diff --git a/data/03/CA/80/03CA8049FFA4FFFE358FF87E5C86FE46.xml b/data/03/CA/80/03CA8049FFA4FFFE358FF87E5C86FE46.xml new file mode 100644 index 00000000000..20af1d40386 --- /dev/null +++ b/data/03/CA/80/03CA8049FFA4FFFE358FF87E5C86FE46.xml @@ -0,0 +1,165 @@ + + + +Megascolex (Perichaeta) diffringens Baird, 1869 and Pheretima pingi Stephenson, 1925 types compared to the Amynthas corticis (Kinberg, 1867) and A. carnosus (Goto & Hatai, 1899) species-groups (Oligochaeta: Megadrilacea: Megascolecidae) + + + +Author + +Blakemore, Robert J. + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +99 +126 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.099 + +journal article +10.12651/JSR.2013.2.2.099 +2713-8615 + + + + + + + +Amynthas hatomajimensis +(Ohfuchi, 1957) + + + + + + + + +Pheretima hatomajimensis +Ohfuchi, 1957: 245 + +, fig. 20. [ +From Ryukus +, +Japan +. +Types +?]. + + + + +Diagnosis. +Length +73-94 mm +by +3-4.5 mm +with 75-93 segments. Spermathecal pores in 5/6/7/8/9. GM in a cross-shape internal to, above and below male pores on 18, plus another pair anteriomedian and postsetally on 18. Intestinal caeca simple in 26. + + + + +Distribution. +Hatoma-jima island, Ryukus. Collected 1 +st +April, 1936. + + + + +Remarks. +Said to resemble + +A. pingi + +its lack of spermathecal papillae and cross-shaped GMs indicate its propable separation from both + +A. corticis + +/ + +diffringens + +and + +A. carnosus + +/ + +pingi + +although combined as a possible synonym of + +A. corticis + +by +Easton (1981: 49-50) +. + + +Now separated is + +Metaphire yamadai +(Hatai, 1930) + +that has spermathecae in 6/7/8/9 and possibly includes + +A. pectiniferus +(Michaelsen, 1931) + +both of which +Gates (1935 +; +1939 +) implicated in + +P. pingi + +as discussed in +Blakemore (2012a) +. However, similar taxa now are + +A. hongkongensis +(Michaelsen, 1910) + +from +China +and + +A. cruxus +Tsai & Shen + +in Tsai, Shen, Tsai and Lee, 2007: 357 from +Taiwan +that seem to belong to the + +A. corticis + +group and similar to current Incheon specimens of + +A. corticis + +and so these taxa should be reevaluated. + + + + \ No newline at end of file diff --git a/data/03/CA/80/03CA8049FFABFFF13626FC3A5C3DFE46.xml b/data/03/CA/80/03CA8049FFABFFF13626FC3A5C3DFE46.xml new file mode 100644 index 00000000000..9338fec7197 --- /dev/null +++ b/data/03/CA/80/03CA8049FFABFFF13626FC3A5C3DFE46.xml @@ -0,0 +1,83 @@ + + + +Megascolex (Perichaeta) diffringens Baird, 1869 and Pheretima pingi Stephenson, 1925 types compared to the Amynthas corticis (Kinberg, 1867) and A. carnosus (Goto & Hatai, 1899) species-groups (Oligochaeta: Megadrilacea: Megascolecidae) + + + +Author + +Blakemore, Robert J. + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +99 +126 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.099 + +journal article +10.12651/JSR.2013.2.2.099 +2713-8615 + + + + + + + +Amynthas carnosus carnosus +( +Goto & Hatai, 1899 +) + + + + + + + +( +Figs. 2-3 +) + + +Delailed by +Kobayashi (1936) +, +Ohfuchi (1937) +and +Blakemore (2012a +; +2013a +; +2013b +) (cf + +A. pingi + +described below). DNA data ( +Fig. 1 +) indicates a new sub-species as next described. + + + + \ No newline at end of file diff --git a/data/03/CA/80/03CA8049FFB9FFE23626FF195C50F85C.xml b/data/03/CA/80/03CA8049FFB9FFE23626FF195C50F85C.xml new file mode 100644 index 00000000000..411c01539a6 --- /dev/null +++ b/data/03/CA/80/03CA8049FFB9FFE23626FF195C50F85C.xml @@ -0,0 +1,365 @@ + + + +Megascolex (Perichaeta) diffringens Baird, 1869 and Pheretima pingi Stephenson, 1925 types compared to the Amynthas corticis (Kinberg, 1867) and A. carnosus (Goto & Hatai, 1899) species-groups (Oligochaeta: Megadrilacea: Megascolecidae) + + + +Author + +Blakemore, Robert J. + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +99 +126 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.099 + +journal article +10.12651/JSR.2013.2.2.099 +2713-8615 + + + + + + + +Pheretima fornicata +Gates, 1935 + + + + + + + +( +Figs. 12 +, +13 +) + + + + + + + +Pheretima fornicata +Gates, 1935: 9 + + +figs. 5-6; + +Chen, 1936: 296 + +(re-examination of +type +in US National Museum); + +Gates, 1939: 434 + +(changing +type +locality to “Tatsienlu, Szechwan” “ + +From Dr Graham: 3 clitellate specimens labeled ‘Tatsienlu, +12,000 feet +, +July 7-9, 1923 + +” and adding 1 clitellate specimen in poor condition labeled “ + +Between Gin Keo Ho and Dawei, + +1,300 +-5,000 +feet + +, August 1-2 + +”. + + + + + +Amynthas fornicatus + +: + + +Shen +et al., +2003: 482 + + +, tab. 1; +Wang & Qiu, 2005 +: tab. 1; + +Sun +et al., +2012 + +: tab. 1. + + + + + +Description. +The original description in full in quotes with Gates’ (1939) amendments added in square braces that yet ignore +Chen’s (1936) +additional and contradictory data from reinspection of Gates’ +types + +[data from + +Shen +et al. +(2003 + +: tab. 1) bolded and also put in square braces but presumably not from +types +]:- + + + + +Fig. 12. + +Amynthas fornicatus + +showing Gates’ (1935: figs. 5-6) most uninformative and irrelevant details of spermathecae invoking adage “missing the forest for the trees”. + + + + +Fig. 13. +Prior + +Amynthas hongkongensis + +after Michaelsen (1910: fig. 22), for comparison. + + + +“ +PHERETIMA FORNICATA +, +n. sp. +Length +78 to 90 mm +[ +100 mm +], diameter +4 to 6 mm +. +[Segments 90-105] +. Setae: vi/17-24 [16-26] +[43-50] +, vii/19-21 [19-23], viii/ 18-23 [18-27] +[42-52] +, +[xii/42-52] +, xvii/13-14 [13-19], xviii/9-14, xix/12-15, [x, 56,] xx/56, +[xxv 45-55] +; a wide dorsal gap in the setal circle of ii. First dorsal pore in 12/ 13 [with pore like marking in 11/12]. [Clitellum annular, 13/14-16/17]. Spermathecal pores minute and superficial, four pairs, in 5/6-8/9 [on tiny, grayish, transversely oval markings]. Male pores superficial, on circular to transversely oval, disk-shaped porophores [that are about +0.5 mm +wide]. No genital markings. Septum 8/9 present but membranous [9/10 laking]. [Intestine from 15]. Intestinal caeca simple. [Hearts in 9-13 to ventral blood vessel, those in 10 and 11 within testis sac]. Testis sacs of x and xi unpaired and horseshoe-shaped. [Seminal vesicles are in 11 & 12, pseudovesicles in 13 and sometimes 14]. [Spermathecal duct as long as the ampulla, diverticulum longer than duct and ampulla]. Spermathecal diverticulum with a long, slender stalk and a spheroidal or asymmetrical seminal chamber. + +Type + +. - +U.S. +N.M no. 200099, from Tatsienlu, Tibet. + + +Distinguished from + +P. hongkongensis + +by the gap in the setal circle of ii, the exclusion of the seminal vesicles of xi from the posterior testis sac, and the absence of genital markings.” [None of these latter three characters seems sufficient justification for their separation in context with the current revisions of + +A. carnosus + +]. + + + + +Remarks. +Chen (1936: 298) +said + +P. fornicata + +“is probably identical with + +P. pingi +Steph. + +” but +Gates (1939: 436) +responded tersely with “ + +P. fornicata + +is, on the contrary, clearly distinguished from + +P. pingi + +by the horseshoe-shaped testis sacs of x and xi.” However, I think this is an unreliable character for separation and am obliged to combine them. + + +Gates (1935) +had implicated his + +fornicata + +as being closest to + +P. hongkongensis +Michaelsen, 1910: 107 + +based on a probable immature and abnormal type that has only a pair of small marking immediately median to male pores on 18 which is all that separates it from + +A. carnosus + +as redescribed by +Blakemore (2012a) +based on its +neotype +, and on +Kobayashi’s (1936) +excellent redescription in a publication that +Gates (1939: 469) +was clearly aware of but rejected for unsound reasons. + + +Thus differences of + +P. fornicata + +from + +A. pingi + +(= + +A. carnosus + +) as reinspected here from its type, are mainly a lack of genital markings which is irrelevant for + +A. carnosus +, + +and the uncertainty about spermathecal papillae. However, the name + +fornicata + +is complicit with the redescription of + +A. carnosus + +based on its +neotype +by +Blakemore (2012d) +and on subsequent records: in particular it agrees with +Kobayashi’s (1936) +absent GMs form types I & I. Thus + +fornicata + +should probably be included in + +pingi + +as Chen suggested and both now seemingly merit inclusion in synonymy of the prior + +A. carnosus +( +Goto & Hatai, 1899 +) + +. + + +Another recently described taxon, + +Amynthas taiwumontis + +Shen +et al +. (2013) + + +was compared by those authors to + +A. fornicatus + +. However its description appears to comply with + +A. carnosus + +having Kobayashi’s spermathecal pores +type +I or II and male pores +type +I, as redescribed by +Blakemore (2012a) +(this overlooked despite my sending a copy to Dr Huei-Ping Shen) and thus this name too is another probable inclusion in the long synonym list of + +A. carnosus + +presented in the Abstract above. + + +However, any of these specimens with spermathecal pores in 5/6/7/8/9 +not +on papillae/porophores described for + +A. carnosus + +probably equate more to + +A. corticis + +, as indeed does + +A. penpuensis + +Shen +et al. +, 2003 + + +as +syn. nov. +since all that currently separates it is its dorsal pores slightly more in advance (from 5/6 or 6/7 rather than from 11/12 abouts), this single character is doubtfully adequate for species level separation. + + + + \ No newline at end of file diff --git a/data/0D/1D/87/0D1D878EFFE2FFD7FF10FD5CFEE9A04D.xml b/data/0D/1D/87/0D1D878EFFE2FFD7FF10FD5CFEE9A04D.xml new file mode 100644 index 00000000000..b6fa9e9fc46 --- /dev/null +++ b/data/0D/1D/87/0D1D878EFFE2FFD7FF10FD5CFEE9A04D.xml @@ -0,0 +1,253 @@ + + + +New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae) + + + +Author + +Blakemore, Robert J. + +text + + +Journal of Species Research + + +2012 + +2012-08-30 + + +1 + + +2 + + +133 +150 + + + + +http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133 + +journal article +10.12651/JSR.2012.1.2.133 +2713-8615 +13144524 + + + + + + + +Amynthas tralfamadore + +sp. nov. + + + + + + + +[ +Fig. 7 +] + + + + + +Diagnosis. + +Amynthas + +with spermathecal pores lateral in 7/8/9. Genital markings near spermathecal and male pores. Intestinal caeca simple with rugose inner face from 27. Spermathecal diverticula rounded rather than elongate and dorsal pores from 9/10. + + + + +Material inspected. + +Holotype +(H), +NIBR +IV0000246 +441, mature specimen fixed and stored in 80% ethanol (EtOH), here dissected and figured ( +Fig. 7 +), collected + +19.III.2012 + +by +RJB +& JooLae Cho of +NIBR +. + + + + + +Etymology. +After writer Kurt Vonnegut’s fictional biosphere reserve and exhibition. + + + + +Description. +Length +125 mm +, segments 125. A dark chocolate brown anterior dorsum with faint mid-dorsal line, clitellum darker and ventrum pale. Dorsal pores minute in 9/10 open from 10/11. Setae 46-50 per segment around segment 12, up to ca. 70 after clitellum. Spermathecal pores ca. 0.4 circumference apart in 7/8/9. Genital markings as small opposed discs just median to spermathecal pores paired either side in 7/8 (only one unilateral after 7/8rhs) and in 8/9 (plus one ‘rogue’ unilateral after 9/ 10lhs); similarly on either side of 18 just ventral to flat male pores. + + + +Fig. 7. + +Amynthas tralfamadore + +sp. nov. +holotype from NIBR Korea; [boxed is a X2 enlargement of 9 lhs spermatheca and 18rhs male pore]. + + +Internally, small stalked glands correspond to the external genital markings. Peptonephridia fill 5 and 6, septa to 7/8 are thin and absent in 8/9/10 where muscular gizzard occurs, and after this they are also thin. Nephridia meroic. Spermathecae in 8 and 9 each having round ampulla on short duct with rounded clavate diverticulum. Dorsal vessel single; hearts in 10-13. Metandric, testis possibly reduced in 10 but only found in 11 and there not iridescent; seminal vesicles larger posteriorly in 11 and smaller anteriorly in 12. Ovaries and funnels in 13. Prostate glands aborted and only short muscular ducts remain. Oesophagus only slightly dilated in 14-½15; intestine origin in 16 with simple caeca from 27 that are unusual in having a paler rugose and capillaried interior face extending forward to ca. 24. Thin lamellar typhlosole commences around 27. Gut contains organic soil and larger grits. + + + +Distribution. +Korea +, +Incheon +NIBR facility, possibly introduced from +Jeju +Island. + + +mtDNA COI Barcode result: + + +> + +WO2 + +A. tralfamadore + +Holotype +IV0000246441 from NIBR’s +Jeju +biosphere: GTGTTGGTATAGGATTGGATCTCCCCCTCCTGC TGGATCAAAGAATGATGTATTGAGGTTTCGATC TGTTAGTAATATGGTAATTGCCCCTGCCAGTAC AGGTAGGGACAATAGTAATAGTACTACAGTGA TTACTACTGCTCACACAAATAGTGGGATTCGTT CTAGACGTAACCCAGATCATCGTATGTTAATTA CTGTTGTGATAAAGTTAATAGCTCCAAGAATTG ACGAGGCACCTGCAAGATGAAGTGAGAAAATT GCAAGGTCTACTGAAGGACCGGCATGTGCTATA TTTCTTGCTAAGGGTGGGTAAACTGTTCAACCT GTGCCAGCCCCCTTTTCTACCGCGGCAGATCTT + + + +ACCAATAAAATTAATGATGGCGGGAGTAGTCA AAATCTTATGTTATTTAATCGAGGGAACGCCAT ATCTGGGGTTCCAAGTATTAGGGGTAGTAACCA GTTTCCGAATCCACCAATAAATACTGGCATTAC TAGAAAGAAGATTATTAAAAATGCATGTGCTGT TACAATTGTATTATATAGCTGGTCCCTACCAAG GAAGGATCCAGGTTGTCTTAACTCAATACGAAT AAGTAGTCTTATTCCTGCACCAATTATTCCTGCT CAAATTCCTAGAATAAAGTATAGGG megaBLAST showed no match better than 94% for voucher specimens, neither based on +types +, of AB542 533 “ + +Amynthas robustus + +” from +Japan +or EF077538 “ + +A. triastriatus + +” from +China +(an erstwhile synonym of + +M. masatakae + +), or only 85% of max identity for DQ224191 “ + +A. robustus + +” from +Taiwan +(cf. + +M. ryunome + +sp. nov. +). + + + + +Remarks. +A parthenogenetically degraded species, lacking prostate glands as with + +A. masatakae + +, nevertheless, in the key of +Sims & Easton (1972) +its incipient metandry corresponds to an + +A. martiorum + +-group. If holandric it would approach the large + +A. aeruginosus + +-group that contains both + +A. robustus + +and + +A. masatakae + +. + + +Distinctive characteristics of + +A. tralfamadore + +are the shape of spermathecae with the diverticula bulb spherical rather than elongate as in + +A. robustus + +or “paprika-shaped” in + +A. masatakae + +-although the importance of this in parthenogenetic morphs is perhaps debatable-and its inner face of intestinal caeca perhaps more rugose than in + +A. masatakae + +types +. Moreover, its paired sets of markings in 18 are slightly wider apart on each side compared to those in the + +A. masatakae + +types +( +Fig. 1 +). Its mtDNA COI barcode data serves to definitively characterize this species. + + +Although type-locality is the NIBR facility, its origin has yet to be clearly determined. The Jeju-do display uses bagged potting soil for bulking, but worms may have been accidentally introduced around roots of trees and shrubs and