This commit is contained in:
maintenance 2024-06-21 12:42:32 +02:00
parent 9718aaf18b
commit a6fc63282e
1752 changed files with 328515 additions and 0 deletions

View file

@ -0,0 +1,85 @@
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.135.1721" ID-GBIF-Dataset="27b26434-b431-43ef-9753-62887c7b70ab" ID-PMC="PMC3252756" ID-Pensoft-Pub="1313-2970-135-41" ID-PubMed="22259300" ModsDocAuthor="" ModsDocDate="2011" ModsDocID="1313-2970-135-41" ModsDocOrigin="ZooKeys 135" ModsDocTitle="A review of Aleurodaphis (Hemiptera, Aphididae, Hormaphidinae) with the description of one new species and keys to species" checkinTime="1451249797273" checkinUser="pensoft" docAuthor="Jiang, Li-Yun &amp; Qiao, Ge-Xia" docDate="2011" docId="852B07F51C579EE5BFB623C1A5B9C78E" docLanguage="en" docName="ZooKeys 135: 41-56" docOrigin="ZooKeys 135" docSource="http://dx.doi.org/10.3897/zookeys.135.1721" docTitle="Aleurodaphis antennata Chakrabarti &amp; Maity, (1980 1982" docType="treatment" docVersion="3" lastPageNumber="44" masterDocId="FFBAFFF4FFA60A468B30FFD1FF97DB5D" masterDocTitle="A review of Aleurodaphis (Hemiptera, Aphididae, Hormaphidinae) with the description of one new species and keys to species" masterLastPageNumber="56" masterPageNumber="41" pageNumber="44" updateTime="1668152367366" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>A review of Aleurodaphis (Hemiptera, Aphididae, Hormaphidinae) with the description of one new species and keys to species</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Jiang, Li-Yun</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Qiao, Ge-Xia</mods:namePart>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>ZooKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2011</mods:date>
<mods:detail type="volume">
<mods:number>135</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>41</mods:start>
<mods:end>56</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/zookeys.135.1721</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.135.1721</mods:identifier>
<mods:identifier type="Pensoft-Pub">1313-2970-135-41</mods:identifier>
</mods:mods>
<treatment ID-GBIF-Taxon="152031357" LSID="urn:lsid:plazi:treatment:852B07F51C579EE5BFB623C1A5B9C78E" httpUri="http://treatment.plazi.org/id/852B07F51C579EE5BFB623C1A5B9C78E" lastPageNumber="44" pageId="3" pageNumber="44">
<subSubSection pageId="3" pageNumber="44" type="nomenclature">
<paragraph pageId="3" pageNumber="44">
<taxonomicName authority="Chakrabarti &amp; Maity, (1980) 1982" authorityYear="1982" class="Insecta" family="Aphididae" genus="Aleurodaphis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Aleurodaphis antennata" order="Hemiptera" pageId="3" pageNumber="44" phylum="Arthropoda" rank="species" species="antennata">Aleurodaphis antennata Chakrabarti &amp; Maity, (1980) 1982</taxonomicName>
http://species-id.net/wiki/Aleurodaphis_antennata
</paragraph>
</subSubSection>
<subSubSection pageId="3" pageNumber="44" type="reference_group">
<paragraph pageId="3" pageNumber="44">
<taxonomicName class="Insecta" family="Aphididae" genus="Aleurodaphis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Aleurodaphis antennata" order="Hemiptera" pageId="3" pageNumber="44" phylum="Arthropoda" rank="species" species="antennata">Aleurodaphis antennata</taxonomicName>
Chakrabarti &amp; Maity, (1980) 1982: 56.
</paragraph>
<paragraph pageId="3" pageNumber="44">
<taxonomicName class="Insecta" family="Aphididae" genus="Aleurodaphis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Aleurodaphis antennata" order="Hemiptera" pageId="3" pageNumber="44" phylum="Arthropoda" rank="species" species="antennata">Aleurodaphis antennata</taxonomicName>
Chakrabarti &amp; Maity:
<bibRefCitation author="Ghosh, AK" journalOrPublisher="Zoological Survey of India, Calcutta" pageId="11" pageNumber="52" title="The Fauna of India and the Adjacent Countries (Homoptera: Aphidoidea) Part 4 Subfamilies: Phloeomyzinae, Anoeciinae and Hormaphidinae." year="1988">Ghosh 1988</bibRefCitation>
: 252;
<bibRefCitation author="Blackman, RL" journalOrPublisher="An Identification and Information Guide. CAB International in Association with the Natural History Museum, Wallingford, UK" pageId="11" pageNumber="52" title="Aphids on the World's Trees." year="1994">Blackman and Eastop 1994</bibRefCitation>
: 551;
<bibRefCitation author="Remaudiere, G" journalOrPublisher="Institut National de la Recherche Agronomique, Paris" pageId="11" pageNumber="52" title="Catalogue of the World's Aphididae." year="1997">
<normalizedToken originalValue="Remaudière">Remaudiere</normalizedToken>
and
<normalizedToken originalValue="Remaudière">Remaudiere</normalizedToken>
1997
</bibRefCitation>
: 179.
</paragraph>
</subSubSection>
<subSubSection pageId="3" pageNumber="44" type="">
<paragraph pageId="3" pageNumber="44">Host plants.</paragraph>
<paragraph pageId="3" pageNumber="44">
<taxonomicName class="Liliopsida" family="Poaceae" genus="Bambusa" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Bambusa" order="Poales" pageId="3" pageNumber="44" phylum="Tracheophyta" rank="genus">Bambusa</taxonomicName>
sp.
</paragraph>
</subSubSection>
<subSubSection pageId="3" pageNumber="44" type="">
<paragraph pageId="3" pageNumber="44">Distribution.</paragraph>
<paragraph pageId="3" pageNumber="44">
India (
<bibRefCitation author="Ghosh, AK" journalOrPublisher="Zoological Survey of India, Calcutta" pageId="11" pageNumber="52" title="The Fauna of India and the Adjacent Countries (Homoptera: Aphidoidea) Part 4 Subfamilies: Phloeomyzinae, Anoeciinae and Hormaphidinae." year="1988">Ghosh 1988</bibRefCitation>
).
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,356 @@
<document id="83E24EE849FCE951DD581D590F436528" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FF8DFF896CE3F9BBFA2A253C" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Eurythenes magellanicus H. Milne Edwards 1848" docType="treatment" docVersion="8" lastPageNumber="42" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="41" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="DEF7478CE8131C7F8E26A8F602E4D405" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="CEFEAB75325086F9BCF6DB8BA4C01795">
<mods:title id="31479D2DF293085C6D9C6826E7B9013E">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="F2F1B83422E91552A6A2AA058DA613AE" type="personal">
<mods:role id="A6252D6A7AD9ED001BD1449F26CBA726">
<mods:roleTerm id="4F911AB97837055844FFD66A682005E0">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E80E1C80DA6572E5F1ACC51604F9DA38">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="E19089C6AC416C9B314D804B71FF2856" type="personal">
<mods:role id="F9DB46368641B0C0D72B762C1878B574">
<mods:roleTerm id="C89A975BA76C7C0AF84B5B118A512F13">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="C1C0F4BBE132F86C80C2545338729CB1">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="D86E5CA5175A854665570C120644A6CA">text</mods:typeOfResource>
<mods:relatedItem id="89B551EC427FFEE10573B24FD6790642" type="host">
<mods:titleInfo id="D9E648D778DB377708B375C9D670FF7E">
<mods:title id="BA60F3FD7E4F282A62920D67DED624CE">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="60F693E5C1F4FCA62E118134B95FBBE2">
<mods:date id="556A26887C980061C246802B7CA00A7B">2015</mods:date>
<mods:detail id="5C991624D8F9A09CB8433651787C7E84" type="volume">
<mods:number id="F448D0F9ABA22AB099B5C4EC5EAE1E53">3971</mods:number>
</mods:detail>
<mods:detail id="C5BB85CD45B9AA40972A34C66C4BEDB3" type="issue">
<mods:number id="507E1B6A5B214F52F3EBF8D15A5EFCF3">1</mods:number>
</mods:detail>
<mods:extent id="120F5B63C9C2107ECCCFDDA3C4F5A730" unit="page">
<mods:start id="9A4E32D64CDDD19C7E71908F892D1D7A">1</mods:start>
<mods:end id="4FDEDDFCCCB433B236B9BF57542FBCA0">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="22E5CDB807F657082C9A2FC83E20D3BC">journal article</mods:classification>
<mods:identifier id="0FCA1876C9AF4497907414B5D56F71C4" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="1EF1520FBBB5684786845410700C88BF" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="817FB8842ACC81B264486833F1773570" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="86B3BDBEBEF6B54FF8C9048D75A54275" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="685F18A93FB3F44EDF29AC3A7A330E4D" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FF8DFF896CE3F9BBFA2A253C" ID-DOI="http://doi.org/10.5281/zenodo.5470186" ID-GBIF-Taxon="127691979" ID-Zenodo-Dep="5470186" LSID="urn:lsid:plazi:treatment:852B87B0FF8DFF896CE3F9BBFA2A253C" httpUri="http://treatment.plazi.org/id/852B87B0FF8DFF896CE3F9BBFA2A253C" lastPageId="42" lastPageNumber="42" pageId="40" pageNumber="41">
<subSubSection id="4598652DFF8DFF8B6CE3F9BBFE992218" pageId="40" pageNumber="41" type="nomenclature">
<paragraph id="0D3D36A6FF8DFF8B6CE3F9BBFCAA2239" blockId="40.[151,788,1591,1651]" box="[151,788,1591,1618]" pageId="40" pageNumber="41">
<heading id="567581CAFF8DFF8B6CE3F9BBFCAA2239" bold="true" box="[151,788,1591,1618]" fontSize="11" level="1" pageId="40" pageNumber="41" reason="1">
<taxonomicName id="CA824D25FF8DFF8B6CE3F9BBFCAA2239" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" box="[151,788,1591,1618]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F9BBFCAA2239" bold="true" box="[151,788,1591,1618]" pageId="40" pageNumber="41">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F9BBFE74223A" bold="true" box="[151,458,1591,1617]" italics="true" pageId="40" pageNumber="41">Eurythenes magellanicus</emphasis>
(H.
<bibRefCitation id="69134B57FF8DFF8B6E74F9B4FCB22239" author="Milne" box="[512,780,1592,1618]" pageId="40" pageNumber="41" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
)
</emphasis>
</taxonomicName>
</heading>
</paragraph>
<paragraph id="0D3D36A6FF8DFF8B6CE3F9D6FE992218" blockId="40.[151,788,1591,1651]" box="[151,295,1626,1651]" pageId="40" pageNumber="41">
(
<figureCitation id="95B92A23FF8DFF8B6CEBF9D6FEA12218" box="[159,287,1626,1651]" captionStart-0="FIGURE 27" captionStart-1="FIGURE 28" captionStart-2="FIGURE 29" captionStart-3="FIGURE 30" captionStart-4="FIGURE 31" captionStart-5="FIGURE 32" captionStartId-0="43.[151,250,1953,1975]" captionStartId-1="44.[151,250,1233,1255]" captionStartId-2="45.[151,250,1914,1936]" captionStartId-3="46.[151,250,1953,1975]" captionStartId-4="47.[151,250,1953,1975]" captionStartId-5="48.[151,250,1953,1975]" captionTargetBox-0="[184,1403,193,1929]" captionTargetBox-1="[151,1436,193,1211]" captionTargetBox-2="[207,1388,193,1877]" captionTargetBox-3="[181,1406,193,1931]" captionTargetBox-4="[217,1370,193,1931]" captionTargetBox-5="[176,1411,193,1931]" captionTargetId-0="figure@43.[184,1403,193,1932]" captionTargetId-1="figure@44.[151,1436,193,1212]" captionTargetId-2="figure@45.[207,1388,193,1888]" captionTargetId-3="figure@46.[181,1406,193,1932]" captionTargetId-4="figure@47.[217,1370,193,1932]" captionTargetId-5="figure@48.[176,1411,193,1932]" captionTargetPageId-0="43" captionTargetPageId-1="44" captionTargetPageId-2="45" captionTargetPageId-3="46" captionTargetPageId-4="47" captionTargetPageId-5="48" captionText-0="FIGURE 27. Eurythenes magellanicus (H. Milne Edwards, 1848), presumably female, 43 mm, RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 13 &quot; S 035 ° 11 ' 17 &quot; W, 4480 m, ZMH K 44270. A, head; B, upper lip; C, lower lip (half of); D, left Md; E, right Md; F, left Mx 1, G, left Mx 2." captionText-1="FIGURE 28. Eurythenes magellanicus (H. Milne Edwards, 1848), presumably female, 43 mm, RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 13 &quot; S 035 ° 11 ' 17 &quot; W, 4480 m, ZMH K 44270. A, Mxp; B, inner plates of Mxp (setae not shown)." captionText-2="FIGURE 29. Eurythenes magellanicus (H. Milne Edwards, 1848), presumably females, 43 mm, RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 13 &quot; S 035 ° 11 ' 17 &quot; W, 4480 m. A, C F, ZMH K 44270; B, DZMB-HH 7985, ZMH K 44268. A, left Gn 1; B, chela of left Gn 1; C, left Gn 2; D, propodus and dactylus of left Gn 2; E, chela of left Gn 2 (lateral view); F, chela of left Gn 2 (medial view)." captionText-3="FIGURE 30. Eurythenes magellanicus (H. Milne Edwards, 1848), presumably female, 43 mm, RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 13 &quot; S 035 ° 11 ' 17 &quot; W, 4480 m, ZMH K 44270. A, left P 3; B, propodus and dactylus of left P 3; C, left P 4; D, telson." captionText-4="FIGURE 31. Eurythenes magellanicus (H. Milne Edwards, 1848), presumably female, 43 mm, RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 13 &quot; S 035 ° 11 ' 17 &quot; W, 4480 m, ZMH K 44270. A, left P 5; B, left P 6; C, left P 7; D, propodus and dactylus of left P 7." captionText-5="FIGURE 32. Eurythenes magellanicus (H. Milne Edwards, 1848), presumably female, 43 mm, RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 13 &quot; S 035 ° 11 ' 17 &quot; W, 4480 m. A E, G H, ZMH K 44270; F, ZMH K 44268. A, pleon and last pereonite; B, left Ep 1; C, left Ep 2; D, left Ep 3; E, left U 1; F, right U 2; G, left U 3; H, ventral face of peduncle of left U 3." httpUri-0="https://zenodo.org/record/288843/files/figure.png" httpUri-1="https://zenodo.org/record/288844/files/figure.png" httpUri-2="https://zenodo.org/record/288845/files/figure.png" httpUri-3="https://zenodo.org/record/288846/files/figure.png" httpUri-4="https://zenodo.org/record/288847/files/figure.png" httpUri-5="https://zenodo.org/record/288848/files/figure.png" pageId="40" pageNumber="41">Figs 2732</figureCitation>
)
</paragraph>
</subSubSection>
<subSubSection id="4598652DFF8DFF8B6CE3F92FFA8A2358" pageId="40" pageNumber="41" type="reference_group">
<paragraph id="0D3D36A6FF8DFF8B6CE3F92FFC5D22BC" blockId="40.[151,1402,1698,1843]" pageId="40" pageNumber="41">
<treatmentCitationGroup id="2D921188FF8DFF8B6CE3F92FFC5D22BC" pageId="40" pageNumber="41">
<taxonomicName id="CA824D25FF8DFF8B6CE3F92FFD0622D3" authority="H. Milne Edwards 1848: 398" authorityName="H. Milne Edwards" authorityPageNumber="398" authorityYear="1848" box="[151,696,1698,1720]" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F92FFE3422D3" box="[151,394,1698,1720]" italics="true" pageId="40" pageNumber="41">Lysianassa magellanica</emphasis>
H.
<treatmentCitation id="8C2310B7FF8DFF8B6DDBF92EFD0622D3" author="Milne" box="[431,696,1698,1720]" page="398" pageId="40" pageNumber="41" year="1848">
<bibRefCitation id="69134B57FF8DFF8B6DDBF92EFD3922D3" author="Milne" box="[431,647,1698,1720]" pageId="40" pageNumber="41" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards 1848</bibRefCitation>
: 398
</treatmentCitation>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FF8DFF8B6EA2F92EFCC422D3" author="Lucas" box="[726,890,1698,1720]" page="13" pageId="40" pageNumber="41" year="1857">
<bibRefCitation id="69134B57FF8DFF8B6EA2F92EFCEB22D3" author="Lucas" box="[726,853,1698,1720]" pageId="40" pageNumber="41" refString="Lucas, H. (1857) Animaux nouveaux ou rares recueillis pendant l'expedition dans les parties centrales de l'Amerique du Sud, de Rio de Janeiro a Lima, et de Lima au Para: executee par ordre du gouvernement francais pendant les annees 1843 a 1847, sous la direction du comte Francis de Castelnau. In: Expedition de F. de Castelneau (Amerique du Sud). Part 7: Zoologie. Vol. 3. P. Bertrand, Paris, 204 pp., 20 pls." type="book" year="1857">Lucas, 1857</bibRefCitation>
: 13
</treatmentCitation>
, pl. 1 fig. 3.—
<treatmentCitation id="8C2310B7FF8DFF8B687EF92EFB4A22D3" author="Spence" box="[1034,1268,1698,1720]" page="66" pageId="40" pageNumber="41" year="1862">
<bibRefCitation id="69134B57FF8DFF8B687EF92EFB7122D3" author="Spence" box="[1034,1231,1698,1720]" pageId="40" pageNumber="41" refString="Spence Bate, C. (1862) Catalogue of the Specimens of Amphipodous Crustacea in the Collection of the British Museum. Trustees British Museum, London, iv pp., 399 pp., 58 pls." type="book" year="1862">Spence Bate, 1862</bibRefCitation>
: 66
</treatmentCitation>
, pl. 10 fig. 5.
<taxonomicName id="CA824D25FF8DFF8B6CE3F94DFE2822BC" box="[151,406,1729,1751]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F94DFE2822BC" box="[151,406,1729,1751]" italics="true" pageId="40" pageNumber="41">Eurythenes magellanicus</emphasis>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FF8DFF8B6DC0F94DFDCB22BC" author="Stebbing" box="[436,629,1729,1751]" page="73" pageId="40" pageNumber="41" year="1906">
<bibRefCitation id="69134B57FF8DFF8B6DC0F94DFDEF22BC" author="Stebbing" box="[436,593,1729,1751]" pageId="40" pageNumber="41" refString="Stebbing, T. R. R. (1906) Amphipoda. I. Gammaridea. Das Tierreich, 21, 1 - 806." type="journal article" year="1906">Stebbing, 1906</bibRefCitation>
: 73
</treatmentCitation>
(in part).—
<treatmentCitation id="8C2310B7FF8DFF8B6E85F94EFC6022BC" author="Barnard" box="[753,990,1729,1751]" page="59" pageId="40" pageNumber="41" year="1932">
<bibRefCitation id="69134B57FF8DFF8B6E85F94EFC0722BC" author="Barnard" box="[753,953,1729,1751]" pageId="40" pageNumber="41" refString="Barnard, K. H. (1932) Amphipoda. Discovery Reports, 5, 1 - 326." type="journal article" year="1932">K.H. Barnard, 1932</bibRefCitation>
: 59
</treatmentCitation>
.
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FF8DFF8B6CE3F96CFC3D237F" blockId="40.[151,1402,1698,1843]" pageId="40" pageNumber="41">
<treatmentCitationGroup id="2D921188FF8DFF8B6CE3F96CFC3D237F" pageId="40" pageNumber="41">
<taxonomicName id="CA824D25FF8DFF8B6CE3F96CFEEB229D" box="[151,341,1760,1782]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F96CFEEB229D" box="[151,341,1760,1782]" italics="true" pageId="40" pageNumber="41">Eurythenes gryllus</emphasis>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FF8DFF8B6D06F96CFD1C229D" author="Stoddart" box="[370,674,1760,1782]" httpUri="http://treatment.plazi.org/id/2D09EC23E90EFFADFFDDFDE9FF75FAA6" page="429" pageId="40" pageNumber="41" year="2004">
<bibRefCitation id="69134B57FF8DFF8B6D06F96CFDCE229D" author="Stoddart" box="[370,624,1760,1782]" pageId="40" pageNumber="41" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
: 429
</treatmentCitation>
, in part, figs. 47.—?
<treatmentCitation id="8C2310B7FF8DFF8B6FF7F96CFB97229D" author="Senna" box="[899,1065,1760,1782]" page="83" pageId="40" pageNumber="41" year="2009">
<bibRefCitation id="69134B57FF8DFF8B6FF7F96CFBBA229D" author="Senna" box="[899,1028,1760,1782]" pageId="40" pageNumber="41" refString="Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96." type="journal article" year="2009">Senna, 2009</bibRefCitation>
: 83
</treatmentCitation>
, in part, figs. 12.
<taxonomicName id="CA824D25FF8DFF8B6CE3F972FEEB237F" box="[151,341,1790,1812]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F972FEEB237F" box="[151,341,1790,1812]" italics="true" pageId="40" pageNumber="41">Eurythenes gryllus</emphasis>
</taxonomicName>
clades Eg4 and Eg5.—
<treatmentCitation id="8C2310B7FF8DFF8B6E34F972FCE8237F" author="Havermans" box="[576,854,1790,1813]" page="12" pageId="40" pageNumber="41" year="2013">
<bibRefCitation id="69134B57FF8DFF8B6E34F972FC8C237F" author="Havermans" box="[576,818,1790,1813]" pageId="40" pageNumber="41" refString="Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. &amp; Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218" type="journal article" year="2013">
Havermans
<emphasis id="3FF6EAB4FF8DFF8B6EC9F88CFD4E237F" box="[701,752,1790,1813]" italics="true" pageId="40" pageNumber="41">et al.</emphasis>
, 2013
</bibRefCitation>
: 12
</treatmentCitation>
13.
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FF8DFF8B6CE3F892FA8A2358" blockId="40.[151,1402,1698,1843]" box="[151,1332,1821,1843]" pageId="40" pageNumber="41">
<treatmentCitationGroup id="2D921188FF8DFF8B6CE3F892FA8A2358" box="[151,1332,1821,1843]" pageId="40" pageNumber="41">
Not
<taxonomicName id="CA824D25FF8DFF8B6CB7F892FE0B2358" box="[195,437,1821,1843]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FF8DFF8B6CB7F892FE0B2358" box="[195,437,1821,1843]" italics="true" pageId="40" pageNumber="41">Eurytenes magellanicus</emphasis>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FF8DFF8B6DA6F891FD1B2358" author="Lilljeborg" box="[466,677,1821,1843]" page="11" pageId="40" pageNumber="41" year="1865">
<bibRefCitation id="69134B57FF8DFF8B6DA6F891FD3C2358" author="Lilljeborg" box="[466,642,1821,1843]" pageId="40" pageNumber="41" refString="Lilljeborg, W. (1865 a) On the Lysianassa magellanica H. Milne Edwards and on the Crustacea of the suborder Amphipoda and subfamily Lysianassina found an [sic] the coast of Sweden and Norway. The royal academy press, Uppsala, 37 pp., 5 pls." type="book" year="1865" yearSuffix="a">Lilljeborg 1865a</bibRefCitation>
: 11
</treatmentCitation>
, pls.
<date id="793C1066FF8DFF8B6EAFF891FCEB2358" box="[731,853,1821,1843]" pageId="40" pageNumber="41" value="1865-03-01">13.—1865</date>
b: 6 (=
<taxonomicName id="CA824D25FF8DFF8B6FE9F892FB3D2358" authority="Lichtenstein" authorityName="Lichtenstein" box="[925,1155,1821,1843]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="40" pageNumber="41" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FF8DFF8B6FE9F892FC412358" box="[925,1023,1821,1843]" italics="true" pageId="40" pageNumber="41">E. gryllus</emphasis>
<collectingCountry id="75957636FF8DFF8B6872F891FB3D2358" box="[1030,1155,1821,1843]" name="Liechtenstein" pageId="40" pageNumber="41">Lichtenstein</collectingCountry>
</taxonomicName>
in Mandt, 1822).
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFF8DFF896CE3F8D3FA2A253C" lastPageId="42" lastPageNumber="43" pageId="40" pageNumber="41" type="materials_examined">
<paragraph id="0D3D36A6FF8DFF8A6CE3F8D3FC1A2576" blockId="40.[151,1436,1887,2021]" lastBlockId="41.[151,1437,151,752]" lastPageId="41" lastPageNumber="42" pageId="40" pageNumber="41">
<emphasis id="3FF6EAB4FF8DFF8B6CE3F8D3FCE02313" bold="true" box="[151,862,1887,1912]" pageId="40" pageNumber="41">
Material examined. Clade Eg4 of
<bibRefCitation id="69134B57FF8DFF8B6E41F8D3FCE72313" box="[565,857,1887,1912]" pageId="40" pageNumber="41" refString="Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. &amp; Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218" type="journal article">
Havermans
<emphasis id="3FF6EAB4FF8DFF8B6EBCF8ECFCBC2313" bold="true" box="[712,770,1887,1912]" italics="true" pageId="40" pageNumber="41">et al.</emphasis>
(2013)
</bibRefCitation>
.
</emphasis>
RV Meteor, expedition
<collectionCode id="6B93AE63FF8DFF8B6802F8ECFB062313" box="[1142,1208,1888,1912]" pageId="40" pageNumber="41">DIVA</collectionCode>
3, ME 79-1,
<collectingCountry id="75957636FF8DFF8B6923F8D3FA252313" box="[1367,1435,1887,1912]" name="Brazil" pageId="40" pageNumber="41">Brazil</collectingCountry>
Basin, sta. 542,
<geoCoordinate id="68B65061FF8DFF8B6D3AF808FE7323F6" box="[334,461,1924,1949]" direction="south" orientation="latitude" pageId="40" pageNumber="41" precision="15" value="-26.55361">26°33'13&quot;S</geoCoordinate>
<geoCoordinate id="68B65061FF8DFF8B6DA2F808FDE123F6" box="[470,607,1924,1949]" direction="west" orientation="longitude" pageId="40" pageNumber="41" precision="15" value="-35.188057">35°11'17&quot;W</geoCoordinate>
,
<quantity id="CA7A9B43FF8DFF8B6E18F808FD7B23F7" box="[620,709,1924,1948]" metricMagnitude="3" metricUnit="m" metricValue="4.4799999999999995" pageId="40" pageNumber="41" unit="m" value="4480.0">4480 m</quantity>
, baited trap,
<date id="793C1066FF8DFF8B6F2EF808FC6023F6" box="[858,990,1924,1949]" pageId="40" pageNumber="41" value="2009-07-21">21.vii.2009</date>
:
<specimenCount id="1B84FD2FFF8DFF8B6F9EF808FBD023F6" box="[1002,1134,1924,1949]" pageId="40" pageNumber="41" type="generic">1 specimen</specimenCount>
, fixed first 96% denatured ethanol, coll. Ed Hendrycks, DZMB-HH 7989,
<collectionCode id="6B93AE63FF8DFF8B6EACF825FCA823AB" box="[728,790,1961,1984]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="40" pageNumber="41">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8DFF8B6F50F825FC2F23AA" box="[804,913,1960,1985]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44264" pageId="40" pageNumber="41" type="EnaNcbi">K 44264</accessionNumber>
; BraB-4, Euryt 77412506 (= EG-2807114),
<accessionNumber id="12D1AB45FF8DFF8B6CE3F840FEB4238E" box="[151,266,1996,2021]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887145" pageId="40" pageNumber="41">JX887145</accessionNumber>
(
<collectionCode id="6B93AE63FF8DFF8B6D6BF840FEEA238F" LSID="urn:lsid:biocol.org:col:14498" box="[287,340,1996,2020]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="40" pageNumber="41">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8DFF8B6D19F840FE5E238F" box="[365,480,1996,2020]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887097" pageId="40" pageNumber="41">JX887097</accessionNumber>
(28S),
<accessionNumber id="12D1AB45FF8DFF8B6E4BF840FD0C238F" box="[575,690,1996,2020]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887073" pageId="40" pageNumber="41">JX887073</accessionNumber>
(16S).—Same station:
<specimenCount id="1B84FD2FFF8DFF8B6FBEF840FBEC238E" box="[970,1106,1996,2021]" pageId="40" pageNumber="41" type="generic">1 specimen</specimenCount>
, DZMB-HH 7983,
<collectionCode id="6B93AE63FF8DFF8B6949F841FAC5238F" box="[1341,1403,1997,2020]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="40" pageNumber="41">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8DFF8A69FCF841FF5F24DB" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44265" lastPageId="41" lastPageNumber="42" pageId="40" pageNumber="41" type="EnaNcbi">K 44265</accessionNumber>
; BraB-5, Euryt 77412578 (= EG-2807117),
<accessionNumber id="12D1AB45FF8CFF8A6E96FF1BFCEB24DB" box="[738,853,151,176]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887145" pageId="41" pageNumber="42">JX887145</accessionNumber>
(
<collectionCode id="6B93AE63FF8CFF8A6F13FF14FC2224DB" LSID="urn:lsid:biocol.org:col:14498" box="[871,924,152,176]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8CFF8A6FC7FF14FB9824DB" box="[947,1062,152,176]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887099" pageId="41" pageNumber="42">JX887099</accessionNumber>
(28S),
<accessionNumber id="12D1AB45FF8CFF8A680BFF14FB4C24DB" box="[1151,1266,152,176]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887074" pageId="41" pageNumber="42">JX887074</accessionNumber>
(16S).—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6C81FF30FEC324BE" box="[245,381,188,213]" pageId="41" pageNumber="42" type="generic">1 specimen</specimenCount>
, DZMB-HH 7976,
<collectionCode id="6B93AE63FF8CFF8A6E13FF31FD1B24BF" box="[615,677,189,212]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6EC5FF31FCA524BE" box="[689,795,188,213]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44266" pageId="41" pageNumber="42" type="EnaNcbi">K 44266</accessionNumber>
; BraB-6, Euryt 77412562 (= EG-2807116),
<accessionNumber id="12D1AB45FF8CFF8A695DFF30FA2224BE" box="[1321,1436,188,213]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887145" pageId="41" pageNumber="42">JX887145</accessionNumber>
(
<collectionCode id="6B93AE63FF8CFF8A6CEBFF6CFF6A2493" LSID="urn:lsid:biocol.org:col:14498" box="[159,212,224,248]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8CFF8A6C9CFF6CFEE22493" box="[232,348,224,248]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887098" pageId="41" pageNumber="42">JX887098</accessionNumber>
(28S),
<accessionNumber id="12D1AB45FF8CFF8A6DC4FF6CFD9D2493" box="[432,547,224,248]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887073" pageId="41" pageNumber="42">JX887073</accessionNumber>
(16S).—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6F58FF6CFC112493" box="[812,943,223,248]" pageId="41" pageNumber="42" type="generic">1 specimen</specimenCount>
, DZMB-HH 7992,
<collectionCode id="6B93AE63FF8CFF8A68FFFF6CFB77249C" box="[1163,1225,224,247]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A68A5FF6CFA892493" box="[1233,1335,223,248]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44267" pageId="41" pageNumber="42" type="EnaNcbi">K 44267</accessionNumber>
; BraB-7, Euryt 77412564 (= EG-2807112),
<accessionNumber id="12D1AB45FF8CFF8A6E6EFE88FD332576" box="[538,653,260,285]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887146" pageId="41" pageNumber="42">JX887146</accessionNumber>
(
<collectionCode id="6B93AE63FF8CFF8A6EE8FE88FD6F2577" LSID="urn:lsid:biocol.org:col:14498" box="[668,721,260,284]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8CFF8A6E91FE88FCE62577" box="[741,856,260,284]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887073" pageId="41" pageNumber="42">JX887073</accessionNumber>
(16S).
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CB3FEABFA9225BB" blockId="41.[151,1437,151,752]" pageId="41" pageNumber="42">
<emphasis id="3FF6EAB4FF8CFF8A6CB3FEABFD2F252B" bold="true" box="[199,657,295,320]" pageId="41" pageNumber="42">
Clade Eg5 of
<bibRefCitation id="69134B57FF8CFF8A6D18FEABFD32252B" box="[364,652,295,320]" pageId="41" pageNumber="42" refString="Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. &amp; Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218" type="journal article">
Havermans
<emphasis id="3FF6EAB4FF8CFF8A6D8AFEA4FD86252B" bold="true" box="[510,568,295,320]" italics="true" pageId="41" pageNumber="42">et al.</emphasis>
(2013)
</bibRefCitation>
.
</emphasis>
Same station as for clade Eg4:
<specimenCount id="1B84FD2FFF8CFF8A6F89FEA4FBDC252B" box="[1021,1122,295,320]" pageId="41" pageNumber="42" type="female">1 female</specimenCount>
, DZMB-HH 7985,
<collectionCode id="6B93AE63FF8CFF8A6935FEA4FAC12554" box="[1345,1407,296,319]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A69FCFEA4FF5F250E" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44268" pageId="41" pageNumber="42" type="EnaNcbi">K 44268</accessionNumber>
; BraB-2, Euryt 77412554 (= EG-2807113),
<accessionNumber id="12D1AB45FF8CFF8A6E96FEC0FCEB250F" box="[738,853,332,356]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887144" pageId="41" pageNumber="42">JX887144</accessionNumber>
(
<collectionCode id="6B93AE63FF8CFF8A6F13FEC0FC22250F" LSID="urn:lsid:biocol.org:col:14498" box="[871,924,332,356]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8CFF8A6FC7FEC0FB98250F" box="[947,1062,332,356]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887102" pageId="41" pageNumber="42">JX887102</accessionNumber>
(28S),
<accessionNumber id="12D1AB45FF8CFF8A680BFEC0FB4C250F" box="[1151,1266,332,356]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887072" pageId="41" pageNumber="42">JX887072</accessionNumber>
(16S).—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6C85FEFCFEE925E3" box="[241,343,367,392]" pageId="41" pageNumber="42" type="female">1 female</specimenCount>
, DZMB-HH 7980,
<collectionCode id="6B93AE63FF8CFF8A6E41FEFCFDCD25EC" box="[565,627,368,391]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6E0FFEFCFD5C25E3" box="[635,738,367,392]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44269" pageId="41" pageNumber="42" type="EnaNcbi">K 44269</accessionNumber>
; BraB-3, Euryt 77412514 (= EG-2807115),
<accessionNumber id="12D1AB45FF8CFF8A68A3FEFCFAF425E3" box="[1239,1354,368,392]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887143" pageId="41" pageNumber="42">JX887143</accessionNumber>
(
<collectionCode id="6B93AE63FF8CFF8A692EFEFCFA3125E3" LSID="urn:lsid:biocol.org:col:14498" box="[1370,1423,368,392]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8CFF8A6CE3FE18FEB425C7" box="[151,266,404,428]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887100" pageId="41" pageNumber="42">JX887100</accessionNumber>
(28S),
<accessionNumber id="12D1AB45FF8CFF8A6D28FE18FE7125C7" box="[348,463,404,428]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887071" pageId="41" pageNumber="42">JX887071</accessionNumber>
(16S).—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6EA0FE18FC8A25C6" box="[724,820,404,429]" pageId="41" pageNumber="42" type="female">1 female</specimenCount>
fully dissected and illustrated, DZMB-HH 7994,
<collectionCode id="6B93AE63FF8CFF8A692AFE19FA2225C7" box="[1374,1436,405,428]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6CE3FE34FF4225BB" box="[151,252,440,464]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44270" pageId="41" pageNumber="42" type="EnaNcbi">K 44270</accessionNumber>
; BraB-1, Euryt 77412540 (= EG-2807111),
<accessionNumber id="12D1AB45FF8CFF8A6E9DFE34FCE225BB" box="[745,860,440,464]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887144" pageId="41" pageNumber="42">JX887144</accessionNumber>
(
<collectionCode id="6B93AE63FF8CFF8A6F18FE34FC1F25BB" LSID="urn:lsid:biocol.org:col:14498" box="[876,929,440,464]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
),
<accessionNumber id="12D1AB45FF8CFF8A6FC0FE34FB9925BB" box="[948,1063,440,464]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887101" pageId="41" pageNumber="42">JX887101</accessionNumber>
(28S), JX88707 (16S).
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CB3FE50FD7426C3" blockId="41.[151,1437,151,752]" pageId="41" pageNumber="42">
<emphasis id="3FF6EAB4FF8CFF8A6CB3FE50FD67259E" bold="true" box="[199,729,476,501]" pageId="41" pageNumber="42">Specimens not sequenced, or without success</emphasis>
. Same station as for clades Eg4 and Eg5:
<specimenCount id="1B84FD2FFF8CFF8A68DFFE50FA89259E" box="[1195,1335,476,501]" pageId="41" pageNumber="42" type="generic">8 specimens</specimenCount>
, DZMB- HH 8047,
<collectionCode id="6B93AE63FF8CFF8A6D6CFD8CFED42673" box="[280,362,512,536]" pageId="41" pageNumber="42">CMNC</collectionCode>
2014-0098.—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6ECBFD8CFCEC2673" box="[703,850,511,536]" pageId="41" pageNumber="42" type="generic">7 specimens</specimenCount>
, DZMB-HH 8047,
<collectionCode id="6B93AE63FF8CFF8A684AFD8CFB2D2673" LSID="urn:lsid:biocol.org:col:35271" box="[1086,1171,512,536]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35271" name="Royal Belgian Institute of Natural Sciences" pageId="41" pageNumber="42">RBINS</collectionCode>
,
<collectionCode id="6B93AE63FF8CFF8A68D1FD8CFB69267C" box="[1189,1239,512,535]" pageId="41" pageNumber="42">INV</collectionCode>
. 132167.—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6C81FDA9FE3B2656" box="[245,389,548,573]" pageId="41" pageNumber="42" type="generic">7 specimens</specimenCount>
, DZMB-HH 8047,
<collectionCode id="6B93AE63FF8CFF8A6E1AFDA9FD122657" box="[622,684,549,572]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6EC3FDA9FCA12657" box="[695,799,548,572]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44279" pageId="41" pageNumber="42" type="EnaNcbi">K 44279</accessionNumber>
.—Same station:
<specimenCount id="1B84FD2FFF8CFF8A6F9CFDA8FBC72656" box="[1000,1145,548,573]" pageId="41" pageNumber="42" type="generic">8 specimens</specimenCount>
, each in a different vial, DZMB-HH 7975,
<collectionCode id="6B93AE63FF8CFF8A6D1EFDC4FE162634" box="[362,424,584,607]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6DC5FDC4FDA9260B" box="[433,535,584,608]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44271" pageId="41" pageNumber="42" type="EnaNcbi">K 44271</accessionNumber>
; DZMB-HH 7977,
<collectionCode id="6B93AE63FF8CFF8A6E8DFDC4FC892634" box="[761,823,584,607]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6F34FDC4FC19260B" box="[832,935,584,608]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44272" pageId="41" pageNumber="42" type="EnaNcbi">K 44272</accessionNumber>
; DZMB-HH 7978,
<collectionCode id="6B93AE63FF8CFF8A68F3FDC4FB7B2634" box="[1159,1221,584,607]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A68BAFDC4FA8B260B" box="[1230,1333,584,608]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44273" pageId="41" pageNumber="42" type="EnaNcbi">K 44273</accessionNumber>
; DZMB- HH 7979,
<collectionCode id="6B93AE63FF8CFF8A6D79FDE1FEF526EF" box="[269,331,621,644]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6D27FDE1FE0726EF" box="[339,441,620,644]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44274" pageId="41" pageNumber="42" type="EnaNcbi">K 44274</accessionNumber>
; DZMB-HH 7982,
<collectionCode id="6B93AE63FF8CFF8A6EE1FDE1FD6D26EF" box="[661,723,621,644]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6EAEFDE1FCFE26EE" box="[730,832,620,645]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44275" pageId="41" pageNumber="42" type="EnaNcbi">K 44275</accessionNumber>
; DZMB-HH 7986,
<collectionCode id="6B93AE63FF8CFF8A6868FDE1FBE426EF" box="[1052,1114,621,644]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6816FDE1FB7626EE" box="[1122,1224,620,645]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44276" pageId="41" pageNumber="42" type="EnaNcbi">K 44276</accessionNumber>
; DZMB-HH 7987,
<collectionCode id="6B93AE63FF8CFF8A6CE3FD1CFF6B26CC" box="[151,213,656,679]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6CA8FD1CFEFF26C3" box="[220,321,656,680]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44277" pageId="41" pageNumber="42" type="EnaNcbi">K 44277</accessionNumber>
; DZMB-HH 7990,
<collectionCode id="6B93AE63FF8CFF8A6E68FD1CFDE426CC" box="[540,602,656,679]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="41" pageNumber="42">ZMH</collectionCode>
<accessionNumber id="12D1AB45FF8CFF8A6E15FD1CFD7B26C3" box="[609,709,656,680]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44278" pageId="41" pageNumber="42" type="EnaNcbi">K 44278</accessionNumber>
.
