|
||||
<subSubSection pageId="72" pageNumber="73" type="nomenclature">
|
||||
<paragraph pageId="72" pageNumber="73">
|
||||
21.
|
||||
<taxonomicName LSID="http://zoobank.org/1C21C5E7-497F-4B35-9D10-CD119B22DE01" class="Insecta" family="Baetidae" genus="Labiobaetis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Labiobaetis paravitilis" order="Ephemeroptera" pageId="72" pageNumber="73" phylum="Arthropoda" rank="species" species="paravitilis">Labiobaetis paravitilis</taxonomicName>
|
||||
<taxonomicNameLabel pageId="72" pageNumber="73">sp. n.</taxonomicNameLabel>
|
||||
Figures 39, 40, 62a, 65b
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="72" pageNumber="73" type="diagnosis">
|
||||
<paragraph pageId="72" pageNumber="73">Diagnosis.</paragraph>
|
||||
<paragraph pageId="72" pageNumber="73">
|
||||
Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 5-6 long, simple setae; B) maxillary palp longer as length of galea-lacinia, apically rounded, without excavation at inner distolateral margin; C) labial glossae much shorter than paraglossae; D) labial palp segment II with an elongated, thumb-like distomedial protuberance, segment III conical, apically slightly truncate; E) fore femur slender, length 3.6
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
maximum width, dorsal margin with a row of ca. 12 curved, spine-like setae; F) fore claw with one row of eleven denticles.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection lastPageId="75" lastPageNumber="76" pageId="72" pageNumber="73" type="description">
|
||||
<paragraph pageId="72" pageNumber="73">Description.</paragraph>
|
||||
<paragraph pageId="72" pageNumber="73">Larva (Figs 39, 40, 62a). Body length 3.7 mm.</paragraph>
|
||||
<caption pageId="72" pageNumber="73">
|
||||
<paragraph pageId="72" pageNumber="73">
|
||||
Figure 39.
|
||||
<taxonomicName class="Insecta" family="Baetidae" genus="Labiobaetis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Labiobaetis paravitilis" order="Ephemeroptera" pageId="72" pageNumber="73" phylum="Arthropoda" rank="species" species="paravitilis">Labiobaetis paravitilis</taxonomicName>
|
||||
sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca f
|
||||
<taxonomicName genus="Hypopharynx" lsidName="Hypopharynx" pageId="72" pageNumber="73" rank="genus">Hypopharynx</taxonomicName>
|
||||
g Maxilla h Labium.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<caption pageId="72" pageNumber="73">
|
||||
<paragraph pageId="72" pageNumber="73">
|
||||
Figure 40.
|
||||
<taxonomicName class="Insecta" family="Baetidae" genus="Labiobaetis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Labiobaetis paravitilis" order="Ephemeroptera" pageId="72" pageNumber="73" phylum="Arthropoda" rank="species" species="paravitilis">Labiobaetis paravitilis</taxonomicName>
|
||||
sp. n., larva morphology: a
|
||||
<taxonomicName genus="Foreleg" lsidName="Foreleg" pageId="72" pageNumber="73" rank="genus">Foreleg</taxonomicName>
|
||||
b Fore claw c
|
||||
<taxonomicName genus="Tergum" lsidName="Tergum" pageId="72" pageNumber="73" rank="genus">Tergum</taxonomicName>
|
||||
IV d Gill IV e
|
||||
<taxonomicName genus="Paraproct" lsidName="Paraproct" pageId="72" pageNumber="73" rank="genus">Paraproct</taxonomicName>
|
||||
.
|
||||
</paragraph>
|
||||
</caption>
|
||||
<paragraph pageId="72" pageNumber="73">Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture. Head, thorax and abdomen ventrally light brown, femur dorsal margin light brown, legs otherwise colourless, caudal filaments colourless.</paragraph>
|
||||
<paragraph pageId="72" pageNumber="73">Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.</paragraph>
|
||||
<paragraph lastPageId="73" lastPageNumber="74" pageId="72" pageNumber="73">
|
||||
Labrum (Fig. 39a). Rectangular, length 0.7
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 5-6 long, simple
|
||||
<pageBreakToken pageId="73" pageNumber="74" start="start">setae</pageBreakToken>
|
||||
. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.
|
||||
</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">Right mandible (Fig. 39b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles, partly plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">Left mandible (Fig. 39d, e). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">
|
||||
<taxonomicName genus="Hypopharynx" lsidName="Hypopharynx" pageId="73" pageNumber="74" rank="genus">Hypopharynx</taxonomicName>
|
||||
(Fig. 39f). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.
|
||||
</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">
|
||||
Maxilla (Fig. 39g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and five long, simple setae. Maxillary palp 1.4
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
as long as length of galea-lacinia; two segmented. Palp segment II 1.4
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, without excavation at inner distolateral margin.