flowers directly imported from the +Island +or indirectly via plant nurseries. + + + +Fig. 8. + +A. shimaensis +Mt. Fuji + +specimen (YNU) [boxed +Goto & Hatai’s (1899 +: fig. 3)]. + + +This survey only took about 10 minutes and probably other species of earthworms are yet living in the facility, despite periodic replacement of the soil (pers. obs.), but a more extensive search was curtailed in order to protect the public display. + + + \ No newline at end of file diff --git a/data/0D/1D/87/0D1D878EFFE4FFD0FF10FADFFB33A015.xml b/data/0D/1D/87/0D1D878EFFE4FFD0FF10FADFFB33A015.xml new file mode 100644 index 00000000000..8882144a6f6 --- /dev/null +++ b/data/0D/1D/87/0D1D878EFFE4FFD0FF10FADFFB33A015.xml @@ -0,0 +1,162 @@ + + + +New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae) + + + +Author + +Blakemore, Robert J. + +text + + +Journal of Species Research + + +2012 + +2012-08-30 + + +1 + + +2 + + +133 +150 + + + + +http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133 + +journal article +10.12651/JSR.2012.1.2.133 +2713-8615 +13144524 + + + + + + + +Amynthas yamizoyamensis +( +Ohfuchi, 1935 +) + + + + + + + +Fig. 9. + +Amynthas yamizoyamensis + +after +Ohfuchi’s (1935 +: figs. 6- 10) originals. + + + + + +[ +Fig. 9 +]. + + + + + + + + +Pheretima yamizoyamensis + +Ohfuchi, 1935: 413 + + + +, figs. 6- 10. +Mt. Yamizo +, +Japan +. +Types +? + + + + + +Amynthas yamizoyamensis + +: + +Blakemore, 2010a: 193 + +(syn.? +conformis +). + + + +Note. +Name sometimes misspelt “yamijoyamensis” or “yamizoyamaensis”. + + + + +Material examined. +None-fate and location of the original +four syntypes +unknown. + + + + +Description. +Pinkish grey colour. Length, +136-177 mm +, segments 117-136. Setae 25-48. Spermathecae in 5/6/7/ 8/9. GMs large paired in 17/18. Male pores, superficial but “elevated” and separated by 7-10 setae. Presence of septa 8/9/10 unrecorded. Spermathecal diverticula variable as short stalks to long coiled ducts. Seminal vesicles in 11 and 12. Intestine from 15, caeca simple from 28. + + + + +Distribution. +Mt Yamizo ( +1022 m +) lies in three prefectures: +Fukushima +, Ibaragi and +Tochigi +. A similar if not conspecific Yamanashi-ken specimen ( +14/2/2003 +) is 10 + +15 also in YNU collection although its caeca are slightly incised ventrally. + + + +Remarks. +The question of restoration from +Easton’s (1981: 55) +synonymy in + +A. micronarius + +mooted by +Blakemore (2010a: 193) +is here supported. + + + + \ No newline at end of file diff --git a/data/0D/1D/87/0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.xml b/data/0D/1D/87/0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.xml new file mode 100644 index 00000000000..8099b24644c --- /dev/null +++ b/data/0D/1D/87/0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.xml @@ -0,0 +1,294 @@ + + + +New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae) + + + +Author + +Blakemore, Robert J. + +text + + +Journal of Species Research + + +2012 + +2012-08-30 + + +1 + + +2 + + +133 +150 + + + + +http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133 + +journal article +10.12651/JSR.2012.1.2.133 +2713-8615 +13144524 + + + + + + + +Metaphire ryunome + +sp. nov. + + + + +[Fig. 10.] + + + + +Material inspected. + +Holotype +(H), +NMST +An457, mature posterior amputee specimen fixed and stored in 80% ethanol (EtOH), here dissected and figured (Fig. 10), from Hikone collected + +2.II.2011 + +by +RJB +and +Shiga +Uni. students + +. + +Paratype +(P) +NMST +An458, mature complete specimen with same collection details, in 80% EtOH + +. + + + + +Etymology. +Japanese “dragon eyes”, for the appearance of the male pores. + + +146 JOURNAL OF SPECIES RESEARCH +Vol. 1, No. 2 + +5 10 15 27lhs 20 + + +Metaphire ryunome + + + +1 mm + + +Fig. 10. + +Metaphire + +18 lhs male pore of the +paratype +Diagnosis. +Marginally in + +Metaphire + +with spermathecal pores 0.3 apart in 7/8/9. Genital markings small near or within spermathecal and male pores. Intestinal caeca simple, smooth from 27. Spermathecal diverticula elongate. Dorsal pores from 10/11. + + + + +Distribution. +Japan +, Shiga-ken, Hikone (ca. 35̊16′N 136̊16′E), Kaideima-cho, from ‘aze’ (dividing pathway) adjacently to rice paddy plots used by +Shiga +University. + + + + +Description. +Length 30+mm (H) and +45 mm +with 70 segments (P). Dorsum a faint brown colour with no mid-dorsal line, clitellum darker and ventrum pale. Dorsal pores from 10/11. Setae ca. 60 per segment. Spermathecal pores ca. 0.3 circumference apart in 7/8/9. Genital markings as small discs just posterior to spermathecal pores in papillae internal to eye-like secondary male pores on 18 just medi- an to primary male pore within small hollow construed as strictly non-superficial thereby just qualifying for + +Metaphire + +. + +Internally, small stalked glands correspond to the external genital markings. Peptonephridia to 5/6, septa after this thin, 8/9 present (at least ventrally) going to base of gizzard, 9/10 absent, 10/11/12 slightly thickened. Nephridia meroic forests. Spermathecae in 8 and 9 each having spherical ampulla on short duct with elongate diverticulum (inseminated). Dorsal vessel single; hearts in 10-13. Holandric, testis in sacs in 10 & 11; seminal vesicles anteriorly in 11 & 12. Ovaries fan-shaped with funnels in +13; no ovisacs in 14. Prostate racemose on long muscular ducts. Oesophagus not dilated; intestinal origin in 16 with simple, smooth caeca from 27. Typhlosole and gut contents not recorded. Parasites not found. + +mtDNA COI-5P Barcode result: + + +Hikone + +Metaphire ryunome + +Holotype +(H) An457. + + + +BOLD +Systems (www.boldsystems.org/) data for +holotype +tagged An457.1 (compared to sub-samples An457.2 and to +paratype +(P) An458.1 and An458.2 all initially tagged as “ + +Metaphire robustus + +” from preliminary identification by + +RJB). + +AACTCTATACTTTATTTTAGGAATTTGAGCCGG AATAATCGGAGCTGGGATAAGCCTACTTATCCG CATTGAACTAAGTCAACCGGGGTCTTTCCTTGG AAGAGACCAGTTATATAATACGATTGTAACAGC ACATGCATTCCTCATAATTTTCTTCTTAGTAATA CCAGTATTTATTGGGGGGTTCGGAAACTGGTTG CTACCACTAATACTAGGAACACCAGATATAGCA TTCCCCCGACTAAATAACATAAGATTTTGACTA CTCCCCCCTTCCCTAATTCTCCTAGTGAGATCAG CTGCCGTAGAAAAAGGAGCAGGTACAGGTTGA ACAGTATACCCACCCCTAGCAAGAAATATAGC ACATGCGGGCCCCTCAGTAGATCTTGCAATCTT CTCACTACATTTAGCAGGTGCCTCGTCAATTTT AGGAGCTATTAATTTTATTACCACAGTGATCAA TATACGATGGTCAGGACTACGACTAGAACGAA TTCCATTATTTGTTTGAGCAGTAATAATTACTGT AGTACTACTACTATTATCACTCCCTGTACTAGC CGGTGCAATTACTATACTACTAACAGACCGAAA TCTTAACACATCCTTCTTTGATCCAGCTGGTGGT GGAGACCCAATTCTATACCAACACTTATTC BLASTn and megaBLAST analyses: +An457.1 vs. An457.2 vs. An458.1 vs. An458.2=100%, i.e. specimens same species. + +Sequence identity of An457.1 with + +A. tralfamadore + +type +is no better than 85%, meaning they are different species. + + +Results of megaBLAST of An457.1 show that it is 99% similar to “ + +Amynthas incongruus + +” voucher EF077552 from +China +; and is just 85% identified with “ + +Amynthas tristriatus + +” voucher EF077538 from +China +, or with “ + +Amynthas robustus + +” vouchers DQ224191 and AB542533 from +Taiwan +and +Japan +, respectively (i.e., similar to + +A. tralfamadore + +result). + + + + +Remarks. +Although coming closest to the restricted definitions of either + +A. masatakae + +or + +A. robustus + +( +Figs. 1 +& 2) the most noticeable differences are lack of markings either mid-ventrally in 18 or paired near spermathecal and/or male pores, respectively. On the basis of the morphology differing from the +types +of + +A. robustus + +or + +A. masatakae + +, and because the mtDNA COI barcodes differ from what workers in +Japan +and +Taiwan +label as “ + +A. robustus + +” (including + +masatakae + +?), these Hikone specimens are thus newly named. However, it is entirely possible that the COI vouchers from +Japan +and +Taiwan +represent some other valid or invalid synonyms of + +A. robustus + +as restored herein. + + + +Metaphire ryunome + +is morphologically comparable to +Kobayashi’s (1937) +Korean + +“ +masatakae + +” and to + +Pheretima reisuiensis +Kobayashi, 1938: 139 + +from “Zenra-nandô” (=South Cholla) that too has spermathecal pores in 7/8/9; however, its anterior markings are more median in intersegmental furrows, amongst many other differences such as its dorsal pores from 11/12 and setae numbering 25-60. +Kobayashi (1938) +figures and describes “ +Secondary male pore represented as a large eye-like aperture +” within which the primary male porophore is found. On the basis of this, it qualifies for genus + +Metaphire + +in a new combination as + +M. reisuiensis + +. + + +Possibly both species are transitional from + +Amynthas +Kinberg, 1867 + +to + +Metaphire +Sims & Easton, 1972 + +, the former having superficial male pores and often complex genital markings, the latter having non-superficial male pores often with intromittent organs in “copulatory pouches” of various depths thus having less need of genital markings to adhere, attach and help co-locate superficial pores of concopulants. + + + + \ No newline at end of file diff --git a/data/18/64/87/18648799B45DB20AFC94FB9D73F0A337.xml b/data/18/64/87/18648799B45DB20AFC94FB9D73F0A337.xml new file mode 100644 index 00000000000..ff9cc75e5ba --- /dev/null +++ b/data/18/64/87/18648799B45DB20AFC94FB9D73F0A337.xml @@ -0,0 +1,462 @@ + + + +A new cyclopoid copepod from Korean subterranean waters reveals an interesting connection with the Central Asian fauna (Crustacea: Copepoda: Cyclopoida) + + + +Author + +Karanovic, Tomislav + + + +Author + +Yoo, Hyunsu + + + +Author + +Lee, Wonchoel + +text + + +Journal of Species Research + + +2012 + +2012-08-30 + + +1 + + +2 + + +156 +174 + + + + +http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=156 + +journal article +10.12651/JSR.2012.1.2.156 +2713-8615 +13144456 +5652093A-DCD1-4ED7-9AF6-58682899A344 + + + + + + + +Monchenkocyclops changi + +sp. nov. + + + + + + + +( +Figs. 1-8 +) + + + + + + + +Type +locality. + +South Korea +, +Gangwondo region +, +Pyeongchang +city, +Jinbu town +, +Odae +stream, 37̊36′43.5′′N 128̊ 33′09.2′′E, + +516 m +a.s.l. + +, interstitial water from sandy bank + +. + + +Type material. + +Holotype +female dissected on two slides ( +NIBRIV0000232646 +) + +. + +Allotype +male also dissected on two slides ( +NIBRIV0000232647 +). Other +paratypes +are +one male +and +two females +on one SEM stub ( +NIBRIV +00 00232648), +one female +dissected on one slide ( +NIBRIV 0000232649 +); all collected at type locality; leg. +J.-L. Cho +, + +24 April 2010 + + +. + + + + +Etymology. +The new species is named in honour of Prof. + + +Cheon Young Chang ( +Daegu +University, +Korea +), in recognition of his enormous contribution to our knowledge of freshwater copepods in +Korea +. The name is a noun in the genitive singular. + + + + +Description. +Female (based on +holotype +and +three paratypes +). Total body length, measured from tip of rostrum to posterior margin of caudal rami (excluding caudal setae), from 789 to 796 µm (792 µm in +holotype +). Preserved specimens colourless; no live specimens observed. Integument weakly sclerotized, smooth, without cuticular pits or cuticular windows. Surface ornamentation of somites consisting of 111 pairs and 12 unpaired (mid-dorsal) pores and sensilla (numbered with Arabic numerals consecutively from anterior to posterior end of body, and from dorsal to ventral side in +Figs. 1A +, +2 +A-E, 3A, B, 4A); no spinules except on anal somite, caudal rami, and appendages. Habitus ( +Fig. 1A +) relatively robust, not dorso-ventrally compressed, with prosome/urosome ratio 1.5 and greatest width in dorsal view at posterior end of cephalothorax. Body length/width ratio about three (dorsal view); cephalothorax 2.3 times as wide as genital double-somite. Free pedigerous somites without lateral or dorsal expansions, all connected with well developed arthrodial membranes, and with narrow and smooth hyaline fringes. Pleural areas of cephalothorax and free pedigerous somites relatively well developed, covering insertions of cephalic appendages and praecoxae and partly coxae of swimming legs in lateral view. + + + +Fig. 1. + +Monchenkocyclops changi + +gen. et sp. nov. +, holotype female: A. habitus, dorsal view. B. antennula, dorsal view. Arabic numerals indicating sensilla and pores consecutively from anterior to posterior end of body, and from dorsal to ventral side (excluding appendages; those on cephalothorax not presented). Scale bars 100 µm. + + + + +Fig. 2. + +Monchenkocyclops changi + +gen. et sp. nov. +, holotype female: A. cephalothoracic shield, lateral view. B. cephalothorax, dorsal view. C. pleurons of free prosomites, lateral view. D. rostrum, dissected and flattened, original anterior view. E. pleuron of second free prosomite (third pedigerous somite), dissected and flattened. Arabic numerals indicating sensilla and pores consecutively from anterior to posterior end of body, and from dorsal to ventral side (excluding appendages). Scale bars 100 µm. + + + +Rostrum ( +Fig. 2D +) well developed, membranous, not demarcated at base, broadly rounded and furnished with single central sensilla frontally (no. 1) and one pair of sensilla (no. 2) and pores (no. 3) at its base; latter probably marking boundary between cephalothorax and rostrum. + + +Cephalothorax ( +Figs. 1A +, +2A, B +) as long as its greatest width (dorsal view), much narrower at anterior part and nicely oval; representing 34% of total body length. Surface of cephalic shield ornamented with six unpaired dorsal sensilla (nos. 4, 12, 18, 29, 43, 56) and 66 pairs of long sensilla and small cuticular pores (nos. 4-11, 13-17, 19- 28, 30-42, 44-55, 57-75); pores and sensilla 56-75 belong to first pedigerous somite, incorporated into cephalothorax. + + +Second pedigerous (first free) somite ( +Figs. 1A +, +2C +) relatively short, ornamented with four pairs of large sensilla (nos. 76, 78, 80, 81) and three pairs of cuticular pores pores (nos. 77, 79, 82); dorsal pair of sensilla no. 76 probably serially homologous to pair no. 67 on first pedigerous somite, and perhaps pairs no. 78 and no. 70 also serially homologous; others serially homologous pairs much more difficult to reconise. + + +Third pedigerous somite ( +Figs. 1A +, +2C, E +) slightly longer than second and significantly narrower in dorsal view, ornamented with two dorsal unpaired pores (nos. 83, 89), eight pairs of large sensilla (nos. 84-86, 88, 90-93), and one pair of lateral pores (no. 87); recognising serially homologous pairs not easy, but probably sensilla pair no. 84 serially homologous to pair no. 76 on second pedigerous somite. + + +Fourth pedigerous somite ( +Figs. 1A +, +2C +) significantly shorter and narrower than third, ornamented only with four pairs of large sensilla (nos. 94-97); recognising serially homologous pairs much easier than with two