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CB3FD38FE5926A7" blockId="41.[151,1437,151,752]" box="[199,487,692,717]" pageId="41" pageNumber="42">
Voucher
<collectionCode id="6B93AE63FF8CFF8A6D5FFD38FED626A7" LSID="urn:lsid:biocol.org:col:15536" box="[299,360,692,716]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:15536" name="Department of Natural Resources, Environment, The Arts and Sport" pageId="41" pageNumber="42">DNA</collectionCode>
sequences.
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CE3FD5BFD38269B" blockId="41.[151,1437,151,752]" box="[151,646,727,752]" pageId="41" pageNumber="42">
<emphasis id="3FF6EAB4FF8CFF8A6CE3FD5BFD38269B" bold="true" box="[151,646,727,752]" pageId="41" pageNumber="42">
Clade Eg4,
<collectingCountry id="75957636FF8CFF8A6D54FD5BFED7269B" box="[288,361,727,752]" name="Brazil" pageId="41" pageNumber="42">Brazil</collectingCountry>
Basin, Euryt 77412506.
</emphasis>
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CE3FCACFE5F2753" blockId="41.[151,1436,799,1184]" box="[151,481,799,824]" pageId="41" pageNumber="42">
<collectionCode id="6B93AE63FF8CFF8A6CE3FCACFF792753" LSID="urn:lsid:biocol.org:col:14498" box="[151,199,800,824]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="41" pageNumber="42">COI</collectionCode>
(GenBANK
<accessionNumber id="12D1AB45FF8CFF8A6D28FC93FE6B2753" box="[348,469,799,824]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887145" pageId="41" pageNumber="42">JX887145</accessionNumber>
):
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CE3FCC8FCB820CB" blockId="41.[151,1436,799,1184]" box="[151,1436,836,1184]" pageId="41" pageNumber="42">AACCTTATATTTCGTCTTAGGCGCCTGAGCTAGGGTTGTTGGTACATCTCTTAGTGTAATTATTCGATCT GAACTCAGTAGACCGGGAAACCTAATTGGAGATGATCAAATCTATAATGTAATAGTAACTGCCCACGC CTTTGTCATAATCTTCTTTATAGTTATACCTATCATAATCGGTGGTTTTGGAAATTGACTTGTACCTCTTA TGCTCGGAAGCCCCGACATAGCTTTCCCGCGCATAAATAATATAAGATTCTGACTCCTGCCCCCCTCAC TAACTTTATTATTAATAAGAGGTCTAGTAGAAAGGGGCGTAGGAACTGGTTGAACAGTCTATCCACCCT TGGCCGCAGCCGCGGCCCACAGCGGAGGGTCTGTTGACCTGGCTATCTTCTCTCTGCACCTAGCAGGT GCTTCCTCCATCTTAGGTGCTATTAATTTTATCTCCACTGTAATCAACATACGAACCCCCGGTATATATAT AGACCGAGTCCCTTTATTTGTCTGGTCTGTCTTCATCACAGCCATTCTACTCCTCTTATCTCTACCCGTA CTGGCAGGTGCAATCACCATACTCCTGACAGACCGAAATCTGAATACTTCCTTCTTTGACCCTAGCGG TGGAGGTGACCCTATCCTCTACCAACATCTATTC</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CE3FB5CFE632083" blockId="41.[151,1436,1232,1904]" box="[151,477,1232,1256]" pageId="41" pageNumber="42">
28S (GenBANK
<accessionNumber id="12D1AB45FF8CFF8A6D2CFB5CFE6F2083" box="[344,465,1232,1256]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887097" pageId="41" pageNumber="42">JX887097</accessionNumber>
):
</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CE3FB78FC61231B" blockId="41.[151,1436,1232,1904]" box="[151,1436,1268,1904]" pageId="41" pageNumber="42">GGCCTGCGGCGGAATGTTGCGTTAAGGGAAAGGTCGTAGTCAAACCCTACAACCACACGAACTCTAA GTCTGCCACGAATAGGCTATCCCAACTAACGGCGGGAGTGACTCCACGGAGGGTGTAAGACCCGTGT GGGCGTGTGTCAATGTTGTATGGGCTCGGCCTCTTCCCTGAGAGTCGCGTTGCTTGAGCATGCAGCGC TAAGCAGGTCGTAAACTCGATCTAAGGCTAAATATTTCCACAGGACCGATAGCAAACAAGTACCGTGA GGGAAAGTTGAAAAGCACTCTGAAGAGAGAGTCAAAAGACCGTGAAACCGCTCAGAGTATAAGCCC ATGGAGCTTGGAAGGCTTCCGCAGCGGCGTGCATCCCTTGTGGGTGTACGTGAGGACATTGTGAAAG GTTCGCTAGGCAGGGGGCATTGAGTTTGCTCCCCACCGCCGTGCTGGTGAATTGCCTGGGAGGAGTC GTGCCTCGGTGCGGCTCTCTTTTGGGTCGTTCTCATGTGTATGAACGTTCAAGGACAATGACCTAATGC GGTACGCCCACCACAGTTTGTTGTGAGGTCACCCACAGGCTCAAACTGTCGATCGTGTGTTCAGTGC GTGGCCTGAATTGTGTGCCGTTCGTAATATAGTGCCACCGTTATCTGTGTGGCGCTCCGGCATGCAGTC GCGCGCTGGACCAGGCGACGAAACGAGTATATCCTGGTATGATCCTCGTGCGACAATCTGATTCTGAC CGAGTGTACATCGCTACCGTTTGGCTCTGCCCATGTGTCGGGCGGAGTCAGGAGGTGCAACCTGATTG TCTGGTCCTCTGAACGATGTAACAGTCGATAAGATCTCAGTCGAGGTAGCGAACGACTCGCGTGGTGT TAAGTCCAGCACCATCGGTCACGTCTCGAAACACGGGCCAAGGAGTATAGCATGTGTGCAAGTCTAA GGGTCTCACAAAACCCGCAGGCGAAGTGAAAGCAAATGGTGTGGCGGGAGCGCTACGGCAATCTCG TCAGCCTTGTGGTGGTCAAAAACTACTCGGCTTAAACCGAGCTGATCCTGTTCTGTTGGCAATGTCTC AAGGCAGGCGCAAGCTCCGGGCTCACATACCAACACTGGCATCCTCACGGGTGCTGTGTTGTGAGCA CCGTGGAGCATGCATGCTATAACCCGAAAGATAGTGAACTATGCC</paragraph>
<paragraph id="0D3D36A6FF8CFF8A6CE3F82CFE6323D3" blockId="41.[151,1426,1952,2012]" box="[151,477,1952,1977]" pageId="41" pageNumber="42">
16S (GenBANK
<accessionNumber id="12D1AB45FF8CFF8A6D2CF82CFE6F23D3" box="[344,465,1952,1976]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887073" pageId="41" pageNumber="42">JX887073</accessionNumber>
):
</paragraph>
<paragraph id="0D3D36A6FF8CFF896CE3F848FA2A253C" blockId="41.[151,1426,1952,2012]" box="[151,1435,152,2012]" lastBlockId="42.[151,1435,152,343]" lastPageId="42" lastPageNumber="43" pageId="41" pageNumber="42">TGCTATAGGGGTAGCGTATGGTAAGGCCTGCCCAGTGATTTATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTATAGTAAGAGTAAAAATACTCTGGTGTGATTAAGGGACGACAAGACCCT AAAAGCTTTATTTTTAGTATTAGTTTGAGTTTAAAATAAAATAGAGAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAGAAGGCATGTAAAGTGGGGTTAGGTCCTTTAGATAAGGATAATTTGAGTGA GTTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGGCTGATTGCGACCTCGAT GTTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA</paragraph>
</subSubSection>
</treatment>
</document>

File diff suppressed because one or more lines are too long

View file

@ -0,0 +1,363 @@
<document id="64BE54C0EF6A5B5228E18534EAEBF0A8" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FF9AFFE36CE3F8BDFCB923B9" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Eurythenes obesus Chevreux 1905" docType="treatment" docVersion="8" lastPageNumber="65" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="64" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="DAFB109B611CB0D5ED793277B29A9809" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="1256FF05EC8731B8C95F9F3FE8E8F99D">
<mods:title id="B5EB100C1912392E09132C6604378C70">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="A9C8E635433B7980A5564AFB5DA63C1C" type="personal">
<mods:role id="2B3F3A7606DDEF012F2364419079F7D1">
<mods:roleTerm id="3D26307703572C00087804ECD682B5DA">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="63A9E67C1E3DBCDF3E4EAB04D7FD2C06">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="BE9FD69F869A57D2D73A4448166A757F" type="personal">
<mods:role id="C48AF12E3FF8C7E1917DA0F8B33C9EE4">
<mods:roleTerm id="3BA2B266E9A80739DAA2DD6BD48799B2">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="91ABD7D1CC00C8E841DA0ACF52F96854">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="5E6AC403F296C685C5B92DF2ADB66C6B">text</mods:typeOfResource>
<mods:relatedItem id="AFEC11863FA3826B250500FC7A05A11E" type="host">
<mods:titleInfo id="BB0D5024F20ED383C9B9C379A5CE3385">
<mods:title id="ADE169E00CDC7BC5FC77CA1AED565B82">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="ACF1B7556BFD3EEACDF06DFDD5C98F99">
<mods:date id="776B5D4F17AA6B008B20718357722E94">2015</mods:date>
<mods:detail id="C9BE27C194DC88CDA04FEEE223B58218" type="volume">
<mods:number id="593FB87E8685F63486336B0C1C2D8D59">3971</mods:number>
</mods:detail>
<mods:detail id="2EC48A5BF0918117B3B6B59C217C73AE" type="issue">
<mods:number id="3966FB8BD2E5B55A9629D4D9D9BA62A9">1</mods:number>
</mods:detail>
<mods:extent id="2DCC4C6E9FD7750440F15AFF6F83D3E7" unit="page">
<mods:start id="29AB422346D89DABDCF728659418AAD7">1</mods:start>
<mods:end id="1E69E68A2948F29FDF65CC3040192B14">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="B904B18D54B43F82B6796BA2C7C4041B">journal article</mods:classification>
<mods:identifier id="58B541DECAF2AB48EA78563CD8BDB77A" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="A8E9AD8975D77FC2A80E3340E0D06EC0" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="9E855CEEA1833E3B48A5034F2E36EEC4" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="EB9F551F7D7CB5C0B46F071ED341B618" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="780ED0AD320AF41C694CFA96F8827CB4" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FF9AFFE36CE3F8BDFCB923B9" ID-DOI="http://doi.org/10.5281/zenodo.5470190" ID-GBIF-Taxon="127691977" ID-Zenodo-Dep="5470190" LSID="urn:lsid:plazi:treatment:852B87B0FF9AFFE36CE3F8BDFCB923B9" httpUri="http://treatment.plazi.org/id/852B87B0FF9AFFE36CE3F8BDFCB923B9" lastPageId="64" lastPageNumber="65" pageId="63" pageNumber="64">
<subSubSection id="4598652DFF9AFF9C6CE3F8BDFF472306" pageId="63" pageNumber="64" type="nomenclature">
<paragraph id="0D3D36A6FF9AFF9C6CE3F8BDFDE92327" blockId="63.[151,599,1841,1901]" box="[151,599,1841,1868]" pageId="63" pageNumber="64">
<heading id="567581CAFF9AFF9C6CE3F8BDFDE92327" bold="true" box="[151,599,1841,1868]" fontSize="11" level="1" pageId="63" pageNumber="64" reason="1">
<taxonomicName id="CA824D25FF9AFF9C6CE3F8BDFDE92327" authority="Chevreux, 1905" authorityName="Chevreux" authorityYear="1905" box="[151,599,1841,1868]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="63" pageNumber="64" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FF9AFF9C6CE3F8BDFDE92327" bold="true" box="[151,599,1841,1868]" pageId="63" pageNumber="64">
<emphasis id="3FF6EAB4FF9AFF9C6CE3F8BDFEC42320" bold="true" box="[151,378,1841,1867]" italics="true" pageId="63" pageNumber="64">Eurythenes obesus</emphasis>
(
<bibRefCitation id="69134B57FF9AFF9C6DFDF8BEFDF12327" author="Chevreux" box="[393,591,1842,1868]" pageId="63" pageNumber="64" refString="Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7." type="journal article" year="1905">Chevreux, 1905</bibRefCitation>
)
</emphasis>
</taxonomicName>
</heading>
</paragraph>
<paragraph id="0D3D36A6FF9AFF9C6CE3F8D8FF472306" blockId="63.[151,599,1841,1901]" box="[151,249,1876,1901]" pageId="63" pageNumber="64">
(
<figureCitation id="95B92A23FF9AFF9C6CEBF8D8FF4F2306" box="[159,241,1876,1901]" captionStart="FIGURE 46" captionStartId="65.[151,250,1954,1976]" captionTargetBox="[256,1330,193,1932]" captionTargetId="figure@65.[256,1330,193,1933]" captionTargetPageId="65" captionText="FIGURE 46. Eurythenes obesus (Chevreux, 1905). ANT-XXVIII / 3, sta. 172 - 3, 49 ° 12.81 S 38 ° 12.97 W, 0 m, RBINS, INV. 122853. A, anterior part of body; B, posterior part of body. Photographs C. Havermans, RBINS, copyright RBINS." httpUri="https://zenodo.org/record/288862/files/figure.png" pageId="63" pageNumber="64">Fig. 46</figureCitation>
)
</paragraph>
</subSubSection>
<subSubSection id="4598652DFF9AFFE36CE3F811FBFC24A7" lastPageId="64" lastPageNumber="65" pageId="63" pageNumber="64" type="reference_group">
<paragraph id="0D3D36A6FF9AFF9C6CE3F811FBAB23BA" blockId="63.[151,1436,1948,2032]" pageId="63" pageNumber="64">
<treatmentCitationGroup id="2D921188FF9AFF9C6CE3F811FBAB23BA" pageId="63" pageNumber="64">
<taxonomicName id="CA824D25FF9AFF9C6CE3F811FE5323D9" authority="Chevreux, 1905: 1" authorityName="Chevreux" authorityPageNumber="1" authorityYear="1905" box="[151,493,1948,1970]" class="Malacostraca" family="Lysianassidae" genus="Katius" kingdom="Animalia" order="Amphipoda" pageId="63" pageNumber="64" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FF9AFF9C6CE3F811FE9823D9" box="[151,294,1948,1970]" italics="true" pageId="63" pageNumber="64">Katius obesus</emphasis>
<treatmentCitation id="8C2310B7FF9AFF9C6D5AF810FE5323D9" author="Chevreux" box="[302,493,1948,1970]" page="1" pageId="63" pageNumber="64" year="1905">
<bibRefCitation id="69134B57FF9AFF9C6D5AF810FE6A23D9" author="Chevreux" box="[302,468,1948,1970]" pageId="63" pageNumber="64" refString="Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7." type="journal article" year="1905">Chevreux, 1905</bibRefCitation>
: 1
</treatmentCitation>
</taxonomicName>
, figs. 13.—
<treatmentCitation id="8C2310B7FF9AFF9C6E1BF810FCCF23D9" author="Schellenberg" box="[623,881,1948,1970]" page="217" pageId="63" pageNumber="64" year="1926">
<bibRefCitation id="69134B57FF9AFF9C6E1BF810FC8323D9" author="Schellenberg" box="[623,829,1948,1970]" pageId="63" pageNumber="64" refString="Schellenberg, A. (1926) Amphipoda 3: Die Gammariden der Deutschen Tiefsee-Expedition. Wissenschaftliche Ergebnisse der Deutschen Tiefsee-Expedition auf dem Dampfer Valdivia 1898 - 1899, 23 (5), 193 - 243, pl. 5." type="journal article" year="1926">Schellenberg, 1926</bibRefCitation>
: 217
</treatmentCitation>
, fig. 26d.—
<treatmentCitation id="8C2310B7FF9AFF9C6F85F810FB5A23D9" author="Barnard" box="[1009,1252,1948,1970]" page="36" pageId="63" pageNumber="64" year="1932">
<bibRefCitation id="69134B57FF9AFF9C6F85F810FB0223D9" author="Barnard" box="[1009,1212,1948,1970]" pageId="63" pageNumber="64" refString="Barnard, K. H. (1932) Amphipoda. Discovery Reports, 5, 1 - 326." type="journal article" year="1932">K.H. Barnard, 1932</bibRefCitation>
: 36
</treatmentCitation>
, fig. 21, pl. 1 fig. 1.—
<treatmentCitation id="8C2310B7FF9AFF9C6C9AF837FE0223BA" author="Chevreux" box="[238,444,1979,2001]" page="63" pageId="63" pageNumber="64" year="1935">
<bibRefCitation id="69134B57FF9AFF9C6C9AF837FE2623BA" author="Chevreux" box="[238,408,1979,2001]" pageId="63" pageNumber="64" refString="Chevreux, E. (1935) Amphipodes provenant des campagnes du Prince Albert Ier de Monaco. Resultats des Campagnes scientifiques accomplies sur son Yacht par Albert Ier Prince Souverain de Monaco, 90, 1 - 214, pls. 1 - 16." type="journal article" year="1935">Chevreux, 1935</bibRefCitation>
: 63
</treatmentCitation>
65, pl. 10 fig. 4, 6, pl. 11 fig. 10.—
<treatmentCitation id="8C2310B7FF9AFF9C6F52F837FBAE23BA" author="Shoemaker" box="[806,1040,1979,2001]" page="177" pageId="63" pageNumber="64" year="1956">
<bibRefCitation id="69134B57FF9AFF9C6F52F837FC6323BA" author="Shoemaker" box="[806,989,1979,2001]" pageId="63" pageNumber="64" refString="Shoemaker, C. R. (1956) Notes on the amphipods Eurythenes gryllus (Lichtenstein) and Katius obesus Chevreux. Proceedings of the Biological Society of Washington, 69, 177 - 178." type="journal article" year="1956">Shoemaker, 1956</bibRefCitation>
: 177
</treatmentCitation>
.
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FF9AFF9C6CE3F856FCA8239B" blockId="63.[151,1436,1948,2032]" box="[151,790,2010,2032]" pageId="63" pageNumber="64">
<treatmentCitationGroup id="2D921188FF9AFF9C6CE3F856FCA8239B" box="[151,790,2010,2032]" pageId="63" pageNumber="64">
<taxonomicName id="CA824D25FF9AFF9C6CE3F856FEEB239B" box="[151,341,2010,2032]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="63" pageNumber="64" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FF9AFF9C6CE3F856FEEB239B" box="[151,341,2010,2032]" italics="true" pageId="63" pageNumber="64">Eurythenes gryllus</emphasis>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FF9AFF9C6D07F856FDF1239B" author="Stephensen" box="[371,591,2010,2032]" page="12" pageId="63" pageNumber="64" year="1933">
<bibRefCitation id="69134B57FF9AFF9C6D07F856FD94239B" author="Stephensen" box="[371,554,2010,2032]" pageId="63" pageNumber="64" refString="Stephensen, K. (1933) The Godthaab expedition 1928. Meddelelser om Gronland, 79 (7), 1 - 88." type="journal article" year="1933">Stephensen, 1933</bibRefCitation>
: 12
</treatmentCitation>
, in part, fig. 6 only.
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CE3FF14FBFC24A7" blockId="64.[151,1436,152,204]" pageId="64" pageNumber="65">
<treatmentCitationGroup id="2D921188FFE5FFE36CE3FF14FBFC24A7" pageId="64" pageNumber="65">
<taxonomicName id="CA824D25FFE5FFE36CE3FF14FEED24C5" box="[151,339,152,174]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE36CE3FF14FEED24C5" box="[151,339,152,174]" italics="true" pageId="64" pageNumber="65">Eurythenes obesus</emphasis>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FFE5FFE36D06FF14FD9324C5" author="Barnard" box="[370,557,152,174]" page="38" pageId="64" pageNumber="65" year="1961">
<bibRefCitation id="69134B57FFE5FFE36D06FF14FDB724C5" author="Barnard" box="[370,521,152,174]" pageId="64" pageNumber="65" refString="Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128." type="journal article" year="1961">Barnard, 1961</bibRefCitation>
: 38
</treatmentCitation>
, fig. 8.—
<treatmentCitation id="8C2310B7FFE5FFE36EFDFF14FBB624C5" author="Bellan-Santini" box="[649,1032,152,174]" page="680" pageId="64" pageNumber="65" year="1974">
<bibRefCitation id="69134B57FFE5FFE36EFDFF14FC6B24C5" author="Bellan-Santini" box="[649,981,152,174]" pageId="64" pageNumber="65" refString="Bellan-Santini, D. &amp; Ledoyer, M. (1974) Gammariens (Crustacea - Amphipoda) des iles Kerguelen &amp; Crozet. Tethys, 5 (4), 635 - 708." type="journal article" year="1974">Bellan-Santini &amp; Ledoyer, 1974</bibRefCitation>
: 680
</treatmentCitation>
, pl. 25.—
<treatmentCitation id="8C2310B7FFE5FFE3681CFF14FA2924C5" author="Stoddart" box="[1128,1431,152,174]" page="445" pageId="64" pageNumber="65" year="2004">
<bibRefCitation id="69134B57FFE5FFE3681CFF14FAD824C5" author="Stoddart" box="[1128,1382,152,174]" pageId="64" pageNumber="65" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
: 445
</treatmentCitation>
, figs. 1215 (ubi syn.).—
<treatmentCitation id="8C2310B7FFE5FFE36DCFFF3AFD6D24A7" author="Senna" box="[443,723,182,204]" page="374" pageId="64" pageNumber="65" year="2008">
<bibRefCitation id="69134B57FFE5FFE36DCFFF3AFD1F24A7" author="Senna" box="[443,673,182,204]" pageId="64" pageNumber="65" refString="Senna, A. R. &amp; Serejo, C. S. (2008) First record of Eurythenes obesus (Chevreux, 1905) (Amphipoda, Lysianassoidea, Eurytheneidae) in Brazilian waters. Arquivos do Museu Nacional, Rio de Janeiro, 66 (2), 373 - 379." type="journal article" year="2008">Senna &amp; Serejo, 2008</bibRefCitation>
: 374
</treatmentCitation>
, figs. 12.—
<treatmentCitation id="8C2310B7FFE5FFE36F27FF3AFC4524A7" author="Senna" box="[851,1019,182,204]" page="88" pageId="64" pageNumber="65" year="2009">
<bibRefCitation id="69134B57FFE5FFE36F27FF3AFC6824A7" author="Senna" box="[851,982,182,204]" pageId="64" pageNumber="65" refString="Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96." type="journal article" year="2009">Senna, 2009</bibRefCitation>
: 88
</treatmentCitation>
, fig. 3.
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE5FFE36CE3FF75FD632169" pageId="64" pageNumber="65" type="materials_examined">
<paragraph id="0D3D36A6FFE5FFE36CE3FF75FE402665" blockId="64.[151,1436,249,562]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CE3FF75FE3D2579" bold="true" box="[151,387,249,274]" pageId="64" pageNumber="65">Material examined.</emphasis>
Tjalfe sta. 15, off SE
<collectingCountry id="75957636FFE5FFE36EFFFF75FCBD2579" box="[651,771,249,274]" name="Greenland" pageId="64" pageNumber="65">Greenland</collectingCountry>
,
<geoCoordinate id="68B65061FFE5FFE36F64FF75FCD22579" box="[784,876,249,274]" direction="north" orientation="latitude" pageId="64" pageNumber="65" precision="925" value="58.133335">58°08'N</geoCoordinate>
<geoCoordinate id="68B65061FFE5FFE36F02FF75FC67257A" box="[886,985,249,273]" direction="west" orientation="longitude" pageId="64" pageNumber="65" precision="925" value="-39.4">39°24'W</geoCoordinate>
,
<quantity id="CA7A9B43FFE5FFE36F93FF75FB8F257A" box="[999,1073,249,274]" metricMagnitude="2" metricUnit="m" metricValue="5.0" pageId="64" pageNumber="65" unit="m" value="500.0">500 m</quantity>
wire, ring trawl,
<date id="793C1066FFE5FFE3688BFF75FA3C2579" box="[1279,1410,249,274]" pageId="64" pageNumber="65" value="1908-05-26">26.05.1908</date>
:
<specimenCount id="1B84FD2FFFE5FFE369FAFF75FEB1255D" pageId="64" pageNumber="65" type="generic">2 specimens</specimenCount>
, TSZCr. 2722.—Station ANO 315-D704 [or DT04???] (the coordinates could not be traced), no date:
<specimenCount id="1B84FD2FFFE5FFE369FAFE92FEB12531" pageId="64" pageNumber="65" type="generic">2 specimens</specimenCount>
, with a label concerning colour notes: small one, gray and pale pink; large one, bright red, leg. J.B., TSZCr 19070. —RV Polarstern, expedition PS79, ANT-XXVIII/3, Southern Ocean, mid of Atlantic sector, sta. 141-7,
<geoCoordinate id="68B65061FFE5FFE36C9EFE05FED725C9" box="[234,361,393,418]" direction="south" orientation="latitude" pageId="64" pageNumber="65" precision="9" value="-51.265835">51°15.95S</geoCoordinate>
<geoCoordinate id="68B65061FFE5FFE36D07FE05FE4325CA" box="[371,509,393,417]" direction="west" orientation="longitude" pageId="64" pageNumber="65" precision="9" value="-12.628333">12°37.70W</geoCoordinate>
,
<quantity id="CA7A9B43FFE5FFE36E78FE05FDC225CA" box="[524,636,393,418]" metricMagnitude="3" metricUnit="m" metricValue="4.1095" pageId="64" pageNumber="65" unit="m" value="4109.5">4109.5 m</quantity>
, Agassiz Trawl,
<date id="793C1066FFE5FFE36F36FE05FC0925C9" box="[834,951,393,418]" pageId="64" pageNumber="65" value="2012-02-18">18.ii.2012</date>
:
<specimenCount id="1B84FD2FFFE5FFE36FB2FE05FBF525C9" box="[966,1099,393,418]" pageId="64" pageNumber="65" type="generic">1 specimen</specimenCount>
, leg. C. Havermans,
<collectionCode id="6B93AE63FFE5FFE36937FE05FA2625CA" LSID="urn:lsid:biocol.org:col:35271" box="[1347,1432,393,417]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35271" name="Royal Belgian Institute of Natural Sciences" pageId="64" pageNumber="65">RBINS</collectionCode>
,
<collectionCode id="6B93AE63FFE5FFE36CE3FE22FF7725AE" box="[151,201,430,453]" pageId="64" pageNumber="65">INV</collectionCode>
.
<date id="793C1066FFE5FFE36CA2FE21FE9325AD" box="[214,301,429,454]" pageId="64" pageNumber="65" value="52-12-28">122852</date>
, Eob-C103, ANT283-103 (
<collectionCode id="6B93AE63FFE5FFE36E1DFE22FD2425AD" LSID="urn:lsid:biocol.org:col:14498" box="[617,666,430,454]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="64" pageNumber="65">COI</collectionCode>
).—ANT-XXVIII/3, NW of
<collectingCountry id="75957636FFE5FFE36F97FE21FB3525AD" box="[995,1163,429,454]" name="South Georgia and the South Sandwich Islands" pageId="64" pageNumber="65">South Georgia</collectingCountry>
, sta. 172-3,
<geoCoordinate id="68B65061FFE5FFE36969FE22FA2225AD" box="[1309,1436,430,454]" direction="south" orientation="latitude" pageId="64" pageNumber="65" precision="9" value="-49.2135">49°12.81S</geoCoordinate>
<geoCoordinate id="68B65061FFE5FFE36CE3FE5DFE9E2582" box="[151,288,465,489]" direction="west" orientation="longitude" pageId="64" pageNumber="65" precision="9" value="-38.216167">38°12.97W</geoCoordinate>
, 0 m, Rectangular Midwater Trawl,
<date id="793C1066FFE5FFE36EC1FE5DFC8C2581" box="[693,818,465,490]" pageId="64" pageNumber="65" value="2012-03-01">01.iii.2012</date>
:
<specimenCount id="1B84FD2FFFE5FFE36F48FE5DFC002581" box="[828,958,465,490]" pageId="64" pageNumber="65" type="generic">1 specimen</specimenCount>
, leg. C. Havermans,
<collectionCode id="6B93AE63FFE5FFE368D1FE5DFB442582" LSID="urn:lsid:biocol.org:col:35271" box="[1189,1274,465,489]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35271" name="Royal Belgian Institute of Natural Sciences" pageId="64" pageNumber="65">RBINS</collectionCode>
,
<collectionCode id="6B93AE63FFE5FFE36971FE5EFA892582" box="[1285,1335,466,489]" pageId="64" pageNumber="65">INV</collectionCode>
.
<date id="793C1066FFE5FFE36935FE5DFA262581" box="[1345,1432,465,490]" pageId="64" pageNumber="65" value="53-12-28">122853</date>
, Eob-C112, ANT283-112 (
<collectionCode id="6B93AE63FFE5FFE36DC8FE7AFE4C2665" LSID="urn:lsid:biocol.org:col:14498" box="[444,498,502,526]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="64" pageNumber="65">COI</collectionCode>
).
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CB3FD95FE4D2659" blockId="64.[151,1436,249,562]" box="[199,499,537,562]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3FD95FE4D2659" bold="true" box="[199,499,537,562]" pageId="64" pageNumber="65">
Voucher
<collectionCode id="6B93AE63FFE5FFE36D46FD95FED12659" LSID="urn:lsid:biocol.org:col:15536" box="[306,367,537,562]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:15536" name="Department of Natural Resources, Environment, The Arts and Sport" pageId="64" pageNumber="65">DNA</collectionCode>
sequences.
</emphasis>
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CE3FDEDFEEE2611" blockId="64.[151,1433,609,994]" box="[151,336,609,634]" pageId="64" pageNumber="65">
Eob-C103,
<collectionCode id="6B93AE63FFE5FFE36D6CFDEEFEF22611" LSID="urn:lsid:biocol.org:col:14498" box="[280,332,610,634]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:14498" name="University of Coimbra Botany Department" pageId="64" pageNumber="65">COI</collectionCode>
:
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CE3FD0AFEE12789" blockId="64.[151,1433,609,994]" box="[151,1433,646,994]" pageId="64" pageNumber="65">TGAGCTAGCGTTGTAGGCACATCCCTAAGCCTAGTTATTCGATCTGAGCTCAGTGGGCCAGGAAATCT AATTGGAGATGACCAAATCTATAACGTAATAGTAACTGCTCACGCCTTCGTAATAATCTTCTTTATAGTT ATACCTATTATAATCGGAGGATTTGGCAATTGACTGGTCCCCCTTATACTAGGGAGCCCTGACATAGCTT TCCCACGGATAAATAACATAAGATTCTGACTACTGCCCCCCTCACTAACCTTGTTACTGATAAGGGGAT TAGTAGAGAGAGGCGTAGGAACAGGCTGGACCGTTTACCCCCCCCTAGCCGCAGCCGCAGCTCATAG CGGAGGATCTGTTGACCTAGCTATCTTCTCCCTTCATCTAGCGGGAGCCTCTTCTATTTTAGGGGCTATC AACTTTATCTCTACCGTAATTAACATGCGAGCCCCTGGGATATATATAGACCGCGTCCCTTTATTTGTCT GGTCGGTCTTCATCACAGCCATTCTTCTACTCTTATCCCTACCAGTATTAGCGGGTGCAATTACAATACT CTTAACAGACCGAAATCTAAATACCTCCTTTTTCGACCCTGGCGGGGGAGGTGACCCCATTCTTTACC AGCACCTATTT</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CB3FB9DFD632169" blockId="64.[151,1436,1041,2002]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3FB9DFD8A2041" bold="true" box="[199,564,1041,1066]" pageId="64" pageNumber="65">
<typeStatus id="D2398804FFE5FFE36CB3FB9DFEBC2041" box="[199,258,1041,1066]" pageId="64" pageNumber="65">Type</typeStatus>
specimens and localities.
</emphasis>
<typeStatus id="D2398804FFE5FFE36E49FB9EFD3E2041" box="[573,640,1042,1066]" pageId="64" pageNumber="65">Types</typeStatus>
not examined. Chevreuxs
<typeStatus id="D2398804FFE5FFE36FCAFB9DFB9E2041" box="[958,1056,1041,1066]" pageId="64" pageNumber="65" type="holotype">holotype</typeStatus>
specimen of
<taxonomicName id="CA824D25FFE5FFE368C9FB9EFA922042" box="[1213,1324,1041,1065]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE368C9FB9EFA922042" box="[1213,1324,1041,1065]" italics="true" pageId="64" pageNumber="65">E. obesus</emphasis>
</taxonomicName>
was a
<quantity id="CA7A9B43FFE5FFE369F4FB9EFF7D2026" metricMagnitude="-2" metricUnit="m" metricValue="1.2" pageId="64" pageNumber="65" unit="mm" value="12.0">12 mm</quantity>
male sampled south of the Azores, in the eastern North Atlantic Ocean: Prince of
<collectingCountry id="75957636FFE5FFE3681CFBBAFB7A2026" box="[1128,1220,1078,1101]" name="Monaco" pageId="64" pageNumber="65">Monaco</collectingCountry>
sta. 1849,
<geoCoordinate id="68B65061FFE5FFE36934FBB9FA222025" box="[1344,1436,1077,1102]" direction="north" orientation="latitude" pageId="64" pageNumber="65" precision="925" value="36.283333">36°17'N</geoCoordinate>
<geoCoordinate id="68B65061FFE5FFE36CE3FBD5FF472019" box="[151,249,1113,1138]" direction="west" orientation="longitude" pageId="64" pageNumber="65" precision="925" value="-28.883333">28°53'W</geoCoordinate>
,
<quantity id="CA7A9B43FFE5FFE36D7CFBD6FECF2019" box="[264,369,1114,1138]" metricMagnitude="3" metricUnit="m" metricValue="1.5" metricValueMax="3.0" metricValueMin="0.0" pageId="64" pageNumber="65" unit="m" value="1500.0" valueMax="3000.0" valueMin="0.0">03000m</quantity>
over
<quantity id="CA7A9B43FFE5FFE36DC2FBD6FDB92019" box="[438,519,1114,1138]" metricMagnitude="3" metricUnit="m" metricValue="3.4" pageId="64" pageNumber="65" unit="m" value="3400.0">3400m</quantity>
, filet Richard à grande ouverture,
<date id="793C1066FFE5FFE36FE2FBD6FC452019" box="[918,1019,1114,1138]" pageId="64" pageNumber="65" value="1904-09-08">8.9.1904</date>
, 08:2511:55hrs. This specimen has been lost and
<bibRefCitation id="69134B57FFE5FFE36D48FBF1FDDB20FD" author="Stoddart" box="[316,613,1149,1174]" pageId="64" pageNumber="65" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
have designated a
<typeStatus id="D2398804FFE5FFE36F3CFBF2FC1B20FD" box="[840,933,1150,1174]" pageId="64" pageNumber="65" type="neotype">neotype</typeStatus>
: female
<quantity id="CA7A9B43FFE5FFE3687EFBF2FBE120FE" box="[1034,1119,1150,1174]" metricMagnitude="-2" metricUnit="m" metricValue="4.8" pageId="64" pageNumber="65" unit="mm" value="48.0">48 mm</quantity>
, with setose oostegites and hatchlings (
<collectionCode id="6B93AE63FFE5FFE36D6EFB2EFECE20D1" box="[282,368,1186,1210]" pageId="64" pageNumber="65">BMNH</collectionCode>
2003.1059), RRS
<emphasis id="3FF6EAB4FFE5FFE36E3CFB2EFD0620D2" box="[584,696,1186,1209]" italics="true" pageId="64" pageNumber="65">Discovery</emphasis>
, stn 9541#30, NE of
<collectingCountry id="75957636FFE5FFE36FC6FB2EFB8820D1" box="[946,1078,1185,1210]" name="Cape Verde" pageId="64" pageNumber="65">Cape Verde</collectingCountry>
Islands, eastern North Atlantic Ocean,
<geoCoordinate id="68B65061FFE5FFE36C9AFB4AFEE820B5" box="[238,342,1222,1246]" direction="north" orientation="latitude" pageId="64" pageNumber="65" precision="92" value="20.03">20°1.8N</geoCoordinate>
<geoCoordinate id="68B65061FFE5FFE36D2BFB4AFE6520B5" box="[351,475,1222,1246]" direction="west" orientation="longitude" pageId="64" pageNumber="65" precision="92" value="-21.33">21°19.8W</geoCoordinate>
to
<geoCoordinate id="68B65061FFE5FFE36E70FB4AFDD520B5" box="[516,619,1222,1246]" direction="north" orientation="latitude" pageId="64" pageNumber="65" precision="92" value="20.021667">20°1.3N</geoCoordinate>
<geoCoordinate id="68B65061FFE5FFE36E01FB4AFD4E20B5" box="[629,752,1222,1246]" direction="west" orientation="longitude" pageId="64" pageNumber="65" precision="92" value="-21.333334">21°20.0W</geoCoordinate>
,
<quantity id="CA7A9B43FFE5FFE36E8AFB49FC3320B6" box="[766,909,1221,1246]" metricMagnitude="3" metricUnit="m" metricValue="1.2475" metricValueMax="1.5" metricValueMin="0.9949999999999999" pageId="64" pageNumber="65" unit="m" value="1247.5" valueMax="1500.0" valueMin="995.0">9951500 m</quantity>
over bottom depth
<quantity id="CA7A9B43FFE5FFE36805FB49FAAE20B6" box="[1137,1296,1221,1246]" metricMagnitude="3" metricUnit="m" metricValue="3.825" metricValueMax="3.85" metricValueMin="3.8" pageId="64" pageNumber="65" unit="m" value="3825.0" valueMax="3850.0" valueMin="3800.0">38003850 m</quantity>
, rectangular midwater trawl RMT 8,
<date id="793C1066FFE5FFE36DDCFB66FDA52169" box="[424,539,1258,1282]" pageId="64" pageNumber="65" value="1977-04-22">22.4.1977</date>
, 19:2123:21hrs.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE5FFE36CB3FA81FD79222D" pageId="64" pageNumber="65" type="description">
<paragraph id="0D3D36A6FFE5FFE36CB3FA81FD5A214D" blockId="64.[151,1436,1041,2002]" box="[199,740,1293,1318]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3FA81FEE7214D" bold="true" box="[199,345,1293,1318]" pageId="64" pageNumber="65">Description.</emphasis>
See e.g.