|
||||
</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">
|
||||
Labium (Fig. 39h). Glossa basally broad, narrowing toward apex; much shorter than paraglossa; inner margin with five spine-like setae increasing in length distally; apex with two long, robust setae; outer margin with 3-4 long, spine-like setae; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 2-3 medium, simple setae; ventrally with two long, spine-like setae near inner margin. Labial palp with segment I 0.8
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.5
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of six medium, spine-like, simple setae. Segment III conical; apex truncate; length 0.9
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.
|
||||
</paragraph>
|
||||
<paragraph pageId="73" pageNumber="74">Hind wing pads absent.</paragraph>
|
||||
<paragraph lastPageId="74" lastPageNumber="75" pageId="73" pageNumber="74">
|
||||
<taxonomicName genus="Foreleg" lsidName="Foreleg" pageId="73" pageNumber="74" rank="genus">Foreleg</taxonomicName>
|
||||
(Fig. 40a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 4
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
maximum width. Dorsal margin with a row of ca. 12 curved, spine-like setae; length of setae 0.16
|
||||
<normalizedToken originalValue="×">x</normalizedToken>
|
||||
maximum width of femur. Apex rounded; with one pair of
|
||||
<pageBreakToken pageId="74" pageNumber="75" start="start">curved</pageBreakToken>
|
||||
, spine-like setae and some very short, stout setae. Many stout, lanceolate setae and a few fine, simple setae scattered along ventral margin; femoral patch absent. Tibia. Dorsal margin with a row of fine, simple setae. Ventral margin with a row of curved, spine-like setae, one seta on apex much longer; one long, bipectinate seta and a tuft of fine, long, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/3. Tarsus. Dorsal margin with row of fine, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of eleven denticles; tapering distally; with three stripes; subapical setae absent.
|
||||
</paragraph>
|
||||
<paragraph pageId="74" pageNumber="75">
|
||||
<taxonomicName genus="Tergum" lsidName="Tergum" pageId="74" pageNumber="75" rank="genus">Tergum</taxonomicName>
|
||||
(Fig. 40c). Surface with irregular rows of U-shaped scale bases and scattered micropores, scales slightly triangular. Posterior margin of tergum IV with rounded or triangular spines, wider than long.
|
||||
</paragraph>
|
||||
<paragraph lastPageId="75" lastPageNumber="76" pageId="74" pageNumber="75">
|
||||
<taxonomicName genus="Gills" lsidName="Gills" pageId="74" pageNumber="75" rank="genus">Gills</taxonomicName>
|
||||
(Fig. 40d). Present on segments
|
||||
<normalizedToken originalValue="II–VII">II-VII</normalizedToken>
|
||||
. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer
|
||||
<pageBreakToken pageId="75" pageNumber="76" start="start">margins</pageBreakToken>
|
||||
. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII and IX combined.
|
||||
</paragraph>
|
||||
<paragraph pageId="75" pageNumber="76">
|
||||
<taxonomicName genus="Paraproct" lsidName="Paraproct" pageId="75" pageNumber="76" rank="genus">Paraproct</taxonomicName>
|
||||
(Fig. 40e). Distally not expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="75" pageNumber="76" type="etymology">
|
||||
<paragraph pageId="75" pageNumber="76">Etymology.</paragraph>
|
||||
<paragraph pageId="75" pageNumber="76">
|
||||
Refers to the morphological similarity with
|
||||
<taxonomicName lsidName="L. vitilis" pageId="75" pageNumber="76" rank="species" species="vitilis">L. vitilis</taxonomicName>
|
||||
.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="75" pageNumber="76" type="distribution">
|
||||
<paragraph pageId="75" pageNumber="76">Distribution.</paragraph>
|
||||
<paragraph pageId="75" pageNumber="76">New Guinea.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="75" pageNumber="76" type="biological aspects">
|
||||
<paragraph pageId="75" pageNumber="76">Biological aspects.</paragraph>
|
||||
<paragraph pageId="75" pageNumber="76">The specimens were collected at an altitude of 30 m a.s.l.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="75" pageNumber="76" type="type material">
|
||||
<paragraph pageId="75" pageNumber="76">Type-material.</paragraph>
|
||||
<paragraph pageId="75" pageNumber="76">
|
||||
Holotype. Nymph (on slide, GBIFCH 00465207), Papua New Guinea, Madang, Trans Gogol, 30 m, 02.2008,
|
||||
<geoCoordinate direction="south" orientation="latitude" precision="9" value="-5.3015">05°18.09'S</geoCoordinate>
|
||||
,
|
||||
<geoCoordinate direction="east" orientation="longitude" precision="9" value="145.6075">145°36.45'E</geoCoordinate>
|
||||
, BRC leg. (PNG 179). Deposited in ZSM. Paratypes. 17 nymphs (1 on slide, GBIFCH 00465208, 11 in alcohol, GBIFCH 00515271, GBIFCH 00508148, deposited in MZL; 5 in alcohol, GBIFCH00515272, deposited in ZSM), same data as holotype.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
Loading…
Add table
Add a link
Reference in a new issue