previous prosomites (94=90, 95=91, 96=92, 97=93). + + +Fifth pedigerous (first urosomal) somite ( +Figs. 3A, B +, +4A +) short, significantly narrower than fourth pedigerous somite and only slightly wider than genital double-somite in dorsal view, ornamented with one pair of pores (no. 98) and two pairs of large dorsal sensilla (nos. 99, 100); recognising serially homologous pairs not as easy as with two previous somites, but probably 99=94 and 100=96; hyaline fringe smooth and very narrow. + + +Genital double-somite ( +Figs. 3A, B +, +4A +) large, with deep lateral recesses at level of sixth legs and swollen antero-ventrally, widest at first third of its length and gradually tapering posteriorly, about 1.2 times as wide as long (dorsal view), ornamented with one unpaired central dorsal pore (no. 101), two pairs of central dorsal sensilla (nos. 102, 103), one pair of ventro-lateral central pores (no. 104), one unpaired posterior dorsal pore (no. 105), two pairs of posterior sensilla (nos. 106, 108), and two pairs of vento-lateral posterior pores (nos. 107, 109); dorsal sensilla probably serially homologous to those on fifth pedigerous somite (i.e. 102=99, 103=100), but recognising serial homologies of posterior sensilla and pores much harder (perhaps 105=101, 106=103); hyaline fringe deeply and irregularly serrated. Copulatory pore very small, ovoid, situated at about midlength of double-somite ventrally; copulatory duct narrow, siphon-shaped, weakly sclerotized. Seminal receptacle with relatively large anterior expansion and much smaller posterior expansion, representing 49% of double-somite’s length; oviducts broad and weakly sclerotized. Ovipores situated dorsolaterally at 2/5 of double-somite length, covered by reduced sixth legs. + + +Third (ancestral fourth) urosomite ( +Figs. 3A, B +, +4A +) relatively short, about 1.7 times as wide as long and only 0.4 times as long as genital double-somite in dorsal view, with also deeply and irregularly serrated hyaline fringe, ornamented with unpaired dorsal posterior pore (no. 110), two pairs of dorso-lateral large sensilla (nos. 111, 112), and two pairs of vento-lateral posterior pores (nos. 113, 114); serially homologous pores and sensilla relatively easy to recognize on genital double-somite (110=105, 111=106, 112=108, 113=107 (?), 114=109). + + +Fourth (preanal) urosomite ( +Figs. 3A, B +, +4A +, +8A +) narrower and shorter than third, with also deeply and irregularly serrated hyaline fringe, ornamented only with pair of lateral pores (no. 115) of uncertain serial homology. + + +Anal somite ( +Figs. 3A, B +, +4A +, +8A +) slightly narrower and shorter than preanal, with short medial cleft, ornamented with one pair of large dorsal sensilla (no. 117), two pairs of small dorsal pores (nos. 116, 118), one pair of small ventral pores (no. 119), and continous posterior row of large spinules. Anal sinus smooth. Anal operculum small, short, slightly convex, not reaching posterior margin of anal somite, representing 47% of anal somite’s width. + + +Caudal rami ( +Figs. 3A, B +, +4A +, +8A +) cylindrical, parallel, inserted close to each other, approximately 2.6 times as long as wide (ventral view) and twice as long as anal somite; armed with six setae (one dorsal, one lateral, and four terminal); ornamented with one dorsal pore in ante- + + +A B + + + +Fig. 3. + +Monchenkocyclops changi + +gen. et sp. nov. +, holotype female: A. urosome, ventral view. B. urosome, lateral view. Arabic numerals indicating sensilla and pores consecutively from anterior to posterior end of body, and from dorsal to ventral side (excluding appendages). Scale bars 100 µm. + + + + +Fig. 4. + +Monchenkocyclops changi + +gen. et sp. nov. +, A-E. holotype female. F. paratype female. A. urosome, dorsal view. B. antenna, dorsal view. C. labrum, anterior view. D. maxillula, posterior view. E. mandibula, anterior view. F. cutting edge of labrum, anterior view. Arabic numerals indicating sensilla and pores consecutively from anterior to posterior end of body, and from dorsal to ventral side (excluding appendages). Scale bars 100 µm. + + +rior part (no. 120), two lateral cuticular pores (nos. 121, 122), one pore on tip of protuberance on distal margin ventrally between two terminal setae (no. 123), rows of small spinules at base of lateral setae, and short row of minute spinules partly covering proximal lateral pore. Dorsal seta about 1.14 times as long as ramus, inserted at 5/6 of ramus’ length, biarticulate at base (inserted on small pseudo-joint) and pinnate at distal part. Lateral seta insert- ed at 2/3 of ramus’ length, 0.3 times as long as dorsal seta, unipinnate laterally and uniarticulate at base. Outermost terminal seta stout, spiniform, 0.6 times as long as ramus, densely bipinnate. Innermost terminal (accessory) seta short and slender, sparsely bipinnate, 0.75 times as long as outermost terminal seta. Principal terminal setae with breaking planes, bipinnate; inner principal terminal seta about 1.5 times as long as outer one and nearly seven times as long as caudal rami. + +Antennula ( +Fig. 1B +) 11-segmented, slightly curved along caudal margin, directed postero-laterally, not reaching posterior margin of cephalothoracic shield, ornament- ed just with arched proximo-ventral row of spinules on first segment (no pits or other integumental structures), with armature formula as follows (ae=aesthetasc): 8.4.8. 4.2.2.3.2+ae.2.3.7+ae. Only one terminal seta on ultimate segment biarticulating on basal part and most setae sparsely pinnate at distal end; both aesthetascs very slen- der; aesthetasc on eight segment reaching posterior margin in length. One seta on fifth segment spiniform and short; all other setae slender; one apical seta on eleventh segment fused basally to aesthetasc; second, fourth, and eleventh segments with one short seta, all other setae well developed. Length ratio of antennular segments, from proximal end and along caudal margin, 1: 0.4: 0.7: 0.4: 0.3: 0.5: 0.9: 0.8: 0.5: 0.7: 0.8. + + +Antenna ( +Fig. 4B +) five-segmented, strongly curved along caudal margin, comprising very short coxa, much longer basis and three-segmented endopod. Coxa without armature or ornamentation, about half as long as wide. Basis cylindrical, 2.1 times as long as wide, ornamented with two short, diagonal rows of spinules on ventral surface, armed with two subequal pinnate setae close on distal inner corner (exopodal seta absent). First endopodal segment narrower at basal part but also generally cyclindrical, 1.8 times as long as wide and 0.8 times as long as basis, with inner smooth seta at 2/3 and patch of spinules along caudal margin. Second endopodal segment also with narrow basal part and twice as long as wide, about as long as first endopodal, bearing nine smooth setae along inner margin (which progressively longer from proximal to distal part), ornamented with one row of spinules along caudal margin. Third endopodal segment cylindrical, 2.4 times as long as wide and as long as second endopodal segment, ornamented with two rows of slender spinules along caudal margin, armed with seven smooth apical setae (four of them strong and geniculate). + + +Labrum ( +Fig. 4C, F +) relatively large trapezoidal plate, with mascular base and strongly sclerotised distal margin (cutting edge), ornamented with two arched, short rows of eight long and slender spinules each on anterior surface, and central row of minute spinules between them. Cutting edge almost straight, with ten to 12 large and sharp teeth between produced and sharply and inwardly pointed lateral corners. + + +Mandibula ( +Fig. 3E, F +) composed of coxa and small palp. Coxal gnathobase cutting edge with five slender spinules on anterior surface, eight apical teeth, and dorsalmost bipinnate seta; ventralmost tooth strongest and quadricuspidate, second and fourth teeth from ventral side bicuspidate, all other teeth unicuspidate; three dorsalmost simple teeth partly fused basally and progressively longer from ventral to dorsal. Palp twice as wide as long, unornamented, armed with three apical setae: two long and plumose and one short and smooth; plumose setae subequal in length, directed posteriorly, nearly reaching posterior margin of cephalic shield. + + +Maxillula ( +Fig. 4D +) composed of praecoxa and two-segmented palp, unornamented. Praecoxal arthrite bearing four very strong distal spines (three smooth, blunt and fused at base; one distinct at base, sharp and with single proximal spinule) and six medial elements (proximalmost one longest and plumose, two distal-most ones with large and strong, three in middle small and slender). Palp composed of coxobasis and one-segmented endopod. Coxobasis with slender proximal seta (probably representing exopod) and three medial setae (two slender and smooth, one strong and bipinnate). Endopod with three slender and pinnate setae. + + +Maxilla ( +Figs. 5A +) five-segmented but praecoxa partly fused to coxa on anterior surface, unornamented. Proximal endite of praecoxa robust, armed with two subequal, sparsely bipinnate setae; distal endite small, unarmed. Proximal endite of coxa with one bipinnate seta; distal endite highly mobile, elongated and armed apically with two pinnate setae, proximal one somewhat longer and much stronger. Basis expanded into robust claw, and claw furnished with longitudinal row of four strong spinules at midlength, armed with two setae; strong seta about as long as claw, pinnate. Endopod two-segmented, but segmentation not easily discernable; proximal segment armed with two robust, unipinnate setae; distal segment with one robust, unipinnate apical seta and two slender and much shorter subapical setae. Longest seta on distal endopodal segment as long as longer seta on proximal endopodal segment. All strong setae on basis and endopod, as well as basal claw, unguiculate. + + +Maxilliped ( +Fig. 5B +) four-segmented, composed of syncoxa, basis and two-segmented endopod. Ornamentation consisting of three rows of long and slender spinules on basis (two on posterior surface close to outer margin and one on anterior surface close to inner margin), as well as one row of two smaller spinules on anterior surface of first endopodal segment. Armature formula: 2.2.1.3. All setae, except two on second endopodal segment, pinnate, and most very strong and unguiculate. + + + +Fig. 5. + +Monchenkocyclops changi + +gen. et sp. nov. +, holotype female: A. maxilla, anterior view. B. maxilliped, posterior view. C. first swimming leg, anterior view. D. second swimming leg, anterior view. Scale bar 100 µm. + + + +All swimming legs ( +Figs. 5C, D +, +6 +A-C) relatively large, composed of minute and triangular praecoxa, large and rectangular coxa, short basis, three-segmented exopod and two-segmented endopod. Endopods slightly shorter than exopods. Third exopodal segment spine formula 2. 3.3.3 and setal formula 4.4.4.4. All setae on endopods and exopods slender and plumose, except apical seta on exopod of first leg, which pinnate along outer margin and plumose along inner ( +Fig. 5C +); no modified setae observ- ed. All spines strong and bipinnate. Intercoxal sclerite of all swimming legs with slightly concave distal margin and without any surface ornamentation, except on posterior surface of fourth leg. + + +First swimming leg ( +Fig. 5C +) slightly shorter than other swimming legs; praecoxa unarmed, ornamented with distal row of small spinules on anterior surface; coxa 2.3 times as wide as long, ornamented with short transverse row of spinules on posterior surface close to outer margin, distal row of minute spinules on anterior surface, and small pore on anterior surface close to inner margin, arm- ed with long and plumose seta on inner-distal corner; basis almost pentagonal in shape, 0.8 times as long as coxa, armed with outer long and slender seta, and inner-distal strong and bipinnate element (latter not reaching distal margin of first endopodal segment in length), ornamented with row of slender spinules along inner margin, two posterior rows of shorter and stronger spinules on anterior surface (one at base of inner seta, other at base of endopod), and one cuticular pore on anterior surface close to outer margin; exopod with single outer spine and single inner seta on first and second segment, with two outer spines and four setae (two inner, two apical) on third segment, ornamented with distal rows of spinules on posterior surface of first segment, row of slender inner spinules on first and second segment, single small pore on anterior surface of second and third segments, and extremely minute spinules as base of almost all setae and spines on anterior surface; endopod armed only with inner seta on first segment, second segment with four inner setae, one apical spine, and one outer seta, ornamented with slender spinules along inner margins of both segments, single pore on anterior surface of second segment, with shorter and stronger spinules along distal margins of first segment on anterior surface, and minute spinules at base of most setae and apical spine on anterior surface; apical spine on second endopodal segment outwardly unguiculate, 0.9 times as long as segment and only slightly shorter than inner setae; second endopodal segment about 1.4 times as long as wide and 1.3 times as long as first endopodal segment, with small inner notch showing ancestral segmentation. + + +Second swimming leg ( +Fig. 5D +) slightly larger than first swimming leg; coxa 2.3 times as wide as long, armed with plumose inner seta (shorter than in first leg), ornamented with short row of strong spinules on posterior surface, in addition to distal row of spinules and small pore on anterior surface; basis with much shorter outer seta than in first leg, and without inner seta, with very small spiniform process instaed; exopod with longer third segment than in first leg, with three outer spines; endopod with longer second segment than in first leg; apical spine on second endopodal segment 0.8 times as long as segment or distal inner seta; second endopodal segment about 1.7 times as long as wide and 1.5 times as long as first endopodal segment. + + +Third swimming leg ( +Fig. 6A +) extremely similar to second leg, except second endopodal segment with five inner setae and apical spine proportionately shorter; apical spine on second endopodal segment 0.7 times as long as segment and 0.5 times as long as apical seta; second endopodal segment about 1.9 times as long as wide and 1.6 times as long as first endopodal segment. + + +Fourth swimming leg ( +Fig. 6B, C +), generally similar to third swimming leg, but slightly shorter and more slender, with longer and more plumose setae, with transverse row of long spinules on posterior surface of intercoxal sclerite and another one on posterior