<bibRefCitation id="69134B57FFE5FFE36DCAFA81FD5E214D" author="Stoddart" box="[446,736,1293,1318]" pageId="64" pageNumber="65" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
.
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CB3FABDFF4121F9" blockId="64.[151,1436,1041,2002]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3FABDFE6D2121" bold="true" box="[199,467,1329,1354]" pageId="64" pageNumber="65">Diagnostic characters.</emphasis>
<taxonomicName id="CA824D25FFE5FFE36DA8FABEFDF72122" box="[476,585,1329,1353]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE36DA8FABEFDF72122" box="[476,585,1329,1353]" italics="true" pageId="64" pageNumber="65">E. obesus</emphasis>
</taxonomicName>
is characterized by the extremely long dactylus of its pereopods 37. The eye of
<taxonomicName id="CA824D25FFE5FFE36C97FADAFEF02106" box="[227,334,1365,1389]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE36C97FADAFEF02106" box="[227,334,1365,1389]" italics="true" pageId="64" pageNumber="65">E. obesus</emphasis>
</taxonomicName>
is narrowly linear instead of being broad and nearly L-shaped' as in the
<taxonomicName id="CA824D25FFE5FFE3680CFAD9FB482106" box="[1144,1270,1365,1389]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFE5FFE3680CFAD9FB482106" box="[1144,1270,1365,1389]" italics="true" pageId="64" pageNumber="65">Eurythenes</emphasis>
</taxonomicName>
of the
<taxonomicName id="CA824D25FFE5FFE36931FAD9FA2D2106" box="[1349,1427,1365,1389]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFE5FFE36931FAD9FA2D2106" box="[1349,1427,1365,1389]" italics="true" pageId="64" pageNumber="65">gryllus</emphasis>
</taxonomicName>
- complex.
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CB3FA11FD0F2249" blockId="64.[151,1436,1041,2002]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3FA11FE3D21DD" bold="true" box="[199,387,1437,1462]" pageId="64" pageNumber="65">Colour pattern.</emphasis>
Specimen of ANT-XXVIII/3, sta. 172-3: pale orange; merus, carpus, propodus and dactylus of pereopods 67 pale pink; eye whitish (see figure 46). The label of the two specimens of Station ANO 315-D704 indicates: small one, gray and pale pink; large one, bright red. So, it seems that
<taxonomicName id="CA824D25FFE5FFE36862FA6AFB3F2196" box="[1046,1153,1509,1533]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE36862FA6AFB3F2196" box="[1046,1153,1509,1533]" italics="true" pageId="64" pageNumber="65">E. obesus</emphasis>
</taxonomicName>
exhibits colour variation similar to
<taxonomicName id="CA824D25FFE5FFE36D7CF986FECB224A" box="[264,373,1545,1569]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFE5FFE36D7CF986FECB224A" box="[264,373,1545,1569]" italics="true" pageId="64" pageNumber="65">E. gryllus</emphasis>
</taxonomicName>
and
<taxonomicName id="CA824D25FFE5FFE36DD8F986FDEF224A" box="[428,593,1545,1569]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="andhakarae" status="sp. nov.">
<emphasis id="3FF6EAB4FFE5FFE36DD8F986FDEF224A" box="[428,593,1545,1569]" italics="true" pageId="64" pageNumber="65">E. andhakarae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE5FFE36E23F985FD0F2249" box="[599,689,1545,1570]" pageId="64" pageNumber="65" rank="species">
<emphasis id="3FF6EAB4FFE5FFE36E23F985FD0F2249" bold="true" box="[599,689,1545,1570]" pageId="64" pageNumber="65">sp. nov.</emphasis>
</taxonomicNameLabel>
</paragraph>
<paragraph id="0D3D36A6FFE5FFE36CB3F9A1FD79222D" blockId="64.[151,1436,1041,2002]" box="[199,711,1581,1606]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3F9A1FF40222D" bold="true" box="[199,254,1581,1606]" pageId="64" pageNumber="65">Size.</emphasis>
Up to
<quantity id="CA7A9B43FFE5FFE36D3FF9A2FE24222E" box="[331,410,1582,1606]" metricMagnitude="-2" metricUnit="m" metricValue="8.0" pageId="64" pageNumber="65" unit="mm" value="80.0">80 mm</quantity>
(
<bibRefCitation id="69134B57FFE5FFE36DDCF9A1FD05222D" author="Stoddart" box="[424,699,1581,1606]" pageId="64" pageNumber="65" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
).
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE5FFE36CB3F9DDFD8E22BE" pageId="64" pageNumber="65" type="distribution">
<paragraph id="0D3D36A6FFE5FFE36CB3F9DDFD8E22BE" blockId="64.[151,1436,1041,2002]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3F9DDFD862201" bold="true" box="[199,568,1617,1642]" pageId="64" pageNumber="65">Distribution and depth range.</emphasis>
Cosmopolitan, exceptionally near the surface (present material), normally between
<quantity id="CA7A9B43FFE5FFE36C8FF9FAFEFD22E6" box="[251,323,1654,1678]" metricMagnitude="2" metricUnit="m" metricValue="1.28" pageId="64" pageNumber="65" unit="m" value="128.0">128 m</quantity>
and
<quantity id="CA7A9B43FFE5FFE36D0DF9F9FE6F22E6" box="[377,465,1653,1678]" metricMagnitude="3" metricUnit="m" metricValue="1.6" pageId="64" pageNumber="65" unit="m" value="1600.0">1600 m</quantity>
, most commonly below
<quantity id="CA7A9B43FFE5FFE36E91F9FAFC8422E6" box="[741,826,1654,1678]" metricMagnitude="3" metricUnit="m" metricValue="1.0" pageId="64" pageNumber="65" unit="m" value="1000.0">1000 m</quantity>
(
<bibRefCitation id="69134B57FFE5FFE36F3DF9F9FBE522E5" author="Stoddart" box="[841,1115,1653,1678]" pageId="64" pageNumber="65" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
;
<bibRefCitation id="69134B57FFE5FFE36812F9FAFAE522E5" author="Senna" box="[1126,1371,1653,1678]" pageId="64" pageNumber="65" refString="Senna, A. R. &amp; Serejo, C. S. (2008) First record of Eurythenes obesus (Chevreux, 1905) (Amphipoda, Lysianassoidea, Eurytheneidae) in Brazilian waters. Arquivos do Museu Nacional, Rio de Janeiro, 66 (2), 373 - 379." type="journal article" year="2008">Senna &amp; Serejo 2008</bibRefCitation>
). One of the specimens recorded here was found in a trawl used at
<quantity id="CA7A9B43FFE5FFE36F36F916FC2622DA" box="[834,920,1690,1714]" metricMagnitude="3" metricUnit="m" metricValue="4.11" pageId="64" pageNumber="65" unit="m" value="4110.0">4110 m</quantity>
, but it is likely that it was caught in the water column when the net was hauled up.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE5FFE36CB3F96DFCD023E1" pageId="64" pageNumber="65" type="biology_ecology">
<paragraph id="0D3D36A6FFE5FFE36CB3F96DFCD023E1" blockId="64.[151,1436,1041,2002]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3F96DFE992291" bold="true" box="[199,295,1761,1786]" pageId="64" pageNumber="65">Biology.</emphasis>
It suffices to repeat herein the account of
<bibRefCitation id="69134B57FFE5FFE36F7CF96DFB932291" author="Stoddart" box="[776,1069,1761,1786]" pageId="64" pageNumber="65" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
. “Very little is known of the life habits of
<taxonomicName id="CA824D25FFE5FFE36D75F88AFED32376" box="[257,365,1797,1821]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE36D75F88AFED32376" box="[257,365,1797,1821]" italics="true" pageId="64" pageNumber="65">E. obesus</emphasis>
</taxonomicName>
. It has never been taken in baited traps; has frequently been taken in midwater trawls; and has once been recorded as burrowing into a salp (
<bibRefCitation id="69134B57FFE5FFE36ECBF8A5FC392329" author="Stephensen" box="[703,903,1833,1858]" pageId="64" pageNumber="65" refString="Stephensen, K. (1915) Isopoda, Tanaidacea, Cumacea, Amphipoda (excl. Hyperiidea). Report on the Danish Oceanographical Expeditions 1908 - 10 to the Mediterranean and Adjacent Seas, Biology (D 1), 2, 1 - 53." type="journal article" year="1915">Stephensen 1915</bibRefCitation>
), once as having coelenterate remains in the stomach (
<bibRefCitation id="69134B57FFE5FFE36D70F8C1FE19230D" author="Hopkins" box="[260,423,1869,1894]" pageId="64" pageNumber="65" refString="Hopkins, T. L. (1985) Food web of an Antarctic midwater ecosystem. Marine Biology, 89, 197 - 212. http: // dx. doi. org / 10.1007 / BF 00392890" type="journal article" year="1985">Hopkins 1985</bibRefCitation>
), once with possibly siliceous sponge spicules in the stomach (
<bibRefCitation id="69134B57FFE5FFE36804F8C2FABD230D" author="Brusca" box="[1136,1283,1869,1894]" pageId="64" pageNumber="65" refString="Brusca, G. J. (1967) The ecology of pelagic Amphipoda. I. Species accounts, vertical zonation and migration of Amphipoda from the waters off Southern California. Pacific Science, 21 (3), 382 - 393." type="journal article" year="1967">Brusca 1967</bibRefCitation>
), and once as attacking fish taken in midwater trawls (
<bibRefCitation id="69134B57FFE5FFE36E2DF8FDFCE923E1" author="Thurston" box="[601,855,1905,1930]" pageId="64" pageNumber="65" refString="Thurston, M. H. &amp; Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209" type="journal article" year="1995">Thurston &amp; Bett 1995</bibRefCitation>
).”
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE5FFE36CB3F819FCB923B9" pageId="64" pageNumber="65" type="discussion">
<paragraph id="0D3D36A6FFE5FFE36CB3F819FCB923B9" blockId="64.[151,1436,1041,2002]" pageId="64" pageNumber="65">
<emphasis id="3FF6EAB4FFE5FFE36CB3F819FE8523C5" bold="true" box="[199,315,1941,1966]" pageId="64" pageNumber="65">Remarks.</emphasis>
In the absence of relevant studies, it is not known whether
<taxonomicName id="CA824D25FFE5FFE36FA0F81AFB8123C6" box="[980,1087,1941,1965]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="64" pageNumber="65" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFE5FFE36FA0F81AFB8123C6" box="[980,1087,1941,1965]" italics="true" pageId="64" pageNumber="65">E. obesus</emphasis>
</taxonomicName>
is genetically homogeneous or not across its nearly cosmopolitan range of distribution.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,825 @@
<document id="45713D9F159E01D19029A926C385AF83" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FFA0FFAB6CE3FD54FC0020CB" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Eurythenes S.I. Smith" docType="treatment" docVersion="8" lastPageNumber="9" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="6" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="621A6A42AC2C0B4DE83D83F18569BFF5" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="5C20D64864D2AFCE125B849430999A79">
<mods:title id="42ACC1938C9341E57C9C5DE405DAAD58">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="20A5C816D467207F35FDEA2B69A50CEC" type="personal">
<mods:role id="547516D4C254BA02CEBB9059BA8F2A67">
<mods:roleTerm id="BF8CC5DF71A23B0173323FD5B1AD6E72">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F0DE0C17B252ED182CF0E3EEE6E9156D">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="E8B5FBF8A5696EF725168E25B44AD376" type="personal">
<mods:role id="B7907AAF68B85AD25A467CE53C97B66E">
<mods:roleTerm id="04EE2D35421BA4917BB89257CAED74AE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7E2F2942FF7BF589822CC55D1A1FD71D">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="49045248EDF28FA52ED394FA53F735D7">text</mods:typeOfResource>
<mods:relatedItem id="D8006CC2DFE7CE33CF6E8CA4C1BE0E9E" type="host">
<mods:titleInfo id="EB481C9237032EC58635763A389A94B9">
<mods:title id="1A853544CC49E8DFDB4FECB8459CBA08">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="007FFD4DDDCB7F5A8CDAA0CBFE9F9966">
<mods:date id="041247C4DEA562B569E4C6E4264F5AA9">2015</mods:date>
<mods:detail id="C558921A2355AFC583BED47B02EFA0C9" type="volume">
<mods:number id="6950A5C6E9875275289CE886E0BA5314">3971</mods:number>
</mods:detail>
<mods:detail id="594297FC27F15882E960F96EB9FC1A6B" type="issue">
<mods:number id="8EB763DBE7E20C7A640128F7E8393BED">1</mods:number>
</mods:detail>
<mods:extent id="2FC5C5ABA781854FAAFC6CEF12FA928D" unit="page">
<mods:start id="12FB700F6908B34CE9A91193CA25497E">1</mods:start>
<mods:end id="BD452E56A0569756547578F75AE9A173">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="8F6F093825B33DA28B58E0F177AB7B0C">journal article</mods:classification>
<mods:identifier id="24420DC0B1A6496053F8E7483C7A9903" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="5356E8262B245AFFF863FA2EF2F78CEF" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="E8051ECB3E935F09A64EE138B9BE09A0" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="DF315BBD4952DFC0E236116CDCB1E677" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="E9C0DD58A2C8C7F280E48D173CB67747" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FFA0FFAB6CE3FD54FC0020CB" ID-DOI="http://doi.org/10.5281/zenodo.5470178" ID-GBIF-Taxon="127691971" ID-Zenodo-Dep="5470178" LSID="urn:lsid:plazi:treatment:852B87B0FFA0FFAB6CE3FD54FC0020CB" httpUri="http://treatment.plazi.org/id/852B87B0FFA0FFAB6CE3FD54FC0020CB" lastPageId="8" lastPageNumber="9" pageId="5" pageNumber="6">
<subSubSection id="4598652DFFA0FFA66CE3FD54FD6C2699" box="[151,722,727,754]" pageId="5" pageNumber="6" type="nomenclature">
<paragraph id="0D3D36A6FFA0FFA66CE3FD54FD6C2699" blockId="5.[151,722,727,754]" box="[151,722,727,754]" pageId="5" pageNumber="6">
<heading id="567581CAFFA0FFA66CE3FD54FD6C2699" bold="true" box="[151,722,727,754]" fontSize="11" level="1" pageId="5" pageNumber="6" reason="1">
<emphasis id="3FF6EAB4FFA0FFA66CE3FD54FD6C2699" bold="true" box="[151,722,727,754]" pageId="5" pageNumber="6">
Genus
<taxonomicName id="CA824D25FFA0FFA66C9AFD5BFE422699" authority="S.I. Smith" authorityName="S.I. Smith" box="[238,508,727,754]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66C9AFD5BFEC6269A" bold="true" box="[238,376,727,753]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
S.I. Smith
</taxonomicName>
in Scudder, 1882
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA0FFA66CE3FCACFCC92023" pageId="5" pageNumber="6" type="reference_group">
<paragraph id="0D3D36A6FFA0FFA66CE3FCACFD002738" blockId="5.[151,1436,798,1096]" pageId="5" pageNumber="6">
<treatmentCitationGroup id="2D921188FFA0FFA66CE3FCACFD002738" pageId="5" pageNumber="6">
<taxonomicName id="CA824D25FFA0FFA66CE3FCACFE69275F" ID-CoL="4GZV" authority="Lilljeborg, 1865a: 11" authorityName="Lilljeborg" authorityPageNumber="11" authorityYear="1865" box="[151,471,798,821]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FCACFF42275E" box="[151,252,800,821]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
<treatmentCitation id="8C2310B7FFA0FFA66D76FC92FE69275F" author="Lilljeborg" box="[258,471,798,820]" page="11" pageId="5" pageNumber="6" year="1865">
<bibRefCitation id="69134B57FFA0FFA66D76FC92FE08275F" author="Lilljeborg" box="[258,438,798,820]" pageId="5" pageNumber="6" refString="Lilljeborg, W. (1865 a) On the Lysianassa magellanica H. Milne Edwards and on the Crustacea of the suborder Amphipoda and subfamily Lysianassina found an [sic] the coast of Sweden and Norway. The royal academy press, Uppsala, 37 pp., 5 pls." type="book" year="1865" yearSuffix="a">Lilljeborg, 1865a</bibRefCitation>
: 11
</treatmentCitation>
</taxonomicName>
(non
<taxonomicName id="CA824D25FFA0FFA66E60FCACFCB6275F" ID-CoL="4GZV" authority="Forster, 1862" authorityName="Forster" authorityYear="1862" box="[532,776,798,821]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66E60FCACFDC7275E" box="[532,633,800,821]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
<bibRefCitation id="69134B57FFA0FFA66E0BFC93FCB6275F" author="Forster" box="[639,776,798,820]" pageId="5" pageNumber="6" refString="Forster, A. (1862) Synopsis der Familien und Gattungen der Braconen. Verhandlungen des naturhistorischen Vereines der preussischen Rheinlande und Westphalens, 19, 225 - 288." type="journal article" year="1862">Förster, 1862</bibRefCitation>
</taxonomicName>
,
<taxonomicName id="CA824D25FFA0FFA66F67FC93FC1C275F" ID-CoL="HYM" box="[787,930,799,820]" class="Insecta" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="order">Hymenoptera</taxonomicName>
); 1865b: 6.
<typeStatus id="D2398804FFA0FFA6686DFC93FBF5275F" box="[1049,1099,799,820]" pageId="5" pageNumber="6">Type</typeStatus>
species:
<taxonomicName id="CA824D25FFA0FFA668DCFCACFE7A2738" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FFA0FFA668DCFCACFA22275F" box="[1192,1436,798,821]" italics="true" pageId="5" pageNumber="6">Lysianassa magellanica</emphasis>
H.
<bibRefCitation id="69134B57FFA0FFA66C92FCB1FE7A2738" author="Milne" box="[230,452,829,851]" pageId="5" pageNumber="6" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
</taxonomicName>
; by original designation.
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FFA0FFA66CE3FCD0FCE027C4" blockId="5.[151,1436,798,1096]" pageId="5" pageNumber="6">
<treatmentCitationGroup id="2D921188FFA0FFA66CE3FCD0FCE027C4" bridged="true" pageId="5" pageNumber="6">
<taxonomicName id="CA824D25FFA0FFA66CE3FCD0FEC52719" authority="S.I. Smith" authorityName="S.I. Smith" box="[151,379,860,882]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FCD0FEB72719" box="[151,265,860,882]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
S.I. Smith
</taxonomicName>
in Scudder, 1882: 135 (Supplemental list of genera in Zoölogy), 122 (Universal index to genera in Zoölogy).—
<treatmentCitation id="8C2310B7FFA0FFA66D38FCF6FD9D27FB" author="Smith" box="[332,547,890,912]" page="54" pageId="5" pageNumber="6" year="1884">
<bibRefCitation id="69134B57FFA0FFA66D38FCF6FE4027FB" author="Smith" box="[332,510,890,912]" pageId="5" pageNumber="6" refString="Smith, S. I. (1884 a) Crustacea of the Albatross dredgings in 1883. American Journal of Science, Series 3, 28, 53 - 56. http: // dx. doi. org / 10.2475 / ajs. s 3 - 28.163.53" type="journal article" year="1884" yearSuffix="a">S.I. Smith, 1884a</bibRefCitation>
: 54
</treatmentCitation>
.—
<treatmentCitation id="8C2310B7FFA0FFA66E34FCF6FCC827FB" author="Stoddart" box="[576,886,890,912]" httpUri="http://treatment.plazi.org/id/2D09EC23E909FFB3FF7BFD49FD94FE26" page="428" pageId="5" pageNumber="6" year="2004">
<bibRefCitation id="69134B57FFA0FFA66E34FCF6FCFB27FB" author="Stoddart" box="[576,837,890,912]" pageId="5" pageNumber="6" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
: 428
</treatmentCitation>
(ubi syn.).
<typeStatus id="D2398804FFA0FFA66F85FCF7FB9D27FB" box="[1009,1059,891,912]" pageId="5" pageNumber="6">Type</typeStatus>
species:
<taxonomicName id="CA824D25FFA0FFA668F1FCF7FE1C27C4" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FFA0FFA668F1FCF7FAC427FB" box="[1157,1402,890,912]" italics="true" pageId="5" pageNumber="6">Lysianassa magellanica</emphasis>
H.
<bibRefCitation id="69134B57FFA0FFA66CB3FC15FE1C27C4" author="Milne" box="[199,418,921,943]" pageId="5" pageNumber="6" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
</taxonomicName>
(nom. nov. for
<taxonomicName id="CA824D25FFA0FFA66E4BFC16FCEC27C4" ID-CoL="4GZV" authority="Lilljeborg, 1865" authorityName="Lilljeborg" authorityYear="1865" box="[575,850,921,943]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66E4BFC16FD1A27C4" box="[575,676,922,943]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
Lilljeborg, 1865
</taxonomicName>
).
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FFA0FFA66CE3FC34FD7F2787" blockId="5.[151,1436,798,1096]" pageId="5" pageNumber="6">
<treatmentCitationGroup id="2D921188FFA0FFA66CE3FC34FD7F2787" pageId="5" pageNumber="6">
<taxonomicName id="CA824D25FFA0FFA66CE3FC34FDB927A5" authority="S.I. Smith, 1884b: 181" authorityName="S.I. Smith" authorityPageNumber="181" authorityYear="1884" box="[151,519,952,974]" class="Insecta" family="Chrysomelidae" genus="Eurysthenes" higherTaxonomySource="GBIF" kingdom="Animalia" order="Coleoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FC34FEAD27A5" box="[151,275,952,974]" italics="true" pageId="5" pageNumber="6">Eurysthenes</emphasis>
<treatmentCitation id="8C2310B7FFA0FFA66D6FFC34FDB927A5" author="Smith" box="[283,519,952,974]" page="181" pageId="5" pageNumber="6" year="1884">
<bibRefCitation id="69134B57FFA0FFA66D6FFC34FE6D27A5" author="Smith" box="[283,467,952,974]" pageId="5" pageNumber="6" refString="Smith, S. I. (1884 b) Crustacea of the Albatross dredgings in 1883. Annals and Magazine of Natural History, Series 5, 14, 179 - 183. [reprinted from the American Journal of Science] http: // dx. doi. org / 10.5962 / bhl. title. 62604" type="journal article" year="1884" yearSuffix="b">S.I. Smith, 1884b</bibRefCitation>
: 181
</treatmentCitation>
</taxonomicName>
.
<typeStatus id="D2398804FFA0FFA66E66FC35FDFA27A5" box="[530,580,953,974]" pageId="5" pageNumber="6">Type</typeStatus>
species:
<taxonomicName id="CA824D25FFA0FFA66ED1FC35FB1E27A5" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" box="[677,1184,952,974]" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FFA0FFA66ED1FC35FC2427A5" box="[677,922,952,974]" italics="true" pageId="5" pageNumber="6">Lysianassa magellanica</emphasis>
H.
<bibRefCitation id="69134B57FFA0FFA66FB6FC34FB1E27A5" author="Milne" box="[962,1184,952,974]" pageId="5" pageNumber="6" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
</taxonomicName>
(probable typographical error for
<taxonomicName id="CA824D25FFA0FFA66D56FC5AFE412787" authority="S.I. Smith" authorityName="S.I. Smith" box="[290,511,982,1004]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66D56FC5AFE2A2787" box="[290,404,982,1004]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
S.I. Smith
</taxonomicName>
in Scudder, 1882).
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FFA0FFA66CE3FC7AFEC42041" blockId="5.[151,1436,798,1096]" pageId="5" pageNumber="6">
<taxonomicName id="CA824D25FFA0FFA66CE3FC7AFE5B2060" authority="G.O. Sars, 1891: 85" authorityName="G.O. Sars" authorityPageNumber="85" authorityYear="1891" box="[151,485,1013,1035]" class="Malacostraca" family="Lysianassidae" genus="Euryporeia" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FC7AFEB42060" box="[151,266,1014,1035]" italics="true" pageId="5" pageNumber="6">Euryporeia</emphasis>
G.O. Sars, 1891: 85
</taxonomicName>
.
<typeStatus id="D2398804FFA0FFA66D86FC7AFD9A2060" box="[498,548,1014,1035]" pageId="5" pageNumber="6">Type</typeStatus>
species:
<taxonomicName id="CA824D25FFA0FFA66EFCFC7AFB332060" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" box="[648,1165,1013,1035]" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FFA0FFA66EFCFC7AFCC12060" box="[648,895,1013,1035]" italics="true" pageId="5" pageNumber="6">Lysianassa magellanica</emphasis>
H.
<bibRefCitation id="69134B57FFA0FFA66FDFFC79FB332060" author="Milne" box="[939,1165,1013,1035]" pageId="5" pageNumber="6" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
</taxonomicName>
(nom. nov. for
<taxonomicName id="CA824D25FFA0FFA66943FC7AFED02041" ID-CoL="4GZV" authority="Lilljeborg, 1865" authorityName="Lilljeborg" authorityYear="1865" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66943FC7AFA222060" box="[1335,1436,1014,1035]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
Lilljeborg, 1865
</taxonomicName>
).
</paragraph>
<paragraph id="0D3D36A6FFA0FFA66CE3FBBFFCC92023" blockId="5.[151,1436,798,1096]" box="[151,887,1074,1096]" pageId="5" pageNumber="6">
<treatmentCitationGroup id="2D921188FFA0FFA66CE3FBBFFCC92023" box="[151,887,1074,1096]" pageId="5" pageNumber="6">
<taxonomicName id="CA824D25FFA0FFA66CE3FBBFFE242023" authority="Chevreux, 1905: 1" authorityName="Chevreux" authorityPageNumber="1" authorityYear="1905" box="[151,410,1074,1096]" class="Malacostraca" family="Lysianassidae" genus="Katius" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FBBFFF672023" box="[151,217,1075,1096]" italics="true" pageId="5" pageNumber="6">Katius</emphasis>
<treatmentCitation id="8C2310B7FFA0FFA66CABFBBEFE242023" author="Chevreux" box="[223,410,1074,1096]" page="1" pageId="5" pageNumber="6" year="1905">
<bibRefCitation id="69134B57FFA0FFA66CABFBBEFE3A2023" author="Chevreux" box="[223,388,1074,1096]" pageId="5" pageNumber="6" refString="Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7." type="journal article" year="1905">Chevreux, 1905</bibRefCitation>
: 1
</treatmentCitation>
</taxonomicName>
(
<typeStatus id="D2398804FFA0FFA66DDCFBBEFE6B2023" box="[424,469,1074,1096]" pageId="5" pageNumber="6">type</typeStatus>
species:
<taxonomicName id="CA824D25FFA0FFA66E46FBBFFCD52023" authority="Chevreux, 1905" authorityName="Chevreux" authorityYear="1905" box="[562,875,1074,1096]" class="Malacostraca" family="Lysianassidae" genus="Katius" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFA0FFA66E46FBBFFD7E2023" box="[562,704,1074,1096]" italics="true" pageId="5" pageNumber="6">Katius obesus</emphasis>
<bibRefCitation id="69134B57FFA0FFA66EB2FBBEFCD52023" author="Chevreux" box="[710,875,1074,1096]" pageId="5" pageNumber="6" refString="Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7." type="journal article" year="1905">Chevreux, 1905</bibRefCitation>
</taxonomicName>
).
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA0FFA66CE3FBF9FEE220BD" pageId="5" pageNumber="6" type="etymology">
<paragraph id="0D3D36A6FFA0FFA66CE3FBF9FEE220BD" blockId="5.[151,1437,1141,2030]" pageId="5" pageNumber="6">
<emphasis id="3FF6EAB4FFA0FFA66CE3FBF9FEA020E5" bold="true" box="[151,286,1141,1166]" pageId="5" pageNumber="6">Etymology.</emphasis>
Lilljeborg (1965a) indicated the following etymology of
<taxonomicName id="CA824D25FFA0FFA66FB8FBFAFB8220E6" box="[972,1084,1142,1165]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66FB8FBFAFB8220E6" box="[972,1084,1142,1165]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
</taxonomicName>
: 'On account of its extensive geographical distribution, we give to this genus the name
<taxonomicName id="CA824D25FFA0FFA66F43FB16FC1920DA" box="[823,935,1178,1201]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66F43FB16FC1920DA" box="[823,935,1178,1201]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
</taxonomicName>
, from the Greek 'εύρυτεής, which signifies widely stretched'.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA0FFA56CB3FB6DFF6C2656" lastPageId="6" lastPageNumber="7" pageId="5" pageNumber="6" type="description">
<paragraph id="0D3D36A6FFA0FFA66CB3FB6DFBCC2091" blockId="5.[151,1437,1141,2030]" box="[199,1138,1249,1274]" pageId="5" pageNumber="6">
<emphasis id="3FF6EAB4FFA0FFA66CB3FB6DFEE72091" bold="true" box="[199,345,1249,1274]" pageId="5" pageNumber="6">Description.</emphasis>
See description of family
<taxonomicName id="CA824D25FFA0FFA66EF4FB6DFC9C2091" box="[640,802,1249,1274]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="family">Eurytheneidae</taxonomicName>
by
<bibRefCitation id="69134B57FFA0FFA66F38FB6DFBD02091" author="Stoddart" box="[844,1134,1249,1274]" pageId="5" pageNumber="6" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
.
</paragraph>
<paragraph id="0D3D36A6FFA0FFA66CB3FA89FEFD21C5" blockId="5.[151,1437,1141,2030]" pageId="5" pageNumber="6">
<emphasis id="3FF6EAB4FFA0FFA66CB3FA89FED92175" bold="true" box="[199,359,1285,1310]" pageId="5" pageNumber="6">Composition.</emphasis>
In the present paper, seven
<taxonomicName id="CA824D25FFA0FFA66ECFFA89FC872176" box="[699,825,1285,1309]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66ECFFA89FC872176" box="[699,825,1285,1309]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
</taxonomicName>
species are recognized:
<taxonomicName id="CA824D25FFA0FFA66829FA8AFAB92176" box="[1117,1287,1285,1309]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="andhakarae" status="sp. nov.">
<emphasis id="3FF6EAB4FFA0FFA66829FA8AFAB92176" box="[1117,1287,1285,1309]" italics="true" pageId="5" pageNumber="6">E. andhakarae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA0FFA66967FA89FACF2175" box="[1299,1393,1285,1310]" pageId="5" pageNumber="6" rank="species">
<emphasis id="3FF6EAB4FFA0FFA66967FA89FACF2175" bold="true" box="[1299,1393,1285,1310]" pageId="5" pageNumber="6">sp. nov.</emphasis>
</taxonomicNameLabel>
,
<taxonomicName id="CA824D25FFA0FFA669F0FA8AFF5B212A" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA0FFA669F0FA8AFF5B212A" italics="true" pageId="5" pageNumber="6">E. gryllus</emphasis>
</taxonomicName>
(
<collectingCountry id="75957636FFA0FFA66C87FAA5FE3E2129" box="[243,384,1321,1346]" name="Liechtenstein" pageId="5" pageNumber="6">Lichtenstein</collectingCountry>
in Mandt, 1822),
<taxonomicName id="CA824D25FFA0FFA66E3EFAA6FB902129" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" box="[586,1070,1321,1346]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FFA0FFA66E3EFAA6FD40212A" box="[586,766,1321,1345]" italics="true" pageId="5" pageNumber="6">E. magellanicus</emphasis>
(H.
<bibRefCitation id="69134B57FFA0FFA66F45FAA5FB982129" author="Milne" box="[817,1062,1321,1346]" pageId="5" pageNumber="6" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
)
</taxonomicName>
,
<taxonomicName id="CA824D25FFA0FFA6684EFAA6FB7C212A" box="[1082,1218,1321,1345]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="maldoror" status="sp. nov.">
<emphasis id="3FF6EAB4FFA0FFA6684EFAA6FB7C212A" box="[1082,1218,1321,1345]" italics="true" pageId="5" pageNumber="6">E. maldoror</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA0FFA668BDFAA5FA9D2129" box="[1225,1315,1321,1346]" pageId="5" pageNumber="6" rank="species">
<emphasis id="3FF6EAB4FFA0FFA668BDFAA5FA9D2129" bold="true" box="[1225,1315,1321,1346]" pageId="5" pageNumber="6">sp. nov.</emphasis>
</taxonomicNameLabel>
,
<taxonomicName id="CA824D25FFA0FFA66944FAA6FEE1210D" authority="Chevreux, 1905" authorityName="Chevreux" authorityYear="1905" class="Malacostraca" family="Lysianassidae" genus="Katius" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFA0FFA66944FAA6FA25212A" box="[1328,1435,1321,1345]" italics="true" pageId="5" pageNumber="6">E. obesus</emphasis>
(
<bibRefCitation id="69134B57FFA0FFA66CEAFAC1FEE9210D" author="Chevreux" box="[158,343,1357,1382]" pageId="5" pageNumber="6" refString="Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7." type="journal article" year="1905">Chevreux, 1905</bibRefCitation>
)
</taxonomicName>
,
<taxonomicName id="CA824D25FFA0FFA66D1FFAC2FDBE210E" box="[363,512,1357,1381]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFA0FFA66D1FFAC2FDBE210E" box="[363,512,1357,1381]" italics="true" pageId="5" pageNumber="6">E. sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA0FFA66E73FAC1FDDF210D" box="[519,609,1357,1382]" pageId="5" pageNumber="6" rank="species">
<emphasis id="3FF6EAB4FFA0FFA66E73FAC1FDDF210D" bold="true" box="[519,609,1357,1382]" pageId="5" pageNumber="6">sp. nov.</emphasis>
</taxonomicNameLabel>
, and
<taxonomicName id="CA824D25FFA0FFA66EEBFAC2FBFF210D" authority="Stoddart &amp; Lowry, 2004" authorityName="Stoddart &amp; Lowry" authorityYear="2004" box="[671,1089,1357,1382]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFA0FFA66EEBFAC2FC9D210E" box="[671,803,1357,1381]" italics="true" pageId="5" pageNumber="6">E. thurstoni</emphasis>
<bibRefCitation id="69134B57FFA0FFA66F5FFAC1FBFF210D" author="Stoddart" box="[811,1089,1357,1382]" pageId="5" pageNumber="6" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
</taxonomicName>
. DNA sequences of specimens not directly examined and morphological observations published in literature are indicative of the existence of further species.
</paragraph>
<paragraph id="0D3D36A6FFA0FFA56CB3FA35FF7125A4" blockId="5.[151,1437,1141,2030]" lastBlockId="6.[151,1437,151,2013]" lastPageId="6" lastPageNumber="7" pageId="5" pageNumber="6">
<emphasis id="3FF6EAB4FFA0FFA66CB3FA35FE7B21B9" bold="true" box="[199,453,1465,1490]" pageId="5" pageNumber="6">Nomenclature issues.</emphasis>
The name
<taxonomicName id="CA824D25FFA0FFA66E3DFA35FD7921BA" box="[585,711,1465,1489]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66E3DFA35FD7921BA" box="[585,711,1465,1489]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
</taxonomicName>
was erected in very unusual manner, and has been a source of confusion for more than a century.
<bibRefCitation id="69134B57FFA0FFA66E44FA51FCBE219D" author="Lilljeborg" box="[560,768,1501,1526]" pageId="5" pageNumber="6" refString="Lilljeborg, W. (1865 a) On the Lysianassa magellanica H. Milne Edwards and on the Crustacea of the suborder Amphipoda and subfamily Lysianassina found an [sic] the coast of Sweden and Norway. The royal academy press, Uppsala, 37 pp., 5 pls." type="book" year="1865" yearSuffix="a">Lilljeborg (1865a)</bibRefCitation>
created the genus
<taxonomicName id="CA824D25FFA0FFA66FA8FA52FBF2219E" box="[988,1100,1502,1525]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66FA8FA52FBF2219E" box="[988,1100,1502,1525]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
</taxonomicName>
(without &quot;h&quot;) for
<taxonomicName id="CA824D25FFA0FFA66954FA52FDF12271" authority="H. Milne Edwards, 1848" authorityName="H. Milne Edwards" authorityYear="1848" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FFA0FFA66954FA52FE9C2272" italics="true" pageId="5" pageNumber="6">Lysianassa magellanica</emphasis>
H.
<bibRefCitation id="69134B57FFA0FFA66D20F98DFDF12271" author="Milne" box="[340,591,1537,1562]" pageId="5" pageNumber="6" refString="Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398." type="journal article" year="1848">Milne Edwards, 1848</bibRefCitation>
</taxonomicName>
(currently
<taxonomicName id="CA824D25FFA0FFA66EA0F98DFC4D2272" box="[724,1011,1537,1561]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FFA0FFA66EA0F98DFC4D2272" box="[724,1011,1537,1561]" italics="true" pageId="5" pageNumber="6">Eurythenes magellanicus</emphasis>
</taxonomicName>
) but this name was preoccupied by
<taxonomicName id="CA824D25FFA0FFA66CE3F9AAFDE82255" authority="Forster, 1862" authorityName="Forster" authorityYear="1862" box="[151,598,1573,1598]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3F9AAFEB92256" box="[151,263,1574,1597]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
<bibRefCitation id="69134B57FFA0FFA66D79F9AAFE1F2255" author="Forster" box="[269,417,1573,1598]" pageId="5" pageNumber="6" refString="Forster, A. (1862) Synopsis der Familien und Gattungen der Braconen. Verhandlungen des naturhistorischen Vereines der preussischen Rheinlande und Westphalens, 19, 225 - 288." type="journal article" year="1862">Förster, 1862</bibRefCitation>
(Hymenoptera)
</taxonomicName>
. On page 135 of the first part of the book by Scudder (1882) (Supplemental list of genera in Zoölogy), '
<taxonomicName id="CA824D25FFA0FFA66DA8F9C5FD622209" authority="Lilljeborg." authorityName="Lilljeborg." box="[476,732,1609,1634]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66DA8F9C5FDE4220A" box="[476,602,1609,1633]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
Lilljeborg.
</taxonomicName>
Nova Acta Soc. Sc. Upsal., vii, p. 11. 1865. Crust., Amph. Smith.' is listed. Column 3 of page 122 of the second part of Scudder (1882) (Universal index to genera in Zoölogy) lists '
<taxonomicName id="CA824D25FFA0FFA66CA7F91EFD9E22C1" authority="Forst., Hym. 1862" authorityName="Forst., Hym." authorityYear="1862" box="[211,544,1681,1706]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CA7F91EFEFD22C2" box="[211,323,1682,1705]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
Först., Hym. 1862
</taxonomicName>
M.' and two lines below '
<taxonomicName id="CA824D25FFA0FFA66F20F91DFB1822C1" authority="Lillj. Crust. 1865" authorityName="Lillj. Crust." authorityYear="1865" box="[852,1190,1681,1706]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66F20F91DFC6C22C2" box="[852,978,1681,1705]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
Lillj. Crust. 1865
</taxonomicName>
. S.'
<bibRefCitation id="69134B57FFA0FFA668AEF91DFA2222C1" author="Chevreux" box="[1242,1436,1681,1706]" pageId="5" pageNumber="6" refString="Chevreux, E. (1889) Quatrieme campagne de l' Hirondelle, 1888. Sur la presence d'une rare et interessante espece d'amphipode, Eurythenes gryllus Mandt, dans les eaux profondes de l'ocean, au voisinage des Acores. Bulletin de la Societe zoologique de France, 14, 298 - 300." type="journal article" year="1889">Chevreux (1889)</bibRefCitation>
made the following statement (freely translated from French): 'Since
<taxonomicName id="CA824D25FFA0FFA66FC8F93AFB9222A6" box="[956,1068,1718,1741]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66FC8F93AFB9222A6" box="[956,1068,1718,1741]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
</taxonomicName>
was used by Förster for a new genus of
<taxonomicName id="CA824D25FFA0FFA66C89F956FE582299" authority="Smith" authorityName="Smith" box="[253,486,1753,1778]" class="Insecta" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="order">Hymenoptera, Smith</taxonomicName>
has slightly modified the spelling of the name proposed by Lilljeborg (1865), so that it remains phonetically identical. In this paper, I keep that spelling of Smith, although I consider the procedure which he followed highly inappropriate'. G.O. Sars (1891) proposed the name
<taxonomicName id="CA824D25FFA0FFA66851F8AEFADA2351" authority="G.O. Sars, 1891" authorityName="G.O. Sars" authorityYear="1891" box="[1061,1380,1826,1850]" class="Malacostraca" family="Lysianassidae" genus="Euryporeia" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66851F8AEFB1D2352" box="[1061,1187,1826,1849]" italics="true" pageId="5" pageNumber="6">Euryporeia</emphasis>
G.O. Sars, 1891
</taxonomicName>
as a replacement name for
<taxonomicName id="CA824D25FFA0FFA66DD1F8CAFD5C2335" authority="Lilljeborg, 1865" authorityName="Lilljeborg" authorityYear="1865" box="[421,738,1861,1886]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66DD1F8CAFDAB2336" box="[421,533,1862,1885]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
Lilljeborg, 1865
</taxonomicName>
, with the following justification: 'In 1865 Prof. Lilljeborg established this genus to include the remarkable gigantic form described by Milne Edwards under the name of
<taxonomicName id="CA824D25FFA0FFA66CE3F802FE1A23CE" box="[151,420,1933,1957]" class="Malacostraca" family="Lysianassidae" genus="Lysianassa" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="magellanica">
<emphasis id="3FF6EAB4FFA0FFA66CE3F802FE1A23CE" box="[151,420,1933,1957]" italics="true" pageId="5" pageNumber="6">Lysianassa magellanica</emphasis>
</taxonomicName>
. The denomination
<taxonomicName id="CA824D25FFA0FFA66EF7F802FD4D23CE" box="[643,755,1934,1957]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66EF7F802FD4D23CE" box="[643,755,1934,1957]" italics="true" pageId="5" pageNumber="6">Eurytenes</emphasis>
</taxonomicName>
proposed by him having, however, been before adopted for a genus of
<taxonomicName id="CA824D25FFA0FFA66D77F83EFE2023A1" box="[259,414,1970,1994]" class="Insecta" kingdom="Animalia" order="Hymenoptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="order">Hymenoptera</taxonomicName>
, I have changed the latter half of the compound, still conserving the signification of the name as intended by Prof. Lilljeborg.' Fifteen years later, in his classical revision of gammaridean amphipods,
<bibRefCitation id="69134B57FFA3FFA56CE3FF1BFEEF24DB" author="Stebbing" box="[151,337,151,176]" pageId="6" pageNumber="7" refString="Stebbing, T. R. R. (1906) Amphipoda. I. Gammaridea. Das Tierreich, 21, 1 - 806." type="journal article" year="1906">Stebbing (1906)</bibRefCitation>
implicitly treated
<taxonomicName id="CA824D25FFA3FFA56E59FF14FCC624DB" authority="S.I. Smith, 1882" authorityName="S.I. Smith" authorityYear="1882" box="[557,888,151,176]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56E59FF14FD1524DB" box="[557,683,152,176]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
<bibRefCitation id="69134B57FFA3FFA56ECCFF14FCC624DB" author="Smith" box="[696,888,151,176]" pageId="6" pageNumber="7" refString="Smith, S. I. (1882) Eurythenes Lilljeborg. In: Scudder, S. H. (Ed.), Nomenclator Zoologicus. An alphabetical list of all generic names that have been employed by naturalists for recent and fossil animals from the earliest times to the close of the year 1879. I. Supplemental list. II. Universal index. Government Printing Office, Washington. Bulletin of the United States National Museum, 19, pp. 135 (Supplemental list of genera in Zoology) &amp; pp. 122 (Universal index to genera in Zoology). [i - xix, 1 - 376 (Supplemental list of genera in Zoology) &amp; 1 - 340 (Universal index to genera in Zoology)]" type="journal article" year="1882">S.I. Smith, 1882</bibRefCitation>
</taxonomicName>
as a replacement name validly introduced for
<taxonomicName id="CA824D25FFA3FFA56CE3FF31FE7124BE" authority="Lilljeborg, 1865" authorityName="Lilljeborg" authorityYear="1865" box="[151,463,188,213]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56CE3FF31FEB924BF" box="[151,263,189,212]" italics="true" pageId="6" pageNumber="7">Eurytenes</emphasis>
Lilljeborg, 1865
</taxonomicName>
. Between
<date id="793C1066FFA3FFA56E3FFF30FD4324BE" box="[587,765,188,213]" pageId="6" pageNumber="7" value="1893" valueMax="1925">1893 and 1925</date>
, a few authors adopted
<taxonomicName id="CA824D25FFA3FFA5686EFF31FB2624BF" box="[1050,1176,189,212]" class="Malacostraca" family="Lysianassidae" genus="Euryporeia" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA5686EFF31FB2624BF" box="[1050,1176,189,212]" italics="true" pageId="6" pageNumber="7">Euryporeia</emphasis>
</taxonomicName>
(see the list given by
<bibRefCitation id="69134B57FFA3FFA56CE3FF53FE102493" author="Stoddart" box="[151,430,223,248]" pageId="6" pageNumber="7" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
), but otherwise the point of view of
<bibRefCitation id="69134B57FFA3FFA56F22FF53FBB02493" author="Stebbing" box="[854,1038,223,248]" pageId="6" pageNumber="7" refString="Stebbing, T. R. R. (1906) Amphipoda. I. Gammaridea. Das Tierreich, 21, 1 - 806." type="journal article" year="1906">Stebbing (1906)</bibRefCitation>
became prevalent and, after 1925, universally accepted. The listing of both '
<taxonomicName id="CA824D25FFA3FFA56E1DFE89FC9A2577" authority="Forst." authorityName="Forst." box="[617,804,260,284]" class="Insecta" family="Braconidae" genus="Eurytenes" kingdom="Animalia" order="Hymenoptera" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56E1DFE89FD672577" box="[617,729,261,284]" italics="true" pageId="6" pageNumber="7">Eurytenes</emphasis>
Först.
</taxonomicName>
' and '
<taxonomicName id="CA824D25FFA3FFA56F17FE88FB9C2576" authority="Lillj." authorityName="Lillj." box="[867,1058,260,285]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56F17FE88FC5F2577" box="[867,993,260,284]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
Lillj.
</taxonomicName>
' in the second part of the book of Scudder (1882), which was overlooked by previous authors, clearly indicates that the spelling modification was deliberate and was intended to be a replacement name sensu
<bibRefCitation id="69134B57FFA3FFA56F22FEC0FC55250F" author="ICZN" box="[854,1003,332,356]" pageId="6" pageNumber="7" refString="ICZN [International Commission on Zoological Nomenclature] (1999) International Code of Zoological Nomenclature. Fourth Edition adopted by the International Union of Biological Sciences. The International Trust for Zoological Nomenclature, the Natural History Museum, London. xxix pp., 306 pp." type="book" year="1999">ICZN (1999)</bibRefCitation>
Art. 60.3. As the change operated by Smith has been done within a book authored by Scudder and not by him, it seems advisable to indicate the authority of the genus
<taxonomicName id="CA824D25FFA3FFA56DEDFE18FDA925C7" box="[409,535,404,428]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56DEDFE18FDA925C7" box="[409,535,404,428]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
</taxonomicName>
as 'Smith in Scudder, 1882' and not simply as '
<bibRefCitation id="69134B57FFA3FFA56846FE18FB7F25C7" author="Smith" box="[1074,1217,404,429]" pageId="6" pageNumber="7" refString="Smith, S. I. (1882) Eurythenes Lilljeborg. In: Scudder, S. H. (Ed.), Nomenclator Zoologicus. An alphabetical list of all generic names that have been employed by naturalists for recent and fossil animals from the earliest times to the close of the year 1879. I. Supplemental list. II. Universal index. Government Printing Office, Washington. Bulletin of the United States National Museum, 19, pp. 135 (Supplemental list of genera in Zoology) &amp; pp. 122 (Universal index to genera in Zoology). [i - xix, 1 - 376 (Supplemental list of genera in Zoology) &amp; 1 - 340 (Universal index to genera in Zoology)]" type="journal article" year="1882">Smith, 1882</bibRefCitation>
' as it is usually the case.
</paragraph>
<paragraph id="0D3D36A6FFA3FFA56CB3FE50FF6C2656" blockId="6.[151,1437,151,2013]" pageId="6" pageNumber="7">
The name
<taxonomicName id="CA824D25FFA3FFA56D30FE50FD1D259E" authority="S.I. Smith, 1884" authorityName="S.I. Smith" authorityYear="1884" box="[324,675,476,501]" class="Insecta" family="Chrysomelidae" genus="Eurysthenes" higherTaxonomySource="GBIF" kingdom="Animalia" order="Coleoptera" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56D30FE50FE73259F" box="[324,461,476,500]" italics="true" pageId="6" pageNumber="7">Eurysthenes</emphasis>
<bibRefCitation id="69134B57FFA3FFA56DA3FE50FD1D259E" author="Smith" box="[471,675,476,501]" pageId="6" pageNumber="7" refString="Smith, S. I. (1884 b) Crustacea of the Albatross dredgings in 1883. Annals and Magazine of Natural History, Series 5, 14, 179 - 183. [reprinted from the American Journal of Science] http: // dx. doi. org / 10.5962 / bhl. title. 62604" type="journal article" year="1884" yearSuffix="b">S.I. Smith, 1884b</bibRefCitation>
</taxonomicName>
has been interpreted as a typographical error (
<bibRefCitation id="69134B57FFA3FFA568B2FE50FF6D2673" author="Stoddart" pageId="6" pageNumber="7" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
), since the paper of
<bibRefCitation id="69134B57FFA3FFA56DCBFD8CFD2A2673" author="Smith" box="[447,660,511,536]" pageId="6" pageNumber="7" refString="Smith, S. I. (1884 b) Crustacea of the Albatross dredgings in 1883. Annals and Magazine of Natural History, Series 5, 14, 179 - 183. [reprinted from the American Journal of Science] http: // dx. doi. org / 10.5962 / bhl. title. 62604" type="journal article" year="1884" yearSuffix="b">S.I. Smith (1884b)</bibRefCitation>
is a reprint of
<bibRefCitation id="69134B57FFA3FFA56F37FD8CFBA72673" author="Smith" box="[835,1049,511,536]" pageId="6" pageNumber="7" refString="Smith, S. I. (1884 a) Crustacea of the Albatross dredgings in 1883. American Journal of Science, Series 3, 28, 53 - 56. http: // dx. doi. org / 10.2475 / ajs. s 3 - 28.163.53" type="journal article" year="1884" yearSuffix="a">S.I. Smith (1884a)</bibRefCitation>
, where the spelling
<taxonomicName id="CA824D25FFA3FFA56976FD8CFA3E2673" box="[1282,1408,512,536]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56976FD8CFA3E2673" box="[1282,1408,512,536]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
</taxonomicName>
is used.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA3FFA56CB3FDCBFC852343" pageId="6" pageNumber="7" type="biology_ecology">
<paragraph id="0D3D36A6FFA3FFA56CB3FDCBFBFD269B" blockId="6.[151,1437,151,2013]" pageId="6" pageNumber="7">
<emphasis id="3FF6EAB4FFA3FFA56CB3FDCBFE99260B" bold="true" box="[199,295,583,608]" pageId="6" pageNumber="7">Biology.</emphasis>
<taxonomicName id="CA824D25FFA3FFA56D59FDC4FE43260B" box="[301,509,584,608]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFA3FFA56D59FDC4FE43260B" box="[301,509,584,608]" italics="true" pageId="6" pageNumber="7">Eurythenes obesus</emphasis>
</taxonomicName>
is a pelagic species, of which the biology is poorly known, whilst other
<taxonomicName id="CA824D25FFA3FFA5696AFDC4FA22260B" box="[1310,1436,584,608]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA5696AFDC4FA22260B" box="[1310,1436,584,608]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
</taxonomicName>
species are benthopelagic,
<taxonomicName id="CA824D25FFA3FFA56DB0FDE1FDF626EF" box="[452,584,620,644]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFA3FFA56DB0FDE1FDF626EF" box="[452,584,620,644]" italics="true" pageId="6" pageNumber="7">E. thurstoni</emphasis>
</taxonomicName>
being more confined to the pelagic realm than the species of the
<taxonomicName id="CA824D25FFA3FFA56951FDE1FA2D26EF" box="[1317,1427,620,644]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56951FDE1FA8826EF" box="[1317,1334,621,644]" italics="true" pageId="6" pageNumber="7">E</emphasis>
.
<emphasis id="3FF6EAB4FFA3FFA56931FDE0FA2D26EF" box="[1349,1427,620,644]" italics="true" pageId="6" pageNumber="7">gryllus</emphasis>
</taxonomicName>
- complex or
<taxonomicName id="CA824D25FFA3FFA56D57FD1DFE2D26C3" box="[291,403,656,680]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56D57FD1DFE2D26C3" box="[291,403,656,680]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56DE8FD03FE0326C3" box="[412,445,655,680]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
(
<bibRefCitation id="69134B57FFA3FFA56DBBFD03FD5426C3" author="Stoddart" box="[463,746,655,680]" pageId="6" pageNumber="7" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
). A substantial corpus of biological literature exists for this species complex. It has to be reviewed collectively because the pseudocyptic species described herein have not been previously separated, assuming that their overall biology is reasonably similar.
</paragraph>
<paragraph id="0D3D36A6FFA3FFA56CB3FD70FABB213E" blockId="6.[151,1437,151,2013]" pageId="6" pageNumber="7">
<bibRefCitation id="69134B57FFA3FFA56CB3FD70FECA277E" author="Barnard" box="[199,372,764,789]" pageId="6" pageNumber="7" refString="Barnard, J. L. (1962) South Atlantic abyssal amphipods collected by R. V. Vema. In: Barnard, J. L., Menzies, R. J. &amp; Bacescu, M. C. (Eds.), Abyssal Crustacea. Columbia University Press, New York and London, pp. 1 - 78." type="book chapter" year="1962">Barnard (1962)</bibRefCitation>
stated that, &quot;morphologically,
<taxonomicName id="CA824D25FFA3FFA56EA4FD71FC80277F" box="[720,830,764,788]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56EA4FD71FC80277F" box="[720,830,764,788]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56F32FD70FCD9277E" box="[838,871,764,789]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
is more pelagic than benthic, but obviously feeds on the bottom”, but
<bibRefCitation id="69134B57FFA3FFA56D08FCACFD002753" author="Bowman" box="[380,702,799,824]" pageId="6" pageNumber="7" refString="Bowman, T. E. &amp; Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1." type="journal article" year="1972">Bowman &amp; Manning (1972)</bibRefCitation>
found that “the heavy compact body seems poorly adapted for a continuous pelagic existence, even though the heavily muscled pleon indicates that
<taxonomicName id="CA824D25FFA3FFA568E1FCC9FAB42737" box="[1173,1290,836,860]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA568E1FCC9FAB42737" box="[1173,1290,836,860]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
is a strong swimmer&quot;. Subsequent papers repeatedly confirmed that
<taxonomicName id="CA824D25FFA3FFA56F5EFCE5FC2427EB" box="[810,922,872,896]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56F5EFCE5FC2427EB" box="[810,922,872,896]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56FD0FCEBFC7B27EB" box="[932,965,871,896]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
is a benthopelagic species and
<bibRefCitation id="69134B57FFA3FFA56943FCEBFF5F27CF" author="Thurston" pageId="6" pageNumber="7" refString="Thurston, M. H. (1990) Abyssal necrophagous amphipods (Crustacea: Amphipoda) in the northeast and tropical Atlantic Ocean. Progress in Oceanography, 24, 257 - 274. http: // dx. doi. org / 10.1016 / 0079 - 6611 (90) 90036 - 2" type="journal article" year="1990">Thurston (1990)</bibRefCitation>
gave an extensive list of papers recording
<taxonomicName id="CA824D25FFA3FFA56ECBFC01FC9427CF" box="[703,810,908,932]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56ECBFC01FD6E27CF" box="[703,720,909,932]" italics="true" pageId="6" pageNumber="7">E</emphasis>
.
<emphasis id="3FF6EAB4FFA3FFA56EA9FC00FC9427CF" box="[733,810,908,932]" italics="true" pageId="6" pageNumber="7">gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56F46FC00FCED27CE" box="[818,851,908,933]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
in the water column, often far above the abyssal sea floor. An extreme case is the record
<quantity id="CA7A9B43FFA3FFA56E2CFC3CFD0D27AC" box="[600,691,944,968]" metricMagnitude="3" metricUnit="m" metricValue="1.8" pageId="6" pageNumber="7" unit="m" value="1800.0">1800 m</quantity>
above the bottom by
<bibRefCitation id="69134B57FFA3FFA56FB1FC23FB4F27A3" author="Baldwin" box="[965,1265,943,968]" pageId="6" pageNumber="7" refString="Baldwin, R. J. &amp; Smith, K. L. Jr. (1987) Temporal variation in the catch rate, length, color and sex of the necrophagous amphipod, Eurythenes gryllus, from the central and eastern North Pacific. Deep-Sea Research, 34 (3), 425 - 439. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90146 - 4" type="journal article" year="1987">Baldwin &amp; Smith (1987)</bibRefCitation>
. According to observations in the European Basin by
<bibRefCitation id="69134B57FFA3FFA56E3BFC58FCD02787" box="[591,878,980,1005]" pageId="6" pageNumber="7" refString="Christiansen, B., Pfannkuche, O. &amp; Thiel, H. K. (1990) Vertical distribution and population structure of the necrophagous amphipod Eurythenes gryllus in the West European Basin. Marine Ecology Progress Series, 66, 35 - 45. http: // dx. doi. org / 10.3354 / meps 066035" type="journal article">
Christiansen
<emphasis id="3FF6EAB4FFA3FFA56E96FC59FCAD2787" box="[738,787,980,1004]" italics="true" pageId="6" pageNumber="7">et al</emphasis>
. (1990)
</bibRefCitation>
, it is predominantly found in the first
<quantity id="CA7A9B43FFA3FFA5696DFC58FAEC2787" box="[1305,1362,980,1005]" metricMagnitude="1" metricUnit="m" metricValue="1.5" pageId="6" pageNumber="7" unit="m" value="15.0">15 m</quantity>
above the sea floor; juveniles and large females being exclusively found in the first
<quantity id="CA7A9B43FFA3FFA56870FC7BFB802064" box="[1028,1086,1015,1040]" metricMagnitude="1" metricUnit="m" metricValue="5.0" pageId="6" pageNumber="7" unit="m" value="50.0">50 m</quantity>
above the bottom; adult males have a bimodal distribution with maxima at 15 and
<quantity id="CA7A9B43FFA3FFA56E9AFB90FC89205F" box="[750,823,1052,1076]" metricMagnitude="2" metricUnit="m" metricValue="3.0" pageId="6" pageNumber="7" unit="m" value="300.0">300 m</quantity>
above the bottom; isolated specimens were observed
<quantity id="CA7A9B43FFA3FFA56CE3FBCCFF53203C" box="[151,237,1088,1112]" metricMagnitude="3" metricUnit="m" metricValue="1.0" pageId="6" pageNumber="7" unit="m" value="1000.0">1000 m</quantity>
above the sea floor.
<bibRefCitation id="69134B57FFA3FFA56DA8FBB3FD442033" author="Baldwin" box="[476,762,1087,1112]" pageId="6" pageNumber="7" refString="Baldwin, R. J. &amp; Smith, K. L. Jr. (1987) Temporal variation in the catch rate, length, color and sex of the necrophagous amphipod, Eurythenes gryllus, from the central and eastern North Pacific. Deep-Sea Research, 34 (3), 425 - 439. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90146 - 4" type="journal article" year="1987">Baldwin &amp; Smith (1987)</bibRefCitation>
, who made fairly similar observations on populations from the central and eastern North Pacific, suspected that juvenile
<taxonomicName id="CA824D25FFA3FFA56F3AFBE8FC722017" box="[846,972,1124,1148]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56F3AFBE8FC722017" box="[846,972,1124,1148]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
</taxonomicName>
remain close to the bottom due to larger food supplies and the possibility to seek refuge in the sediment as a protection from predation. Concerning pelagic specimens,
<bibRefCitation id="69134B57FFA3FFA56D6EFB21FD8A20AF" author="Ingram" box="[282,564,1196,1221]" pageId="6" pageNumber="7" refString="Ingram, C. L. &amp; Hessler, R. R. (1983) Distribution and behavior of scavenging amphipods from the central North Pacific. Deep- Sea Research Part A. Oceanographic Research Papers, 30 (7), 683 - 706. http: // dx. doi. org / 10.1016 / 0198 - 0149 (83) 90017 - 1" type="journal article" year="1983">Ingram &amp; Hessler (1983)</bibRefCitation>
state that: &quot;The bathymetric distribution of
<taxonomicName id="CA824D25FFA3FFA56854FB21FB3320AF" box="[1056,1165,1196,1220]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56854FB21FB3320AF" box="[1056,1165,1196,1220]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
implies that individuals probably spend long periods above the sediment searching for food. Those that live hundreds of meters above the sediment might only rarely, if ever, descend to the sediment. Such behavior would be energetically expensive unless
<taxonomicName id="CA824D25FFA3FFA56C97FA95FEEE215B" box="[227,336,1304,1328]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56C97FA95FEEE215B" box="[227,336,1304,1328]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
were neutrally buoyant or nearly so. Their primary energy store, lipids, may aid in maintaining the neutral buoyancy that would require little if any energy expenditure for staying in the water column.&quot;
</paragraph>
<paragraph id="0D3D36A6FFA3FFA56CB3FAD3FC852343" blockId="6.[151,1437,151,2013]" pageId="6" pageNumber="7">
The data of
<bibRefCitation id="69134B57FFA3FFA56D38FAD3FDDD2113" author="Baldwin" box="[332,611,1375,1400]" pageId="6" pageNumber="7" refString="Baldwin, R. J. &amp; Smith, K. L. Jr. (1987) Temporal variation in the catch rate, length, color and sex of the necrophagous amphipod, Eurythenes gryllus, from the central and eastern North Pacific. Deep-Sea Research, 34 (3), 425 - 439. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90146 - 4" type="journal article" year="1987">Baldwin &amp; Smith (1987)</bibRefCitation>
suggest that
<taxonomicName id="CA824D25FFA3FFA56E81FAECFC762113" box="[757,968,1376,1400]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56E81FAECFC762113" box="[757,968,1376,1400]" italics="true" pageId="6" pageNumber="7">Eurythenes gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56FBAFAD3FC512113" box="[974,1007,1375,1400]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
has a continuous recruitment, as there is no size class progression along with the annual cycle. Hatchlings are
<quantity id="CA7A9B43FFA3FFA56FBFFA08FBA521F7" box="[971,1051,1412,1436]" metricMagnitude="-2" metricUnit="m" metricValue="1.1" pageId="6" pageNumber="7" unit="mm" value="11.0">11 mm</quantity>
long (
<bibRefCitation id="69134B57FFA3FFA56811FA08FADD21F6" author="Thurston" box="[1125,1379,1412,1437]" pageId="6" pageNumber="7" refString="Thurston, M. H. &amp; Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209" type="journal article" year="1995">Thurston &amp; Bett 1995</bibRefCitation>
) and according to
<bibRefCitation id="69134B57FFA3FFA56D5EFA25FDF921AB" author="Ingram" box="[298,583,1447,1473]" pageId="6" pageNumber="7" refString="Ingram, C. L. &amp; Hessler, R. R. (1987) Population biology of the deep-sea amphipod Eurythenes gryllus: inferences from instar analyses. Deep-Sea Research Part A. Oceanographic Research Papers, 34 (12), 1889 - 1910. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90090 - 2" type="journal article" year="1987">Ingram &amp; Hessler (1987)</bibRefCitation>
, in
<taxonomicName id="CA824D25FFA3FFA56E04FA25FD6021AB" box="[624,734,1448,1472]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56E04FA25FD6021AB" box="[624,734,1448,1472]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56E91FA2BFCB821AB" box="[741,774,1447,1472]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
from the central North Pacific, males mature at instar VIII (mean length
<quantity id="CA7A9B43FFA3FFA56D44FA40FE3E218F" box="[304,384,1484,1508]" metricMagnitude="-2" metricUnit="m" metricValue="7.0" pageId="6" pageNumber="7" unit="mm" value="70.0">70 mm</quantity>
) and females at instar XV (mean length
<quantity id="CA7A9B43FFA3FFA56F31FA40FC18218F" box="[837,934,1484,1508]" metricMagnitude="-1" metricUnit="m" metricValue="1.09" pageId="6" pageNumber="7" unit="mm" value="109.0">109 mm</quantity>
); both males and females are mature through several instars and females can have multiple broods; they estimate that females mature at 9 years and males at 4 years. However, according to
<bibRefCitation id="69134B57FFA3FFA56D90F998FD522246" author="Thurston" box="[484,748,1556,1581]" pageId="6" pageNumber="7" refString="Thurston, M. H. &amp; Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209" type="journal article" year="1995">Thurston &amp; Bett (1995)</bibRefCitation>
the relationship between the size and the instars as calculated by
<bibRefCitation id="69134B57FFA3FFA56CC8F9B5FE61223B" author="Ingram" box="[188,479,1591,1617]" pageId="6" pageNumber="7" refString="Ingram, C. L. &amp; Hessler, R. R. (1987) Population biology of the deep-sea amphipod Eurythenes gryllus: inferences from instar analyses. Deep-Sea Research Part A. Oceanographic Research Papers, 34 (12), 1889 - 1910. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90090 - 2" type="journal article" year="1987">Ingram &amp; Hessler (1987)</bibRefCitation>
requires minor adjustments. Adult females with setose oostegites are uncommonly recorded and have very soft teguments compared to males and females in non-brooding intermoult (
<bibRefCitation id="69134B57FFA3FFA5695DF9D0FE9122F3" author="Ingram" pageId="6" pageNumber="7" refString="Ingram, C. L. &amp; Hessler, R. R. (1987) Population biology of the deep-sea amphipod Eurythenes gryllus: inferences from instar analyses. Deep-Sea Research Part A. Oceanographic Research Papers, 34 (12), 1889 - 1910. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90090 - 2" type="journal article" year="1987">Ingram &amp; Hessler 1987</bibRefCitation>
,
<bibRefCitation id="69134B57FFA3FFA56D48F9F3FD8322F3" author="Thurston" box="[316,573,1663,1688]" pageId="6" pageNumber="7" refString="Thurston, M. H. &amp; Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209" type="journal article" year="1995">Thurston &amp; Bett 1995</bibRefCitation>
). The only brooding female ever caught (bearing hatchlings, not eggs) was caught with a midwater trawl
<quantity id="CA7A9B43FFA3FFA56D86F928FDF722D7" box="[498,585,1700,1725]" metricMagnitude="3" metricUnit="m" metricValue="1.5" pageId="6" pageNumber="7" unit="m" value="1500.0">1500 m</quantity>
above the seafloor, suggesting pelagic incubation, at a depth range where predators are scarce (
<bibRefCitation id="69134B57FFA3FFA56DF6F94BFDC0228B" author="Thurston" box="[386,638,1735,1760]" pageId="6" pageNumber="7" refString="Thurston, M. H. &amp; Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209" type="journal article" year="1995">Thurston &amp; Bett 1995</bibRefCitation>
). We hypothesise that soft (i.e. lighter) teguments would ensure a better buoyancy—hence a reduced energetic budget—during the presumably non-feeding pelagic brooding stage and that females descend to the bottom for releasing their hatchlings.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA3FFAB6CB3F8B8FC0020CB" lastPageId="8" lastPageNumber="9" pageId="6" pageNumber="7" type="reference_group">
<paragraph id="0D3D36A6FFA3FFA46CB3F8B8FF612673" blockId="6.[151,1437,151,2013]" lastBlockId="7.[151,1437,151,2013]" lastPageId="7" lastPageNumber="8" pageId="6" pageNumber="7">
<taxonomicName id="CA824D25FFA3FFA56CB3F8B8FEFB2327" box="[199,325,1844,1868]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA3FFA56CB3F8B8FEFB2327" box="[199,325,1844,1868]" italics="true" pageId="6" pageNumber="7">Eurythenes</emphasis>
</taxonomicName>
spp. enter baited traps in swarms (e.g.
<bibRefCitation id="69134B57FFA3FFA56F6CF8B8FBCC2327" author="Shulenberger" box="[792,1138,1844,1869]" pageId="6" pageNumber="7" refString="Shulenberger, E. &amp; Hessler, R. R., (1974) Scavenging abyssal benthic amphipods trapped under oligotrophic cental North Pacific gyre waters. Marine BioIogy, 28, 185 - 187. http: // dx. doi. org / 10.1007 / BF 00387296" type="journal article" year="1974">Shulenberger &amp; Hessler 1974</bibRefCitation>
,
<bibRefCitation id="69134B57FFA3FFA568F5F8B8FADF2327" author="Premke" box="[1153,1377,1844,1869]" pageId="6" pageNumber="7" refString="Premke, K., Muyakshin, S., Klages, M. &amp; Wegner, J. (2003) Evidence for long-range chemoreceptive tracking of food odour in deep-sea scavengers by scanning sonar data. Journal of Experimental Marine Biology and Ecology, 285 - 286, 283 - 294. http: // dx. doi. org / 10.1016 / S 0022 - 0981 (02) 00533 - 6" type="book chapter" year="2003">
Premke
<emphasis id="3FF6EAB4FFA3FFA56895F8B9FAAB2327" box="[1249,1301,1844,1868]" italics="true" pageId="6" pageNumber="7">et al</emphasis>
. 2003
</bibRefCitation>
) and
<bibRefCitation id="69134B57FFA3FFA56CE3F8DBFEC7231B" box="[151,377,1879,1904]" pageId="6" pageNumber="7" refString="Dauby, P., Scailteur, Y. &amp; De Broyer, C. (2001) Trophic diversity within the eastern Weddell Sea amphipod community. Hydrobiologia, 443, 69 - 81. http: // dx. doi. org / 10.1023 / A: 1017596120422" type="journal article">
Dauby
<emphasis id="3FF6EAB4FFA3FFA56C9FF8D5FE98231B" box="[235,294,1880,1904]" italics="true" pageId="6" pageNumber="7">et al.</emphasis>
(2001)
</bibRefCitation>
considered
<taxonomicName id="CA824D25FFA3FFA56E71F8D5FDCB231B" box="[517,629,1880,1904]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56E71F8D5FDCB231B" box="[517,629,1880,1904]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56E0AF8DBFD21231B" box="[638,671,1879,1904]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
to be an exclusive scavenger. However, it has also been shown to predate on fishes caught by long lines (
<bibRefCitation id="69134B57FFA3FFA56E3FF8F0FCAE23FE" author="Templeman" box="[587,784,1916,1941]" pageId="6" pageNumber="7" refString="Templeman, W. (1967) Predation on living fishes on longline in Baffin Bay by the amphipod Eurythenes gryllus (Lichtenstein) and a new distribution record. Journal of the Fishery Research Board of Canada, 5, 234 - 237." type="journal article" year="1967">Templeman 1967</bibRefCitation>
) and to ingest mud (
<bibRefCitation id="69134B57FFA3FFA56F81F8F0FB2A23FE" author="Barnard" box="[1013,1172,1916,1941]" pageId="6" pageNumber="7" refString="Barnard, J. L. (1962) South Atlantic abyssal amphipods collected by R. V. Vema. In: Barnard, J. L., Menzies, R. J. &amp; Bacescu, M. C. (Eds.), Abyssal Crustacea. Columbia University Press, New York and London, pp. 1 - 78." type="book chapter" year="1962">Barnard 1962</bibRefCitation>
). Anatomical studies of
<taxonomicName id="CA824D25FFA3FFA56CE3F82DFEBB23D3" box="[151,261,1952,1976]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="6" pageNumber="7" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA3FFA56CE3F82DFEBB23D3" box="[151,261,1952,1976]" italics="true" pageId="6" pageNumber="7">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA3FFA56D79F82CFE9023D2" box="[269,302,1952,1977]" pageId="6" pageNumber="7" sensu="lato">s.l.</taxonomicNameLabel>
have revealed well-developed chemosensory organs on the antennae (
<bibRefCitation id="69134B57FFA3FFA5683BF82CFB6C23D3" author="Dahl" box="[1103,1234,1952,1977]" pageId="6" pageNumber="7" refString="Dahl, E. (1979) Deep-sea carrion feeding amphipods: evolutionary patterns in niche adaptation. Oikos, 33, 167 - 175. http: // dx. doi. org / 10.2307 / 3543994" type="journal article" year="1979">Dahl, 1979</bibRefCitation>
), mandibles welladapted for rapidly devouring pieces of carrion (
<bibRefCitation id="69134B57FFA3FFA56EBDF848FCCB23B7" author="Thurston" box="[713,885,1988,2013]" pageId="6" pageNumber="7" refString="Thurston, M. H. (1979) Scavenging abyssal amphipods from the north-east Atlantic Ocean. Marine BioIogy, 51, 55 - 68. http: // dx. doi. org / 10.1007 / BF 00389031" type="journal article" year="1979">Thurston 1979</bibRefCitation>
,
<bibRefCitation id="69134B57FFA3FFA56FF7F848FBBD23B7" author="Dahl" box="[899,1027,1988,2013]" pageId="6" pageNumber="7" refString="Dahl, E. (1979) Deep-sea carrion feeding amphipods: evolutionary patterns in niche adaptation. Oikos, 33, 167 - 175. http: // dx. doi. org / 10.2307 / 3543994" type="journal article" year="1979">Dahl, 1979</bibRefCitation>
) and a midgut capable of storing a large amount of food, as the fall of carcasses is sporadic (
<bibRefCitation id="69134B57FFA2FFA46F54FF1BFC1D24DB" author="Dahl" box="[800,931,151,176]" pageId="7" pageNumber="8" refString="Dahl, E. (1979) Deep-sea carrion feeding amphipods: evolutionary patterns in niche adaptation. Oikos, 33, 167 - 175. http: // dx. doi. org / 10.2307 / 3543994" type="journal article" year="1979">Dahl, 1979</bibRefCitation>
). According to
<bibRefCitation id="69134B57FFA2FFA46826FF1BFAD324DB" author="Smith" box="[1106,1389,151,176]" pageId="7" pageNumber="8" refString="Smith, K. L. &amp; Baldwin, R. J. (1984) Vertical distribution of the necrophagous amphipod, Eurythenes gryllus, in the North Pacific: spatial and temporal variation. Deep-Sea Research Part A. Oceanographic Research Papers, 31 (10), 1179 - 1196. http: // dx. doi. org / 10.1016 / 0198 - 0149 (84) 90057 - 8" type="journal article" year="1984">Smith &amp; Baldwin (1984)</bibRefCitation>
, the short range detection of carrion by
<taxonomicName id="CA824D25FFA2FFA46E5EFF30FD4124BF" box="[554,767,188,212]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46E5EFF30FD4124BF" box="[554,767,188,212]" italics="true" pageId="7" pageNumber="8">Eurythenes gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46F73FF30FC9624BE" box="[775,808,188,213]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
would obviously result from chemoreception, but they suspect that the noise and vibrations of their feeding and swimming would then attract specimens located beyond the odour boundary. Subsequent authors (e.g.
<bibRefCitation id="69134B57FFA2FFA46ED9FE88FC322577" author="Premke" box="[685,908,260,285]" pageId="7" pageNumber="8" refString="Premke, K., Muyakshin, S., Klages, M. &amp; Wegner, J. (2003) Evidence for long-range chemoreceptive tracking of food odour in deep-sea scavengers by scanning sonar data. Journal of Experimental Marine Biology and Ecology, 285 - 286, 283 - 294. http: // dx. doi. org / 10.1016 / S 0022 - 0981 (02) 00533 - 6" type="book chapter" year="2003">
Premke
<emphasis id="3FF6EAB4FFA2FFA46F78FE89FCFF2577" box="[780,833,260,284]" italics="true" pageId="7" pageNumber="8">et al</emphasis>
. 2003
</bibRefCitation>
) only retained chemoreception and no longer consider the acoustic/vibratory hypothesis.
<bibRefCitation id="69134B57FFA2FFA46EF0FEA4FC1D252B" author="Ingram" box="[644,931,295,320]" pageId="7" pageNumber="8" refString="Ingram, C. L. &amp; Hessler, R. R. (1983) Distribution and behavior of scavenging amphipods from the central North Pacific. Deep- Sea Research Part A. Oceanographic Research Papers, 30 (7), 683 - 706. http: // dx. doi. org / 10.1016 / 0198 - 0149 (83) 90017 - 1" type="journal article" year="1983">Ingram &amp; Hessler (1983)</bibRefCitation>
think that
<taxonomicName id="CA824D25FFA2FFA46855FEA5FB2E252B" box="[1057,1168,296,320]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46855FEA5FB2E252B" box="[1057,1168,296,320]" italics="true" pageId="7" pageNumber="8">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA468ECFEABFB07252B" box="[1176,1209,295,320]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
are hovering above the bottom, like vultures, in order to survey a larger area increasing the probability of detecting odour diffusion plumes of carcasses.