margin of coxa, and with second enopodal segment armed with three or four inner setae, two apical spines and one outer seta; second endopodal segment without notch on inner margin, with two pores on anterior surface, about 1.6 times as long as wide, and also 1.6 times as long as first endopodal segment; inner apical spine on second endopodal segment 1.4 times as long as outer apical spine, 0.65 times as long as segment, and less than 0.4 times as long as distal inner seta. + + +Fifth leg ( +Figs. 3A, B +, +6D +) inserted ventro-laterally, relatively small, two-segmented. First segment (possibly protopod) broad and short, almost rhomboidal in shape, half as long as greatest width, ornamented with single pore on anterior surface close to proximal margin, armed with single outer slender seta (probably ancestral outer basal), which inserted on short setophore and unipinnate distally. Second segment (probably exopod) irregularly cylindrical, widest at midlength, 1.2 times as long as first segment and 1.7 times as long as wide, unornamented, armed with apical long seta and subapical inner spine; apical exopodal seta bipinnate distally, 1.4 times as long as basal seta, 4.6 times as long as exopod, and nearly ten times as long as subapical spine, but only reaching midlength of genital double-somite in length; subapical exopodal spine small and slender, smooth, half as long as exopod and 0.8 times as long as exopod’s greatest width. + + + +Fig. 6. + +Monchenkocyclops changi + +gen. et sp. nov. +, A-E. holotype female. F. allotype male. A. second endopodal segment of third swimming leg, anterior view. B. left fourth swimming leg, anterior view. C. second endopodal segment of right fourth swimming leg, anterior view. D. fifth leg, anterior view. E. sixth leg, lateral view. Scale bar 100 µm. + + + + +Fig. 7. + +Monchenkocyclops changi + +gen. et sp. nov. +, allotype male. A. habitus, dorsal view. B. urosome, ventral view. C. right caudal ramus, dorsal view. D. right caudal ramus, lateral view. E. second endopodal segment of fourth swimming leg, anterior view. F. sixth leg, ventrolateral view. Arabic numerals indicating sensilla and pores consecutively from anterior to posterior end of body, and from dorsal to ventral side(excluding appendages). Scale bars 100 µm. + + + +Sixth leg ( +Figs. 6E +) small, short and broad semicircular cuticular plate, armed with two short and smooth spines and outermost much longer and distally unipinnate seta; inner spine fused to plate, outer articulated basally; outermost seta directed postero-dorsally. + + +Male +(based on +allotype +and +one paratype +). Total body length from 640 to 663 µm. Urosome with free genital somite. Habitus ( +Figs. 7A +) much more slender than in female, with prosome/urosome ratio about 1.35 and greatest width in dorsal view at second pedigerous somite. Body length/width ratio 3.3; cephalothorax about 1.9 times as wide as genital somite. Cephalothorax 1.1 times as long as wide (dorsal view); representing 32% of total body length. Ornamentation of cephalothorax and free prosomites ( +Fig. 7A +) and most urosomites ( +Figs. 7A, B +) with same number and distribution of sensilla and pores as in female. Unpaired dorsal pore on genital somite (no. 101) situated more posteriorly than dorsal pair of sensilla no. 102 (more anteriorly in female); ventral pair of pores on fourth urosomite (no. 114) situated closer to each other. + + +Genital somite ( +Fig. 7A, B +) 1.75 times as wide as long in dorsal view, with finely serrated hyaline fringe dorsally, ornamented with one unpaired dorsal pore (no. 101) and two pairs of dorsal sensilla (nos. 102, 103); no spermatophores visible inside; pair of pores on sixth legs probably homologous to lateral central pores on female genital double-somite (no. 104). Third urosomite homologous to posterior part of female genital double-somite, also ornamented with two pairs of posterior sensilla (nos. 106, 108) and two pairs of posterior ventral pores (nos. 107, 109). Fourth and fifth urosomite as in female. Anal somite ( +Fig. 7A, B +) as in female, except anal operculum slightly narrower and more convex. + + +Caudal rami ( +Fig. 7 +B-D) slightly more slender than in female and with proportionately longer outermost terminal setae, but with very similar ornamentation and armature as in female; outermost terminal seta about nearly twice as long as innermost terminal seta, and only slightly shorter than ramus. + + + +Fig. 8. +Scanning electron micrographs of + +Monchenkocyclops changi + +gen. et sp. nov. +, A. paratype female. B-D. paratype male: A. anal somite and caudal rami, dorsal view (most caudal setae broken off). B. proximal part of antennula, dorsal view. C. middle part of antennula, dorsal view. D. distal part of antennula, dorsal view. Scale bars 40 µm (A-C) and 20 µm(D). + + + +Antennula ( +Figs. 6F +, +8 +B-D) strongly prehensile and digeniculate, 17-segmented (but sixteenth and seventeenth segments partly fused on ventral side), ornamented with spinules only on first segment (as in female), with anvilshaped structures on anterior margin of fourteenth and fifteenth segments (distal geniculation). Armature formula as follows: 8+3ae.4.2.2+ae.2.2.2.2.2+ae.2.2.2.2+ae. 2.1+ae.4.8+ae. All aesthetascs linguiform and most relatively long and broad, apical one on seventeenth segment fused basally to one seta; most setae slender and smooth; short smooth setae on eighth (one), ninth (one), tenth (one), twelfth (two), and thirteenth (two) segments; shot pinnate elements on eleventh (one) and fourteenth (one) segments; several seta on seventeenth segment biarticulate distally or with breaking plane. + +Antenna, labrum, mandibula, maxillula, maxilla, first swimming leg, second swimming leg, and third swimming leg as in female. + +Fourth swimming leg ( +Fig. 7E +) also with similar armature and ornamentation as in female, as well as with similar proportions of spines and setae, except second endopodal segment with four inner setae (instead of three), and two proximal ones shorter, more slender and more sparsely plumose; second endopodal segment more slen- der than in female, about twice as long as wide. + + +Fifth leg ( +Fig. 7B +) similar to female, but with slightly shorter apical exopodal seta. + + +Sixth leg ( +Fig. 7F +) large cuticular plate, ornamented with single pore (probably no. 104) on anterior surface, armed with inner spine and two setae on outer distal corner; outermost seta 2.7 times as long as inner seta and 5.5 times as long as innermost spine. + + + + \ No newline at end of file diff --git a/data/41/32/A8/4132A810FFB1DB50FF40FB32C1B9F8F1.xml b/data/41/32/A8/4132A810FFB1DB50FF40FB32C1B9F8F1.xml new file mode 100644 index 00000000000..779206960fe --- /dev/null +++ b/data/41/32/A8/4132A810FFB1DB50FF40FB32C1B9F8F1.xml @@ -0,0 +1,272 @@ + + + +On Schmarda’s lost earthworm and some newly found New Zealand species (Oligochaeta: Megadrilacea: Lumbricidae, Acanthodrilidae, Octochaetidae, & Megascolecidae s. stricto) + + + +Author + +Blakemore, Robert J. +rob.blakemore@gmail.com + +text + + +Journal of Species Research + + +2012 + +1 + + +2 + + +105 +132 + + + +journal article +10.5281/zenodo.13144478 +2713-8615 +13144478 +E9D67D17-1460-4D96-999C-A0EAAB6F54EC + + + + + + + +Rhododrilus mangamingi + +sp. nov. + + + + + + + +[ +Fig. 10 +] + + + + + +Material Examined. + +Holotype +(H) +AMNZ86028 +(mature, sketched, dissected). +From +fenced remnant scrubland above and to +NE of Te Kopia +geothermal field features on sheep paddock at +Mangamingi Station +(ca. S38̊ +5.535 E +176̊12.996; +Atiamuri region +NZTM +E1880782 N5742 +165 +AMSL + +630 m + +pg. 223 of www.waikatoregion.govt. nz/PageFiles/20544/1.6TeKopia.pdf that provides ecological and vegetative data). Collected by RJB 28 +th +Nov., 2011. Fixed in 80% ethanol and small tissue sample removed for DNA analysis (WM5). + + + + + +Etymology. +After +type +locality. + + + + +Diagnosis. +Acanthodrilid with microscolecine reduction of male and prostatic pores to 17. Penial setae present. Muscular gizzard in 5. Spermathecal pores near b lines in 7/8/9. Markings on 19. Holoic nephridia avesiculate. mtDNA COI barcode as provided. + + +External characters. +Body circular. Pale unpigmented; clitellum buff. Length +60 mm +with 100 segments (broken in half during dissection). Prostomium epilobous. Setae lumbricine, evenly spaced. Clitellum annular, 13- 16. Neither dorsal pores nor nephropores found; however there are a few small mid-dorsal dots present after clitellum and minute perforations were detected in c lines in excised cuticle. Spermathecal pores near b lines in 7/8 and 8/9. Female pores on 14 above setae a. Male and prostatic pores combined at ab on 17; ab setae replaced with penial setae. Genital markings as faint indistinct pads in 19 posterior to ab setae (no glands internally). Setae ab in 18 and 19 appear unmodified. + + +Internal morphology. +Septa +all thin. Gizzard large in 5. Dorsal blood vessel single. The last pair of hearts detect- ed in 12. Nephridia holoic, avesiculate in c lines throughout. Spermathecae in 8 and 9 each a spherical ampulla on short duct with a thumb-like diverticulum. Testes flat and iridescent in 10 and 11. Seminal vesicles large, racemose posteriorly in 9 and anteriorly in 11 and 12. Small pseudo-vesicles on posterior of 12/13 and 13/14. Ovaries in 13 with several egg strings. Prostates tubular in 17 with a flaccid duct and long penial setae. Oesophagus not noticeably modified, with intestinal origin somewhat indeterminate after 16 (possibly in 17). Intestinal typhlosole absent. Gut contains fine soil (selective topsoil dweller rather than detritivore). + + + + +Ecology. +Dug from loose soil under scrub near paddock fenceline with + +Lumbricus rubellus + +, + +L. terrestris + +(specimens not kept) and with + +Deinodrilus orcus + +sp. nov. +nearby. + + +mtDNA results. +megaBLAST match no closer than 84% max identity with various worms, i.e., nothing similar yet sequenced on GenBank. + + + + +Remarks. + +Rhododrilus + +is one of the larger genera with 30 +New Zealand +members ( +Lee, 1952a +; +1959 +; +1962 +). The present species lacks dorsal pores (not mentioned by Lee) and has minute nephropores presumed to exit in setal c lines where avesiculate nephridia attach. Vesiculate + +Rhododrilus benhami +Lee, 1952 + +is superficially similar with faint markings in 19, but it has a tanylobous prostomium and spermathecal pores in setal a lines. Especially similar avesiculate species are + +Rhododrilus aquaticus +Lee, 1959 + +from Caswell Sound in the SW Fiordland that is smaller ( +30-40 mm +) with male pores at the end of a transverse ridge, amongst other differences, or + +R. cockaynei +Benham, 1905 + +from +Auckland +, Campbell and Snares Islands that has a saddle-shaped clitellum and spermathecal pores at anterior margins of 8 and 9 (or 7, 8 and 9). Species with spermathecal pores in 7/8/9 and annular clitella in 13-16,17 are + +R. huttoni +(Benham, 1901) + +and + +R. dobsoni +Lee, 1959 + +that also lack nephridial vesicles but both have prostatic pores in setal a lines; while vesiculate + +R. microgaster +Lee, 1959 + +and + +R. papaensis +Lee, 1952 + +additionally have reproductive pores that are mid-ventral or in ab lines, respectively. All four latter species also have different seminal vesicle arrangements. + + +The long, thin penial setae of the current species are distinctive, but their minutae are purposefully omitted for reasons cogently explained by +Blakemore (2002 +; +2010a +; +2010b +), viz.: the microscopic details reported for these are of debatable value for some such taxa as they vary individually, even within a bundle, are damaged or worn by age and use, and may be similar if not the same in several species. For example, +Lee (1962: 170) +found details of penial setae of + +Rhododrilus minutus +Beddard, 1889 + +to differ intraspecifically. And, as +Gates (1972: 23) +observed: “ +The systematic importance claimed for differences of shape, sculpturing, and ornamentation in those kinds of setae in the classical system, may have been too great. Penial setae may show considerable intraspecific variation or may be similar if not the same in several species +.” + + + +Fig. 9. + +Anisochaeta macleayi +( +Fletcher, 1889 +) + +, Wairakei Steamfield near original Geothermal well WK 44/0 (central specimen “S1” AMNZ 5262, rhs specimen “S2” AMNZ 5263). Specimens differ slightly but mtDNA COIs 100% identical. + + +Moreover, even when present, the reliance on penial setal detail for specific characterization requires these be + +20 +1 mm + + + +Fig. 10. + +Rhododrilus mangamingi +Blakemore + +, +sp. nov. +Holotype AMNZ86028 showing dorsal views of prostomium (pharynx everted) and pygidium; ventral aspect of body with gizzard, spermathecae in 8 rhs & 9 rhs and prostate in 17 lhs with penial setae +in situ +, plus actual setal ratios in 9 rhs. + + + + +elucidated for all specimens under consideration (which is not always the case), and is impracticable for the majority of field workers who lack access to high-powered or scanning electrode microscopes ( +SEM +) or for taxonomists pressed for time. Finally, their importance to determine specific affinities is rendered irrelevant when replaced by compelling DNA data (preferably from +types +), as used here + +. + + +Family + +OCTOCHAETIDAE +Michaelsen, 1900 +sensu +Blakemore, 2000 + + + +Genus + +Deinodrilus +Beddard, 1889 + + + + + \ No newline at end of file diff --git a/data/41/32/A8/4132A810FFB1DB56FF40FE35C71FFC71.xml b/data/41/32/A8/4132A810FFB1DB56FF40FE35C71FFC71.xml new file mode 100644 index 00000000000..cf6200c68fc --- /dev/null +++ b/data/41/32/A8/4132A810FFB1DB56FF40FE35C71FFC71.xml @@ -0,0 +1,105 @@ + + + +On Schmarda’s lost earthworm and some newly found New Zealand species (Oligochaeta: Megadrilacea: Lumbricidae, Acanthodrilidae, Octochaetidae, & Megascolecidae s. stricto) + + + +Author + +Blakemore, Robert J. +rob.blakemore@gmail.com + +text + + +Journal of Species Research + + +2012 + +1 + + +2 + + +105 +132 + + + +journal article +10.5281/zenodo.13144478 +2713-8615 +13144478 +E9D67D17-1460-4D96-999C-A0EAAB6F54EC + + + + + + + +Anisochaeta macleayi +( +Fletcher, 1889 +) + + + + + + + + +[ +Fig. 9 +] + + + +This species is fully described by Blakemore (1994; 1997; 2000a; 2010b), and in +Blakemore & Elton (1994) +but under its prior name, + +Spenceriella macleayi + +. + + + + +Distribution. +Australia +, these +two specimens +from Wairakei are a new record for +NZ +. Possible mechanisms for transportation are as discussed in +Blakemore (1999 +, +2010b +). + + +mtDNA. +Whereas, BLASTn of + +Anisochaeta macleayi + +specimens AMNZ 5262 and 5263 (S1 & S2) show 100% agreement, surprisingly they show similarity no better than 86% with congeneric + +A. kiwi + +. megaBLAST matches no better than 87% with Asian megascolecids. + + + + +Remarks. +Further work is required to investigate the molecular boundaries of these taxa. + + + + \ No newline at end of file diff --git a/data/41/32/A8/4132A810FFBCDB54FCE9FB52C4ECFCF1.xml b/data/41/32/A8/4132A810FFBCDB54FCE9FB52C4ECFCF1.xml new file mode 100644 index 00000000000..74f6d9186a6 --- /dev/null +++ b/data/41/32/A8/4132A810FFBCDB54FCE9FB52C4ECFCF1.xml @@ -0,0 +1,436 @@ + + + +On Schmarda’s lost earthworm and some newly found New Zealand species (Oligochaeta: Megadrilacea: Lumbricidae, Acanthodrilidae, Octochaetidae, & Megascolecidae s. stricto) + + + +Author + +Blakemore, Robert J. +rob.blakemore@gmail.com + +text + + +Journal of Species Research + + +2012 + +1 + + +2 + + +105 +132 + + + +journal article +10.5281/zenodo.13144478 +2713-8615 +13144478 +E9D67D17-1460-4D96-999C-A0EAAB6F54EC + + + + + + + +Anisochaeta kiwi + +sp. nov. + + + + + + + +[ +Fig. 6 +] + + + + + +Material Examined. + +Holotype +, H ( +AMNZ 5270 +), a complete specimen, sketched and dissected, plus +paratype +P1 ( +AMNZ 5271 +) also sketched and dissected, +paratypes +P2-P16 ( +AMNZ 5272 +) 14 mostly mature specimens, including +two juveniles +and an anterior “head” regenerate specimen that lacks markings (regressed?). +From SW +face of +Mt +Wellington, Auckland +(ca. 36̊892990S 174̊ 845545E, + +120 m + +). +Collector +RJB, 14 +th +Oct. +, 2011. + +Etymology. +Nominal + +taxon after “Kiwi”, the colloquial name for + +New Zealanders. +Diagnosis. + + +Anisochaeta + +having spermathecal pores in bc lines in 7/8/9; markings absent from anterior but variously near male pores, strong gizzard in 5, last hearts in 12 and oesophagus dilated in 13; ovisacs typically present in 14. COI barcode in + +Appendix I. +Behaviour. +Vigorous + +and rapid escape to disturbance (more so than lumbricids). + +Length + + +. + +Holotype +(H) ( +AMNZ 5270 +) ca. +90 mm +; mature +paratypes + +85-95 mm +Widths. + +ca. +1-1.5 mm +. + +Body +/segments. + +(H) 95; body tapers and flattens to tail end + +. + + + +Fig. 5. + +Anisochaeta laingii +( +Benham, 1903 +) + +from Norfolk Island (Australia) the only previous + +Anisochaeta + +questionably reported from NZ. Its markings in segments 10-12 and 17 differ, but internal organization is somewhat similar to the new + +Anisochaeta +spp. + +herein (After Benham’s original with copy permission from Royal Society NZ; Oct., 2011). + + + +Colour. +A brick brown-red or puce dorsum with iridescent sheen, with a darker mid-dorsal line; pale ventrally; clitella buff. + + +Prostomium. +Open epilobous; ventrally cleft peristomia. + + +First dorsal pore. +From 5/6. + + +Setae. +Perichaetine with 28-36 per segment increasing further posteriorly. + + +Nephropores. +Not found (meroic). + + +Clitellum. +Annular ½13-16, sometimes slightly encroaching into 17 (e.g. P1). + + +Male pores. +Superficial and small eye-shaped on low papillae insunk on +18 in +setal b lines. + + +Female pores. +Single mid-ventral on 14. + + +Spermathecal pores. +7/8 and 8/ +9 in +line with setal interval bc. + + +Genital markings. + +Holotype +(H) has small disc-like markings paired posteriorly in 17 and anteriorly in 19 lining up with the male pores; its P +1 paratype +has them narrow- er in 17 and in 17/18, rather than 19, where they are wider; other mature +paratypes +( +AMNZ 5272 +) have various combinations including marking on +16 in +some or near 17/18 and 18/19, the last location more usual; +one specimen +with no marking was also an anterior regenerate. + + + + +Septa +. + +None especially thickened. + + +Blood vessels. +Dorsal vessel single, connects to supraoesophageal as seen in 9-½14. + + +Hearts. +Commissurals in 7-9, hearts in 10-12 from supraoesophageal vessel. + + +Gizzard. +Compact and muscular in 5 preceded in 4 by pharyngeal mass. + + +Calciferous glands. +Oesophagus only slightly dilated in 13; valvular in 15. + + +Intestine. +Origin in 16; caeca absent; typhlosole not found. + + +Nephridia. +Meroic, with large tufted peptonephridia anteriorly in 4. + + +Testis/seminal vesicles. +Holandric, paired testis in 10 and 11 free but invested in mucus; seminal vesicles pair- ed, racemose in 9 and larger in 12. + + +Ovaries. +In 13; ovisacs in 14. + + +Prostates and penial setae. +Tubuloracemose gland with short duct; penial setae not found but their presence anticipated, possibly as small setae implicated with the male pores, since setae a are most often occluded or displaced on 18. + + +Spermathecae. +In 8 and 9 with globular ampullae each with a shorter, curved diverticulum not especially dilat- ed terminally, opening by its own duct into short main duct. + + +Gut contents. +Organic mixed soil. + + +mtDNA results. +BLASTn analysis of COI results (Appendix I) shows that + +A. kiwi + +holotype +(H) and +paratype +(P1) are 100% identical despite their apparent differences in genital markings (cf. + +A. macleayi + +outlined below). mega +BLAST +has no close matches-the nearest at 85% max identity is an unidentified GenBank “ +Megascolecidae +sp.” from the +Philippines +. + + + + +Remarks. +A species introduced from +Australia +, where its origin and nearest relations may be sought (possibly with different provenances of its sub-species, + +A. kiwi mihi + +below). It differs from + +Anisochaeta minor +(Spencer, 1900) + +from +Queensland +which is usually just +50-60 mm +long, with paired female pores (always?), and often distinctive genital markings paired in 10, 11 (and 16 or 17) and 20 that, although varying between its specimens, are the usual locations. Distinction of the current species from the rather inadequate description of + +Anisochaeta laingii +( +Benham, 1903 +) + +( +Fig. 5 +) is mainly due to its lack of markings on 10-12 and the characteristically con-joined pair in 17; instead, + +A. kiwi + +most consistently displays a pair of small papillae in or near 18/19 below its male pores and other combinations as noted. + + + +Fig. 7. +“ + +Spenceriella decapita + +” unpublished Queensland taxon from Blakemore (1994). This damaged specimen (ANIC RB.95. 5.19) is remarkably similar to Mt Wellington paratypes, especially P1, of + +A. kiwi kiwi + +(Fig. 6). + + + + +Fig. 6. + +Anisochaeta kiwi +Blakemore + +sp. nov. +Holotype (AMNZ 5270) from Mt Wellington. Ventral aspect with dorsal view of epilobous prostomium, spermathecae and 18 lhs prostate +in situ +; male field of Paratype P1 (AMNZ 5271) shown for comparison (also cf. Fig. 7). Superficially differing, mtDNA COI agrees 100% for H and P1, i.e., same species (see Appendix I). + + + + +Anisochaeta kiwi + + +is somewhat reminiscent of + +A. sebastiani +( +Blakemore, 1997 +) + +that is widely distributed in +Eastern +Australia +and +Tasmania +, but which has a vestigial gizzard and typically lacks genital markings entirely. +Remarkably +, the current species-and especially specimen P1 from +Mt Wellington +( +Fig. 6 +)-resemble almost exactly one described 20 yrs earlier under the provisional name “ +Spenceriella decapita +” ( +Fig. 7 +) from the 80 or so species in a PhD +Thesis +(Blakemore, 1994). +This +specimen ( +ANIC +RB.95.5.19-see www.annelida.net/earthworm/ Australian%20Earthworms/Register.xls) was collected by +C.H. Thompson +, 24 +th +May +, 1992 from a rural-residential garden at +Brookfield +, +Brisbane +, +Queensland-the +possible state of origin of the current stock. +The +only significant difference is that I recorded its last hearts as in segment 13. +For +that unpublished species, +Blakemore +(1994: 542) noted + +: + + +“ +The endemic genus +Spenceriella +[now= + +Anisochaeta + +] +has many unnamed and morphologically similar species, often differing intraspecifically +[I meant to say ‘interspecifically’] +in the distribution of genital markings. The damaged individual described here is insufficient for definite classification, but appears very similar in form to +S. sebastianae +and +S. stephanie [eventually published as + +Anisochaeta sebastiani +( +Blakemore, 1997 +) + +and + +A. stephanieae +( +Blakemore, 1997 +) + +].” + + + + \ No newline at end of file diff --git a/data/41/32/A8/4132A810FFBEDB58FCE9F93AC136FE33.xml b/data/41/32/A8/4132A810FFBEDB58FCE9F93AC136FE33.xml new file mode 100644 index 00000000000..f300c227d20 --- /dev/null +++ b/data/41/32/A8/4132A810FFBEDB58FCE9F93AC136FE33.xml @@ -0,0 +1,212 @@ + + + +On Schmarda’s lost earthworm and some newly found New Zealand species (Oligochaeta: Megadrilacea: Lumbricidae, Acanthodrilidae, Octochaetidae, & Megascolecidae s. stricto) + + + +Author + +Blakemore, Robert J. +rob.blakemore@gmail.com + +text + + +Journal of Species Research + + +2012 + +1 + + +2 + + +105 +132 + + + +journal article +10.5281/zenodo.13144478 +2713-8615 +13144478 +E9D67D17-1460-4D96-999C-A0EAAB6F54EC + + + + + + + +Eisenia japonica japonica +(Michaelsen, 1892) + + + + + +[Fig. 3] + + + + +This taxon and its sub-species are reviewed in detail by +Blakemore (2003 +, +2010b +) and in +Blakemore & Grygier (2011) +based on German +types +and fresh Japanese material. The +NZ +specimen is described below for comparison. + + + + +Distribution. +Possibly endemic to +Japan +( +Hokkaido +to Kyushu) and +Korea +, or to +China +and Siberia where it is listed in a Red Data Book of the +Russian Federation +from +Sakhalin +Island; introduced to +Taiwan +, there is a single record from +Germany +plus an unconfirmed report from +Slovakia +. No previous records are from Australasia. + + + + +Material examined. + +Specimen ( +AMNZ86031 +) from Waiotapu-Ngapouri, immediately behind the Arataki Honey processing yards in a midgy, waterlogged paddock (S38̊ +20.447 E +176̊21.654; Grid ref. ca. NZtopo50 BF + +37934511, 400 m + +AMSL +, from www.waikatoregion.gov.nz/PageFiles/ 20544/1.3Waiotapu.pdf: pg 108 with vegetation data) adjacent to a geothermal pool (soil pH 4.7, 23.5̊C). Collector, RJB, + + +28 +th +Nov. 2011 + + +. Sample also contains an unidentified immature lumbricid ( +AMNZ86032 +) for which DNA is pending + +. + + + + + +Description of +NZ +specimen. + +Body circular in section, +41 mm +long with 121 segments (11/12 and 33-34 slightly irregular/damaged); unpigmented and transparent in posterior and ventrum, pink anteriorly and puce dorsally, clitellum buff, saddle-shaped in ½23,24-31 with TPs prominent on 27 & 29. Prostomium open epilobous. + + +Setae lumbricine with ventrally tumidity around ab on 14, 21, 25, 26, and slightly in 29-31. Dorsal pores minute in 3/4, open from 4/5. Nephropores in mid-bc in 8-12, 15-16rhs, 19-21 and above d in other segments (especially obvious on clitellum). Spermathecae in 9/10/ +11 in +setal c lines. Female pores on 14 lateral to b setae. Male pores small on +15 in +mid-bc. + +Internally, septa are not especially thickened. Commissurals are in 7 (and 8?), hearts in (8),9-10 but not clearly found in 11. Holandric with testis iridescent and free in 10 & 11, seminal vesicles small in 9 and 10 and larger in 12. Spermathecae are lateral in 9 & 10. Ovaries and funnels are in 13; no ovisacs noted in 14. Annular calciferous glands are in 11 & 12. The intestinal crop is in 15- 16, the muscular gizzard occupies 17-18 with a low typhlosole developing soon after. Nephridia are vesiculate, the bladders sausage shaped. + +mtDNA results. + +Unfortunately, results for +syntypes +failed and the +Arataki +sample WM6 was contaminated (resamples as WO8 and WO9 also failed), but data for +Japanese +topotypic and +other specimens +of + +E. japonica + +from +National Museum of Nature +& +Science +, +Tokyo +(hereafter +NSMT +) An-415 & An-417 (detailed in http://ibol.org) are given in +Appendix I + +. + + + + +Remarks. +Albeit manifestly different in other regards, the markings when prominent in 27 & +29 in + +E. japonica + +sub-species are reminiscent to those in 28 & +30 in + +Allolobophora cupulifera +Tétry, 1937 + +. The Arataki specimen from +NZ +complies with previous descriptions of +A. + + + +japonica japonica + +(its DNA sample was contaminated or mixed up). + + +A distinct specimen (NSMT An-415) from Hodogaya shows molecular similarity no better than 93% with (NSMT An-417) +topotype +from Enoshima, confirming my initial reservation of its inclusion and indicating, moreover, that speciation and divergence has already occurred within native (or introduced?) populations in +Japan +. The opportunity is here taken to formally name and briefly describe this specimen, comparing it to the Arataki specimen of + +E. japonica + +and to + +E. anzac +Blakemore, 2011 + +, as follows. + + + + \ No newline at end of file diff --git a/data/43/D1/72/43D1724ED18057A1A2A26F345CE8A189.xml b/data/43/D1/72/43D1724ED18057A1A2A26F345CE8A189.xml new file mode 100644 index 00000000000..c076d4db243 --- /dev/null +++ b/data/43/D1/72/43D1724ED18057A1A2A26F345CE8A189.xml @@ -0,0 +1,186 @@ + + + +New records on the distribution of the Mexclapique, Girardinichthys viviparus (Bustamante, 1837) (Cyprinodontiformes, Goodeidae), an endangered species in Mexico + + + +Author + +López-Segovia, Eduardo +0000-0001-8065-1521 +Posgrado en Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México; Av. Universidad 3000, Ciudad Universitaria, Coyoacán, C. P. 04510, Ciudad de México, Mexico + + + +Author + +Pérez-Díaz, Jorge +0000-0002-3232-8233 +Posgrado en Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México; Av. Universidad 3000, Ciudad Universitaria, Coyoacán, C. P. 04510, Ciudad de México, Mexico + + + +Author + +Del Moral-Flores, Luis Fernando +0000-0002-7804-2716 +Posgrado en Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México; Av. Universidad 3000, Ciudad Universitaria, Coyoacán, C. P. 04510, Ciudad de México, Mexico + + + +Author + +Hernández-Arellano, Tao +0000-0003-0898-5978 +Posgrado en Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México; Av. Universidad 3000, Ciudad Universitaria, Coyoacán, C. P. 04510, Ciudad de México, Mexico & Laboratorio de Zoología, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México. Av. de los Barrios No. 1, Los Reyes Iztacala, 54090 Tlalnepantla de Baz, Estado de México, Mexico + +text + + +Neotropical Biology and Conservation + + +2024 + +2024-07-31 + + +19 + + +3 + + +347 +359 + + + +journal article +300417 +10.3897/neotropical.19.e126767 +e0d248a6-fa06-4841-b4fb-0e073695b5ac +1840813B-6181-400F-A8CD-97625A5305CD + + + + + +Girardinichthys viviparus +( +Bustamante, 1837 +) + + + + + +Figs 1 +, +2 +, +3 + + + + +Material collected. + + +Mexico +: +CIFI +1505, 21 ind., +20.9–36.5 mm +SL +, Atlangatepec Lake, Atlangatepec municipality, Atoyac River basin, + +19 ° 32 ' 58.2 " N +, +98 ° 10 ' 32.5 " W + +, +18 Feb 2019 +, Col. Perez-Díaz, J.; +CIFI +1708, 31 ind., +21.5–48.2 mm +SL +, Tochac Lake, borderline of the municipality of Benito Juárez, +Tlaxcala +and San Antonio Atocha, +Hidalgo +, Moctezuma River basin, + +19 ° 36 ' 58.3 " N +, +98 ° 26 ' 46.2 " W + +, +20 Jun 2019 +, Col. Pérez-Díaz, J., Perez-Díaz, Y. A., Hernández-Arellano, +T +., López-Segovia, E.; +CIFI +1598, 13 ind., +18.6–53.4 mm +SL +, Tenexac reservoir, Terrenate municipality, Tecolutla River basin, + +19 ° 30 ' 03.6 " N +, +97 ° 58 ' 50.6 " W + +, +7 Mar 2020 +, Col. Pérez-Huerta, J. A., Pérez-Díaz, J., López-Segovia, E.; +CIFI +1709, 75 ind., +21.6–29.2 mm +SL +, Tenexac reservoir, Terrenate municipality, Tecolutla River basin, + +19 ° 30 ' 05.5 " N +, +97 ° 58 ' 51.4 " W + +, +18. Jul 2020 +, Col. Pérez-Díaz, J., Hernández-Arellano, +T +., Del Moral-Flores, L. F., López-Segovia, E.; +CIFI +1710, 13 ind., +20.9–29.52 mm +SL +, " Jagüey ", near Atlangatepec Lake, Loma Bonita, Atlangatepec municipality, Atoyac River basin, + +19 ° 31 ' 53.6 " N +, +98 ° 12 ' 56.8 " W + +, +19 Jul 2020 +, Col. Pérez-Díaz, J., Hernández-Arellano, +T +., Del Moral-Flores, L. F., López-Segovia, E.; +CIFI +1711, 7 ind., +17.9–31.2 mm +SL +, Atlangatepec Lake, Atlangatepec municipality, Atoyac River basin, + +19 ° 33 ' 24.6 " N +, +98 ° 12 ' 08.9 " W + +, +19 Jul 2020 +, Col. Pérez-Díaz, J., Hernández-Arellano, +T +., Del Moral-Flores, L. F., López-Segovia, E. + + + + \ No newline at end of file diff --git a/data/78/7E/26/787E262FB52656F2B2ABBACADACF5638.xml b/data/78/7E/26/787E262FB52656F2B2ABBACADACF5638.xml new file mode 100644 index 00000000000..cd1504667f3 --- /dev/null +++ b/data/78/7E/26/787E262FB52656F2B2ABBACADACF5638.xml @@ -0,0 +1,409 @@ + + + +Two new species of the genus Halichoanolaimus (Nematoda, Selachinematidae) from the intertidal zone of the Yellow Sea, China + + + +Author + +Huang, Mian +0000-0003-3343-1520 +College of Life Sciences, Liaocheng University, Liaocheng 252059, China + + + +Author + +Zhai, Hongxiu +0000-0003-0003-9549 +College of Life Sciences, Liaocheng University, Liaocheng 252059, China + +text + + +ZooKeys + + +2024 + +2024-07-31 + + +1208 + + +259 +274 + + + +journal article +10.3897/zookeys.1208.124047 +CA37DEF5-365F-4B12-AC70-78C5E7EEA7BE + + + + + +Halichoanolaimus sinensis + +sp. nov. + + + + +Figs 1 +, +2 +, +Table 1 + + + + +Material examined. + + + +Four males +and +two females +were obtained. + +Holotype + +: +♂ +1 on slide RZ 08-7 - 5; + +paratypes + +: +♂ +2 on slide RZ 08-7 - 2, +♂ +3 on slide RZ 08-7 - 5, +♂ +4 and +♀ +1 on slide RZ 08-7 - 3, and +♀ +2 on slide RZ 08-7 - 2. +Type +specimens were deposited in the +Marine Biological Museum +of the +Chinese Academy of Sciences +, Qingdao. + + + + + +Type locality and habitat. + + +Holotype +and all +additional specimens +were found from intertidal silt sediment at Rizhao coast of the Yellow Sea; + +35 ° 26 ' N +, +119 ° 34 ' E + +; +0–2 cm +and +2–5 cm +sediment depth. + + + + +Etymology. + + +The specific epithet refers to the country origin, +China +. + + + + +Measurements. + + +All measurement data are given in Table +1 +. + + + + + + +Individual measurements of + +Halichoanolaimus sinensis + +sp. nov. +(in µm except for ratios; -, null). + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
CharactersHolotypeParatypes
male +males ( +N += 3) + +females ( +N += 2) +
Total body length24162197 ± 59.0 (2138–2259)2792 ± 38.2 (2765–2819)
Maximum body diameter6672.3 ± 2.1 (70–74)86.0 ± 5.7 (82–90)
Head diameter3635.3 ± 3.1 (32–38)39.0 ± 0.8 (37–41)
Length of outer labial sensilla43.0 ± 0 (3–3)3.0 ± 0.0 (3–3)
Depth of buccal cavity4636.0 ± 2.6 (31–38)40.0 ± 0.0 (40–40)
Width of amphid1411.3 ± 1.2 (10–12)10.0 ± 0.0 (10–10)
Amphid from anterior end2020.0 ± 1.7 (19–22)14.0 ± 1.4 (13–15)
Nerve ring from anterior end140117 ± 0 (117–117)–
Length of pharynx320301.3 ± 24.0 (274–319)307.0 ± 18.4 (294–320)
Body diameter at pharyngeal base6667.0 ± 4.0 (63–71)69.0 ± 9.9 (62–76)
Spicule length along arc8279.7 ± 5.5 (76–86)–
Length of gubernaculum4245.0 ± 5.3 (41–51)–
Number of precloacal supplements1012.0 ± 1.0 (11–13)–
Vulva from anterior end––1251.5 ± 153.4 (1143–1360)
V %––44.8 ± 4.9 (41.3–48.2)
Body diameter at cloaca5555.3 ± 1.2 (54–56)–
Tail length166190.7 ± 7.6 (182–196)204.0 ± 2.8 (202–206)
a36.630.4 ± 1.3 (28.9–31.4)32.6 ± 2.6 (30.7–34.4)
b7.67.3 ± 0.8 (6.9–8.2)9.1 ± 0.4 (8.8–9.4)
c14.611.5 ± 0.8 (10.9–12.4)13.7 ± 0.0 (13.7–13.7)
c′3.03.5 ± 0.2 (3.3–3.6)3.1 ± 0.4 (2.8–3.4)
+ + + + +Description. + + +Males. +Body cylindrical, tapering slightly towards posterior end. Cuticle with transverse rows of punctations, lateral differentiation consisting of slightly larger and more widely spaced punctations. Cuticle pore not observed. Somatic setae short, 3 µm long, sparsely distributed. Lip region slightly rounded. Six inner labial sensilla papillose; six outer labial sensilla setiform, 3–4 µm long, at same level as four papilliform cephalic sensilla (Fig. +2 C +). Amphideal fovea multispiral with 3 turns (Fig. +2 B +), 25–27 % of corresponding body diameter in width, located at the level of the middle of buccal cavity, ca 20 µm from anterior end of body. Buccal cavity large, ca 45 µm deep, divided into anterior and posterior portions by two rows of 15–17 denticles. Anterior portion of buccal cavity cup-shaped, with three sets of three cuticularized rhabdions; posterior portion of buccal cavity narrower, cylindrical, surrounded by three Y-shaped pairs of cuticularized rhabdions with swollen bases, 20 µm long. Pharynx cylindrical, anterior end swelling, wrapped the buccal cavity, without posterior bulb. Pharyngeal lumen cuticularized. Nerve ring at ca 44 % of pharynx length from anterior end. Secretory-excretory system present. Renette cell small, situated at level of cardia; ampulla large, excretory pore situated slightly posterior to the nerve ring, ca 180 µm from the anterior end. Cardia small, surrounded by intestine. + + + + + + +Drawings of + +Halichoanolaimus sinensis + +sp. nov. +A +pharyngeal region of male +B +posterior end of male +C +entire body of female +D +entire body of male +E +anterior end of male. Scale bars: 30 μm ( +A, B, E +); 100 μm ( +C, D +). + + + + + + + +Microscopic images of + +Halichoanolaimus sinensis + +sp. nov. +A +anterior end of holotype, showing buccal cavity and excretory ampulla (arrow) +B +anterior end of male 2, showing amphidial fovea +C +anterior end of holotype, showing stomatorhabdions and anterior sensilla (arrow) +D +posterior part of holotype, showing supplements +E +cloacal region, showing spicules, gubernaculum and supplements. Scale bars: 20 μm ( +A, B, C, E +); 30 μm ( +D +). + + + +Reproductive system diorchic with two opposed, outstretched testes. Anterior testis to the right or ventrally to intestine, posterior testis to the left side of intestine. Spicules paired, curved, middle portion broad, tapering distally, 1.4–1.5 cloacal body diameters long, interior of spicules granular in appearance. Gubernaculum slender, consisting of two detached lateral pieces tapering distally, adjoining the dorsal side of spicules. 10–13 papilliform precloacal supplements in two groups, the posterior three supplements smaller and closer to each other (Fig. +2 E +), located 7 µm from the cloaca; 5 µm from each other; remaining supplements larger and widely spaced, ca 25 µm from each other. Each supplement consisting of conical papilla and an internal duct. Tail conico-cylindrical with posterior cylindrical portion comprising about half of total tail length. Caudal setae absent. Three caudal glands located posterior to spicules, spinneret present, 7 µm long. + + +Females. +Similar to males, but with slightly larger body and slightly smaller amphideal fovea (20 % of corresponding body diameter in width and with 2.5 turns). Reproductive system didelphic, with two opposed, reflexed ovaries. Anterior ovary to the left of intestine and posterior ovary to the right of intestine. Vulva situated slightly pre-median. Intestine blind, anus not observed. + + + + +Differential diagnosis and discussion. + + + +Halichoanolaimus sinensis + +sp. nov. +is characterized by amphideal fovea with 2.5–3.0 turns, 20–27 % of corresponding body diameter; spicules curved, middle portion broad, tapering distally, 1.4–1.5 cloacal body diameters long; gubernaculum slender consisting of two detached lateral pieces tapering distally; 10–13 papilliform precloacal supplements in two groups, the posterior three supplements smaller and closer to each other, remaining supplements larger and widely spaced; tail conico-cylindrical with half cylindrical portion. The new species is most similar to + +H. sonorus + +Belogurov & Fadeeva, +1980 in + + +body shape and number of precloacal supplements, but differs from the latter species by numbers of amphid turns (2.5–3 vs 4–4.2), different shape and structure of spicules (spicules without capitulum, distal hook and central spacer vs with weak capitulum, distal hook and central spacer). The new species is also similar to + +H. stagnalis + +Gagarin & Long, +2017 in + + +the number of the amphidial turns and tail, but can easily be distinguished from the latter by the different arrangement of precloacal supplements (3 posterior supplements smaller and closer vs 5–6 smaller and closer supplements + + + + \ No newline at end of file diff --git a/data/9E/D2/8E/9ED28E12F4695F1CAE60858338D7390C.xml b/data/9E/D2/8E/9ED28E12F4695F1CAE60858338D7390C.xml new file mode 100644 index 00000000000..a43f3b1b1a7 --- /dev/null +++ b/data/9E/D2/8E/9ED28E12F4695F1CAE60858338D7390C.xml @@ -0,0 +1,382 @@ + + + +Two new species of the genus Halichoanolaimus (Nematoda, Selachinematidae) from the intertidal zone of the Yellow Sea, China + + + +Author + +Huang, Mian +0000-0003-3343-1520 +College of Life Sciences, Liaocheng University, Liaocheng 252059, China + + + +Author + +Zhai, Hongxiu +0000-0003-0003-9549 +College of Life Sciences, Liaocheng University, Liaocheng 252059, China + +text + + +ZooKeys + + +2024 + +2024-07-31 + + +1208 + + +259 +274 + + + +journal article +10.3897/zookeys.1208.124047 +CA37DEF5-365F-4B12-AC70-78C5E7EEA7BE + + + + + +Halichoanolaimus zhangi + +sp. nov. + + + + +Figs 3 +, +4 +, +5 +, +Table 2 + + + + +Material examined. + + + +Two males +and +one juvenile +were obtained. + +Holotype + +: +♂ +1 on slide 22 HSB- 11-2 - 1; + +paratypes + +: +♂ +2 and juvenile on slide 22 HSB- 11-2 - 2. +Type +specimens were deposited in the +Marine Biological Museum +of the +Chinese Academy of Sciences +, Qingdao. + + + + + +Type locality and habitat. + + +Holotype +and +paratypes +were found from intertidal muddy sediment at Rizhao coast along the Yellow Sea; + +35 ° 18 ' N +, +119 ° 31 ' E + +; +0–2 cm +sediment depth. + + + + +Etymology. + +The specific epithet “ zhangi ” is in honor of Professor Zhinan Zhang, a Chinese nematologist, in recognition of his contributions to nematode taxonomy. + + + +Measurements. + + +All measurement data are given in Table +2 +. + + + + + + +Individual measurements of + +Halichoanolaimus zhangi + +sp. nov. +(in µm except for ratios; -, null). + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
CharactersHolotypeParatypes
♂ 1♂ 2Juvenile
Total body length309030751940
Maximum body diameter807962
Head diameter636035
Length of cephalic sensilla545
Depth of buccal cavity434532
Width of buccal cavity323122
Width of amphid201812
Amphid from anterior end272821
Length of pharynx483474332
Body diameter at pharyngeal base787660
Spicule length along arc115106–
Length of gubernaculum4240–
Number of precloacal supplements77–
Body diameter at cloaca5852–
Tail length630590314
a38.638.931.3
b6.46.55.8
c4.95.26.2
c′10.911.39.2
+ + + + +Description. + + +Males. +Body cylindrical, tapering slightly towards posterior end. Cuticle with transverse rows of punctations. Lateral differentiation presents except to anterior half of pharynx with even punctations. Lateral differentiation consisting of slightly larger and more widely spaced punctations. Four longitudinal rows of pore complexes situated at sublateral sides of pharyngeal region (Fig. +4 B +). Each row with 10–12 pores. Cephalic region slightly rounded. Inner and outer labial sensilla papillose; four cephalic sensilla setiform, 4–5 µm long. Amphideal fovea multispiral with 3–3.25 turns, located at the level of the buccal cavity base, 27–28 µm from anterior end of body. Buccal cavity large, 43–45 µm deep, divided into anterior and posterior portions by two rows of 25 denticles. Anterior portion of buccal cavity cup-shaped, with three sets of three cuticularized rhabdions, terminating in three sets of paired denticles; posterior portion of buccal cavity narrower, cylindrical, surrounded by three Y-shaped pairs of cuticularized rhabdions with swollen bases, ca 20 µm long. Pharynx cylindrical, muscular, without anterior or posterior bulb; pharyngeal lumen cuticularized. Nerve ring difficult to distinguish. Secretory-excretory system present. Ventral gland small, situated at level of cardia; ampulla large, excretory pore situated at position of three corresponding body diameters from the anterior end. Cardia small, partially surrounded by intestine. + + + + + + +Drawings of + +Halichoanolaimus zhangi + +sp. nov. +A +pharyngeal region of holotype +B +anterior end of holotype +C +cloacal region of holotype +D +posterior end of male 2. Scale bars: 30 μm ( +A, B, C +); 50 μm ( +D +). + + + + + + + +Microscopic images of + +Halichoanolaimus zhangi + +sp. nov. +A +anterior end of holotype, showing buccal cavity and excretory pore (arrow) +B +anterior end of holotype, showing cephalic seta (arrow 1) amphidial fovea and cuticle pores (arrow 2) +C +posterior portion of male 2, showing spicules and tail +D +cloacal region of holotype, showing spicules, gubernaculum and supplements. Scale bars: 20 μm ( +A, B, D +); 50 μm ( +C +). + + +Reproductive system diorchic with two opposed, outstretched testes. Anterior testis to the right or ventrally to intestine, posterior testis to the left side of intestine. Spicules paired, curved, gradually narrowing from proximal to distal end with pointed tip, ca 2 cloacal body diameters long. Gubernaculum rod-like, adjoining to the dorsal side of spicules. 