<taxonomicName id="CA824D25FFA2FFA46DF8FEFDFE4525E3" box="[396,507,368,392]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46DF8FEFDFE4525E3" box="[396,507,368,392]" italics="true" pageId="7" pageNumber="8">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46E71FEE3FD9825E3" box="[517,550,367,392]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
is known to reach carcasses quickly and it has been reported that up to
<specimenCount id="1B84FD2FFFA2FFA46906FEE3FEB225C6" pageId="7" pageNumber="8" type="generic">618 specimens</specimenCount>
have been caught in a trap, only 12 minutes after its deposition on the sea floor (
<bibRefCitation id="69134B57FFA2FFA468C5FE18FA2F25C7" author="Premke" box="[1201,1425,404,429]" pageId="7" pageNumber="8" refString="Premke, K., Muyakshin, S., Klages, M. &amp; Wegner, J. (2003) Evidence for long-range chemoreceptive tracking of food odour in deep-sea scavengers by scanning sonar data. Journal of Experimental Marine Biology and Ecology, 285 - 286, 283 - 294. http: // dx. doi. org / 10.1016 / S 0022 - 0981 (02) 00533 - 6" type="book chapter" year="2003">
Premke
<emphasis id="3FF6EAB4FFA2FFA46965FE19FAF525C7" box="[1297,1355,404,428]" italics="true" pageId="7" pageNumber="8">et al.</emphasis>
2003
</bibRefCitation>
). This is however an exceptional case and the arrival of
<taxonomicName id="CA824D25FFA2FFA46F7CFE35FCCE25BB" box="[776,880,440,464]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46F7CFE35FCCE25BB" box="[776,880,440,464]" italics="true" pageId="7" pageNumber="8">E gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46F0CFE3BFC2725BB" box="[888,921,439,464]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
usually takes a longer time (
<bibRefCitation id="69134B57FFA2FFA46890FE3BFA2E25BB" author="Thurston" box="[1252,1424,439,464]" pageId="7" pageNumber="8" refString="Thurston, M. H. (1979) Scavenging abyssal amphipods from the north-east Atlantic Ocean. Marine BioIogy, 51, 55 - 68. http: // dx. doi. org / 10.1007 / BF 00389031" type="journal article" year="1979">Thurston 1979</bibRefCitation>
). Brooding females of
<taxonomicName id="CA824D25FFA2FFA46DF7FE51FE51259F" box="[387,495,476,500]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46DF7FE51FE51259F" box="[387,495,476,500]" italics="true" pageId="7" pageNumber="8">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46D82FE50FDA9259E" box="[502,535,476,501]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
have so far never entered a trap (
<bibRefCitation id="69134B57FFA2FFA46FFCFE50FB2D259F" author="Ingram" box="[904,1171,476,501]" pageId="7" pageNumber="8" refString="Ingram, C. L. &amp; Hessler, R. R. (1983) Distribution and behavior of scavenging amphipods from the central North Pacific. Deep- Sea Research Part A. Oceanographic Research Papers, 30 (7), 683 - 706. http: // dx. doi. org / 10.1016 / 0198 - 0149 (83) 90017 - 1" type="journal article" year="1983">Ingram &amp; Hessler 1983</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA468EAFE50FF6D2673" author="Charmasson" pageId="7" pageNumber="8" refString="Charmasson, S. S. &amp; Calmet, D. P. (1987) Distribution of scavenging Lysianassidae amphipods Eurythenes gryllus in the northeast Atlantic: comparison with studies held in the Pacific. DeepSea Research Part A. Oceanographic Research Paper, 34 (9), 1509 - 1523. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90106 - 3" type="journal article" year="1987">Charmasson &amp; Calmet 1987</bibRefCitation>
).
</paragraph>
<paragraph id="0D3D36A6FFA2FFA46CB3FDA8FB102753" blockId="7.[151,1437,151,2013]" pageId="7" pageNumber="8">
On several occasions,
<taxonomicName id="CA824D25FFA2FFA46DB4FDA8FD2D2657" box="[448,659,548,572]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46DB4FDA8FD2D2657" box="[448,659,548,572]" italics="true" pageId="7" pageNumber="8">Eurythenes gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46EEEFDA8FD042656" box="[666,698,548,573]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
has been found in the stomach of flying sea birds (
<collectingCountry id="75957636FFA2FFA46887FDA8FAC12656" box="[1267,1407,548,573]" name="Liechtenstein" pageId="7" pageNumber="8">Lichtenstein</collectingCountry>
in Mandt 1822;
<bibRefCitation id="69134B57FFA2FFA46D5AFDCBFE4E260B" author="Stephensen" box="[302,496,583,608]" pageId="7" pageNumber="8" refString="Stephensen, K. (1925) Crustacea Malacostraca, VI: (Amphipoda I). The Danish Ingolf-Expedition, 3 (9), 101 - 178." type="journal article" year="1925">Stephensen 1925</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA46D8FFDC4FD89260B" author="Stephensen" box="[507,567,584,608]" pageId="7" pageNumber="8" refString="Stephensen, K. (1949) The Amphipoda of Tristan da Cunha. Results of the Norwegian scientific Expedition to Tristan da Cunha 1937 - 1938, 19, 1 - 61." type="journal article" year="1949">1949</bibRefCitation>
;
<bibRefCitation id="69134B57FFA2FFA46E36FDCBFD4F260B" author="Chevreux" box="[578,753,583,608]" pageId="7" pageNumber="8" refString="Chevreux, E. (1935) Amphipodes provenant des campagnes du Prince Albert Ier de Monaco. Resultats des Campagnes scientifiques accomplies sur son Yacht par Albert Ier Prince Souverain de Monaco, 90, 1 - 214, pls. 1 - 16." type="journal article" year="1935">Chevreux 1935</bibRefCitation>
;
<bibRefCitation id="69134B57FFA2FFA46E89FDCBFC75260B" author="Ainley" box="[765,971,583,608]" pageId="7" pageNumber="8" refString="Ainley, D. G., Fraser, W. R., Sullivan, C. W., Torres, J. J., Hopkins, T. L. &amp; Smith, W. O. (1986) Antarctic mesopelagic micronekton: evidence from seabirds that pack ice affects community structure. Science, 232, 847 - 849. [N. Y.]" type="journal article" year="1986">
Ainley
<emphasis id="3FF6EAB4FFA2FFA46F24FDC5FC3E260B" box="[848,896,584,608]" italics="true" pageId="7" pageNumber="8">et al</emphasis>
. 1986
</bibRefCitation>
;
<bibRefCitation id="69134B57FFA2FFA46FA3FDCBFB60260B" author="Klages" box="[983,1246,583,608]" pageId="7" pageNumber="8" refString="Klages, N. T. W. &amp; Cooper, J. (1997) Diet of the Atlantic petrel Pterodroma incerta during breeding at South Atlantic Gough Island. Marine Ornithology, 25, 13 - 16." type="journal article" year="1997">Klages &amp; Cooper 1997</bibRefCitation>
). Since these sea birds are obviously unable to dive at the minimal depths were living specimens have been recorded (i.e. below
<quantity id="CA7A9B43FFA2FFA46906FDE0FF0E26C3" metricMagnitude="2" metricUnit="m" metricValue="5.0" pageId="7" pageNumber="8" unit="m" value="500.0">500 m</quantity>
), it has been suggested that dead
<taxonomicName id="CA824D25FFA2FFA46E5EFD1CFD1626C3" box="[554,680,656,680]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA46E5EFD1CFD1626C3" box="[554,680,656,680]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
would drift towards the surface, where birds would consume them (
<bibRefCitation id="69134B57FFA2FFA46CEAFD38FE6F26A7" author="Bowman" box="[158,465,692,717]" pageId="7" pageNumber="8" refString="Bowman, T. E. &amp; Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1." type="journal article" year="1972">Bowman &amp; Manning 1972</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA46DA9FD39FD5426A7" author="Ingram" box="[477,746,692,717]" pageId="7" pageNumber="8" refString="Ingram, C. L. &amp; Hessler, R. R. (1983) Distribution and behavior of scavenging amphipods from the central North Pacific. Deep- Sea Research Part A. Oceanographic Research Papers, 30 (7), 683 - 706. http: // dx. doi. org / 10.1016 / 0198 - 0149 (83) 90017 - 1" type="journal article" year="1983">Ingram &amp; Hessler 1983</bibRefCitation>
). This statement remains however purely speculative. If dead
<taxonomicName id="CA824D25FFA2FFA46CE3FD54FEAB269B" box="[151,277,728,752]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA46CE3FD54FEAB269B" box="[151,277,728,752]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
would be drifting towards the surface, they should occasionally wash ashore, which, as far we know, is not corroborated by any records.
<bibRefCitation id="69134B57FFA2FFA46E79FD70FD54277E" box="[525,746,764,789]" pageId="7" pageNumber="8" refString="Ainley, D. G., Fraser, W. R., Sullivan, C. W., Torres, J. J., Hopkins, T. L. &amp; Smith, W. O. (1986) Antarctic mesopelagic micronekton: evidence from seabirds that pack ice affects community structure. Science, 232, 847 - 849. [N. Y.]" type="journal article">
Ainley
<emphasis id="3FF6EAB4FFA2FFA46E14FD71FD27277F" box="[608,665,764,788]" italics="true" pageId="7" pageNumber="8">et al.</emphasis>
(1986)
</bibRefCitation>
record
<taxonomicName id="CA824D25FFA2FFA46F35FD71FC11277F" box="[833,943,764,788]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46F35FD71FC11277F" box="[833,943,764,788]" italics="true" pageId="7" pageNumber="8">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46FC2FD70FC69277E" box="[950,983,764,789]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
in bird stomachs only where pack ice is present and conclude that they presumably occur near the surface level in such environments.
</paragraph>
<paragraph id="0D3D36A6FFA2FFA46CB3FCC8FA992083" blockId="7.[151,1437,151,2013]" pageId="7" pageNumber="8">
<emphasis id="3FF6EAB4FFA2FFA46CB3FCC8FCFE2736" bold="true" box="[199,832,836,861]" pageId="7" pageNumber="8">Sexual dimorphism, allometry, individual variations.</emphasis>
In
<taxonomicName id="CA824D25FFA2FFA46F13FCC8FC5B2737" box="[871,997,836,860]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA46F13FCC8FC5B2737" box="[871,997,836,860]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
there is almost no sexual dimorphism, except for antenna 2, which increases considerably in length in males that reach sexual maturity. The number of setae on the inner plate of maxilla 1 increases with size. The propodus of gnathopod 2 lengthens slightly when specimens increase in size (but the proportions of that article is also partly species-dependent). The spines and setae of pereopods 37 and uropods drastically shorten and widen when specimens increase in size. The propodus of pereopods 57 becomes slightly longer and narrower when size increases. The number of spines on the anterior border of the propodus of pereopods 57 increases with body size. The acuity of the posteroventral tooth of the first and second epimeral plate reduces when size increases. In some species, small specimens (&lt;
<quantity id="CA7A9B43FFA2FFA468D9FBB3FABF2033" box="[1197,1281,1087,1112]" metricMagnitude="-2" metricUnit="m" metricValue="5.0" pageId="7" pageNumber="8" unit="mm" value="50.0">50 mm</quantity>
) have or may have a posteroventral tooth on the third epimeral plate. This tooth disappears when the specimens get larger. The proportions of coxae and appendages also change with size, albeit very slightly. The rami of uropod 3 widen in large specimens. Finally, in
<taxonomicName id="CA824D25FFA2FFA46DA2FB21FD3220AF" box="[470,652,1196,1220]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FFA2FFA46DA2FB21FD3220AF" box="[470,652,1196,1220]" italics="true" pageId="7" pageNumber="8">E. magellanicus</emphasis>
</taxonomicName>
, some individual variations were observed in the size of the palm of gnathopod 1, the shape of coxa 4 and the strength of crenulation of the posterior basis of pereopods 57.
</paragraph>
<paragraph id="0D3D36A6FFA2FFA46CB3FB79FAF32263" blockId="7.[151,1437,151,2013]" pageId="7" pageNumber="8">
In agreement with literature data on
<taxonomicName id="CA824D25FFA2FFA46E1AFB78FCFA2167" box="[622,836,1268,1292]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46E1AFB78FCFA2167" box="[622,836,1268,1292]" italics="true" pageId="7" pageNumber="8">Eurythenes gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46F3AFB78FCD12166" box="[846,879,1268,1293]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
(e.g.
<bibRefCitation id="69134B57FFA2FFA46FC0FB78FB7C2167" author="Smith" box="[948,1218,1268,1293]" pageId="7" pageNumber="8" refString="Smith, K. L. &amp; Baldwin, R. J. (1984) Vertical distribution of the necrophagous amphipod, Eurythenes gryllus, in the North Pacific: spatial and temporal variation. Deep-Sea Research Part A. Oceanographic Research Papers, 31 (10), 1179 - 1196. http: // dx. doi. org / 10.1016 / 0198 - 0149 (84) 90057 - 8" type="journal article" year="1984">Smith &amp; Baldwin 1984</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA468A5FB78FF6C215B" author="Baldwin" pageId="7" pageNumber="8" refString="Baldwin, R. J. &amp; Smith, K. L. Jr. (1987) Temporal variation in the catch rate, length, color and sex of the necrophagous amphipod, Eurythenes gryllus, from the central and eastern North Pacific. Deep-Sea Research, 34 (3), 425 - 439. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90146 - 4" type="journal article" year="1987">Baldwin &amp; Smith 1987</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA46CABFA9BFE10215B" author="Thoen" box="[223,430,1303,1328]" pageId="7" pageNumber="8" refString="Thoen, H. H., Johnsen, G. &amp; Berge, J. (2011) Pigmentation and spectral absorbance in the deep-sea arctic amphipods Eurythenes gryllus and Anonyx sp. Polar Biology, 34, 83 - 93. http: // dx. doi. org / 10.1007 / s 00300 - 010 - 0861 - 5" type="journal article" year="2011">
Thoen
<emphasis id="3FF6EAB4FFA2FFA46D44FA95FED5215B" box="[304,363,1304,1328]" italics="true" pageId="7" pageNumber="8">et al.</emphasis>
2011
</bibRefCitation>
), we observed that the colour pattern of
<taxonomicName id="CA824D25FFA2FFA46FF7FA94FBBF215B" box="[899,1025,1304,1328]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA46FF7FA94FBBF215B" box="[899,1025,1304,1328]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
of the same species (in our case
<taxonomicName id="CA824D25FFA2FFA469F0FA95FEA3213F" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="andhakarae" status="sp. nov.">
<emphasis id="3FF6EAB4FFA2FFA469F0FA95FEA3213F" italics="true" pageId="7" pageNumber="8">E. andhakarae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46D57FAB0FEC3213E" box="[291,381,1340,1365]" pageId="7" pageNumber="8" rank="species">
<emphasis id="3FF6EAB4FFA2FFA46D57FAB0FEC3213E" bold="true" box="[291,381,1340,1365]" pageId="7" pageNumber="8">sp. nov.</emphasis>
</taxonomicNameLabel>
and
<taxonomicName id="CA824D25FFA2FFA46DC7FAB1FD9E213F" box="[435,544,1340,1364]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="stricto" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46DC7FAB1FD9E213F" box="[435,544,1340,1364]" italics="true" pageId="7" pageNumber="8">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46E53FAB0FDF7213F" box="[551,585,1340,1364]" pageId="7" pageNumber="8" sensu="stricto">s.s.</taxonomicNameLabel>
) is extremely variable and may range from white to yellow, orange and red.
<bibRefCitation id="69134B57FFA2FFA46CE3FAD3FE022113" author="Baldwin" box="[151,444,1375,1400]" pageId="7" pageNumber="8" refString="Baldwin, R. J. &amp; Smith, K. L. Jr. (1987) Temporal variation in the catch rate, length, color and sex of the necrophagous amphipod, Eurythenes gryllus, from the central and eastern North Pacific. Deep-Sea Research, 34 (3), 425 - 439. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90146 - 4" type="journal article" year="1987">Baldwin &amp; Smith (1987)</bibRefCitation>
propose the following links: (1) pigmentation deposition in animals with increasing length of intermoult period and (2) lower food supply resulting in a longer intermoult period, therefore allowing an increased time to incorporate pigments. This idea of a correlation between the colour and the moult/intermoult cycle is supported by observations on the green shore crab,
<taxonomicName id="CA824D25FFA2FFA46F18FA40FAB9218E" authority="Linnaeus, 1758" authorityName="Linnaeus" authorityYear="1758" box="[876,1287,1484,1509]" class="Malacostraca" family="Portunidae" genus="Carcinus" kingdom="Animalia" order="Decapoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="maenas">
<emphasis id="3FF6EAB4FFA2FFA46F18FA40FB8D218F" box="[876,1075,1484,1508]" italics="true" pageId="7" pageNumber="8">Carcinus maenas</emphasis>
(Linnaeus, 1758)
</taxonomicName>
, where only specimens in long intermoult get a red ventral colour (
<bibRefCitation id="69134B57FFA2FFA46E82FA63FC102263" author="Reid" box="[758,942,1519,1544]" pageId="7" pageNumber="8" refString="Reid, D. G., Abello, P., Kaiser, M. J. &amp; Warman, C. G. (1997) Carapace colour, inter-moult duration and the behavioural and physiological ecology of the shore crab Carcinus maenas. Estuarine, Coastal and Shelf Science, 44 (2), 203 - 211. http: // dx. doi. org / 10.1006 / ecss. 1996.0212" type="journal article" year="1997">
Reid
<emphasis id="3FF6EAB4FFA2FFA46F40FA7DFCDB2263" box="[820,869,1520,1544]" italics="true" pageId="7" pageNumber="8">et al</emphasis>
. 1997
</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA46FCCFA63FB112263" author="Styrishave" box="[952,1199,1519,1544]" pageId="7" pageNumber="8" refString="Styrishave, B., Rewitz, K. &amp; Andersen, O. (2004) Frequency of moulting by shore crabs Carcinus maenas (L.) changes their colour and their success in mating and physiological performance. Journal of Experimental Marine Biology and Ecology, 313 (2), 317 - 336. http: // dx. doi. org / 10.1016 / j. jembe. 2004.08.013" type="journal article" year="2004">
Styrishave
<emphasis id="3FF6EAB4FFA2FFA46841FA7DFBD32263" box="[1077,1133,1520,1544]" italics="true" pageId="7" pageNumber="8">et al.</emphasis>
2004
</bibRefCitation>
,
<bibRefCitation id="69134B57FFA2FFA468CEFA63FAFF2263" author="Lewis" box="[1210,1345,1519,1544]" pageId="7" pageNumber="8" refString="Lewis, J. (2011) Red and green Carcinus: how different? The Plymouth Student Scientist, 4 (1), 423 - 431." type="journal article" year="2011">Lewis 2011</bibRefCitation>
).
</paragraph>
<paragraph id="0D3D36A6FFA2FFA46CB3F998FED6236E" blockId="7.[151,1437,151,2013]" pageId="7" pageNumber="8">
<emphasis id="3FF6EAB4FFA2FFA46CB3F998FE502246" bold="true" box="[199,494,1556,1581]" pageId="7" pageNumber="8">Interspecific differences.</emphasis>
<taxonomicName id="CA824D25FFA2FFA46D83F999FDDA2247" box="[503,612,1556,1580]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFA2FFA46D83F999FDDA2247" box="[503,612,1556,1580]" italics="true" pageId="7" pageNumber="8">E. obesus</emphasis>
</taxonomicName>
exhibits profound differences with other
<taxonomicName id="CA824D25FFA2FFA46834F998FB002247" box="[1088,1214,1556,1580]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA46834F998FB002247" box="[1088,1214,1556,1580]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
species. Especially the very long dactylus of its pereopods 37 allows for an immediate distinction from all other
<taxonomicName id="CA824D25FFA2FFA468CAF9B4FA82223B" box="[1214,1340,1592,1616]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA468CAF9B4FA82223B" box="[1214,1340,1592,1616]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
species. Its ventrally deeply convex coxa 4 and the very elongate shape of its eyes are also very characteristic.
<taxonomicName id="CA824D25FFA2FFA46963F9D1FA22221F" box="[1303,1436,1628,1652]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFA2FFA46963F9D1FA22221F" box="[1303,1436,1628,1652]" italics="true" pageId="7" pageNumber="8">E. thurstoni</emphasis>
</taxonomicName>
exhibit clear-cut, albeit much less pronounced, differences from the remaining
<taxonomicName id="CA824D25FFA2FFA46867F90CFB2F22F3" box="[1043,1169,1664,1688]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA2FFA46867F90CFB2F22F3" box="[1043,1169,1664,1688]" italics="true" pageId="7" pageNumber="8">Eurythenes</emphasis>
</taxonomicName>
species. Especially, the palm of gnathopod 2 is considerably more protruding than in
<taxonomicName id="CA824D25FFA2FFA46F33F928FC2A22D7" box="[839,916,1700,1724]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46F33F928FC2A22D7" box="[839,916,1700,1724]" italics="true" pageId="7" pageNumber="8">gryllus</emphasis>
</taxonomicName>
and its relatives, the ventral border of its coxa 4 is more rounded and the postero-distal border of the basis of its pereopod 7 is much more elongated than in the remaining species.
</paragraph>
<paragraph id="0D3D36A6FFA2FFAB6CB3F89CFE67250E" blockId="7.[151,1437,151,2013]" lastBlockId="8.[151,1436,151,357]" lastPageId="8" lastPageNumber="9" pageId="7" pageNumber="8">
A group of extremely similar species remained to be studied, which can be referred as the
<taxonomicName id="CA824D25FFA2FFA468A9F89CFA952343" box="[1245,1323,1808,1832]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA468A9F89CFA952343" box="[1245,1323,1808,1832]" italics="true" pageId="7" pageNumber="8">gryllus</emphasis>
</taxonomicName>
-complex.
<bibRefCitation id="69134B57FFA2FFA46CE3F8B9FE602327" author="Bowman" box="[151,478,1844,1869]" pageId="7" pageNumber="8" refString="Bowman, T. E. &amp; Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1." type="journal article" year="1972">Bowman &amp; Manning (1972)</bibRefCitation>
and
<bibRefCitation id="69134B57FFA2FFA46E6DF8B8FC812327" author="Stoddart" box="[537,831,1844,1869]" pageId="7" pageNumber="8" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
observed and illustrated minute differences between specimens of different origins but considered them as insufficient to justify the recognition of different species. On the other hand,
<bibRefCitation id="69134B57FFA2FFA46D39F8F1FDCF23FF" author="Ingram" box="[333,625,1916,1941]" pageId="7" pageNumber="8" refString="Ingram, C. L. &amp; Hessler, R. R. (1983) Distribution and behavior of scavenging amphipods from the central North Pacific. Deep- Sea Research Part A. Oceanographic Research Papers, 30 (7), 683 - 706. http: // dx. doi. org / 10.1016 / 0198 - 0149 (83) 90017 - 1" type="journal article" year="1983">Ingram &amp; Hessler (1983)</bibRefCitation>
, who also observed differences, did not rule out that they might be of specific nature, but did not investigate the problem in any detail. Molecular data definitely settles the issue and indicates beyond doubt that
<taxonomicName id="CA824D25FFA2FFA46DA0F849FDFC23B7" box="[468,578,1988,2012]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" sensu="lato" species="gryllus">
<emphasis id="3FF6EAB4FFA2FFA46DA0F849FDFC23B7" box="[468,578,1988,2012]" italics="true" pageId="7" pageNumber="8">E. gryllus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFA2FFA46E3EF848FDD423B6" box="[586,618,1988,2013]" pageId="7" pageNumber="8" sensu="lato">s.l.</taxonomicNameLabel>
consists of several species-level clades (
<bibRefCitation id="69134B57FFA2FFA46841F848FA8423B7" author="Havermans" box="[1077,1338,1988,2012]" pageId="7" pageNumber="8" refString="Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. &amp; Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218" type="journal article" year="2013">
Havermans
<emphasis id="3FF6EAB4FFA2FFA468C9F849FB4823B7" box="[1213,1270,1988,2012]" italics="true" pageId="7" pageNumber="8">et al.</emphasis>
2013
</bibRefCitation>
). Hence, it was necessary to reconsider the question by a morphological comparison of the different molecular clades and to re-consider the elusive characters previously considered as intraspecific variation, which is commonly referred to as the reverse taxonomy approach (e.g.
<bibRefCitation id="69134B57FFADFFAB6E24FF53FC902493" author="Kanzaki" box="[592,814,223,248]" pageId="8" pageNumber="9" refString="Kanzaki, N., Giblin-Davis, R. M., Scheffrahn, R. H., Taki, H., Esquivel, A., Davies, K. A., Herre, E. A. (2012) Reverse taxonomy for elucidating diversity of insect-associated nematodes: a case study with termites. PLoS ONE, 7 (8), e 43865. http: // dx. doi. org / 10.1371 / journal. pone. 0043865" type="journal article" year="2012">
Kanzaki
<emphasis id="3FF6EAB4FFADFFAB6EC7FF6DFD552493" box="[691,747,224,248]" italics="true" pageId="8" pageNumber="9">et al.</emphasis>
2012
</bibRefCitation>
). Indeed, with the exception of shape of coxa 2 which is markedly different in
<taxonomicName id="CA824D25FFADFFAB6DE5FE89FDA52577" box="[401,539,260,284]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="maldoror" status="sp. nov.">
<emphasis id="3FF6EAB4FFADFFAB6DE5FE89FDA52577" box="[401,539,260,284]" italics="true" pageId="8" pageNumber="9">E. maldoror</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFADFFAB6E50FE88FDC12576" box="[548,639,260,285]" pageId="8" pageNumber="9" rank="species">
<emphasis id="3FF6EAB4FFADFFAB6E50FE88FDC12576" bold="true" box="[548,639,260,285]" pageId="8" pageNumber="9">sp. nov.</emphasis>
</taxonomicNameLabel>
compared to all other species, other differences are rather difficult to appreciate and should be used with the greatest caution, when trying to identify specimens. Specific characters in the
<taxonomicName id="CA824D25FFADFFAB6CB4FEC0FEB0250F" box="[192,270,332,356]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFADFFAB6CB4FEC0FEB0250F" box="[192,270,332,356]" italics="true" pageId="8" pageNumber="9">gryllus</emphasis>
</taxonomicName>
-complex include:
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FE19FE5D25BB" blockId="8.[151,1436,404,1184]" pageId="8" pageNumber="9">- degree of carination of body segments and the number of body segments with a sigmoid profile (i.e. with a slight anterior concavity)</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FE51FE39259E" blockId="8.[151,1436,404,1184]" box="[151,391,476,501]" pageId="8" pageNumber="9">- shape of the eyes</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FD8CFD312673" blockId="8.[151,1436,404,1184]" box="[151,655,511,536]" pageId="8" pageNumber="9">- development of the anterior lobe of head</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FDA9FCBC2656" blockId="8.[151,1436,404,1184]" box="[151,770,548,573]" pageId="8" pageNumber="9">- width and shape of article 2 of the mandibular palp</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FDC4FBD5260B" blockId="8.[151,1436,404,1184]" box="[151,1131,583,608]" pageId="8" pageNumber="9">- number of nodular spines on the anterior border of the inner plate of the maxilliped</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FDE1FCEC26EE" blockId="8.[151,1436,404,1184]" box="[151,850,620,645]" pageId="8" pageNumber="9">- degree of protrusion of the aforementioned nodular spines</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FD1CFD7826C3" blockId="8.[151,1436,404,1184]" box="[151,710,655,680]" pageId="8" pageNumber="9">- ratio length/width of the basis of gnathopod 1</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FD39FD5F26A7" blockId="8.[151,1436,404,1184]" box="[151,737,692,717]" pageId="8" pageNumber="9">- degree of protrusion of the palm of gnathopod 1</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FD54FDDC269B" blockId="8.[151,1436,404,1184]" box="[151,610,727,752]" pageId="8" pageNumber="9">- shape of the ventral border of coxa 2</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FD71FBD3277E" blockId="8.[151,1436,404,1184]" box="[151,1133,764,789]" pageId="8" pageNumber="9">- proportions of the propodus of gnathopod 2 (this character is also partly allometric)</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FCACFCE82753" blockId="8.[151,1436,404,1184]" box="[151,854,799,824]" pageId="8" pageNumber="9">- level of protrusion or intrusion of the palm of gnathopod 2</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FCC9FCBB2737" blockId="8.[151,1436,404,1184]" box="[151,773,836,861]" pageId="8" pageNumber="9">- number of spines defining the palm of gnathopod 2</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FCE4FB3127EB" blockId="8.[151,1436,404,1184]" box="[151,1167,871,896]" pageId="8" pageNumber="9">- proportions and shape of coxa 4 (difficult to phrase in simple and unambiguous terms)</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FC01FC5827CE" blockId="8.[151,1436,404,1184]" box="[151,998,908,933]" pageId="8" pageNumber="9">- degree of posterior expansion of the basis of pereopod 7 (and its shape)</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FC3CFBC227AC" blockId="8.[151,1436,404,1184]" box="[151,1148,943,968]" pageId="8" pageNumber="9">- degree of development and shape of the posterodistal lobe of the basis of pereopod 7</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FC59FD90205E" blockId="8.[151,1436,404,1184]" pageId="8" pageNumber="9">- degree of crenulation of the posterior border of the basis of pereopods 57 (in keeping in mind that the crenulation is usually more developed in immatures than in adults and that the posterior border of the basis is fragile and hence easily eroded)</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FBCCFB3E2033" blockId="8.[151,1436,404,1184]" box="[151,1152,1087,1112]" pageId="8" pageNumber="9">- degree of broadening of the merus of pereopod 57 (and to a certain extent its shape)</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FBE9FB702017" blockId="8.[151,1436,404,1184]" box="[151,1230,1124,1149]" pageId="8" pageNumber="9">
- presence/absence of a posteroventral tooth on the third epimeral plate in specimens &lt;
<quantity id="CA7A9B43FFADFFAB68F4FBE8FB702017" box="[1152,1230,1124,1149]" metricMagnitude="-2" metricUnit="m" metricValue="5.0" pageId="8" pageNumber="9" unit="mm" value="50.0">50 mm</quantity>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FB05FC0020CB" blockId="8.[151,1436,404,1184]" box="[151,958,1159,1184]" pageId="8" pageNumber="9">- degree of curvature of the ventral border of the third epimeral plate.</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,206 @@
<document id="E1D400ED34235889F5F4A679F1A3848B" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FFA1FFA66CE3FA2FFBEB26EF" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Lysianassoidea Dana 1849" docType="treatment" docVersion="8" lastPageNumber="5" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="5" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="67106F7E7B1E94E62C6D6B6D4BCEEF08" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="67C8C2693092F59E35970C8C81A07084">
<mods:title id="C71AD24C0A40EEC972056F7B97370D96">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="1CFB53B88D5C6320BDBEEFEFEC5FFD77" type="personal">
<mods:role id="B1A0DAC8431E2DBFB9120C5EF45479B6">
<mods:roleTerm id="A80DDDD3A9158B773CEE7A3674015A94">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="8A7205AC490B5DE36E1634187423AB52">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="563AC3F4616A96B241BE22EFA5E2BA05" type="personal">
<mods:role id="3905DA7FEC63B5DF4D5898C371BF46C6">
<mods:roleTerm id="6AE938DFA14929BD6A91F2AE49F15E4F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F5A65770C0E48C0F0FDF5D5522851C4B">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="C3BF01991AAA2BA53D0BE5BE22E40A00">text</mods:typeOfResource>
<mods:relatedItem id="059C5319BE200E20829EB67FBD900E19" type="host">
<mods:titleInfo id="D61A867B38E199DCFA2D9F7A5C3BEA98">
<mods:title id="0B44152916F86433FCCDCCBFB787165E">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="4B0693A89891347D0439DF44C31857B9">
<mods:date id="CF1EA6EE353A288D6A7F7080CFC1E5EC">2015</mods:date>
<mods:detail id="BEA369EE92270B99AB31682326F0FF9F" type="volume">
<mods:number id="A6CF9CC106425CBC60687173EBBAD4B1">3971</mods:number>
</mods:detail>
<mods:detail id="68010105A3ED368775244C097F0859D5" type="issue">
<mods:number id="DF13595E05C14551EDD7A9FFFDE01CF0">1</mods:number>
</mods:detail>
<mods:extent id="AE729C35C8B73E3A3719CBB6B1C97932" unit="page">
<mods:start id="CDAA0C17B386D51021E20FDA74B19A44">1</mods:start>
<mods:end id="F147125D0819039293BB3C411AEE961E">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="7035EAF1616C90AD78CC5AC6EF2D855B">journal article</mods:classification>
<mods:identifier id="070E6A64CD3B2ABFB4B7A3492D7AEA10" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="BD0369A3864C1404A69B126E339EE584" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="3939AD06D13A549C53C7FAC5CE8FB55A" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="0ADD6E7A0311A1E373DE146FA5B0B0F6" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="C1400D0CA622AF12687D4D7B460E8837" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FFA1FFA66CE3FA2FFBEB26EF" ID-DOI="http://doi.org/10.5281/zenodo.5470176" ID-GBIF-Taxon="127691968" ID-Zenodo-Dep="5470176" LSID="urn:lsid:plazi:treatment:852B87B0FFA1FFA66CE3FA2FFBEB26EF" httpUri="http://treatment.plazi.org/id/852B87B0FFA1FFA66CE3FA2FFBEB26EF" lastPageId="5" lastPageNumber="5" pageId="4" pageNumber="5">
<subSubSection id="4598652DFFA1FFA76CE3FA2FFD3621D6" box="[151,648,1443,1469]" pageId="4" pageNumber="5" type="nomenclature">
<paragraph id="0D3D36A6FFA1FFA76CE3FA2FFD3621D6" blockId="4.[151,648,1443,1469]" box="[151,648,1443,1469]" pageId="4" pageNumber="5">
<heading id="567581CAFFA1FFA76CE3FA2FFD3621D6" bold="true" box="[151,648,1443,1469]" fontSize="11" level="1" pageId="4" pageNumber="5" reason="1">
<emphasis id="3FF6EAB4FFA1FFA76CE3FA2FFD3621D6" bold="true" box="[151,648,1443,1469]" pageId="4" pageNumber="5">
Superfamily
<taxonomicName id="CA824D25FFA1FFA76D4DFA2FFD3621D6" ID-CoL="7NGQH" authority="Dana, 1849" authorityName="Dana" authorityYear="1849" box="[313,648,1443,1469]" class="Malacostraca" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="4" pageNumber="5" phylum="Arthropoda" rank="superFamily" superFamily="Lysianassoidea">
Lysianassoidea
<bibRefCitation id="69134B57FFA1FFA76D8FFA2FFD3621D6" author="Dana" box="[507,648,1443,1469]" pageId="4" pageNumber="5" refString="Dana, J. D. (1849) Synopsis of the genera of Gammaracea. American Journal of Science and Arts, Series 2, 8, 135 - 140." type="journal article" year="1849">Dana, 1849</bibRefCitation>
</taxonomicName>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA1FFA76CE3FA65FDF0224D" pageId="4" pageNumber="5" type="materials_examined">
<paragraph id="0D3D36A6FFA1FFA76CE3FA65FD532269" blockId="4.[151,1437,1513,2006]" box="[151,749,1513,1538]" pageId="4" pageNumber="5">
<emphasis id="3FF6EAB4FFA1FFA76CE3FA65FE9A2269" bold="true" box="[151,292,1513,1538]" pageId="4" pageNumber="5">
<typeStatus id="D2398804FFA1FFA76CE3FA65FF6C2269" box="[151,210,1513,1538]" pageId="4" pageNumber="5">Type</typeStatus>
genus.
</emphasis>
<taxonomicName id="CA824D25FFA1FFA76D5FFA65FD9F2269" authority="S.I. Smith" authorityName="S.I. Smith" box="[299,545,1513,1538]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA1FFA76D5FFA65FE17226A" box="[299,425,1513,1537]" italics="true" pageId="4" pageNumber="5">Eurythenes</emphasis>
S.I. Smith
</taxonomicName>
in Scudder, 1882.
</paragraph>
<paragraph id="0D3D36A6FFA1FFA76CB3F981FDF0224D" blockId="4.[151,1437,1513,2006]" box="[199,590,1549,1574]" pageId="4" pageNumber="5">
<emphasis id="3FF6EAB4FFA1FFA76CB3F981FE7B224D" bold="true" box="[199,453,1549,1574]" pageId="4" pageNumber="5">Generic composition.</emphasis>
Monotypic.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA1FFA76CB3F9BDFD0A2221" box="[199,692,1585,1610]" pageId="4" pageNumber="5" type="description">
<paragraph id="0D3D36A6FFA1FFA76CB3F9BDFD0A2221" blockId="4.[151,1437,1513,2006]" box="[199,692,1585,1610]" pageId="4" pageNumber="5">
<emphasis id="3FF6EAB4FFA1FFA76CB3F9BDFEE72221" bold="true" box="[199,345,1585,1610]" pageId="4" pageNumber="5">Description.</emphasis>
See
<bibRefCitation id="69134B57FFA1FFA76DFAF9BDFD0E2221" author="Stoddart" box="[398,688,1585,1610]" pageId="4" pageNumber="5" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFA1FFA66CB3F9D9FBEB26EF" lastPageId="5" lastPageNumber="6" pageId="4" pageNumber="5" type="discussion">
<paragraph id="0D3D36A6FFA1FFA66CB3F9D9FBEB26EF" blockId="4.[151,1437,1513,2006]" lastBlockId="5.[151,1437,151,645]" lastPageId="5" lastPageNumber="6" pageId="4" pageNumber="5">
<emphasis id="3FF6EAB4FFA1FFA76CB3F9D9FE852205" bold="true" box="[199,315,1621,1646]" pageId="4" pageNumber="5">Remarks.</emphasis>
During the past two decades, Lowry and his collaborators have split the old family Lysianassidaeelevated to the rank of superfamily Lysianassoidea—into a large number of new families. In their studies, a largely phenetic approach was applied, in the sense that each group of taxa sharing distinctive characters was automatically assigned to a separate family or genus, without attempting to unravel the deep interrelationships between taxa. In one case, they even rejected taxa definitions based on phylogenetic analyses (
<bibRefCitation id="69134B57FFA1FFA76874F96AFEC0234A" author="Lowry" pageId="4" pageNumber="5" refString="Lowry, J. K. &amp; Kilgallen, N. M. (2014) A generic review of the lysianassoid family Uristidae and descriptions of new taxa from Australian waters (Crustacea, Amphipoda, Uristidae). Zootaxa, 3867 (1), 1 - 92. http: // dx. doi. org / 10.11646 / zootaxa. 3867.1.1" type="journal article" year="2014">
Lowry &amp; Kilgallen 2014: discussion on
<taxonomicName id="CA824D25FFA1FFA76CCAF885FEC0234A" box="[190,382,1801,1825]" class="Malacostraca" family="Lysianassidae" genus="Pseudorchomene" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA1FFA76CCAF885FEC0234A" box="[190,382,1801,1825]" italics="true" pageId="4" pageNumber="5">Pseudorchomene</emphasis>
</taxonomicName>
</bibRefCitation>
). In the course of this division process,
<bibRefCitation id="69134B57FFA1FFA76F16F885FB312349" author="Stoddart" box="[866,1167,1801,1826]" pageId="4" pageNumber="5" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
erected the monotypic family
<taxonomicName id="CA824D25FFA1FFA76C9DF8A1FE35232D" box="[233,395,1837,1862]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="4" pageNumber="5" phylum="Arthropoda" rank="family">Eurytheneidae</taxonomicName>
for the genus
<taxonomicName id="CA824D25FFA1FFA76E45F8A1FD11232E" box="[561,687,1837,1861]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA1FFA76E45F8A1FD11232E" box="[561,687,1837,1861]" italics="true" pageId="4" pageNumber="5">Eurythenes</emphasis>
</taxonomicName>
. Recent works such as
<bibRefCitation id="69134B57FFA1FFA76FCAF8A2FB73232D" author="Havermans" box="[958,1229,1837,1862]" pageId="4" pageNumber="5" refString="Havermans, C., Nagy, Z. T., Sonet, G., De Broyer, C. &amp; Martin, P. (2010) Incongruence between molecular phylogeny and morphological classification in amphipod crustaceans: A case study of Antarctic lysianassoids. Molecular Phylogenetics and Evolution, 55, 202 - 209. http: // dx. doi. org / 10.1016 / j. ympev. 2009.10.025" type="journal article" year="2010">
Havermans
<emphasis id="3FF6EAB4FFA1FFA76833F8A2FB3F232E" box="[1095,1153,1837,1861]" italics="true" pageId="4" pageNumber="5">et al.</emphasis>
(2010
</bibRefCitation>
,
<bibRefCitation id="69134B57FFA1FFA768AEF8A2FAAB232D" author="Havermans" box="[1242,1301,1838,1862]" pageId="4" pageNumber="5" refString="Havermans, C., Nagy, Z. T., Sonet, G., De Broyer, C. &amp; Martin, P. (2011) DNA barcoding reveals new insights into the diversity of Antarctic species of Orchomene sensu lato (Crustacea: Amphipoda: Lysianassoidea). Deep - Sea Research Part II: Topical Studies in Oceanography, 58 (1 - 2), 230 - 241. http: // dx. doi. org / doi: 10.1016 / j. dsr 2.2010.09.028" type="journal article" year="2011">2011</bibRefCitation>
),
<bibRefCitation id="69134B57FFA1FFA7695EF8A1FE602301" pageId="4" pageNumber="5" refString="d'Udekem d'Acoz, C. &amp; Havermans, C. (2012) Two new Pseudorchomene species from the Southern Ocean, with phylogenetic remarks on the genus and related species (Crustacea: Amphipoda: Lysianassoidea: Lysianassidae: Tryphosinae). Zootaxa, 3310, 1 - 50." type="journal article">d'Udekem d'Acoz &amp; Havermans (2012)</bibRefCitation>
and
<bibRefCitation id="69134B57FFA1FFA76E62F8DDFCB12301" box="[534,783,1873,1898]" pageId="4" pageNumber="5" refString="Corrigan, L. J., Horton, T., Fotherby, H., White, T. A. &amp; Hoelzel, A. R. (2014) Adaptative evolution of the deep-sea amphipods from the superfamily Lysiassanoidea [sic] in the North Atlantic. Evolutionary Biology, 41 (1), 154 - 165. http: // dx. doi. org / 10.1007 / s 11692 - 013 - 9255 - 2" type="journal article">
Corrigan
<emphasis id="3FF6EAB4FFA1FFA76EF6F8DEFD0B2302" box="[642,693,1873,1897]" italics="true" pageId="4" pageNumber="5">et al</emphasis>
. (2014)
</bibRefCitation>
have shown that an important part of traditional or semiphenetic classifications of lysianassoid amphipods are not supported by molecular phylogenies. Therefore, the validity (and the composition) of the family
<taxonomicName id="CA824D25FFA1FFA76EEEF815FC8223D9" box="[666,828,1945,1970]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="4" pageNumber="5" phylum="Arthropoda" rank="family">Eurytheneidae</taxonomicName>
remains an open question, as indeed for many other lysianassoid families. Future molecular phylogenies involving a larger number of lysianassoid taxa and a higher number of genetic markers will probably help to solve such issues, but for the time being, with limited data at hand, the family
<taxonomicName id="CA824D25FFA0FFA66D62FF30FE0624BE" box="[278,440,188,213]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="family">Eurytheneidae</taxonomicName>
is accepted. The question of its delimitation is another issue to be solved. Should the
<taxonomicName id="CA824D25FFA0FFA66CE3FF53FE872493" box="[151,313,223,248]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="family">Eurytheneidae</taxonomicName>
remain restricted to
<taxonomicName id="CA824D25FFA0FFA66E5CFF6CFD182493" box="[552,678,224,248]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66E5CFF6CFD182493" box="[552,678,224,248]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
</taxonomicName>
as proposed by
<bibRefCitation id="69134B57FFA0FFA66F10FF53FB362493" author="Stoddart" box="[868,1160,223,248]" pageId="5" pageNumber="6" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
or should the family be expanded to include other genera? In a recent multigene phylogenetic study including 15 scavenger lysianassoid taxa,
<bibRefCitation id="69134B57FFA0FFA66CADFEABFE63252B" box="[217,477,295,320]" pageId="5" pageNumber="6" refString="Corrigan, L. J., Horton, T., Fotherby, H., White, T. A. &amp; Hoelzel, A. R. (2014) Adaptative evolution of the deep-sea amphipods from the superfamily Lysiassanoidea [sic] in the North Atlantic. Evolutionary Biology, 41 (1), 154 - 165. http: // dx. doi. org / 10.1007 / s 11692 - 013 - 9255 - 2" type="journal article">
Corrigan
<emphasis id="3FF6EAB4FFA0FFA66D3DFEA5FE38252B" box="[329,390,296,320]" italics="true" pageId="5" pageNumber="6">et al.</emphasis>
(2014)
</bibRefCitation>
have shown that
<taxonomicName id="CA824D25FFA0FFA66EC3FEA4FC8B252B" box="[695,821,296,320]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66EC3FEA4FC8B252B" box="[695,821,296,320]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
</taxonomicName>
forms a clade together with the genera
<taxonomicName id="CA824D25FFA0FFA66968FEA4FA2B252B" box="[1308,1429,296,320]" class="Malacostraca" family="Lysianassidae" genus="Cyclocaris" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66968FEA4FA2B252B" box="[1308,1429,296,320]" italics="true" pageId="5" pageNumber="6">Cyclocaris</emphasis>
</taxonomicName>
,
<taxonomicName id="CA824D25FFA0FFA66CE3FEC0FEAB250F" box="[151,277,332,356]" class="Malacostraca" family="Lysianassidae" genus="Paralicella" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FEC0FEAB250F" box="[151,277,332,356]" italics="true" pageId="5" pageNumber="6">Paralicella</emphasis>
</taxonomicName>
and
<taxonomicName id="CA824D25FFA0FFA66D23FEC0FE77250F" box="[343,457,332,356]" class="Malacostraca" family="Uristidae" genus="Stephonyx" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66D23FEC0FE77250F" box="[343,457,332,356]" italics="true" pageId="5" pageNumber="6">Stephonyx</emphasis>
</taxonomicName>
. While these genera exhibit significant morphological differences, they also share similarities, such as a reduction of coxa 1, which might be synapomorphies. To visualise the differences between these genera and
<taxonomicName id="CA824D25FFA0FFA66D28FE18FE6425C7" box="[348,474,404,428]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66D28FE18FE6425C7" box="[348,474,404,428]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
</taxonomicName>
, see for instance the illustrations of
<taxonomicName id="CA824D25FFA0FFA66F0DFE18FC4D25C7" box="[889,1011,404,428]" class="Malacostraca" family="Lysianassidae" genus="Cyclocaris" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66F0DFE18FC4D25C7" box="[889,1011,404,428]" italics="true" pageId="5" pageNumber="6">Cyclocaris</emphasis>
</taxonomicName>
given by
<bibRefCitation id="69134B57FFA0FFA66811FE18FA9825C7" author="Sars" box="[1125,1318,404,428]" pageId="5" pageNumber="6" refString="Sars, G. O. (1900) Crustacea. In: Nansen, F. (Ed.), The Norwegian North Pole Expedition 1893 - 1896. Scientific Results, 1 (5), pp. 1 - 141, pls. 1 - 36." type="journal article" year="1900">G.O. Sars (1900)</bibRefCitation>
,
<bibRefCitation id="69134B57FFA0FFA66947FE19FEF625BB" author="Lowry" pageId="5" pageNumber="6" refString="Lowry, J. K. &amp; Stoddart, H. E. (2011) The new deep-sea families Cebocaridae fam. nov., Cyclocaridae fam. nov. and Thoriellidae fam. nov. (Crustacea: Amphipoda: Lysianassoidea). Zootaxa, 27, 53 - 68." type="journal article" year="2011">Lowry &amp; Stoddart (2011)</bibRefCitation>
and
<bibRefCitation id="69134B57FFA0FFA66DF7FE34FD0925BB" author="Horton" box="[387,695,439,464]" pageId="5" pageNumber="6" refString="Horton, T. &amp; Thurston, M. H. (2014) A revision of the bathyal and abyssal necrophage genus Cyclocaris Stebbing, 1888 (Crustacea: Amphipoda: Cyclocarididae) with the addition of two new species from the Atlantic Ocean. Zootaxa, 3796 (3), 507 - 527. http: // dx. doi. org / 10.11646 / zootaxa. 3796.3.6" type="journal article" year="2014">Horton &amp; Thurston (2014)</bibRefCitation>
, those of
<taxonomicName id="CA824D25FFA0FFA66F5EFE34FC1625BB" box="[810,936,440,464]" class="Malacostraca" family="Lysianassidae" genus="Paralicella" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66F5EFE34FC1625BB" box="[810,936,440,464]" italics="true" pageId="5" pageNumber="6">Paralicella</emphasis>
</taxonomicName>
by Barnard &amp; Ingram (1990), and those of
<taxonomicName id="CA824D25FFA0FFA66CE3FE50FEB7259F" box="[151,265,476,500]" class="Malacostraca" family="Uristidae" genus="Stephonyx" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FE50FEB7259F" box="[151,265,476,500]" italics="true" pageId="5" pageNumber="6">Stephonyx</emphasis>
</taxonomicName>
by
<bibRefCitation id="69134B57FFA0FFA66D4AFE50FD37259F" author="Diffenthal" box="[318,649,476,501]" pageId="5" pageNumber="6" refString="Diffenthal, M. &amp; Horton, T. (2007) Stephonyx arabiensis (Crustacea: Amphipoda: Lysianassoidea: Uristidae), a new deepwater scavenger species from the Indian Ocean, with a key to the genus Stephonyx. Zootaxa, 1665, 31 - 41." type="journal article" year="2007">Diffenthal &amp; Horton (2007)</bibRefCitation>
,
<bibRefCitation id="69134B57FFA0FFA66EEEFE50FC1C259F" box="[666,930,476,501]" pageId="5" pageNumber="6" refString="Narahara, Y., Tomikawa, K. &amp; Torigoe, K. (2012) Four species of the genus Stephonyx (Crustacea: Amphipoda: Uristidae) from Japan, with description of a new species. Journal of Natural History, 46 (23 - 24), 1477 - 1507. http: // dx. doi. org / 10.1080 / 00222933.2012.675598" type="journal article">
Narahara
<emphasis id="3FF6EAB4FFA0FFA66F79FE51FCF5259F" box="[781,843,476,500]" italics="true" pageId="5" pageNumber="6">et al.</emphasis>
(2012)
</bibRefCitation>
and
<bibRefCitation id="69134B57FFA0FFA66F97FE51FA9E259F" author="Lowry" box="[995,1312,476,501]" pageId="5" pageNumber="6" refString="Lowry, J. K. &amp; Kilgallen, N. M. (2014) A generic review of the lysianassoid family Uristidae and descriptions of new taxa from Australian waters (Crustacea, Amphipoda, Uristidae). Zootaxa, 3867 (1), 1 - 92. http: // dx. doi. org / 10.11646 / zootaxa. 3867.1.1" type="journal article" year="2014">Lowry &amp; Kilgallen (2014)</bibRefCitation>
. If further molecular studies based on a larger number of taxa confirm the existence of a cluster of genera surrounding
<taxonomicName id="CA824D25FFA0FFA66CE3FDA8FEAB2657" box="[151,277,548,572]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FDA8FEAB2657" box="[151,277,548,572]" italics="true" pageId="5" pageNumber="6">Eurythenes</emphasis>
</taxonomicName>
, it would be logical to expand the definition of
<taxonomicName id="CA824D25FFA0FFA66F41FDA8FC692656" box="[821,983,548,573]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="family">Eurytheneidae</taxonomicName>
to include these additional genera. This would imply the relegation of the monotypic family Cyclocarididae
<bibRefCitation id="69134B57FFA0FFA66FA1FDC4FB43260B" author="Lowry" box="[981,1277,583,608]" pageId="5" pageNumber="6" refString="Lowry, J. K. &amp; Stoddart, H. E. (2011) The new deep-sea families Cebocaridae fam. nov., Cyclocaridae fam. nov. and Thoriellidae fam. nov. (Crustacea: Amphipoda: Lysianassoidea). Zootaxa, 27, 53 - 68." type="journal article" year="2011">Lowry &amp; Stoddart, 2011</bibRefCitation>
(
<typeStatus id="D2398804FFA0FFA66967FDC4FAFB260B" box="[1299,1349,584,608]" pageId="5" pageNumber="6">type</typeStatus>
genus:
<taxonomicName id="CA824D25FFA0FFA66CE3FDE0FEAE26EF" box="[151,272,620,644]" class="Malacostraca" family="Lysianassidae" genus="Cyclocaris" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFA0FFA66CE3FDE0FEAE26EF" box="[151,272,620,644]" italics="true" pageId="5" pageNumber="6">Cyclocaris</emphasis>
</taxonomicName>
) to the rank of junior synonym of
<taxonomicName id="CA824D25FFA0FFA66EE7FDE0FBEF26EF" authority="Stoddart &amp; Lowry, 2004" authorityName="Stoddart &amp; Lowry" authorityYear="2004" box="[659,1105,620,645]" class="Malacostraca" family="Eurytheneidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Amphipoda" pageId="5" pageNumber="6" phylum="Arthropoda" rank="family">
Eurytheneidae
<bibRefCitation id="69134B57FFA0FFA66F48FDE0FBEF26EF" author="Stoddart" box="[828,1105,620,645]" pageId="5" pageNumber="6" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
</taxonomicName>
.
</paragraph>
</subSubSection>
</treatment>
</document>

File diff suppressed because one or more lines are too long

View file

@ -0,0 +1,146 @@
<document id="90F25D06878F3DA4D1D9716E6C184F00" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FFADFFAA6CE3FB78FA2224A1" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Eurythenes" docType="key" docVersion="8" lastPageNumber="10" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="9" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="0348BD7D24D52EAD6874DCC97664BC6B" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="376B386249D46BB2C2CA528D2ABFCD91">
<mods:title id="5C67E31901BAA26A92191D3806003B27">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="76C4096E4345FD43CBBCA954B9D75B28" type="personal">
<mods:role id="23C551B4757A1E3C8965E00F73B59AFB">
<mods:roleTerm id="08C7E590A1DF34B46963B077FF695F0F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="C85E08EA3EF83B4DF93724E061DCB645">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="222A928D5B051F65F410D022F97907C0" type="personal">
<mods:role id="D580CC6D34308FC705E154C98B2661D9">
<mods:roleTerm id="FA5B5BAAF8AD7495532E4663E3DB5964">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="C737F2B47E8A9E8E3CD8AB86E03F7881">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="25C7BA36401A1034B663F532BCDB1495">text</mods:typeOfResource>
<mods:relatedItem id="0BA98F9ECF435F730C9756B18AC00342" type="host">
<mods:titleInfo id="478C72783F2812C32970071E85BB0E60">
<mods:title id="5666BBEBB8E088F739B61C22D2743760">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="DFAB06028D38EF2E17C05BA4DC05D28F">
<mods:date id="AAAFFAA59AC1048B0630987221F6432A">2015</mods:date>
<mods:detail id="3A9F9C61CC9EEFB614ACEC20C8ABA935" type="volume">
<mods:number id="C1B0FD61CBC33652FFE666A2A79D2287">3971</mods:number>
</mods:detail>
<mods:detail id="C77AC33AB9B6FAD27D769A67E2055880" type="issue">
<mods:number id="B1AA486EF0F30170AB51C1EA4FC0F44C">1</mods:number>
</mods:detail>
<mods:extent id="5964A6C6547EA121C9F11A0A1D9A3BCA" unit="page">
<mods:start id="FB1877E4AD57B1D57F6472A5154B894E">1</mods:start>
<mods:end id="199BA3B3F1CABD55A0E4E532EEC588F6">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="60C3269417D2348EE7AC176AE5AE263F">journal article</mods:classification>
<mods:identifier id="2EE0536841112F2705206E2C8F25DD0A" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="2FCAB7E2A40F479B41991B3F9519B14D" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="5F5D73B293C07A503044FE8E8DE96910" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="DCA185806B898A4B0A05E9FBA00DC482" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="31F84ACBF3345286F03DF50602EE583A" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FFADFFAA6CE3FB78FA2224A1" ID-DOI="http://doi.org/10.5281/zenodo.5470180" ID-GBIF-Taxon="127691970" ID-Zenodo-Dep="5470180" LSID="urn:lsid:plazi:treatment:852B87B0FFADFFAA6CE3FB78FA2224A1" httpUri="http://treatment.plazi.org/id/852B87B0FFADFFAA6CE3FB78FA2224A1" lastPageId="9" lastPageNumber="10" pageId="8" pageNumber="9">
<subSubSection id="4598652DFFADFFAB6CE3FB78FD4D21F0" pageId="8" pageNumber="9" type="nomenclature">
<paragraph id="0D3D36A6FFADFFAB6CE3FB78FD4C2165" blockId="8.[151,754,1268,1294]" box="[151,754,1268,1294]" pageId="8" pageNumber="9">
<heading id="567581CAFFADFFAB6CE3FB78FD4C2165" bold="true" box="[151,754,1268,1294]" fontSize="11" level="1" pageId="8" pageNumber="9" reason="1">
<emphasis id="3FF6EAB4FFADFFAB6CE3FB78FD4C2165" bold="true" box="[151,754,1268,1294]" pageId="8" pageNumber="9">
Key to
<taxonomicName id="CA824D25FFADFFAB6C84FB78FEC42165" box="[240,378,1268,1294]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFADFFAB6C84FB78FEC42165" bold="true" box="[240,378,1268,1294]" italics="true" pageId="8" pageNumber="9">Eurythenes</emphasis>
</taxonomicName>
specimens larger than
<quantity id="CA7A9B43FFADFFAB6EE9FB78FD4C2165" box="[669,754,1268,1294]" metricMagnitude="-2" metricUnit="m" metricValue="2.5" pageId="8" pageNumber="9" unit="mm" value="25.0">25 mm</quantity>
</emphasis>
</heading>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FAB6FD4D21F0" blockId="8.[151,1436,1338,1435]" pageId="8" pageNumber="9">This key should be used with caution, for three reasons: (1) some characters are hard to observe, (2) material examined was limited and (3) the analysis of DNA sequences of specimens not examined morphologically strongly suggests the existence of further, undescribed species.</paragraph>
</subSubSection>
<subSubSection id="4598652DFFADFFAA6CE3FA45FA2224A1" lastPageId="9" lastPageNumber="10" pageId="8" pageNumber="9" type="key">
<keyStep id="B6762E03FFADFFAB6CE3FA45FA222196" pageId="8" pageNumber="9">
<paragraph id="0D3D36A6FFADFFAB6CE3FA45FA2521B4" blockId="8.[151,1436,1481,2032]" box="[151,1435,1481,1503]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3FA45FA2521B4" box="[151,1435,1481,1503]" pageId="8" pageNumber="9">1. Dactylus of pereopods 37 short (less than 0.3 of propodus).................................................... 2</keyLead>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3FA6BFA222196" blockId="8.[151,1436,1481,2032]" box="[151,1436,1511,1533]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3FA6BFA222196" box="[151,1436,1511,1533]" pageId="8" pageNumber="9">
- Dactylus of pereopods 37 long (more than 0.6 of propodus)............................................
<taxonomicName id="CA824D25FFADFFAB6934FA64FA222196" box="[1344,1436,1511,1533]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="obesus">
<emphasis id="3FF6EAB4FFADFFAB6934FA64FA222196" box="[1344,1436,1511,1533]" italics="true" pageId="8" pageNumber="9">E. obesus</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
</keyStep>
<keyStep id="B6762E03FFADFFAB6CE3F988FA2222C6" pageId="8" pageNumber="9">
<paragraph id="0D3D36A6FFADFFAB6CE3F988FA25223E" blockId="8.[151,1436,1481,2032]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F988FA25223E" pageId="8" pageNumber="9">2. Anterodorsal margin of head not forming an upturned ridge; palm of gnathopod 2 not or weakly protruding; junction between ventral and posteroventral border of coxa 4 distinct; posterodistal lobe of basis of pereopod 7 short or fairly short; pleonite 3 notched dorsally...................................................................................... 3</keyLead>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3F9D1FA2222C6" blockId="8.[151,1436,1481,2032]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F9D1FA2222C6" pageId="8" pageNumber="9">
- Anterodorsal margin of head forming an upturned ridge; palm of gnathopod 2 very protruding; junction between ventral and posteroventral border of coxa 4 indistinct; posterodistal lobe of basis of pereopod 7 very long; pleonite 3 not notched dorsally, showing only a scarcely distinct concavity........................................................
<taxonomicName id="CA824D25FFADFFAB695FF914FA2222C6" box="[1323,1436,1687,1709]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFADFFAB695FF914FA2222C6" box="[1323,1436,1687,1709]" italics="true" pageId="8" pageNumber="9">E. thurstoni</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
</keyStep>
<keyStep id="B6762E03FFADFFAB6CE3F938FA22228C" pageId="8" pageNumber="9">
<paragraph id="0D3D36A6FFADFFAB6CE3F938FA2522A1" blockId="8.[151,1436,1481,2032]" box="[151,1435,1716,1738]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F938FA2522A1" box="[151,1435,1716,1738]" pageId="8" pageNumber="9">3. Coxa 2 ventrally broad and weakly curved................................................................. 4</keyLead>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3F95EFA22228C" blockId="8.[151,1436,1481,2032]" box="[151,1436,1745,1767]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F95EFA22228C" box="[151,1436,1745,1767]" pageId="8" pageNumber="9">
- Coxa 2 ventrally narrow and strongly curved.......................................................
<taxonomicName id="CA824D25FFADFFAB6953F95EFA22228C" box="[1319,1436,1745,1767]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="maldoror">
<emphasis id="3FF6EAB4FFADFFAB6953F95EFA22228C" box="[1319,1436,1745,1767]" italics="true" pageId="8" pageNumber="9">E. maldoror</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
</keyStep>
<keyStep id="B6762E03FFADFFAB6CE3F963FA222354" pageId="8" pageNumber="9">
<paragraph id="0D3D36A6FFADFFAB6CE3F963FA252349" blockId="8.[151,1436,1481,2032]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F963FA252349" pageId="8" pageNumber="9">4. Pereonites 67 and pleonites 13 not keeled to slightly keeled; pereonites 67 and pleonite 12 dorsally not sigmoid (without anterior concavity), pleonite 3 with distinct anterior concavity.................................................. 5</keyLead>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3F8A6FA222354" blockId="8.[151,1436,1481,2032]" box="[151,1436,1833,1855]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F8A6FA222354" box="[151,1436,1833,1855]" pageId="8" pageNumber="9">
- Pereonites 67 and pleonites 13 strongly keeled and sigmoid (anteriorly slightly to distinctly concave).......
<taxonomicName id="CA824D25FFADFFAB6969F8A6FA222354" box="[1309,1436,1833,1855]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="sigmiferus">
<emphasis id="3FF6EAB4FFADFFAB6969F8A6FA222354" box="[1309,1436,1833,1855]" italics="true" pageId="8" pageNumber="9">E. sigmiferus</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
</keyStep>
<keyStep id="B6762E03FFADFFAB6CE3F8CBFA2223DE" pageId="8" pageNumber="9">
<paragraph id="0D3D36A6FFADFFAB6CE3F8CBFA252311" blockId="8.[151,1436,1481,2032]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F8CBFA252311" pageId="8" pageNumber="9">5. Anterior lobe of head protruding; lower lobe of eye rounded and pointing obliquely backwards; inner plate of maxilliped with 3 to 6 nodular spines.................................................................................. 6</keyLead>
</paragraph>
<paragraph id="0D3D36A6FFADFFAB6CE3F80EFA2223DE" blockId="8.[151,1436,1481,2032]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F80EFA2223DE" pageId="8" pageNumber="9">
- Anterior lobe of head not protruding; lower lobe of eye acute and pointing downwards; inner plate of maxilliped with 3 (sometimes 4 on one side) nodular spines................................................................
<taxonomicName id="CA824D25FFADFFAB694AF82CFA2223DE" box="[1342,1436,1951,1973]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFADFFAB694AF82CFA2223DE" box="[1342,1436,1951,1973]" italics="true" pageId="8" pageNumber="9">E. gryllus</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
</keyStep>
<keyStep id="B6762E03FFADFFAA6CE3F830FA2224A1" lastPageId="9" lastPageNumber="10" pageId="8" pageNumber="9">
<paragraph id="0D3D36A6FFADFFAB6CE3F830FA25239B" blockId="8.[151,1436,1481,2032]" pageId="8" pageNumber="9">
<keyLead id="B6739593FFADFFAB6CE3F830FA25239B" pageId="8" pageNumber="9">
6. Maxilliped with 3 non-protruding nodular spines; pereopod 7 with basis posteriorly strongly expanded, with merus narrow...........................................................................................
<taxonomicName id="CA824D25FFADFFAB697AF857FA25239B" box="[1294,1435,2010,2032]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="andhakarae">
<emphasis id="3FF6EAB4FFADFFAB697AF857FA25239B" box="[1294,1435,2010,2032]" italics="true" pageId="8" pageNumber="9">E. andhakarae</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
<paragraph id="0D3D36A6FFACFFAA6CE3FF1BFA2224A1" blockId="9.[151,1436,151,202]" pageId="9" pageNumber="10">
<keyLead id="B6739593FFACFFAA6CE3FF1BFA2224A1" pageId="9" pageNumber="10">
- Maxilliped with 46 protruding nodular spines; pereopod 7 with basis posteriorly not strongly expanded, with merus rather stout....................................................................................
<taxonomicName id="CA824D25FFACFFAA6975FF39FA2224A1" box="[1281,1436,180,202]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="9" pageNumber="10" phylum="Arthropoda" rank="species" species="magellanicus">
<emphasis id="3FF6EAB4FFACFFAA6975FF39FA2224A1" box="[1281,1436,180,202]" italics="true" pageId="9" pageNumber="10">E. magellanicus</emphasis>
</taxonomicName>
</keyLead>
</paragraph>
</keyStep>
</subSubSection>
</treatment>
</document>

File diff suppressed because one or more lines are too long

View file

@ -0,0 +1,533 @@
<document id="6672086CAC84F3014A378C4631FB6687" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FFE7FFEA6CE3FF1BFBD42033" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Eurythenes sigmiferus DAcoz &amp; Havermans, 2015, sp. nov." docType="treatment" docVersion="8" lastPageNumber="74" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="67" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="96EF800666E0896A0946F6443F81C26C" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="6938D0727642B5EA4BDF5109BED15B86">
<mods:title id="E1D5E5E320E752ED4BC3E57595597751">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="005AC20B969C17D079481F85FBBB3B31" type="personal">
<mods:role id="327C759E0F6C0C358FF88FA65DBF98D7">
<mods:roleTerm id="356B86237702D6D3EF655C44C724CAB7">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="63097D8853636910266815257DAE82F6">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="B3F7EB0BF30FBCC25E62C83A59FD274D" type="personal">
<mods:role id="3296AF5EB3AFD5CBBB39AE084A1874C2">
<mods:roleTerm id="367408395FD6FD94D438C1CA29B5AE48">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="82BC719B37923A8120F81FE6C5A60989">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="4DA71D7934B859DF94F8137070FE6581">text</mods:typeOfResource>
<mods:relatedItem id="4A0C74B381367EF9ABA151B10BC876B2" type="host">
<mods:titleInfo id="0778CE6FE2D90E4ED5C4010EBC6D7CF7">
<mods:title id="60834D391545F80490D7CEB4E6204768">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="3A3E9B94A820D9286F8284E117EBC2B8">
<mods:date id="8AF013DAFC982759024649BDC93A8F04">2015</mods:date>
<mods:detail id="7982B9826AD29ED0DE3EED14B9F7220D" type="volume">
<mods:number id="6A4D4C476CF57702F74D7161B59BCB39">3971</mods:number>
</mods:detail>
<mods:detail id="F92DA7B2EABD764A22444AFC49C286ED" type="issue">
<mods:number id="3409940365EBD942DAC5A666BA26EF09">1</mods:number>
</mods:detail>
<mods:extent id="E4322795D4F426CE57EC64F41D18BEAD" unit="page">
<mods:start id="584EDA0E6EB77601920F655B14CE4F7B">1</mods:start>
<mods:end id="EBAC751A872A5F4F1B1A1BE30B242F00">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="7B352079E243CEBF924C74422EA76B12">journal article</mods:classification>
<mods:identifier id="1366E1908F9231130B71755CB1067C2A" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="65ED08DE763A020CF8CA256FF041C514" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="00E631F03660964C0640BB6E4536778A" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="D4DAACBCEA2A177DDBA840842B5A4D83" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="51E161879DDA0DB1EB18630F56C6EF56" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FFE7FFEA6CE3FF1BFBD42033" ID-DOI="http://doi.org/10.5281/zenodo.5470192" ID-GBIF-Taxon="127691973" ID-Zenodo-Dep="5470192" LSID="urn:lsid:plazi:treatment:852B87B0FFE7FFEA6CE3FF1BFBD42033" httpUri="http://treatment.plazi.org/id/852B87B0FFE7FFEA6CE3FF1BFBD42033" lastPageId="73" lastPageNumber="74" pageId="66" pageNumber="67">
<subSubSection id="4598652DFFE7FFE16CE3FF1BFE9924B8" pageId="66" pageNumber="67" type="nomenclature">
<paragraph id="0D3D36A6FFE7FFE16CE3FF1BFDB224D9" blockId="66.[151,524,151,211]" box="[151,524,151,178]" pageId="66" pageNumber="67">
<heading id="567581CAFFE7FFE16CE3FF1BFDB224D9" bold="true" box="[151,524,151,178]" fontSize="11" level="1" pageId="66" pageNumber="67" reason="1">
<emphasis id="3FF6EAB4FFE7FFE16CE3FF1BFDB224D9" bold="true" box="[151,524,151,178]" pageId="66" pageNumber="67">
<taxonomicName id="CA824D25FFE7FFE16CE3FF1BFE1624DA" box="[151,424,151,177]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="66" pageNumber="67" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE7FFE16CE3FF1BFE1624DA" bold="true" box="[151,424,151,177]" italics="true" pageId="66" pageNumber="67">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE7FFE16DDBFF14FDB224D9" box="[431,524,152,178]" pageId="66" pageNumber="67" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CE3FF36FE9924B8" blockId="66.[151,524,151,211]" box="[151,295,186,211]" pageId="66" pageNumber="67">
(
<figureCitation id="95B92A23FFE7FFE16CEBFF36FF4D24B8" box="[159,243,186,211]" captionStart="FIGURE 47" captionStartId="67.[151,250,1953,1975]" captionTargetBox="[216,1370,193,1931]" captionTargetId="figure@67.[216,1370,193,1932]" captionTargetPageId="67" captionText="FIGURE 47. Eurythenes sigmiferus n. sp., holotype, presumably female, 53 mm, RV Meteor, DIVA 3, ME 79 - 1, sta. 542, 26 ° 33 ' 21 &quot; S 35 ° 11 ' 29 &quot; W, 4480 m, ZMH K 44286. Habitus." httpUri="https://zenodo.org/record/288863/files/figure.png" pageId="66" pageNumber="67">Figs 47</figureCitation>
52)
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE7FFE16CE3FE8EFC29253D" pageId="66" pageNumber="67" type="reference_group">
<paragraph id="0D3D36A6FFE7FFE16CE3FE8EFC24255C" blockId="66.[151,1436,258,342]" pageId="66" pageNumber="67">
<treatmentCitationGroup id="2D921188FFE7FFE16CE3FE8EFC24255C" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CE3FE8EFECA2573" box="[151,372,258,280]" italics="true" pageId="66" pageNumber="67">
<taxonomicName id="CA824D25FFE7FFE16CE3FE8EFEE82573" box="[151,342,258,280]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="66" pageNumber="67" phylum="Arthropoda" rank="species" species="gryllus">Eurythenes gryllus</taxonomicName>
.—
</emphasis>
?
<treatmentCitation id="8C2310B7FFE7FFE16DF2FE8EFDFC2573" author="Barnard" box="[390,578,258,280]" page="35" pageId="66" pageNumber="67" year="1961">
<bibRefCitation id="69134B57FFE7FFE16DF2FE8EFDA22573" author="Barnard" box="[390,540,258,280]" pageId="66" pageNumber="67" refString="Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128." type="journal article" year="1961">Barnard, 1961</bibRefCitation>
: 35
</treatmentCitation>
, in part, fig. 5.—?
<treatmentCitation id="8C2310B7FFE7FFE16F7DFE8FFBE42573" author="Bowman" box="[777,1114,258,280]" page="193" pageId="66" pageNumber="67" year="1972">
<bibRefCitation id="69134B57FFE7FFE16F7DFE8FFB992573" author="Bowman" box="[777,1063,258,280]" pageId="66" pageNumber="67" refString="Bowman, T. E. &amp; Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1." type="journal article" year="1972">Bowman &amp; Manning, 1972</bibRefCitation>
: 193
</treatmentCitation>
, figs. 25, in part (
<collectingCountry id="75957636FFE7FFE16954FE8EFA222573" box="[1312,1436,258,280]" name="Guadeloupe" pageId="66" pageNumber="67">Guadeloupe</collectingCountry>
and Andros material only).—
<treatmentCitation id="8C2310B7FFE7FFE16D98FEADFCF9255C" author="Escobar-Briones" box="[492,839,289,311]" page="177" pageId="66" pageNumber="67" year="2010">
<bibRefCitation id="69134B57FFE7FFE16D98FEADFCA8255C" author="Escobar-Briones" box="[492,790,289,311]" pageId="66" pageNumber="67" refString="Escobar-Briones, E., Najera-Hillman, E. &amp; &amp; Alvarez, F. (2010) Unique 16 S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain. Revista Mexicana de Biodiversidad, 81, S 177 - S 185." type="journal article" year="2010">
Escobar-Briones
<emphasis id="3FF6EAB4FFE7FFE16EEBFEAEFD72255C" box="[671,716,289,311]" italics="true" pageId="66" pageNumber="67">et al</emphasis>
., 2010
</bibRefCitation>
: 177
</treatmentCitation>
, in part.
</treatmentCitationGroup>
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CE3FECCFC29253D" blockId="66.[151,1436,258,342]" box="[151,919,320,342]" pageId="66" pageNumber="67">
<treatmentCitationGroup id="2D921188FFE7FFE16CE3FECCFC29253D" box="[151,919,320,342]" pageId="66" pageNumber="67">
<taxonomicName id="CA824D25FFE7FFE16CE3FECCFEEB253D" box="[151,341,320,342]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="66" pageNumber="67" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFE7FFE16CE3FECCFEEB253D" box="[151,341,320,342]" italics="true" pageId="66" pageNumber="67">Eurythenes gryllus</emphasis>
</taxonomicName>
clade Eg6.—
<treatmentCitation id="8C2310B7FFE7FFE16DA8FECCFD4D253D" author="Havermans" box="[476,755,320,342]" page="12" pageId="66" pageNumber="67" year="2013">
<bibRefCitation id="69134B57FFE7FFE16DA8FECCFD71253D" author="Havermans" box="[476,719,320,342]" pageId="66" pageNumber="67" refString="Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. &amp; Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218" type="journal article" year="2013">
Havermans
<emphasis id="3FF6EAB4FFE7FFE16E2DFECDFD33253D" box="[601,653,320,342]" italics="true" pageId="66" pageNumber="67">et al.</emphasis>
, 2013
</bibRefCitation>
: 12
</treatmentCitation>
13, fig. 5 (1A).
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE7FFE16CE3FE0EFAB527F9" pageId="66" pageNumber="67" type="materials_examined">
<paragraph id="0D3D36A6FFE7FFE16CE3FE0EFC672588" blockId="66.[151,1436,386,519]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CE3FE0EFD9325F0" bold="true" box="[151,557,386,411]" pageId="66" pageNumber="67">
Material examined.
<typeStatus id="D2398804FFE7FFE16DF3FE0EFD9625F0" box="[391,552,386,411]" pageId="66" pageNumber="67" type="holotype">HOLOTYPE</typeStatus>
.
</emphasis>
RV Meteor, expedition
<collectionCode id="6B93AE63FFE7FFE16F48FE0FFCC025F0" box="[828,894,387,411]" pageId="66" pageNumber="67">DIVA</collectionCode>
3, ME 79-1, sta. 542,
<geoCoordinate id="68B65061FFE7FFE1680EFE0EFB4725F0" box="[1146,1273,386,411]" direction="south" orientation="latitude" pageId="66" pageNumber="67" precision="15" value="-26.555832">26°33'21&quot;S</geoCoordinate>
<geoCoordinate id="68B65061FFE7FFE16975FE0EFA2625F0" box="[1281,1432,386,411]" direction="west" orientation="longitude" pageId="66" pageNumber="67" precision="15" value="-35.19139">035°11'29&quot;W</geoCoordinate>
,
<quantity id="CA7A9B43FFE7FFE16CE3FE2BFF4C25D5" box="[151,242,423,447]" metricMagnitude="3" metricUnit="m" metricValue="4.4799999999999995" pageId="66" pageNumber="67" unit="m" value="4480.0">4480 m</quantity>
, baited trap,
<date id="793C1066FFE7FFE16DFBFE2AFDAC25D4" box="[399,530,422,447]" pageId="66" pageNumber="67" value="2009-07-21">21.vii.2009</date>
:
<specimenCount id="1B84FD2FFFE7FFE16E56FE2BFD1625D4" box="[546,680,422,447]" pageId="66" pageNumber="67" type="generic">1 specimen</specimenCount>
,
<quantity id="CA7A9B43FFE7FFE16EC3FE2AFCB225D5" box="[695,780,422,447]" metricMagnitude="-2" metricUnit="m" metricValue="5.3" pageId="66" pageNumber="67" unit="mm" value="53.0">53 mm</quantity>
, fixed first 96% denatured ethanol, coll. Ed Hendrycks, DZMB-HH 7991,
<collectionCode id="6B93AE63FFE7FFE16D12FE47FE1A2589" box="[358,420,459,482]" httpUri="http://grbio.org/cool/kdnf-0379" name="Zoologisches Museum Hamburg" pageId="66" pageNumber="67">ZMH</collectionCode>
<accessionNumber id="12D1AB45FFE7FFE16DD8FE47FDAF2588" box="[428,529,458,483]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="66" pageNumber="67" type="EnaNcbi">K 44286</accessionNumber>
; BraB-8, EG-2101108,
<accessionNumber id="12D1AB45FFE7FFE16F6EFE47FC332588" box="[794,909,459,483]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887070" pageId="66" pageNumber="67">JX887070</accessionNumber>
(16S).