7 papilliform precloacal supplements, the most posterior supplement located 14 µm from the cloaca; remaining supplements gradually increasing the spacing distance forward, from 9 µm to 26 µm to each other. Each supplement consists of conical papilla and an internal duct. Two rows of short conical setae situated at two subventral sides of the precloacal supplements region of body. Tail conical with a long posterior filiform portion, accounts for 92 % total tail length. A row of 5 caudal setae distributed at ventral side of tail conical part, 3–4 µm long. Caudal glands and spinneret present, 7 µm long. + + + + + +Microscopic images of + +Halichoanolaimus zhangi + +sp. nov. +A +anterior end of holotype, showing lateral differentiation and somatic setae (arrow) +B +cloacal region of holotype, showing lateral differentiation and conical setae situated at two subventral sides of precloacal supplements (arrow) +C +anterior end of juvenile, showing buccal cavity and cephalic sensilla (arrow) +D +posterior portion of juvenile, showing the end of intestine (arrow). Scale bars: 20 μm ( +A, B, C, D +). + + +Female not found. Juvenile similar to males in body shape, and with a long filiform tail, except body size smaller, intestine with blind end. + + + +Differential diagnosis and discussion. + + + +Halichoanolaimus zhangi + +sp. nov. +is distinct by lateral differentiation presenting posterior to the middle of the pharynx, amphideal fovea with 3.0–3.3 turns, spicules curved, gradually narrowing from proximal to distal end with pointed tip, 7 papilliform precloacal supplements, gradually increasing the spacing distance forward, two rows of subventral stout setae situated at precloacal region, tail elongated, filiform. The new species is most similar to + +H. possjetiensis + +Belogurov & Fadeeva, +1980 in + + +the filiform tail and number of precloacal supplements, but differs from the latter species by body slender (a = 38.6–38.9 vs body stout, a = 25.8–26.6), longer tail (c = 4.9–5.2 vs c = 8–8.3) and different gubernaculum (slender and straight vs. broad and hooked proximally in + +H. possjetiensis + +). + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD700A921FF50FA4FFBC3E08E.xml b/data/A5/75/87/A575878AD700A921FF50FA4FFBC3E08E.xml new file mode 100644 index 00000000000..0be94a2eb1a --- /dev/null +++ b/data/A5/75/87/A575878AD700A921FF50FA4FFBC3E08E.xml @@ -0,0 +1,162 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +3. + +Drawida songae yeongdo +Blakemore + +subsp. n. + + + + + + + +( +Fig. 2 +). + + + + + +Material. + +NIBR-IV0000261284 +(DNA sample H1), H, +holotype +, a complete specimen 24 +th +April +, 2013 from +Yeongdo Island +in woodland just below +Temple +on southeast coastal walk. +In +same sample: IV0000261285 (DNA sample H2), P, +paratype +, a smaller ( +37 mm +) and paler immature; and IV0000261293, +three immature + +Amynthas +sp. + +that were not studied further + +. + + + + +Etymology. +Noun, after type-locality. + + + + +Description. +Colour copper green in life looking like + +Amynthas hupeiensis + +but without its characteristic smell and coiling behaviour: this specimen was sluggish and remained elongated. Prostomium prolobous. Clitellum not noticeable. Length 135(+?) mm. Segments 202 with the last seven segments paler, possibly regenerated or a zone of growth. No DPs. Nephropores near intersegments and appear mainly in cd but are above d in the anterior. Spermathecal pores in 7/ +8 in +ab lines. Male pores in 10/ +11 in +ab lines. Female pores in anterior of +12 in +ab lines. Genital markings in 8-10: paired in 8, 9 and 11 with analogue in 10lhs (faint remnant in 10rhs?); sessile glands correspond internally. + +Septum “9/10” displaced to mid-segment 10; 11/12 also displaced and combined with 12/13. Dorsal blood vessel single; hearts large in 6-9. Spermathecal ampulla on 7/8 with long duct to body wall; no atrium present in 8. Testis sacs in 10/11 with long coiled vasa deferentia to flat, sessile prostates; no penes. Ovaries as several sheets enclosed in septa with small and empty egg sac posteriorly from 12/13. Gizzards in 14-17; gut filled with organic soil supporting classification as a topsoil species. Nephridial bladders elongate. + + + +Remarks. +The current species appears particularly close to + +Drawida songae +Hong, 2002 + +from +Daegu +that is somewhat smaller at +70-93 mm +with fewer segments (viz. 172). Both taxa have simple, superficial spermathecal and male pores, and four gizzards in 14-17. However + +D. songae + +was described with a pink colour (but possibly due to preservation?) rather than green as in the current specimen. The genital markings were twice described as from 7-11,12 (although it is ambiguous since only some were figured - see +Fig. 2B +), whereas the current specimen lacks markings in both 7 and 12 but has them clearly in 8-11. The markings in + +D. songae + +were said to have “muscular areas” that probably correspond to the sessile glands observed in the present species. Other differences are that the egg-sacs in + +D. songae + +were larger (more mature or seasonal?) from 12-14 and were said to cover the gizzards. Perhaps most distinctive, the prostates were said to be absent whereas the current specimen has low, flat glands. The accumulation of these differences possibly merits separate species status although the gross similarities suggest a close relationship and thus it is proposed as a new sub-species. Attached DNA data should help resolve its ultimate status and relationships, should further material of nominal + +D. songae songae + +be uncovered. + + +MEGASCOLECIDAE + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD700A921FF50FD6CFE6AE3E2.xml b/data/A5/75/87/A575878AD700A921FF50FD6CFE6AE3E2.xml new file mode 100644 index 00000000000..3ba92fef06d --- /dev/null +++ b/data/A5/75/87/A575878AD700A921FF50FD6CFE6AE3E2.xml @@ -0,0 +1,117 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +2. + +Drawida +cf. +koreana +Kobayashi, 1938: 102 + + + + + + + +Material. +NIBR-IV +0000261283 (DNA sample H7), mature specimen, 26 +th +April from Jungang Pk. + + + + +Description. +Slight blue-grey colour. Length +47 mm +. Clitellum 10-13 at least. Dorsal pores absent. Spermathecal pores in atria in 7/8. Male pores on 10/11 protrude on penes. Genital markings are present on 8rhs above setae ab and 10rhs on male pore. + + + + +Remarks. +The DNA sample H7 (Appendix) agrees 100% with WO23, a specimen from NIBR, Incheon (IV00002 49929) identified as “ + +Drawida +sp. + +” and it is possible that both are + +D. koreana + +proper. Originally described on 150 or so specimens ranging from “Kyôjô” in +North Korea +to +Gyeonggi-do +South Korea +, + +D. koreana + +is a variable species. Several other specimens in current studies are superficially similar but appear to differ molecularly ( +Fig. 1 +). +Types +of + +D. koreana + +are missing - if they ever existed - and there is an urgent need for neotypification, albeit previous and contemporary Korean workers have avoid- ed this for the last 75 yrs! Further study is ongoing to determine intraspecific variation permissible for + +D. koreana + +identification using both its morphology and genetics (Blakemore in prep.). + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD700A926FCFBF960FDF9E1F1.xml b/data/A5/75/87/A575878AD700A926FCFBF960FDF9E1F1.xml new file mode 100644 index 00000000000..ebc6f63a06a --- /dev/null +++ b/data/A5/75/87/A575878AD700A926FCFBF960FDF9E1F1.xml @@ -0,0 +1,375 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +4. + +Amynthas carnosus roki +Blakemore + +subsp. n. + + + + + + + +( +Fig. 3 +). + + + + + +Material. + +Incheon +specimen +NIBR-IV0000261264 +(DNA w56) H, +holotype +, mature broken in two parts, anterior dissected; collected by RJB 23 +rd +Oct., 2012 from + +Incheon +Great Park from infilled ditch just above the park boundary. + +Busan +specimen IV0000261286 (DNA H4) P, +paratype +, mature +175 mm +long, undissected but broken in two parts, 24 +th +April, 2013 from +Yeongdo Island +, just down from Temple in woodland on walk to the beach + +. + + + + +Fig. 2. +A. + +Drawida songae yeongdo + +subsp. n. +holotype (H, DNA H1) showing prostomium, gizzards, pygidium, habitus with reproductive organs +in situ +and all four genital marking glands in 8-11lhs plus a nephridium from 15rhs. B. + +D. songae songae + +after Hong (2002: fig. 1) with GMs in 7, 10-11 (but not 12?) for fair use comparison. + + + + +Etymology. +From acronym of +Republic of Korea +( +ROK +), latinized to “roki”, due to its wide distribution ( +Incheon +↔ +Busan +) even though endemicity just in +South Korea +is not implied. + + + + +Description. +Lengths H, 270+ +30 mm +(= +300 mm +); P, 125+ +50 mm +(= +175 mm +). Segments H, 112+24 (=136). Colour dark brown dorsum, clitellum buff. Prostomium epilobous open. First dorsal pore 12/13. Setae ca. 60 on 12. Spermathecal pores post-intersegmental in U-shaped hemispheres on dorsal aspects of 5/6/7/8/9. Clitellum 14-16. Female pore mid-ventral on 14. Male pores superfical on small mounds within concentric rings ca. 0.3 C apart on 18 with ca. 14 setae intervening. Genital markings absent (from both specimens). + + +Internally (H) septa 8/9/10 aborted. Spermathecae in 6-9 as figured. Holandric with seminal vesicles in 11 and 12. Last hearts in 13. Prostates racemose in 18. Intestinal caecae simple from 27. Other characteristics comply with nominal taxon (see +Blakemore, 2012a +). + + + + +Remarks. +Distinctive characters are the tendency to large size ( +175-300 mm +), U-shaped post-intersegmental spermathecal pores (called “spermathecal papillae” by +Kobayashi, 1936: 130 +) plus lack of genital markings thereby complying with +Kobayashi’s (1936 +, text-figs types II & I) also coded by +Blakemore (2012a +, fig. 3) [as already noted, segments counts for XVIIrhs are out by one in this latter figure]. On these characters the present sub-species appears to differ from the nominal taxon’s +neotype +and from other synonyms in +Blakemore (2012a: 36) +, also supported with definitive DNA barcode data from its primary type (w +56 in +Appendix). It shows only 91% similarity to other + +A. carnosus + +specimens and was just 93% compliant with w54 DNA data from an Ulleungdo specimen. The DNA of sample H4 from +Busan +has 100% agreement with w56 from +Incheon +designated as +paratype +and +holotype +, respectively. + + + +Fig. 3. +A. + +Amynthas carnosus roki + +subsp. n. +holotype (H, DNA w56) showing habitus, prostomium, spermathecae, caecum and prostate of 18lhs +in situ +with X2 enlargements of post-intersegmental spermathecal pores of 8rhs and simple male pore of 18rhs. B. Sketch of these from Busan paratype (P, DNA H4 agreeing 100%). 3C and 3D are comparison sketches with similar X2 enlargements for sympatric + +A. carnosus carnosus +( +Goto and Hatai, 1899 +) + +specimens from Incheon (200 and 280 mm long) with pre-intersegmental spermathecal pores that provided DNA samples w55 and w57, respectively, agreeing>99% with each other (see Fig. 1 and Appendix). + + + +This taxon is particularly similar to + +A. monstriferus +( +Kobayashi, 1936 +) + +, differing not least on the lack of markings on segment 8, and possibly they should be merged. Pending further research, + +A. carnosus monstriferus + +is reduced to sub-species status as it complies with +Kobayashi’s (1936) +types +XII & I of + +A. carnosus + +! + + +Blakemore (2012a: 41) +stated, “ + +the genital marking variation in +A. carnosus allowed +for by Kobayashi in his detailed and most thorough account is excessive, rather representing a congeries of morphs, if not separate species + +”. This seems to be borne out by the preliminary DNA results presented here as justified with the new taxon. In particular, sample IV0000261266 (providing DNA w57) was collected at the same time as + +A. carnosus roki + +Holotype +(w56) yet it complies with +Kobayashi (1936) +textfig. types IX & III of + +A. carnosus carnosus + +. Whereas IV0000261263 (providing DNA w55) also from +Incheon +Great Park but found crawling on the surface at dusk, complies with Kobayashi’s types VI & VIII and is almost exactly the same as + +A. carnosus + +neotype +(Tokyo NMST An435). Both these latter specimens are closer morphologically to materials from elsewhere in +Korea +and, significantly, from +Japan +that clearly separate out on their genetics from the current taxon. + + +From the results in the DNA phylogram ( +Fig. 1 +) it appears that the specimen from Ulleungdo (providing DNA sample w54) labeled as “? + +Amynthas pingi +(Stephenson, 1925) + +” by +Blakemore (2013b: 60) +may also merit separate sub-specific status, which is investigated further in an accompanying paper based on + +A. pingi + +types +( +Blakemore, 2013d +this issue). + + +Regarding other putative sub-species of + +A. carnosus + +, it was already noted by +Blakemore (2012a: 36) +that + +A. pingi chungkingensis +( +Chen, 1936 +) + +probably merits elevation to separate species level as + +A. chungkingensis + +. This taxon was ascribed to “ + +Am. carnosus chungkingensis + +” by +Wang and Qiu (2005: 25 +, tab. 2) when comparing it to their + +Amynthas carnosus lichuanensis +Wang and Qiu, 2005 + +from Mt. Xingdou, +Hubei +, +China +. Herein this is also raised to separate species level as + +A. lichuanensis + +stat. nov. +since it has no characters in any way similar to revised concepts of + +A. carnosus + +. For example, this +300- 400 mm +species has rows of 7-8 papillae median to male pores on 18, and corresponding rows of three or four papillae on segment 8 median to spermathecal pores that number only three pairs in 6/7/8/9 with its spermathecae nubby stubs. These authors also record + +A. carnosus carnosus +( +Goto and Hatai, 1899 +) + +from this location, but their identification may be suspect since they claim subsumed + +A. fornicatus +(Gates, 1935) + +(and + +A. diffringens + +!) too (see +Blakemore, 2013d +). + + +Similar specimens from any region may now be compared genetically to an increasingly refined formulation of + +A. carnosus + +, including the present new sub-species. Moreover, as coded by +Blakemore (2012a +, fig. 3), +Kobayashi’s (1936) +text-figs +types +II & I (lacking markings) and possibly +types +XII & I (with markings in 8), having U-shaped post-intersegmental spermathecal papillae should now be removed as characteristic of + +A. c. +carnosus + +proper. +Kobayashi (1936: 130) +tabulated 14 such specimens from 204 from +Korea +and this may represent an approximate proportion (~7%) of the + +A. carnosus roki + +(and + +A. c. +monstriferus + +) sub-species, but its area of prevalence is currently indeterminate. + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD704A924FCFBFA1CFEB1E4EF.xml b/data/A5/75/87/A575878AD704A924FCFBFA1CFEB1E4EF.xml new file mode 100644 index 00000000000..c76b393d469 --- /dev/null +++ b/data/A5/75/87/A575878AD704A924FCFBFA1CFEB1E4EF.xml @@ -0,0 +1,139 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +8. + +Metaphire ryunome +Blakemore, 2012 + + + + + + + + +( +Fig. 4B +). + + + + + +Material. +IV0000261294 (DNA HY2, this data not includ- ed in phylogram +Fig. 1 +) collected from Jungang Park, 26 +th +April, 2013. + + + + +Description. +Length +116 mm +. Clitellum 14-16. Spermathecal pores 7/8/9. Male pores on 18, slightly protruded. GMs absent (cf. +Shiga +types +). Spermathecae with elongated, paprika-shaped diverticular bulbs on long stalks. Prostates present but copulatory pouches absent. Caeca ventrally incised (27rhs removed to check