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FE62FC2D266C" blockId="66.[151,1436,386,519]" box="[199,915,494,519]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FE62FE4D266C" bold="true" box="[199,499,494,519]" pageId="66" pageNumber="67">
Voucher
<collectionCode id="6B93AE63FFE7FFE16D46FE62FED1266C" LSID="urn:lsid:biocol.org:col:15536" box="[306,367,494,519]" httpUri="http://biocol.org/urn:lsid:biocol.org:col:15536" name="Department of Natural Resources, Environment, The Arts and Sport" pageId="66" pageNumber="67">DNA</collectionCode>
sequences.
</emphasis>
<typeStatus id="D2398804FFE7FFE16D8EFE63FD2F266C" box="[506,657,495,519]" pageId="66" pageNumber="67" type="holotype">HOLOTYPE</typeStatus>
, BraB-8, EG-2101108.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CE3FDBAFE632624" blockId="66.[151,1435,566,843]" box="[151,477,566,591]" pageId="66" pageNumber="67">
16S (GenBANK
<accessionNumber id="12D1AB45FFE7FFE16D2CFDBBFE6E2624" box="[344,464,567,591]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/JX887070" pageId="66" pageNumber="67">JX887070</accessionNumber>
):
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CE3FDD7FA3E2720" blockId="66.[151,1435,566,843]" box="[151,1435,603,843]" pageId="66" pageNumber="67">TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGGGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTATAATAAGGGTAAAAATACTTTGGTGTGATTAAGGGACGACAAGACCCTA AAAGCTTTATTTTTAATATGAGTTTGAGTTTAAAATAAAACAGAAAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAAAAGGCATATAAAATGGAGTTAGGTTCTTTAGATAAGGATAATTTGAGTGAG TTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCTCGATG TTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACGGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FCF6FAB527F9" blockId="66.[151,1437,890,1982]" box="[199,1291,890,915]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FCF6FEDB27F8" bold="true" box="[199,357,890,915]" pageId="66" pageNumber="67">
<typeStatus id="D2398804FFE7FFE16CB3FCF6FEBC27F8" box="[199,258,890,915]" pageId="66" pageNumber="67">Type</typeStatus>
locality.
</emphasis>
Southwestern Atlantic, off
<collectingCountry id="75957636FFE7FFE16EEFFCF6FD5C27F8" box="[667,738,890,915]" name="Brazil" pageId="66" pageNumber="67">Brazil</collectingCountry>
,
<collectingCountry id="75957636FFE7FFE16E99FCF6FC8F27F8" box="[749,817,890,915]" name="Brazil" pageId="66" pageNumber="67">Brazil</collectingCountry>
Basin,
<geoCoordinate id="68B65061FFE7FFE16FF3FCF6FBB827F8" box="[903,1030,890,915]" direction="south" orientation="latitude" pageId="66" pageNumber="67" precision="15" value="-26.555832">26°33'21&quot;S</geoCoordinate>
<geoCoordinate id="68B65061FFE7FFE16879FCF6FB1A27F8" box="[1037,1188,890,915]" direction="west" orientation="longitude" pageId="66" pageNumber="67" precision="15" value="-35.19139">035°11'29&quot;W</geoCoordinate>
,
<quantity id="CA7A9B43FFE7FFE168DBFCF7FAB927F9" box="[1199,1287,891,915]" metricMagnitude="3" metricUnit="m" metricValue="4.4799999999999995" pageId="66" pageNumber="67" unit="m" value="4480.0">4480 m</quantity>
.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE7FFE16CB3FC10FD5D279C" pageId="66" pageNumber="67" type="etymology">
<paragraph id="0D3D36A6FFE7FFE16CB3FC10FD5D279C" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FC10FEF027DE" bold="true" box="[199,334,924,949]" pageId="66" pageNumber="67">Etymology.</emphasis>
<taxonomicName id="CA824D25FFE7FFE16D23FC10FE7127DF" box="[343,463,924,948]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="66" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE7FFE16D23FC10FE7127DF" box="[343,463,924,948]" italics="true" pageId="66" pageNumber="67">Sigmiferus</emphasis>
</taxonomicName>
, -
<emphasis id="3FF6EAB4FFE7FFE16D9CFC11FE4827DF" box="[488,502,925,948]" italics="true" pageId="66" pageNumber="67">a</emphasis>
, -
<emphasis id="3FF6EAB4FFE7FFE16E64FC11FD8C27DF" box="[528,562,925,948]" italics="true" pageId="66" pageNumber="67">um</emphasis>
, adjective created in combining
<taxonomicName id="CA824D25FFE7FFE16FD8FC10FC4C27D8" box="[940,1010,924,947]" class="Bacillariophyceae" genus="Sigma" higherTaxonomySource="GBIF" kingdom="Plantae" pageId="66" pageNumber="67" phylum="Bacillariophyta" rank="genus">
<emphasis id="3FF6EAB4FFE7FFE16FD8FC10FC4C27D8" box="[940,1010,924,947]" italics="true" pageId="66" pageNumber="67">Sigma</emphasis>
</taxonomicName>
, which is the eighteenth letter of the Greek alphabet, and the suffix -
<emphasis id="3FF6EAB4FFE7FFE16D8CFC31FD8E27BE" box="[504,560,957,981]" italics="true" pageId="66" pageNumber="67">ferus</emphasis>
, which means bearing. The name alludes to the dorsal sigmoid profile of most segments of the pereon and pleosome of the species.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFE7FFEA6CB3FC73FE3F250E" lastPageId="73" lastPageNumber="74" pageId="66" pageNumber="67" type="description">
<paragraph id="0D3D36A6FFE7FFE16CB3FC73FD442073" blockId="66.[151,1437,890,1982]" box="[199,762,1023,1048]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FC73FEE72073" bold="true" box="[199,345,1023,1048]" pageId="66" pageNumber="67">Description.</emphasis>
<typeStatus id="D2398804FFE7FFE16D2BFC73FE742073" box="[351,458,1023,1048]" pageId="66" pageNumber="67" type="holotype">Holotype</typeStatus>
,
<quantity id="CA7A9B43FFE7FFE16DA1FC73FD98207C" box="[469,550,1023,1048]" metricMagnitude="-2" metricUnit="m" metricValue="5.3" pageId="66" pageNumber="67" unit="mm" value="53.0">53 mm</quantity>
, presumed female.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FBADFE892017" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FBADFEBF2052" box="[199,257,1057,1081]" italics="true" pageId="66" pageNumber="67">Body</emphasis>
: pereonites 27 and pleosomites 13 posteriorly carinate; the most carinate body segment, i.e. pereonites 67 and pleosomites 13 have a sigmoid profile: they present a slight anterior concavity (which is deeper in pleosomite 3).
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FB09FA2E20F5" blockId="66.[151,1437,890,1982]" box="[199,1424,1157,1182]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FB09FEBA20F6" box="[199,260,1157,1181]" italics="true" pageId="66" pageNumber="67">Head</emphasis>
: anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FB2AFB9320D4" blockId="66.[151,1437,890,1982]" box="[199,1069,1190,1215]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FB2AFE8C20D5" box="[199,306,1190,1214]" italics="true" pageId="66" pageNumber="67">Mandible</emphasis>
: article 2 of palp posteriorly not expanded and distally not tapering.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FB44FBE7208B" blockId="66.[151,1437,890,1982]" box="[199,1113,1223,1248]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FB44FEFE208B" box="[199,320,1224,1248]" italics="true" pageId="66" pageNumber="67">Maxilliped</emphasis>
: Inner plate with 910 nodular spines, which are distinctly protruding.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FB65FEB92148" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FB65FEE1216A" box="[199,351,1257,1281]" italics="true" pageId="66" pageNumber="67">Gnathopod 1</emphasis>
: coxa straight anteriorly; basis broad, 2.9 x as long as wide; palm well developed, weakly produced.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FAA0FC70210D" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FAA0FEE3212F" box="[199,349,1324,1348]" italics="true" pageId="66" pageNumber="67">Gnathopod 2</emphasis>
: coxa broad and weakly curved ventrally; propodus stout, expanded distally, 2.4 x as long as wide, palm distinctly curved and intrusively oblique, defined by 4 spines.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FAE2FE4A21CC" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FAE2FEF921EC" box="[199,327,1390,1415]" italics="true" pageId="66" pageNumber="67">Pereopod 3</emphasis>
: Coxa rather narrow, 1.9 x as deep as wide; basis stout, 3.1 x as long as wide; propodus stout, 4.5 x as long as wide; dactylus stout.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3FA3DFD892267" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3FA3DFEF921A2" box="[199,327,1457,1481]" italics="true" pageId="66" pageNumber="67">Pereopod 4</emphasis>
: coxa fairly broad, 1.1 x as deep as wide; junction between anterior and ventral border rounded but well distinct; ventral border nearly straight; posteroventral border with inconspicuous concavity, scarcely oblique; leg almost identical with pereopod 3.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3F999FE432204" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3F999FEF92246" box="[199,327,1557,1581]" italics="true" pageId="66" pageNumber="67">Pereopod 5</emphasis>
: basis with posterior border slightly crenulated; merus of normal width, 1.8 x as long as wide, with posterior border forming a regular curve; propodus rather stout, 5.6 x as long as wide, with 9 groups of spines anteriorly; dactylus rather stout.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3F9F5FB8822F9" blockId="66.[151,1437,890,1982]" box="[199,1078,1657,1682]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3F9F5FEF622FA" box="[199,328,1657,1681]" italics="true" pageId="66" pageNumber="67">Pereopod 6</emphasis>
: missing in the only specimen available (used for the DNA study).
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3F917FDF4235C" blockId="66.[151,1437,890,1982]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3F917FEF422D9" box="[199,330,1691,1715]" italics="true" pageId="66" pageNumber="67">Pereopod 7</emphasis>
: basis stout, with posterior border expanded normally, with posterior border strongly crenulated, with ornamentation of anterior border normal, 1.5 x as long as wide, with posterodistal corner of lobe a bit produced and bluntly angular, ratio length of lobe of basis / total length of basis = 0.21; merus stout, 1.6 x as long as wide, with posterior border forming a regular curve; propodus stout, 5.3 x as long as wide, with 9 groups of spines anteriorly; dactylus rather stout.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3F8CEFC792331" blockId="66.[151,1437,890,1982]" box="[199,967,1857,1882]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3F8CEFEF72332" box="[199,329,1857,1881]" italics="true" pageId="66" pageNumber="67">Epimeron 3</emphasis>
: weakly rounded ventrally, without posteroventral tooth.
</paragraph>
<paragraph id="0D3D36A6FFE7FFE16CB3F8EFFBBB2310" blockId="66.[151,1437,890,1982]" box="[199,1029,1890,1915]" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3F8EFFE8C2310" box="[199,306,1891,1915]" italics="true" pageId="66" pageNumber="67">Uropod 3</emphasis>
: spines of distolateral angle of peduncle rather long and slender.
</paragraph>
<paragraph id="0D3D36A6FFE7FFEA6CB3F808FE3724BF" blockId="66.[151,1437,890,1982]" lastBlockId="73.[151,1437,151,1112]" lastPageId="73" lastPageNumber="74" pageId="66" pageNumber="67">
<emphasis id="3FF6EAB4FFE7FFE16CB3F808FE3F23F6" bold="true" box="[199,385,1924,1949]" pageId="66" pageNumber="67">Colour pattern.</emphasis>
Colour of
<typeStatus id="D2398804FFE7FFE16D8DF808FDE523F6" box="[505,603,1924,1949]" pageId="66" pageNumber="67" type="holotype">holotype</typeStatus>
unrecorded. Photographs previously uploaded on the WWW of specimens possibly belonging to
<taxonomicName id="CA824D25FFE7FFE16DD0F82AFD8623D6" box="[420,568,1957,1981]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="66" pageNumber="67" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE7FFE16DD0F82AFD8623D6" box="[420,568,1957,1981]" italics="true" pageId="66" pageNumber="67">E. sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE7FFE16E31F829FD2123D5" box="[581,671,1957,1982]" pageId="66" pageNumber="67" rank="species">
<emphasis id="3FF6EAB4FFE7FFE16E31F829FD2123D5" bold="true" box="[581,671,1957,1982]" pageId="66" pageNumber="67">sp. nov.</emphasis>
</taxonomicNameLabel>
(crested
<taxonomicName id="CA824D25FFE7FFE16F60F829FC2C23D6" box="[788,914,1957,1981]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="66" pageNumber="67" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFE7FFE16F60F829FC2C23D6" box="[788,914,1957,1981]" italics="true" pageId="66" pageNumber="67">Eurythenes</emphasis>
</taxonomicName>
) show completely white animals with pale yellowish eyes; e.g. ECOMARE Cruise diary,
<date id="793C1066FFECFFEA6EB0FF1BFC3324DB" box="[708,909,151,176]" pageId="73" pageNumber="74" value="2007-08-07">7th August 2007</date>
, http://www.oceanlab.abdn.ac.uk/blog/?p=244 [accessed
<date id="793C1066FFECFFEA6D7DFF30FEC024BF" box="[265,382,188,212]" pageId="73" pageNumber="74" value="2011-10-21">21.x.2011</date>
].
</paragraph>
<caption id="59FD662EFFE6FFE06CE3F82DFD5723BD" httpUri="https://zenodo.org/record/288863/files/figure.png" pageId="67" pageNumber="68" targetBox="[216,1370,193,1931]" targetPageId="67">
<paragraph id="0D3D36A6FFE6FFE06CE3F82DFD5723BD" blockId="67.[151,1436,1953,2006]" pageId="67" pageNumber="68">
<emphasis id="3FF6EAB4FFE6FFE06CE3F82DFE9C23DD" bold="true" box="[151,290,1953,1975]" pageId="67" pageNumber="68">FIGURE 47.</emphasis>
<taxonomicName id="CA824D25FFE6FFE06D5FF82DFDB023DC" box="[299,526,1953,1975]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="67" pageNumber="68" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE6FFE06D5FF82DFDB023DC" box="[299,526,1953,1975]" italics="true" pageId="67" pageNumber="68">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE6FFE06E6CF82DFDED23DD" box="[536,595,1953,1974]" pageId="67" pageNumber="68" rank="species">
<emphasis id="3FF6EAB4FFE6FFE06E6CF82DFDED23DD" bold="true" box="[536,595,1953,1974]" pageId="67" pageNumber="68">n. sp.</emphasis>
</taxonomicNameLabel>
, holotype, presumably female, 53 mm, RV Meteor, DIVA 3, ME 79-1, sta. 542, 26°33'21&quot;S 35°11'29&quot;W, 4480 m, ZMH
<accessionNumber id="12D1AB45FFE6FFE06E5AF84DFD3423BD" box="[558,650,1984,2006]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="67" pageNumber="68" type="EnaNcbi">K 44286</accessionNumber>
. Habitus.
</paragraph>
</caption>
<caption id="59FD662EFFE1FFE76CE3F82DFBC7239F" httpUri="https://zenodo.org/record/288864/files/figure.png" pageId="68" pageNumber="69" targetBox="[176,1410,193,1931]" targetPageId="68">
<paragraph id="0D3D36A6FFE1FFE76CE3F82DFBC7239F" blockId="68.[151,1436,1953,2036]" pageId="68" pageNumber="69">
<emphasis id="3FF6EAB4FFE1FFE76CE3F82DFE9C23DD" bold="true" box="[151,290,1953,1975]" pageId="68" pageNumber="69">FIGURE 48.</emphasis>
<taxonomicName id="CA824D25FFE1FFE76D5FF82DFDB023DC" box="[299,526,1953,1975]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="68" pageNumber="69" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE1FFE76D5FF82DFDB023DC" box="[299,526,1953,1975]" italics="true" pageId="68" pageNumber="69">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE1FFE76E6CF82DFDED23DD" box="[536,595,1953,1974]" pageId="68" pageNumber="69" rank="species">
<emphasis id="3FF6EAB4FFE1FFE76E6CF82DFDED23DD" bold="true" box="[536,595,1953,1974]" pageId="68" pageNumber="69">n. sp.</emphasis>
</taxonomicNameLabel>
, holotype, presumably female, 53 mm, RV Meteor, DIVA 3, ME 79-1, sta. 542, 26°33'21&quot;S 35°11'29&quot;W, 4480 m, ZMH
<accessionNumber id="12D1AB45FFE1FFE76E59F84DFD3623BD" box="[557,648,1984,2006]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="68" pageNumber="69" type="EnaNcbi">K 44286</accessionNumber>
. A, head and periferal structures; B, left Md; C, left Mx1; D, tip of palp of left Mx1; E, left Mx2; F, Mxp; G, tip of inner plates of Mxp (setae and mediofacial spines not shown).
</paragraph>
</caption>
<caption id="59FD662EFFE0FFE66CE3F82DFC0F239F" httpUri="https://zenodo.org/record/288865/files/figure.png" pageId="69" pageNumber="70" targetBox="[180,1406,193,1931]" targetPageId="69">
<paragraph id="0D3D36A6FFE0FFE66CE3F82DFC0F239F" blockId="69.[151,1436,1953,2036]" pageId="69" pageNumber="70">
<emphasis id="3FF6EAB4FFE0FFE66CE3F82DFE9C23DD" bold="true" box="[151,290,1953,1975]" pageId="69" pageNumber="70">FIGURE 49.</emphasis>
<taxonomicName id="CA824D25FFE0FFE66D5FF82DFDB023DC" box="[299,526,1953,1975]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="69" pageNumber="70" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE0FFE66D5FF82DFDB023DC" box="[299,526,1953,1975]" italics="true" pageId="69" pageNumber="70">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE0FFE66E6CF82DFDED23DD" box="[536,595,1953,1974]" pageId="69" pageNumber="70" rank="species">
<emphasis id="3FF6EAB4FFE0FFE66E6CF82DFDED23DD" bold="true" box="[536,595,1953,1974]" pageId="69" pageNumber="70">n. sp.</emphasis>
</taxonomicNameLabel>
, holotype, presumably female, 53 mm, RV Meteor, DIVA 3, ME 79-1, sta. 542, 26°33'21&quot;S 35°11'29&quot;W, 4480 m, ZMH
<accessionNumber id="12D1AB45FFE0FFE66E40F84DFD3123BD" box="[564,655,1984,2006]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="69" pageNumber="70" type="EnaNcbi">K 44286</accessionNumber>
. A, left Gn1; B, chela of left Gn1; C, left Gn2; D, propodus and dactylus of left Gn2; E, chela of left Gn2 (facial view); F, chela of left Gn2 (medial view).
</paragraph>
</caption>
<caption id="59FD662EFFE3FFE56CE3F82DFAFB23BD" httpUri="https://zenodo.org/record/288866/files/figure.png" pageId="70" pageNumber="71" targetBox="[183,1403,193,1931]" targetPageId="70">
<paragraph id="0D3D36A6FFE3FFE56CE3F82DFAFB23BD" blockId="70.[151,1436,1953,2006]" pageId="70" pageNumber="71">
<emphasis id="3FF6EAB4FFE3FFE56CE3F82DFE9C23DD" bold="true" box="[151,290,1953,1975]" pageId="70" pageNumber="71">FIGURE 50.</emphasis>
<taxonomicName id="CA824D25FFE3FFE56D5FF82DFDB023DC" box="[299,526,1953,1975]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="70" pageNumber="71" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE3FFE56D5FF82DFDB023DC" box="[299,526,1953,1975]" italics="true" pageId="70" pageNumber="71">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE3FFE56E6CF82DFDED23DD" box="[536,595,1953,1974]" pageId="70" pageNumber="71" rank="species">
<emphasis id="3FF6EAB4FFE3FFE56E6CF82DFDED23DD" bold="true" box="[536,595,1953,1974]" pageId="70" pageNumber="71">n. sp.</emphasis>
</taxonomicNameLabel>
, holotype, presumably female, 53 mm, RV Meteor, DIVA 3, ME 79-1, sta. 542, 26°33'21&quot;S 35°11'29&quot;W, 4480 m, ZMH
<accessionNumber id="12D1AB45FFE3FFE56E5AF84DFD3423BD" box="[558,650,1984,2006]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="70" pageNumber="71" type="EnaNcbi">K 44286</accessionNumber>
. A, left P3; B, propodus and dactylus of left P3; C, left P4; D, telson.
</paragraph>
</caption>
<caption id="59FD662EFFE2FFE46CE3F82DFB2D23BD" httpUri="https://zenodo.org/record/288867/files/figure.png" pageId="71" pageNumber="72" targetBox="[171,1415,193,1931]" targetPageId="71">
<paragraph id="0D3D36A6FFE2FFE46CE3F82DFB2D23BD" blockId="71.[151,1436,1953,2006]" pageId="71" pageNumber="72">
<emphasis id="3FF6EAB4FFE2FFE46CE3F82DFE9C23DD" bold="true" box="[151,290,1953,1975]" pageId="71" pageNumber="72">FIGURE 51.</emphasis>
<taxonomicName id="CA824D25FFE2FFE46D5FF82DFDB023DC" box="[299,526,1953,1975]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="71" pageNumber="72" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFE2FFE46D5FF82DFDB023DC" box="[299,526,1953,1975]" italics="true" pageId="71" pageNumber="72">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFE2FFE46E6CF82DFDED23DD" box="[536,595,1953,1974]" pageId="71" pageNumber="72" rank="species">
<emphasis id="3FF6EAB4FFE2FFE46E6CF82DFDED23DD" bold="true" box="[536,595,1953,1974]" pageId="71" pageNumber="72">n. sp.</emphasis>
</taxonomicNameLabel>
, holotype, presumably female, 53 mm, RV Meteor, DIVA 3, ME 79-1, sta. 542, 26°33'21&quot;S 35°11'29&quot;W, 4480 m, ZMH
<accessionNumber id="12D1AB45FFE2FFE46E5AF84DFD3423BD" box="[558,650,1984,2006]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="71" pageNumber="72" type="EnaNcbi">K 44286</accessionNumber>
. A, left P5; B, left P7; C, tip of propodus of left P7.
</paragraph>
</caption>
<paragraph id="0D3D36A6FFEDFFEB6CE3F8E7FE9323D4" pageId="72" pageNumber="73">
<table id="7F82C406FFED005C6CE3F8E7FA2223D4" box="[151,1436,1899,1983]" gridcols="3" gridrows="3" pageId="72" pageNumber="73">
<tr id="B3B234E4FFED005C6CE3F8E7FA2223EA" box="[151,1436,1899,1921]" gridrow="0" pageId="72" pageNumber="73">
<th id="F0635D98FFED005C6CE3F8E7FD9323EA" box="[151,557,1899,1921]" gridcol="0" gridrow="0" pageId="72" pageNumber="73">
<emphasis id="3FF6EAB4FFEDFFEB6CE3F8E7FE9C23EB" bold="true" box="[151,290,1899,1921]" pageId="72" pageNumber="73">FIGURE 52.</emphasis>
<taxonomicName id="CA824D25FFEDFFEB6D5FF8E7FDB023EA" box="[299,526,1899,1921]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="72" pageNumber="73" phylum="Arthropoda" rank="species" species="sigmiferus" status="n.">
<emphasis id="3FF6EAB4FFEDFFEB6D5FF8E7FDB023EA" box="[299,526,1899,1921]" italics="true" pageId="72" pageNumber="73">Eurythenes sigmiferus</emphasis>
</taxonomicName>
<emphasis id="3FF6EAB4FFEDFFEB6E6CF8E0FD9223EA" bold="true" box="[536,556,1900,1921]" pageId="72" pageNumber="73">
<taxonomicNameLabel id="24C557CFFFEDFFEB6E6CF8E0FD9223EA" box="[536,556,1900,1921]" pageId="72" pageNumber="73">n.</taxonomicNameLabel>
</emphasis>
</th>
<th id="F0635D98FFED005C6E41F8E7FC2A23EA" box="[565,916,1899,1921]" gridcol="1" gridrow="0" pageId="72" pageNumber="73">
<emphasis id="3FF6EAB4FFEDFFEB6E41F8E0FDED23EA" bold="true" box="[565,595,1900,1921]" pageId="72" pageNumber="73">sp.</emphasis>
, holotype, presumably female,
</th>
<th id="F0635D98FFED005C6FEFF8E7FA2223EA" box="[923,1436,1899,1921]" gridcol="2" gridrow="0" pageId="72" pageNumber="73">53 mm, RV Meteor, DIVA 3, ME 79-1, sta. 542,</th>
</tr>
<tr id="B3B234E4FFED005C6CE3F806FA2223CB" box="[151,1436,1930,1952]" gridrow="1" pageId="72" pageNumber="73">
<th id="F0635D98FFED005C6CE3F806FD9323CB" box="[151,557,1930,1952]" gridcol="0" gridrow="1" pageId="72" pageNumber="73">26°33'21&quot;S 35°11'29&quot;W, 4480 m, ZMH</th>
<td id="F0635D98FFED005C6E41F806FC2A23CB" box="[565,916,1930,1952]" gridcol="1" gridrow="1" pageId="72" pageNumber="73">
<accessionNumber id="12D1AB45FFEDFFEB6E41F807FD2F23CB" box="[565,657,1930,1952]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/K44286" pageId="72" pageNumber="73" type="EnaNcbi">K 44286</accessionNumber>
. A, left Ep1Ep3; B, left
</td>
<td id="F0635D98FFED005C6FEFF806FA2223CB" box="[923,1436,1930,1952]" gridcol="2" gridrow="1" pageId="72" pageNumber="73">U1; C, left U2; D, left U3; E, peduncle of left U3</td>
</tr>
<tr id="B3B234E4FFED005C6CE3F825FA2223D4" box="[151,1436,1961,1983]" gridrow="2" pageId="72" pageNumber="73" rowspan-1="1" rowspan-2="1">
<th id="F0635D98FFED005C6CE3F825FD9323D4" box="[151,557,1961,1983]" gridcol="0" gridrow="2" pageId="72" pageNumber="73">(ventral view).</th>
</tr>
</table>
</paragraph>
<paragraph id="0D3D36A6FFECFFEA6CB3FF53FE3F250E" blockId="73.[151,1437,151,1112]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3FF53FF402493" bold="true" box="[199,254,223,248]" pageId="73" pageNumber="74">Size.</emphasis>
The
<typeStatus id="D2398804FFECFFEA6D43FF53FE272493" box="[311,409,223,248]" pageId="73" pageNumber="74" type="holotype">holotype</typeStatus>
is
<quantity id="CA7A9B43FFECFFEA6DCDFF53FDB6249C" box="[441,520,223,248]" metricMagnitude="-2" metricUnit="m" metricValue="5.3" pageId="73" pageNumber="74" unit="mm" value="53.0">53 mm</quantity>
long. The two possible
<taxonomicName id="CA824D25FFECFFEA6F67FF6DFC182493" box="[787,934,224,248]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus">
<emphasis id="3FF6EAB4FFECFFEA6F67FF6DFC182493" box="[787,934,224,248]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
specimens recorded by
<bibRefCitation id="69134B57FFECFFEA68C0FF53FAE12493" author="Barnard" box="[1204,1375,223,248]" pageId="73" pageNumber="74" refString="Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128." type="journal article" year="1961">Barnard (1961)</bibRefCitation>
as
<taxonomicName id="CA824D25FFECFFEA69F0FF6DFF5B2577" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFECFFEA69F0FF6DFF5B2577" italics="true" pageId="73" pageNumber="74">E. gryllus</emphasis>
</taxonomicName>
were respectively
<quantity id="CA7A9B43FFECFFEA6DCDFE88FDB72577" box="[441,521,260,285]" metricMagnitude="-2" metricUnit="m" metricValue="5.0" pageId="73" pageNumber="74" unit="mm" value="50.0">50 mm</quantity>
and
<quantity id="CA7A9B43FFECFFEA6E4BFE88FD312577" box="[575,655,260,285]" metricMagnitude="-2" metricUnit="m" metricValue="7.5" pageId="73" pageNumber="74" unit="mm" value="75.0">75 mm</quantity>
long. The possible
<taxonomicName id="CA824D25FFECFFEA6F18FE89FBBF2577" box="[876,1025,260,284]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus">
<emphasis id="3FF6EAB4FFECFFEA6F18FE89FBBF2577" box="[876,1025,260,284]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
specimen of the ECOMARE Cruise previously illustrated at http://www.oceanlab.abdn.ac.uk/blog/wp-content/fig-1.JPG [accessed
<date id="793C1066FFECFFEA689CFEA4FAE4252B" box="[1256,1370,296,320]" pageId="73" pageNumber="74" value="2011-10-21">21.x.2011</date>
] was nearly
<quantity id="CA7A9B43FFECFFEA6C90FEC0FEFF250F" box="[228,321,332,356]" metricMagnitude="-1" metricUnit="m" metricValue="1.4" pageId="73" pageNumber="74" unit="mm" value="140.0">140 mm</quantity>
long.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CB3FEE3FB00259F" pageId="73" pageNumber="74" type="distribution">
<paragraph id="0D3D36A6FFECFFEA6CB3FEE3FB00259F" blockId="73.[151,1437,151,1112]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3FEE3FD9325E3" bold="true" box="[199,557,367,392]" pageId="73" pageNumber="74">Distribution and depth range.</emphasis>
The only absolutely certain record of the species is that of the
<typeStatus id="D2398804FFECFFEA6887FEE3FAEB25E3" box="[1267,1365,367,392]" pageId="73" pageNumber="74" type="holotype">holotype</typeStatus>
in the
<collectingCountry id="75957636FFECFFEA6CE3FE18FF6525C6" box="[151,219,404,429]" name="Brazil" pageId="73" pageNumber="74">Brazil</collectingCountry>
Basin (
<geoCoordinate id="68B65061FFECFFEA6D4FFE18FE0525C6" box="[315,443,404,429]" direction="south" orientation="latitude" pageId="73" pageNumber="74" precision="15" value="-26.555832">26°33'21&quot;S</geoCoordinate>
<geoCoordinate id="68B65061FFECFFEA6DB3FE18FDE125C6" box="[455,607,404,429]" direction="west" orientation="longitude" pageId="73" pageNumber="74" precision="15" value="-35.19139">035°11'29&quot;W</geoCoordinate>
) at
<quantity id="CA7A9B43FFECFFEA6EE7FE18FD4E25C7" box="[659,752,404,428]" metricMagnitude="3" metricUnit="m" metricValue="4.4799999999999995" pageId="73" pageNumber="74" unit="m" value="4480.0">4480 m</quantity>
. However, the species may be widely distributed, since it presumably also occurs in the Gulf of
<collectingCountry id="75957636FFECFFEA6E3CFE3BFD2325BB" box="[584,669,439,464]" name="Mexico" pageId="73" pageNumber="74">Mexico</collectingCountry>
around
<quantity id="CA7A9B43FFECFFEA6E8FFE34FCEF25A4" box="[763,849,440,464]" metricMagnitude="3" metricUnit="m" metricValue="3.3" pageId="73" pageNumber="74" unit="m" value="3300.0">3300 m</quantity>
depth, based on
<bibRefCitation id="69134B57FFECFFEA6864FE3BFAE125BB" box="[1040,1375,439,464]" pageId="73" pageNumber="74" refString="Escobar-Briones, E., Najera-Hillman, E. &amp; &amp; Alvarez, F. (2010) Unique 16 S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain. Revista Mexicana de Biodiversidad, 81, S 177 - S 185." type="journal article">
Escobar-Briones
<emphasis id="3FF6EAB4FFECFFEA68A6FE35FAB525BB" box="[1234,1291,440,464]" italics="true" pageId="73" pageNumber="74">et al.</emphasis>
(2010)
</bibRefCitation>
, who record
<taxonomicName id="CA824D25FFECFFEA6C91FE50FEDD259F" box="[229,355,476,500]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFECFFEA6C91FE50FEDD259F" box="[229,355,476,500]" italics="true" pageId="73" pageNumber="74">Eurythenes</emphasis>
</taxonomicName>
specimens with extremely similar DNA sequences (
<bibRefCitation id="69134B57FFECFFEA6FDAFE50FB0C259F" author="Havermans" box="[942,1202,476,500]" pageId="73" pageNumber="74" refString="Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. &amp; Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218" type="journal article" year="2013">
Havermans
<emphasis id="3FF6EAB4FFECFFEA6842FE51FBD6259F" box="[1078,1128,476,500]" italics="true" pageId="73" pageNumber="74">et al</emphasis>
. 2013
</bibRefCitation>
).
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CB3FE73FC41267C" box="[199,1023,511,536]" pageId="73" pageNumber="74" type="biology_ecology">
<paragraph id="0D3D36A6FFECFFEA6CB3FE73FC41267C" blockId="73.[151,1437,151,1112]" box="[199,1023,511,536]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3FE73FE992673" bold="true" box="[199,295,511,536]" pageId="73" pageNumber="74">Biology.</emphasis>
The species is a scavenger, which sometimes enters baited traps.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CB3FDA8FBD42033" pageId="73" pageNumber="74" type="discussion">
<paragraph id="0D3D36A6FFECFFEA6CB3FDA8FBD42033" blockId="73.[151,1437,151,1112]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3FDA8FE852656" bold="true" box="[199,315,548,573]" pageId="73" pageNumber="74">Remarks.</emphasis>
Besides genetically confirmed records of
<taxonomicName id="CA824D25FFECFFEA6F51FDA9FC022657" box="[805,956,548,572]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFECFFEA6F51FDA9FC022657" box="[805,956,548,572]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFECFFEA6FB1FDA8FB9C2656" box="[965,1058,548,573]" pageId="73" pageNumber="74" rank="species">
<emphasis id="3FF6EAB4FFECFFEA6FB1FDA8FB9C2656" bold="true" box="[965,1058,548,573]" pageId="73" pageNumber="74">sp. nov.</emphasis>
</taxonomicNameLabel>
, there is a number of records of crested
<taxonomicName id="CA824D25FFECFFEA6C87FDC4FECF260B" box="[243,369,584,608]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFECFFEA6C87FDC4FECF260B" box="[243,369,584,608]" italics="true" pageId="73" pageNumber="74">Eurythenes</emphasis>
</taxonomicName>
, which are possibly conspecific but require further studies.
<bibRefCitation id="69134B57FFECFFEA6831FDCBFB49260B" author="Barnard" box="[1093,1271,583,608]" pageId="73" pageNumber="74" refString="Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128." type="journal article" year="1961">Barnard (1961)</bibRefCitation>
recorded and illustrated two crested
<taxonomicName id="CA824D25FFECFFEA6DEFFDE0FDA726EF" box="[411,537,620,644]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFECFFEA6DEFFDE0FDA726EF" box="[411,537,620,644]" italics="true" pageId="73" pageNumber="74">Eurythenes</emphasis>
</taxonomicName>
specimens collected in the Indian Ocean, off
<collectingCountry id="75957636FFECFFEA685DFDE0FBD826EE" box="[1065,1126,620,645]" name="South Africa" pageId="73" pageNumber="74">Natal</collectingCountry>
at
<geoCoordinate id="68B65061FFECFFEA68F8FDE0FB5A26EF" box="[1164,1252,620,644]" direction="south" orientation="latitude" pageId="73" pageNumber="74" precision="925" value="-29.65">29°39'S</geoCoordinate>
<geoCoordinate id="68B65061FFECFFEA6899FDE0FAF726EF" box="[1261,1353,620,644]" direction="east" orientation="longitude" pageId="73" pageNumber="74" precision="925" value="37.016666">37°01'E</geoCoordinate>
,
<quantity id="CA7A9B43FFECFFEA6922FDE0FF4F26CC" metricMagnitude="3" metricUnit="m" metricValue="4.985" metricValueMax="5.09" metricValueMin="4.88" pageId="73" pageNumber="74" unit="m" value="4985.0" valueMax="5090.0" valueMin="4880.0">4880 5090 m</quantity>
, which could be
<taxonomicName id="CA824D25FFECFFEA6DC8FD1DFDED26C3" box="[444,595,656,680]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus">
<emphasis id="3FF6EAB4FFECFFEA6DC8FD1DFDED26C3" box="[444,595,656,680]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
.