for resident Rotifera that, however, were not found). + + + + +Remarks. +Slight differences from the original description of Japanese + +M. ryunome + +are that the GMs were not recorded and that the caeca were serrate. Nevertheless, DNA shows 100% conformity with barcode results in +Blakemore (2012d +: fig. 4). Finding + +M. ryunome + +in +Shiga +, +Japan +and now +Busan +, +Korea +indicates that this species has wide distribution suggesting it is peregrine and is to be expected from other countries. The BLAST results (Appendix) show it closest to Chinese + +A. incongruus +(Chen, 1933) + +on GenBank; however, that taxon typically has spermathecal pores in 5/6/7 rather than 6/7/8 and a different arrangement of GMs, at least, compared to those discussed by +Blakemore (2012d) +for + +M. ryunome + +. Most likely the identity of the Chinese specimen was mistaken, just as the DNA data for + +A. masatakae + +appears misidentified with Chinese + +A. triastriatus +(Chen, 1946) + +on Gen Bank (see Appendix). + + +LUMBRICIDAE + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD705A924FF52FB8AFD91E00B.xml b/data/A5/75/87/A575878AD705A924FF52FB8AFD91E00B.xml new file mode 100644 index 00000000000..73a262ca2f0 --- /dev/null +++ b/data/A5/75/87/A575878AD705A924FF52FB8AFD91E00B.xml @@ -0,0 +1,101 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +10. + +Eisenia fetida +(Savigny, 1826) + + + + + + + +Material. +NIBR-IV +0000261291 (DNA sample H6), a mature specimen collected 26 +th +April, 2013 from Jungang Park beside a walking trail. + + + + +Description. +Body has ‘classic’ transversely coloured stripes alternating with pale intersegments; also pale laterally in 8,9-11,12. Clitellum 26-31,32; TP on 28-30. + + + + +Remarks. +Part of the species-complex ( +Fig. 1 +and Appendix), agreeing 100% with GenBank sample (FJ214216) from “ +Denmark +: Svendborg”. Obviously this specimen differs from some Korean samples variously named “ + +E. fetida + +” or “ + +E. andrei + +” - see +Blakemore (2013a: 42 +; +2013b: 64 +) and recent Mongolian work ( +Blakemore, 2013c +). True identity and status of specimens/taxa remains unclear, requiring further work (Blakemore in prep.). + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD705A924FF52FD40FDB9E223.xml b/data/A5/75/87/A575878AD705A924FF52FD40FDB9E223.xml new file mode 100644 index 00000000000..93db60c1762 --- /dev/null +++ b/data/A5/75/87/A575878AD705A924FF52FD40FDB9E223.xml @@ -0,0 +1,87 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +9. + +Aporrectodea trapezoides +(Dugès, 1828) + + + + + + + +Material. +NIBR-IV +0000261290, four representative specimens from many collected 26 +th +April, 2013 on walk from Gwangalli Beach towards Nam-gu. + + + + +Description. +Male pores on 15. Clitella 26-34; tubercula pubertates 31-33 continuously. + + + + +Remarks. +Abundant locally and previously recorded from +Korea +(e.g. +Kobayashi, 1941: 150 +). + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD705A92BFF52F9D2FE0AE0F7.xml b/data/A5/75/87/A575878AD705A92BFF52F9D2FE0AE0F7.xml new file mode 100644 index 00000000000..bf3bf0760d6 --- /dev/null +++ b/data/A5/75/87/A575878AD705A92BFF52F9D2FE0AE0F7.xml @@ -0,0 +1,250 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +11. + +Eisenia japonica vaga +Blakemore + +sub-sp. n. + + + + + + + +( +Fig. 5 +). + + + + + +Material. + +NIBR-IV0000261292 +(DNA H5) H, +holotype +, a mature specimen collected 26 +th +April +, from +Jungang Park +under (Japanese?) sakura cherry trees. IV0000250 889 (DNA WO20) P, +paratype +, an undissected mature specimen collected 5 +th +April +, 2012 by RJB from near +Hagae Bridge +, +Young River +central +South Korea +; (a second sympatric specimen from there, IV0000250890, not tested genetically, may be similar) + +. + + + + +Etymology. +Latin for “wandering” from its distribution that may also include +New Zealand +. + + + + +Description. +Grey unpigmented in alcohol with white clitellum and dark dorsal vessel visible. Length +58 mm +. Segments 120. First dorsal pore 4/5. Clitellum +½ +23-31. TP distinctively raised on 27 and 29. Setae ab on 11, 17 and 18 faintly marked; ab on 25 and 26 clearly tumid. Spermathecal pores in 9/10/ +11 in +c lines. Holandric: testes iridescent in 10 and 11; seminal vesicles in 9-12, the latter elongate. Last hearts in 11. Calciferous glands in 11 and 12. Intestine from 15. Gizzard in 17-18. Typhlosole large T-shaped from about 19 onwards. Nephridial bladders sausage-shaped. Gut contains mainly mineral soil (i.e., a topsoil species that is at least partly geophageous). + + + + +Remarks. +Superficial agreement supported by its DNA data shows this to be part of the + +Eisenia japonica +Michaelsen, 1892 + +species-complex. It is not clear which part is closest, however it is remarkably similar to a +New Zealand +specimen described by +Blakemore (2012c +: fig. 3, 2013a: 40, 45). The DNA data is unequivocal that the Busan specimen objectively represents an as yet unknown taxon, and ditto sample WO20 having 99% agreement ( +Fig. 1 +and Appendix). The current specimen sequence is only 92-93% similar to GenBank specimens unidentifi- ed as “ +Lumbricidae +sp.” (AB607078) or as + +Eisenia japonica + +(AB542698) from +Japan +. And it is just 82-83% similar to the author’s + +Eisenia japonica japonica +(Michaelsen, 1892) + +topotype +from Enoshima, +Japan +or to +E. j. hiramoto +Blakemore, 2012 from near Yokohama. Such genetic dissimilarity (~20%) is normally associated with separate species/genera or even separate families (e.g. see sample H2 megaBLAST results in Appendix). + + +The scant difference from previous descriptions (e.g. by +Kobayashi, 1941 +; +Gates, 1975 +; +Blakemore and Grygier, 2011 +; +Blakemore, 2012c +) of + +E. japonica + +are perhaps the tumid setae ab only on 25 and 26 (cf. on 22 and +26 in +a +syntype +- +Fig. 5 +), and the TP on 27 and 29 maybe less triangular. Differences from + +E. japonica minuta +( +Oishi, 1934 +) + +supposedly from Morioka and Asamushi, +Japan +that is, however, more usually combined under the nominal taxon, are that the TP are not so round and the size is slightly more than +24-55 mm +as allowed for by +Oishi (1934) +and later by +Kobayashi (1941: 153) +and +Easton (1981 +, tab. 2). + + +Kobayashi (1941) +had specimens from “Keiki-dô” identified as + +A. japonica minuta +Oishi, 1934 + +- they also had setae ab of 25 and 26 on oval papillae - although it is now certain neither that this complies with the Japanese originals nor that his identification is correct in light of the new information presented here. Moreover, that the specimen providing DNA sample WO19 ( +Fig. 1 +and Appendix) represents + +E. japonica gigantica +( +Oishi, 1934 +) + +originally from Tomakomai, +Japan +reported from “Kwaizan” in Chúngchóng-bukto, +South Korea +by +Kobayashi (1941: 152) +is also unclear. Neither +minuta +nor +gigantica +have since been found and reported sufficiently for comparison by subsequent Japanese workers. + + + +Fig. 5. +A. + +Eisenia japonica vaga + +sub-sp. n. Busan holotype (H, DNA H5). B. + +Eisenia +j. + + +japonica +(Michaelsen, 1892) Berlin + +syntype Nr. 2117 (as anticipated, DNA was not extractable from this older material), author’s sketch after +Blakemore and Grygier (2011 +, fig. 2) that compares to Hamburg syntypes V119-V121 (see +Blakemore and Grygier, 2011 +, fig. 3). + + + + +Eisenia japonica vaga + +is a molecular taxon objectively defined on its definitive DNA. + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD707A925FCF5F970FA8AE3B2.xml b/data/A5/75/87/A575878AD707A925FCF5F970FA8AE3B2.xml new file mode 100644 index 00000000000..a4f9049a7df --- /dev/null +++ b/data/A5/75/87/A575878AD707A925FCF5F970FA8AE3B2.xml @@ -0,0 +1,171 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +7. + +Amynthas masatakae +(Beddard, 1892) + + + + + + + + +( +Fig. 4A +). + + + + + +Material. +NIBR- IV0000261289 (DNA sample H3; +Fig. 4A +) from Jungang Park, 26 +th +April. Natural History Museum, London +types +inspected for confirmation (see +Blakemore, 2012d +). + + + + +Description. +Length +180 mm +. Clitellum 14-16. Spermathecal pores 7/8/9. Male pores on 18, superficial. GMs typically present, paired near spermathecal and male pores. Spermathecae with elongated, paprika-shaped diverticular bulbs on long stalks. Prostates (always?) reduced to muscular duct. Glands associated with GMs, where present. Caeca ventrally incised. + + + + +Fig. 4. +A. + +Amynthas masatakae +(Beddard, 1892) + +Busan specimen showing spermathecal and male regions. B. + +Metaphire ryunome +Blakemore, 2012 + +Busan specimen [boxed is X2 enlargement of its18rhs male pore that appears elevated, non-superficial, i.e.,= + +Metaphire + +]. + + + + +Remarks. +DNA data in the appendix helps to confirm this identity based on the redescriptions of + +A. masatakae + +by +Blakemore (2012d: 134 +; +2013a: 29 +). +Kobayashi (1937: 337 +, +1938: 140 +) observed complete prostates, in some of his Korean specimens, although such specimens should now be compared to + +Metaphire ryunome + +as next describ- ed. Whereas this latter taxon has male pores slightly elevated (resembling those in the type-species of + +Metaphire +Sims and Easton, 1972 + +- see +Blakemore, 2012b +) and thus strictly non-superficial qualifying for membership of genus + +Metaphire + +, such a condition has not been confirm- ed in amphimixic forms of + +A. masatakae + +although accidentally indicated in +Blakemore (2012a: 31) +where it says “ + +M. masatakae + +”, again possibly alluding to specimens resembling + +M. ryunome + +. + + +Note that although +Kobayashi (1938: 138) +said the caeca were simple “without indentations” (lapsus?), his earlier account ( +Kobayashi, 1937: 338 +) had “each with several serriformed outgrowths on ventral margin only”, as were found in the current specimen. +Kobayashi (1937: 340) +also notes that +Goto and Hatai (1899) +were incorrect to cite the present species as having manicate caeca. + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD707A926FCF5FA71FA9DE0AF.xml b/data/A5/75/87/A575878AD707A926FCF5FA71FA9DE0AF.xml new file mode 100644 index 00000000000..d659c91c319 --- /dev/null +++ b/data/A5/75/87/A575878AD707A926FCF5FA71FA9DE0AF.xml @@ -0,0 +1,82 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +6. + +Amynthas hupeiensis +(Michaelsen, 1895) + + + + + + + +Material. +Specimens collected from Jungang Park, 26 +th +April but returned to the earth there. + + + + +Remarks. +This is a distinctive and fairly common cosmopolitan species already well known from +Korea +(e.g. +Kobayashi, 1938: 152 +) thus not unexpected in +Busan +. + + + + \ No newline at end of file diff --git a/data/A5/75/87/A575878AD707A926FCF5FEB6FB5BE3AF.xml b/data/A5/75/87/A575878AD707A926FCF5FEB6FB5BE3AF.xml new file mode 100644 index 00000000000..b05da616715 --- /dev/null +++ b/data/A5/75/87/A575878AD707A926FCF5FEB6FB5BE3AF.xml @@ -0,0 +1,140 @@ + + + +Survey of Busan Oligochaeta earthworms supported by DNA barcodes + + + +Author + +Blakemore, Robert J. + + + +Author + +Lee, Seunghan + +text + + +Journal of Species Research + + +2013 + +2013-08-31 + + +2 + + +2 + + +127 +144 + + + + +http://dx.doi.org/10.12651/jsr.2013.2.2.127 + +journal article +10.12651/JSR.2013.2.2.127 +2713-8615 + + + + + + +5. + +Amynthas +cf. +corticis +(Kinberg, 1867) + + + + + + + +Material. +NIBR-IV +0000261287, a mature specimen collected 25 +th +April, 2013 from Dongnae Botanic Gardens, Geumgang Park; IV0000261288 second and third complete specimen (160 and +100 mm +long) plus a possible sub-adult ( +80 mm +) from Jungang Park, 26 +th +April. + + + + +Remarks. +The Dongnae specimen had spermathecae only in 7-9 that had diverticula reduced or wanting and lacked GMs. Approximately 130 pheretimoids are described with spermathecal pores in 6/7/8/9 (Blakemore unpublished), of these about 69 are in + +Amynthas + +plus + +A. carnosus + +and + +A. corticis + +that sometimes (rarely?) have specimens lacking their anterior pair of spermathecae, as in + +A. chunkingensis +( +Chen, 1936 +) + +that was at one time associated with + +A. carnosus + +as noted above (it differs further in having only one pair of GMs on 18 just below the male pores). Other than these two taxa, the only previously known Korean representative is + +Amynthas moakensis +Hong and Kim, 2002 + +that, however, is smaller ( +32 mm +) and does appear to have a pair of GMs posteriorventral to male pores (cf. +Hong and Kim, 2002 +: fig. 3) despite its description of having none, and long tightly coiled diverticula on the spermathecae. + + +In +Blakemore (2002 +; 2010; 2012f) it keys to + +Amynthas asiaticus +Michaelsen, 1900 + +. +Michaelsen (1900: 527) +described Chinese + +Pheretima asiatica +(Michaelsen) + +with “Intestinal caeca long, with wart-like outgrowths underneath. Spermathecal diverticulum about as long as the ampulla, its proximal third tapered somewhat, slightly tortuous and narrow” - conditions that do not apply to the current specimen. The tentative conclusion is a parthenogenetically degraded + +A. corticis + +sexthecal morph lacking GMs but retaining its prostate glands. DNA data from this otherwise unremarkable and common species is pending; nevertheless, it is reviewed further in an accompanying paper ( +Blakemore, 2013d +). + + + + \ No newline at end of file diff --git a/data/E0/3A/1E/E03A1EC4C0E85EEAAC2FF970BD25D6A1.xml b/data/E0/3A/1E/E03A1EC4C0E85EEAAC2FF970BD25D6A1.xml new file mode 100644 index 00000000000..b7029769a31 --- /dev/null +++ b/data/E0/3A/1E/E03A1EC4C0E85EEAAC2FF970BD25D6A1.xml @@ -0,0 +1,69 @@ + + + +Two new species of the genus Halichoanolaimus (Nematoda, Selachinematidae) from the intertidal zone of the Yellow Sea, China + + + +Author + +Huang, Mian +0000-0003-3343-1520 +College of Life Sciences, Liaocheng University, Liaocheng 252059, China + + + +Author + +Zhai, Hongxiu +0000-0003-0003-9549 +College of Life Sciences, Liaocheng University, Liaocheng 252059, China + +text + + +ZooKeys + + +2024 + +2024-07-31 + + +1208 + + +259 +274 + + + +journal article +10.3897/zookeys.1208.124047 +CA37DEF5-365F-4B12-AC70-78C5E7EEA7BE + + + + +Genus + +Halichoanolaimus +De Man, 1886 + + + + + +Diagnosis + + + +(modified from +Leduc 2020 +). + +Cuticle with lateral differentiation in the form of larger and more widely spaced punctations. All anterior sensilla usually papilliform. Buccal cavity separated into two chambers by transversal sets of denticles; posterior chamber of buccal cavity surrounded by three Y-shaped pairs of cuticularized rhabdions. Pharynx without anterior or posterior bulb. Intestine of adult stages blind. Precloacal supplements usually papilliform or setiform. Tail with conical proximal portion and often elongated cylindrical distal portion. + + + + \ No newline at end of file