<bibRefCitation id="69134B57FFECFFEA6E10FD1CFC1326C3" author="Bowman" box="[612,941,655,680]" pageId="73" pageNumber="74" refString="Bowman, T. E. &amp; Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1." type="journal article" year="1972">Bowman &amp; Manning (1972)</bibRefCitation>
also recorded crested
<taxonomicName id="CA824D25FFECFFEA68C1FD1CFA8D26C3" box="[1205,1331,656,680]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFECFFEA68C1FD1CFA8D26C3" box="[1205,1331,656,680]" italics="true" pageId="73" pageNumber="74">Eurythenes</emphasis>
</taxonomicName>
(without giving illustrations of the crests) from
<collectingCountry id="75957636FFECFFEA6E24FD38FD6926A6" box="[592,727,692,717]" name="Guadeloupe" pageId="73" pageNumber="74">Guadeloupe</collectingCountry>
and Andros Island, but from a much shallower depth (around
<quantity id="CA7A9B43FFECFFEA6CE3FD54FF4E269B" box="[151,240,728,752]" metricMagnitude="3" metricUnit="m" metricValue="1.8" pageId="73" pageNumber="74" unit="m" value="1800.0">1800 m</quantity>
); their identity with
<taxonomicName id="CA824D25FFECFFEA6DA0FD55FDD6269B" box="[468,616,728,752]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFECFFEA6DA0FD55FDD6269B" box="[468,616,728,752]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFECFFEA6E1AFD5BFD76269B" box="[622,712,727,752]" pageId="73" pageNumber="74" rank="species">
<emphasis id="3FF6EAB4FFECFFEA6E1AFD5BFD76269B" bold="true" box="[622,712,727,752]" pageId="73" pageNumber="74">sp. nov.</emphasis>
</taxonomicNameLabel>
seems possible but requires confirmation, the concept of “crest” remaining too imprecise when not substantiated by illustrations. There are also several pictures accessible on WWW showing
<taxonomicName id="CA824D25FFECFFEA6D21FCACFE6D2753" box="[341,467,800,824]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFECFFEA6D21FCACFE6D2753" box="[341,467,800,824]" italics="true" pageId="73" pageNumber="74">Eurythenes</emphasis>
</taxonomicName>
specimens with a dorsal crests more or less similar to those of
<taxonomicName id="CA824D25FFECFFEA68D0FCADFA872753" box="[1188,1337,800,824]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFECFFEA68D0FCADFA872753" box="[1188,1337,800,824]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFECFFEA6935FC93FA222753" box="[1345,1436,799,824]" pageId="73" pageNumber="74" rank="species">
<emphasis id="3FF6EAB4FFECFFEA6935FC93FA222753" bold="true" box="[1345,1436,799,824]" pageId="73" pageNumber="74">sp. nov.</emphasis>
</taxonomicNameLabel>
The specimen illustrated at http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ KAH0910_6%20
<taxonomicName id="CA824D25FFECFFEA6D2EFCEBFE6427EB" box="[346,474,871,896]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">Eurythenes</taxonomicName>
.jpg [accessed on
<date id="793C1066FFECFFEA6EB7FCEBFC8327EB" box="[707,829,871,896]" pageId="73" pageNumber="74" value="2014-09-23">23.ix.2014</date>
] comes from the Kermadec Trench,
<geoCoordinate id="68B65061FFECFFEA6969FCEBFA2227EB" box="[1309,1436,871,896]" direction="south" orientation="latitude" pageId="73" pageNumber="74" precision="9" value="-36.16783">36°10.07S</geoCoordinate>
<geoCoordinate id="68B65061FFECFFEA6CE3FC00FE9127CF" box="[151,303,908,932]" direction="west" orientation="longitude" pageId="73" pageNumber="74" precision="9" value="-179.0045">179°00.27W</geoCoordinate>
,
<quantity id="CA7A9B43FFECFFEA6D37FC00FE1D27CF" box="[323,419,908,933]" metricMagnitude="3" metricUnit="m" metricValue="6.0" pageId="73" pageNumber="74" unit="m" value="6000.0">6000 m</quantity>
, and that of http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/
<taxonomicName id="CA824D25FFECFFEA6CE3FC23FEA627A3" box="[151,280,943,968]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="genus">Eurythenes</taxonomicName>
%202.JPG [accessed on
<date id="793C1066FFECFFEA6E59FC23FD1627A3" box="[557,680,943,968]" pageId="73" pageNumber="74" value="2014-09-23">23.ix.2014</date>
] from the Peru-Chile Trench,
<geoCoordinate id="68B65061FFECFFEA6875FC23FB3027A3" box="[1025,1166,943,968]" direction="south" orientation="latitude" pageId="73" pageNumber="74" precision="1" value="-4.450267">04°27.016S</geoCoordinate>
<geoCoordinate id="68B65061FFECFFEA68E3FC23FA9127A3" box="[1175,1327,943,968]" direction="west" orientation="longitude" pageId="73" pageNumber="74" precision="1" value="-81.91198">81°54.719W</geoCoordinate>
,
<quantity id="CA7A9B43FFECFFEA6948FC23FA2B27AC" box="[1340,1429,943,968]" metricMagnitude="3" metricUnit="m" metricValue="5.329" pageId="73" pageNumber="74" unit="m" value="5329.0">5329 m</quantity>
] (Kilgallen comm. pers.). The specimen previously illustrated by a photograph at http://www.oceanlab.abdn.ac.uk/ blog/wp-content/fig-1.JPG [accessed
<date id="793C1066FFECFFEA6E37FC74FD0A207B" box="[579,692,1016,1040]" pageId="73" pageNumber="74" value="2011-10-21">21.x.2011</date>
] presumably comes from the Atlantic Ocean, possibly from the Mid-Atlantic Ridge. If it is genetically confirmed that these specimens are indeed
<taxonomicName id="CA824D25FFECFFEA6853FB91FB05205F" box="[1063,1211,1052,1076]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="sigmiferus" status="sp. nov.">
<emphasis id="3FF6EAB4FFECFFEA6853FB91FB05205F" box="[1063,1211,1052,1076]" italics="true" pageId="73" pageNumber="74">E. sigmiferus</emphasis>
</taxonomicName>
<taxonomicNameLabel id="24C557CFFFECFFEA68B5FB90FAA7205E" box="[1217,1305,1052,1077]" pageId="73" pageNumber="74" rank="species">
<emphasis id="3FF6EAB4FFECFFEA68B5FB90FAA7205E" bold="true" box="[1217,1305,1052,1077]" pageId="73" pageNumber="74">sp. nov.</emphasis>
</taxonomicNameLabel>
, this would mean that it is a cosmopolitan tropical/subtropical abyssal (and possibly hadal) species.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,223 @@
<document id="28C4C0ECEC3B7357BB6E29A71C91EFA8" ID-DOI="10.11646/zootaxa.3971.1.1" ID-GBIF-Dataset="28ab0d98-ed65-4875-af05-94c47f4c6d8f" ID-ISSN="1175-5326" ID-Zenodo-Dep="288816" ID-ZooBank="61D379B9-D9BA-41FB-B6A9-57BF87131B42" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461184669123" checkinUser="plazi" docAuthor="DAcoz, Cédric DUdekem &amp; Havermans, Charlotte" docDate="2015" docId="852B87B0FFECFFE96CE3FB20FA3924BE" docLanguage="en" docName="zt03971p080.pdf" docOrigin="Zootaxa 3971 (1)" docStyle="DocumentStyle:8B0D3ECF822058C8413568C103B59429.6:Zootaxa.2001-2006.monograph" docStyleId="8B0D3ECF822058C8413568C103B59429" docStyleName="Zootaxa.2001-2006.monograph" docStyleVersion="6" docTitle="Eurythenes thurstoni Stoddart &amp; Lowry 2004" docType="treatment" docVersion="8" lastPageNumber="75" masterDocId="7912FFC8FFA5FFA36C74FF8CFFBE246B" masterDocTitle="Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)" masterLastPageNumber="80" masterPageNumber="1" pageNumber="74" updateTime="1698599219233" updateUser="plazi">
<mods:mods id="325595969F4C3C954ED8013AB3516D9E" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="0D1831107F93FCF797C85C1E8ABBDC11">
<mods:title id="371C33596AA3539A90D295D486018932">Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae)</mods:title>
</mods:titleInfo>
<mods:name id="98FD3B496A55F41BC4749C2B96703233" type="personal">
<mods:role id="E968C3100432580A389FC4689B305195">
<mods:roleTerm id="84AAC21EC79849D0C3E76E7F05C46E31">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3151674E70E11BB96E19D55A831676E9">DAcoz, Cédric DUdekem</mods:namePart>
</mods:name>
<mods:name id="8665F873C502421E2D55896F4A381EF1" type="personal">
<mods:role id="0ACAA6BB7E5F33DAA7E6B928FB27DF2D">
<mods:roleTerm id="B0D0F17340C7E87DA26198E4292EB904">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="0402031B8FD907EA68E8F289C5CD17AB">Havermans, Charlotte</mods:namePart>
</mods:name>
<mods:typeOfResource id="3AAA4EEC3047E360D18122F3A22A34D2">text</mods:typeOfResource>
<mods:relatedItem id="5FBD972F31B69C0F6CDC91BA26793623" type="host">
<mods:titleInfo id="F4FE6F041C336FB91A15FE162FEBD10D">
<mods:title id="C0A43C85617000057928D1E5BF02A2C0">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="F4CFBA593F538D85A7370A0AC15D9262">
<mods:date id="8286FA27B67C8B8B46E229B7CB6183CD">2015</mods:date>
<mods:detail id="352EF37F14D5A65C16381C5307535974" type="volume">
<mods:number id="268BBD29D94851543B0FE00FF8B7C430">3971</mods:number>
</mods:detail>
<mods:detail id="36D0A8E863373706FDD5515EF41FA818" type="issue">
<mods:number id="775D9C28F54E717CE20D75D854AFEDAA">1</mods:number>
</mods:detail>
<mods:extent id="E20C2A2A10C4450FEB20334F89FD6ED8" unit="page">
<mods:start id="4A4A269C1337348463347607122D4FD7">1</mods:start>
<mods:end id="3055A1AF4EA0A965A91D676D554B7BB1">80</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="02518120881917CB61B27CB6205B2CF7">journal article</mods:classification>
<mods:identifier id="622233C4E77178F9E810D3352F9E6322" type="DOI">10.11646/zootaxa.3971.1.1</mods:identifier>
<mods:identifier id="3A284F8DE6C33495FF90866DD0FEE576" type="GBIF-Dataset">28ab0d98-ed65-4875-af05-94c47f4c6d8f</mods:identifier>
<mods:identifier id="C6534410BE92145E99836A1128A3FC76" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="3A36AE08201CAA8EF7F4D8890B265B3E" type="Zenodo-Dep">288816</mods:identifier>
<mods:identifier id="57FF4269CCE1A77495FF14AEB1DDCA55" type="ZooBank">61D379B9-D9BA-41FB-B6A9-57BF87131B42</mods:identifier>
</mods:mods>
<treatment id="852B87B0FFECFFE96CE3FB20FA3924BE" ID-DOI="http://doi.org/10.5281/zenodo.5470194" ID-GBIF-Taxon="127691972" ID-Zenodo-Dep="5470194" LSID="urn:lsid:plazi:treatment:852B87B0FFECFFE96CE3FB20FA3924BE" httpUri="http://treatment.plazi.org/id/852B87B0FFECFFE96CE3FB20FA3924BE" lastPageId="74" lastPageNumber="75" pageId="73" pageNumber="74">
<subSubSection id="4598652DFFECFFEA6CE3FB20FD582163" pageId="73" pageNumber="74" type="nomenclature">
<paragraph id="0D3D36A6FFECFFEA6CE3FB20FD7020AD" blockId="73.[151,718,1196,1222]" box="[151,718,1196,1222]" pageId="73" pageNumber="74">
<heading id="567581CAFFECFFEA6CE3FB20FD7020AD" bold="true" box="[151,718,1196,1222]" fontSize="11" level="1" pageId="73" pageNumber="74" reason="1">
<taxonomicName id="CA824D25FFECFFEA6CE3FB20FD7020AD" authority="Stoddart &amp; Lowry, 2004" authorityName="Stoddart &amp; Lowry" authorityYear="2004" box="[151,718,1196,1222]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFECFFEA6CE3FB20FD7020AD" bold="true" box="[151,718,1196,1222]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CE3FB20FE2620AD" bold="true" box="[151,408,1196,1222]" italics="true" pageId="73" pageNumber="74">Eurythenes thurstoni</emphasis>
<bibRefCitation id="69134B57FFECFFEA6DEAFB20FD7020AD" author="Stoddart" box="[414,718,1196,1222]" pageId="73" pageNumber="74" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
</emphasis>
</taxonomicName>
</heading>
</paragraph>
<paragraph id="0D3D36A6FFECFFEA6CE3FB7EFD582163" blockId="73.[151,1436,1266,1319]" box="[151,742,1266,1288]" pageId="73" pageNumber="74">
<treatmentCitationGroup id="2D921188FFECFFEA6CE3FB7EFD582163" box="[151,742,1266,1288]" pageId="73" pageNumber="74">
<taxonomicName id="CA824D25FFECFFEA6CE3FB7EFEEB2163" box="[151,341,1266,1288]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFECFFEA6CE3FB7EFEEB2163" box="[151,341,1266,1288]" italics="true" pageId="73" pageNumber="74">Eurythenes gryllus</emphasis>
</taxonomicName>
.—
<treatmentCitation id="8C2310B7FFECFFEA6D07FB7EFD902163" author="Barnard" box="[371,558,1266,1288]" page="35" pageId="73" pageNumber="74" year="1961">
<bibRefCitation id="69134B57FFECFFEA6D07FB7EFDB72163" author="Barnard" box="[371,521,1266,1288]" pageId="73" pageNumber="74" refString="Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128." type="journal article" year="1961">Barnard, 1961</bibRefCitation>
: 35
</treatmentCitation>
, in part, figs. 67.
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CE3FA9DFA22214C" box="[151,1436,1297,1319]" pageId="73" pageNumber="74" type="reference_group">
<paragraph id="0D3D36A6FFECFFEA6CE3FA9DFA22214C" blockId="73.[151,1436,1266,1319]" box="[151,1436,1297,1319]" pageId="73" pageNumber="74">
<treatmentCitationGroup id="2D921188FFECFFEA6CE3FA9DFA22214C" box="[151,1436,1297,1319]" pageId="73" pageNumber="74">
<taxonomicName id="CA824D25FFECFFEA6CE3FA9DFD27214C" authority="Stoddart &amp; Lowry, 2004: 451" authorityName="Stoddart &amp; Lowry" authorityPageNumber="451" authorityYear="2004" box="[151,665,1297,1319]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFECFFEA6CE3FA9DFED4214C" box="[151,362,1297,1319]" italics="true" pageId="73" pageNumber="74">Eurythenes thurstoni</emphasis>
<treatmentCitation id="8C2310B7FFECFFEA6D1BFA9DFD27214C" author="Stoddart" box="[367,665,1297,1319]" httpUri="http://treatment.plazi.org/id/2D09EC23E910FF94FF44FA69FE90FAC9" page="451" pageId="73" pageNumber="74" year="2004">
<bibRefCitation id="69134B57FFECFFEA6D1BFA9DFDD7214C" author="Stoddart" box="[367,617,1297,1319]" pageId="73" pageNumber="74" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry, 2004</bibRefCitation>
: 451
</treatmentCitation>
</taxonomicName>
, figs. 1620.—
<treatmentCitation id="8C2310B7FFECFFEA6F47FA9DFC68214C" author="Senna" box="[819,982,1297,1319]" page="86" pageId="73" pageNumber="74" year="2009">
<bibRefCitation id="69134B57FFECFFEA6F47FA9DFC0A214C" author="Senna" box="[819,948,1297,1319]" pageId="73" pageNumber="74" refString="Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96." type="journal article" year="2009">Senna, 2009</bibRefCitation>
: 86
</treatmentCitation>
(table).—
<treatmentCitation id="8C2310B7FFECFFEA684EFA9DFA8B214C" author="Quadra" box="[1082,1333,1297,1319]" page="376" pageId="73" pageNumber="74" year="2014">
<bibRefCitation id="69134B57FFECFFEA684EFA9DFABD214C" author="Quadra" box="[1082,1283,1297,1319]" pageId="73" pageNumber="74" refString="Quadra, A., Sorrentino, R., Senna, A. R. &amp; Serejo, C. S. (2014) First record of Eurythenes thurstoni Stoddart &amp; Lowry (2004). (Crustacea: Amphipoda: Lysianassoidea) from the South Mid-Atlantic Ridge. Latin American Journal of Aquatic Research, 42 (2), 376 - 380. http: // dx. doi. org / 10.3856 / vol 42 - issue 2 - fulltext- 8" type="journal article" year="2014">
Quadra
<emphasis id="3FF6EAB4FFECFFEA68FAFA9EFB04214C" box="[1166,1210,1297,1319]" italics="true" pageId="73" pageNumber="74">et al</emphasis>
., 2014
</bibRefCitation>
: 376
</treatmentCitation>
, figs. 23.
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CE3FAD8FBC721B3" pageId="73" pageNumber="74" type="materials_examined">
<paragraph id="0D3D36A6FFECFFEA6CE3FAD8FE752107" blockId="73.[151,1437,1364,2037]" box="[151,459,1364,1389]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CE3FAD8FE3E2106" bold="true" box="[151,384,1364,1389]" pageId="73" pageNumber="74">Material examined.</emphasis>
None.
</paragraph>
<paragraph id="0D3D36A6FFECFFEA6CB3FAFBFBC721B3" blockId="73.[151,1437,1364,2037]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3FAFBFDB721FB" bold="true" box="[199,521,1399,1424]" pageId="73" pageNumber="74">
<typeStatus id="D2398804FFECFFEA6CB3FAFBFE8A21FB" box="[199,308,1399,1424]" pageId="73" pageNumber="74" type="holotype">Holotype</typeStatus>
and
<typeStatus id="D2398804FFECFFEA6D05FAFBFE1A21FB" box="[369,420,1399,1424]" pageId="73" pageNumber="74">type</typeStatus>
locality.
</emphasis>
<collectingCountry id="75957636FFECFFEA6E65FAFBFDC521FB" box="[529,635,1399,1424]" name="Australia" pageId="73" pageNumber="74">Australia</collectingCountry>
, Tasman Sea, SE of Twofold Bay, New South
<collectingCountry id="75957636FFECFFEA68F9FAFBFB6A21FB" box="[1165,1236,1399,1424]" name="United Kingdom" pageId="73" pageNumber="74">Wales</collectingCountry>
, FRV Kapala, stn K
<date id="793C1066FFECFFEA6CD9FA10FEAA21DF" box="[173,276,1436,1460]" pageId="73" pageNumber="74" value="1977-03-19">77-19-03</date>
,
<geoCoordinate id="68B65061FFECFFEA6D5CFA10FE3A21DF" box="[296,388,1436,1460]" direction="south" orientation="latitude" pageId="73" pageNumber="74" precision="925" value="-37.4">37°24S</geoCoordinate>
<geoCoordinate id="68B65061FFECFFEA6DE0FA10FE4121DE" box="[404,511,1436,1461]" direction="east" orientation="longitude" pageId="73" pageNumber="74" precision="925" value="150.5">150°30E</geoCoordinate>
to
<geoCoordinate id="68B65061FFECFFEA6E40FA10FD2E21DF" box="[564,656,1436,1460]" direction="south" orientation="latitude" pageId="73" pageNumber="74" precision="925" value="-37.466667">37°28S</geoCoordinate>
<geoCoordinate id="68B65061FFECFFEA6ED4FA10FCB021DE" box="[672,782,1436,1461]" direction="east" orientation="longitude" pageId="73" pageNumber="74" precision="925" value="150.55">150°33E</geoCoordinate>
,
<quantity id="CA7A9B43FFECFFEA6F56FA10FCCF21DF" box="[802,881,1436,1461]" metricMagnitude="2" metricUnit="m" metricValue="5.5" pageId="73" pageNumber="74" unit="m" value="550.0">550 m</quantity>
over bottom depth
<quantity id="CA7A9B43FFECFFEA681AFA10FB7021DF" box="[1134,1230,1436,1461]" metricMagnitude="3" metricUnit="m" metricValue="3.658" pageId="73" pageNumber="74" unit="m" value="3658.0">3658 m</quantity>
, midwater trawl, 0
<date id="793C1066FFECFFEA6CD1FA4CFEA921B3" box="[165,279,1472,1496]" pageId="73" pageNumber="74" value="1977-01-11">1.11.1977</date>
, K. Graham, female
<quantity id="CA7A9B43FFECFFEA6D8BFA4CFDEE21BC" box="[511,592,1472,1496]" metricMagnitude="-2" metricUnit="m" metricValue="3.3" pageId="73" pageNumber="74" unit="mm" value="33.0">33 mm</quantity>
, with
<specimenCount id="1B84FD2FFFECFFEA6EE1FA4CFCA321B3" box="[661,797,1471,1496]" pageId="73" pageNumber="74" type="juvenile">18 juveniles</specimenCount>
in brood pouch (AM P62435).
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CB3FA68FDEA2293" pageId="73" pageNumber="74" type="diagnosis">
<paragraph id="0D3D36A6FFECFFEA6CB3FA68FDEA2293" blockId="73.[151,1437,1364,2037]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3FA68FEFF2196" bold="true" box="[199,321,1508,1533]" pageId="73" pageNumber="74">Diagnosis.</emphasis>
Body not keeled. Pleonite 3 anteriorly not notched as in the
<taxonomicName id="CA824D25FFECFFEA6F99FA68FB852197" box="[1005,1083,1508,1532]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFECFFEA6F99FA68FB852197" box="[1005,1083,1508,1532]" italics="true" pageId="73" pageNumber="74">gryllus</emphasis>
</taxonomicName>
-complex. Anterodorsal margin of head forming an upturned ridge (not observed in other species). Anterior lobe of head acute. Gnathopod 1 with basis very narrow, 3.8 x as long as wide, with palm of propodus protruding. Gnathopod 2 with coxa narrow and rounded ventrally, with propodus narrow, about 3.6 x as long as wide, not expanded, with palm very strongly projecting. Pereopod 3 with coxa very elongate, 2.5 x as long as wide. Coxa 4 with junction between ventral and posteroventral borders indistinct. Pereopod 7 with very long basis, 1.85 x as long as wide, with maximal width on proximal 0.25, with very elongate distal lobe (narrowing distally), 0.23 x as long as total length of basis, with propodus short (not longer than merus).
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CB3F888FB0A232B" pageId="73" pageNumber="74" type="description">
<paragraph id="0D3D36A6FFECFFEA6CB3F888FD0A2377" blockId="73.[151,1437,1364,2037]" box="[199,692,1796,1821]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3F888FEE72376" bold="true" box="[199,345,1796,1821]" pageId="73" pageNumber="74">Description.</emphasis>
See
<bibRefCitation id="69134B57FFECFFEA6DFAF888FD0E2377" author="Stoddart" box="[398,688,1796,1821]" pageId="73" pageNumber="74" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry (2004)</bibRefCitation>
.
</paragraph>
<paragraph id="0D3D36A6FFECFFEA6CB3F8ABFB0A232B" blockId="73.[151,1437,1364,2037]" box="[199,1204,1831,1856]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3F8ABFF40232B" bold="true" box="[199,254,1831,1856]" pageId="73" pageNumber="74">Size.</emphasis>
Up to
<quantity id="CA7A9B43FFECFFEA6D3FF8ABFE242354" box="[331,410,1831,1856]" metricMagnitude="-2" metricUnit="m" metricValue="4.6" pageId="73" pageNumber="74" unit="mm" value="46.0">46 mm</quantity>
but most commonly not longer than
<quantity id="CA7A9B43FFECFFEA6F4CF8ABFC392354" box="[824,903,1831,1856]" metricMagnitude="-2" metricUnit="m" metricValue="3.5" pageId="73" pageNumber="74" unit="mm" value="35.0">35 mm</quantity>
(
<bibRefCitation id="69134B57FFECFFEA6FE1F8ABFB16232B" author="Stoddart" box="[917,1192,1831,1856]" pageId="73" pageNumber="74" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
).
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFECFFEA6CB3F8C0FB53239F" pageId="73" pageNumber="74" type="distribution">
<paragraph id="0D3D36A6FFECFFEA6CB3F8C0FB53239F" blockId="73.[151,1437,1364,2037]" pageId="73" pageNumber="74">
<emphasis id="3FF6EAB4FFECFFEA6CB3F8C0FD89230E" bold="true" box="[199,567,1868,1893]" pageId="73" pageNumber="74">Distribution and depth range.</emphasis>
South Atlantic (
<bibRefCitation id="69134B57FFECFFEA6E8EF8C0FC62230F" author="Quadra" box="[762,988,1868,1893]" pageId="73" pageNumber="74" refString="Quadra, A., Sorrentino, R., Senna, A. R. &amp; Serejo, C. S. (2014) First record of Eurythenes thurstoni Stoddart &amp; Lowry (2004). (Crustacea: Amphipoda: Lysianassoidea) from the South Mid-Atlantic Ridge. Latin American Journal of Aquatic Research, 42 (2), 376 - 380. http: // dx. doi. org / 10.3856 / vol 42 - issue 2 - fulltext- 8" type="journal article" year="2014">
Quadra
<emphasis id="3FF6EAB4FFECFFEA6F2DF8C1FC28230F" box="[857,918,1868,1892]" italics="true" pageId="73" pageNumber="74">et al.</emphasis>
2014
</bibRefCitation>
),
<collectingCountry id="75957636FFECFFEA6F87F8C0FBE3230E" box="[1011,1117,1868,1893]" name="Australia" pageId="73" pageNumber="74">Australia</collectingCountry>
,
<collectingCountry id="75957636FFECFFEA6818F8C0FB62230E" box="[1132,1244,1868,1893]" name="Indonesia" pageId="73" pageNumber="74">Indonesia</collectingCountry>
, Loyalty Islands Basin,
<collectingCountry id="75957636FFECFFEA6C9AF8E3FE7223EC" box="[238,460,1903,1928]" name="Wallis and Futuna" pageId="73" pageNumber="74">Wallis and Futuna</collectingCountry>
Islands,
<collectingCountry id="75957636FFECFFEA6E30F8FCFD3223E3" box="[580,652,1904,1928]" name="Tonga" pageId="73" pageNumber="74">Tonga</collectingCountry>
, Tasman Sea, South Tasmania,
<collectingCountry id="75957636FFECFFEA6869F8FCFB0123E3" box="[1053,1215,1903,1928]" name="New Zealand" pageId="73" pageNumber="74">New Zealand</collectingCountry>
, Gulf of
<collectingCountry id="75957636FFECFFEA6934F8E3FA2623E3" box="[1344,1432,1903,1928]" name="Mexico" pageId="73" pageNumber="74">Mexico</collectingCountry>
,
<collectingCountry id="75957636FFECFFEA6CE3F818FE9F23C6" box="[151,289,1940,1965]" name="Guadeloupe" pageId="73" pageNumber="74">Guadeloupe</collectingCountry>
,
<quantity id="CA7A9B43FFECFFEA6D58F818FE0523C7" box="[300,443,1940,1965]" metricMagnitude="3" metricUnit="m" metricValue="1.255" metricValueMax="1.96" metricValueMin="0.55" pageId="73" pageNumber="74" unit="m" value="1255.0" valueMax="1960.0" valueMin="550.0">5501960 m</quantity>
, exceptionally as shallow as
<quantity id="CA7A9B43FFECFFEA6E8BF818FCF823C7" box="[767,838,1940,1964]" metricMagnitude="2" metricUnit="m" metricValue="1.28" pageId="73" pageNumber="74" unit="m" value="128.0">128 m</quantity>
(
<bibRefCitation id="69134B57FFECFFEA6F20F818FBD823C7" author="Stoddart" box="[852,1126,1940,1965]" pageId="73" pageNumber="74" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
).
<bibRefCitation id="69134B57FFECFFEA680CF818FA9D23C6" author="Barnard" box="[1144,1315,1940,1965]" pageId="73" pageNumber="74" refString="Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128." type="journal article" year="1961">Barnard (1961)</bibRefCitation>
records
<taxonomicName id="CA824D25FFECFFEA69F0F819FF4223BB" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="thurstoni">
<emphasis id="3FF6EAB4FFECFFEA69F0F819FF4223BB" italics="true" pageId="73" pageNumber="74">E. thurstoni</emphasis>
</taxonomicName>
under the name
<taxonomicName id="CA824D25FFECFFEA6DCFF835FD9723BB" box="[443,553,1976,2000]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="73" pageNumber="74" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFECFFEA6DCFF835FD9723BB" box="[443,553,1976,2000]" italics="true" pageId="73" pageNumber="74">E. gryllus</emphasis>
</taxonomicName>
at much deeper (abyssal) stations (
<bibRefCitation id="69134B57FFECFFEA6FCCF834FB7323BB" author="Stoddart" box="[952,1229,1976,2001]" pageId="73" pageNumber="74" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
), but it is possible that they were mesopelagic or upper bathypelagic specimens caught when the trawl was hauled up.
</paragraph>
</subSubSection>
<subSubSection id="4598652DFFEFFFE96CB3FF1BFA3924BE" pageId="74" pageNumber="75" type="biology_ecology">
<paragraph id="0D3D36A6FFEFFFE96CB3FF1BFA3924BE" blockId="74.[151,1436,151,213]" pageId="74" pageNumber="75">
<emphasis id="3FF6EAB4FFEFFFE96CB3FF1BFE9924DB" bold="true" box="[199,295,151,176]" pageId="74" pageNumber="75">Biology.</emphasis>
The species is a scavenger, which often enters baited traps. It is frequently captured in midwater trawls (
<bibRefCitation id="69134B57FFEFFFE96C9EFF30FE4724BF" author="Stoddart" box="[234,505,188,213]" pageId="74" pageNumber="75" refString="Stoddart, H. E. &amp; Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468." type="journal article" year="2004">Stoddart &amp; Lowry 2004</bibRefCitation>
) suggesting a more pelagic life style than the
<taxonomicName id="CA824D25FFEFFFE96F8FFF30FBC724BF" box="[1019,1145,188,212]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="74" pageNumber="75" phylum="Arthropoda" rank="genus">
<emphasis id="3FF6EAB4FFEFFFE96F8FFF30FBC724BF" box="[1019,1145,188,212]" italics="true" pageId="74" pageNumber="75">Eurythenes</emphasis>
</taxonomicName>
of the
<taxonomicName id="CA824D25FFEFFFE968B3FF30FAAB24BF" box="[1223,1301,188,212]" class="Malacostraca" family="Lysianassidae" genus="Eurythenes" kingdom="Animalia" order="Amphipoda" pageId="74" pageNumber="75" phylum="Arthropoda" rank="species" species="gryllus">
<emphasis id="3FF6EAB4FFEFFFE968B3FF30FAAB24BF" box="[1223,1301,188,212]" italics="true" pageId="74" pageNumber="75">gryllus</emphasis>
</taxonomicName>
-complex.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,146 @@
<document ID-DOI="http://dx.doi.org/10.3897/italianbotanist.15.103217" ID-Pensoft-Pub="2531-4033-15-137" ID-Pensoft-UUID="A0ED26AE219752299C11A734C6D0F79E" ModsDocID="2531-4033-15-137" checkinTime="1686864349411" checkinUser="pensoft" docAuthor="Marletta, Giuliana &amp; Lombardo, Andrea" docDate="2023" docId="852B927E20DC5A5990A3D5C93C024D60" docLanguage="en" docName="ItalBot 15: 137-163" docOrigin="Italian Botanist 15" docPubDate="2023-06-15" docSource="http://dx.doi.org/10.3897/italianbotanist.15.103217" docTitle="Ericaria crinita Molinari &amp; Guiry 2020" docType="treatment" docVersion="1" id="A0ED26AE219752299C11A734C6D0F79E" lastPageNumber="137" masterDocId="A0ED26AE219752299C11A734C6D0F79E" masterDocTitle="The Fucales (Ochrophyta, Phaeophyceae) of the Island of Pantelleria (Sicily Channel, Mediterranean Sea): a new contribution" masterLastPageNumber="163" masterPageNumber="137" pageNumber="137" updateTime="1686864349411" updateUser="pensoft">
<mods:mods id="1C5CE883F61E75660D2FE6A3A985A00B" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="8D695CA70A6B74A0EBD4AF35B9E37C54">
<mods:title id="8C1F691C9AEFF2956A18A651CE198040">The Fucales (Ochrophyta, Phaeophyceae) of the Island of Pantelleria (Sicily Channel, Mediterranean Sea): a new contribution</mods:title>
</mods:titleInfo>
<mods:name id="B3C573F559122DB9441D06E56FFFB7D2" type="personal">
<mods:role id="61FAD9BD48021D00D973CC5A5157CF12">
<mods:roleTerm id="22696D869D7EB6B361184A445917F2A7">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3DA1C90394439A17B207005BED2580DA">Marletta, Giuliana</mods:namePart>
<mods:affiliation id="62EC9D08093E1B79033237CF81BEC82D">Department of Life and Environmental Sciences, Polytechnic University of Marche, Via Brecce Bianche 60131 Ancona, Italy</mods:affiliation>
<mods:nameIdentifier id="CD2B1625FEF36744B23ACE3E9E15D9D4" type="email">g.marletta@univpm.it</mods:nameIdentifier>
</mods:name>
<mods:name id="7313743A6C9C8E27143511DA33E327B5" type="personal">
<mods:role id="CB5B273C110AD17E9052B9815DED3EBC">
<mods:roleTerm id="6DA01E885B4B7480C830D2DA57C66FAC">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="612D7B79DD7FABE45E3AF7B9C749A1BA">Lombardo, Andrea</mods:namePart>
<mods:affiliation id="3ADB8320288902FAFE583B5B3E91DB92">Department of Biological, Geological and Environmental Sciences, University of Catania, 95124 Catania, Italy</mods:affiliation>
</mods:name>
<mods:typeOfResource id="43AA7E546170B278A9CA073F336D48A4">text</mods:typeOfResource>
<mods:relatedItem id="C1EA327A5B97F262EAFA8EAB8797A1C8" type="host">
<mods:titleInfo id="26F6C0B1853445E68299971C2330E99A">
<mods:title id="53E404527D9A1D085364133D11385E2F">Italian Botanist</mods:title>
</mods:titleInfo>
<mods:part id="5FADFCECBF4CED65CE48751D04155AEB">
<mods:date id="49AD6B1A61E2108EE4DEABBA2661A6A1">2023</mods:date>
<mods:detail id="CB7F8AEE9A3D4BA594607726A27F5356" type="pubDate">
<mods:number id="0D94C1D84992E1426FA01DCE59BDE636">2023-06-15</mods:number>
</mods:detail>
<mods:detail id="5A0F29219E4873D62AA294B4DA0DF79F" type="volume">
<mods:number id="09B7198283ADCC090ECCDBA0BF80DC61">15</mods:number>
</mods:detail>
<mods:extent id="CF1A3F656009CBC46AEBA591551F3274" unit="page">
<mods:start id="34274ACA6A8873EB866F650276D75CE2">137</mods:start>
<mods:end id="96DD00F6B4FEE8015B977ABE6C7513A4">163</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="31D65157DF9CC8246084955AB4022D8E">
<mods:url id="C5C412434EEA0F2BF35F469677F8B3B6">http://dx.doi.org/10.3897/italianbotanist.15.103217</mods:url>
</mods:location>
<mods:classification id="493F3580A6C3DFD391FD7337BC0C1EDF">journal article</mods:classification>
<mods:identifier id="9C5897BF3F20513EE1C9891B21A758C4" type="DOI">http://dx.doi.org/10.3897/italianbotanist.15.103217</mods:identifier>
<mods:identifier id="9DE3096F41D65839B0CC569C832ABC69" type="Pensoft-Pub">2531-4033-15-137</mods:identifier>
<mods:identifier id="2876D29D22B660028515F57F8BA9D9B8" type="Pensoft-UUID">A0ED26AE219752299C11A734C6D0F79E</mods:identifier>
</mods:mods>
<treatment id="852B927E20DC5A5990A3D5C93C024D60" LSID="urn:lsid:plazi:treatment:852B927E20DC5A5990A3D5C93C024D60" httpUri="http://treatment.plazi.org/id/852B927E20DC5A5990A3D5C93C024D60" lastPageNumber="137" pageId="0" pageNumber="137">
<subSubSection id="F982556B23089265D3EEE44CC13A1C63" pageId="0" pageNumber="137" type="nomenclature">
<paragraph id="749ED874B349E359E999C9CA1A41CD8C" pageId="0" pageNumber="137">
<taxonomicName id="C108EDB70103B1D70CDA0B6A86BF34A4" LSID="852B927E-20DC-5A59-90A3-D5C93C024D60" authority="(Duby) Molinari &amp; Guiry" authorityName="Molinari &amp; Guiry" authorityYear="2020" baseAuthorityName="Duby" family="Fucaceae" genus="Ericaria" higherTaxonomySource="treatment-meta" kingdom="Chromista" lsidName="Ericaria crinita" order="Fucales" pageId="0" pageNumber="137" rank="species" species="crinita">Ericaria crinita (Duby) Molinari &amp; Guiry</taxonomicName>
</paragraph>
</subSubSection>
<subSubSection id="0970DE62BD04DBA7A957A9334CF2CAE6" pageId="0" pageNumber="137" type="description">
<paragraph id="3D817442B16D7E6DE6BC5508008E1B0F" pageId="0" pageNumber="137">
<figureCitation id="CDB8B8EFDCD3DFBB44E1046EC33F1E1F" captionStart="Figure 13" captionStartId="F13" captionText="Figure 13. Ericaria crinita A habit B detail of receptacles C detail of prominent apex with spinose appendages." figureDoi="10.3897/italianbotanist.15.103217.figure13" httpUri="https://binary.pensoft.net/fig/864667" pageId="0" pageNumber="137">Fig. 13A-C</figureCitation>
</paragraph>
</subSubSection>
<subSubSection id="800A64242CC288B33F0057D07D45FEC2" pageId="0" pageNumber="137" type="reference_group">
<paragraph id="D65C4470EC1C194C81AED7BAF0B69B7E" pageId="0" pageNumber="137">
<taxonomicName id="376460D58058D053105D625A09707F22" authorityName="Duby" authorityYear="1830" class="Phaeophyceae" family="Fucaceae" genus="Cystoseira" higherTaxonomySource="CoL" kingdom="Chromista" lsidName="Cystoseira crinita" order="Fucales" pageId="0" pageNumber="137" phylum="Ochrophyta" rank="species" species="crinita">Cystoseira crinita</taxonomicName>
Duby. Basionym.
</paragraph>
<paragraph id="15EBDA6043441C1FC2CDE2CA5323A7F2" pageId="0" pageNumber="137">
<taxonomicName id="460422F44C81EB2CEFCAD53E36A043EF" authorityName="C.Agardh" authorityYear="1820" class="Phaeophyceae" family="Fucaceae" genus="Cystoseira" higherTaxonomySource="CoL" kingdom="Chromista" lsidName="Cystoseira granulata" order="Fucales" pageId="0" pageNumber="137" phylum="Ochrophyta" rank="species" species="granulata">Cystoseira granulata</taxonomicName>
Schousboe,
<taxonomicName id="BCD81B47971C2AB81768155A8F954DB6" class="Phaeophyceae" family="Fucaceae" genus="Fucus" higherTaxonomySource="CoL" kingdom="Chromista" lsidName="Fucus crinitus" order="Fucales" pageId="0" pageNumber="137" phylum="Ochrophyta" rank="species" species="crinitus">Fucus crinitus</taxonomicName>
Desfontaines,
<taxonomicName id="C90F417997BC4762A87B4667B58BF60D" authorityName="Orellana &amp; Sanson" authorityYear="2019" baseAuthorityName="Duby" family="Fucaceae" genus="Carpodesmia" higherTaxonomySource="treatment-meta" kingdom="Chromista" lsidName="Carpodesmia crinita" order="Fucales" pageId="0" pageNumber="137" rank="species" species="crinita">Carpodesmia crinita</taxonomicName>
(Duby) Orellana &amp;
<normalizedToken id="EF5B13586133F56C363C01CFD2554791" originalValue="Sansón">Sanson</normalizedToken>
. Synonyms.
</paragraph>
</subSubSection>
<subSubSection id="7D7FEDA19BB9FB436CB0805F520AD91A" pageId="0" pageNumber="137" type="morphology of specimens from pantelleria">
<paragraph id="1417A2689F5C84595610A1BB9405375A" pageId="0" pageNumber="137">Morphology of specimens from Pantelleria.</paragraph>
<paragraph id="52FBA93D4B56F1BAA710D864A7F2B752" pageId="0" pageNumber="137">
<taxonomicName id="E2348AA8399FC820EB54AF38D447178D" lsidName="E. crinita" pageId="0" pageNumber="137" rank="species" species="crinita">
<emphasis id="754B8181671FD6C85AAE7661162E9155" italics="true" pageId="0" pageNumber="137">E. crinita</emphasis>
</taxonomicName>
is a caespitose species, adhering to the substrate by an irregular discoid holdfast, from which several cylindrical and knotted axes are issued. The apices are protruding and covered by spinose appendages. Primary branches are cylindrical, with a pyramidal habit. Higher order branches are cylindrical, thin, more or less twisted and usually devoid of spines. During the monitoring activities, this species was found fertile. Receptacles are borne on terminal branchlets; they are compact, cylindrical, swollen, single or once branched, usually without spiny appendages.
</paragraph>
</subSubSection>
<subSubSection id="7EB4E80C5E3C6A0CBFED558914028B7B" pageId="0" pageNumber="137" type="habitat">
<paragraph id="168DFEB9F598B0D59926B7069662E902" pageId="0" pageNumber="137">Habitat.</paragraph>
<paragraph id="9EBBD9094E713B891C8054BAED4BE75F" pageId="0" pageNumber="137">This species was observed during snorkelling activities at Martingana and Arenella, in shallow (0.5-3 m) and sheltered habitats.</paragraph>
</subSubSection>
<subSubSection id="B3F3D923D652E9B2753726D163029789" pageId="0" pageNumber="137" type="distribution">
<paragraph id="987E3E796A856405348E93511EF9A2E5" pageId="0" pageNumber="137">Distribution.</paragraph>
<paragraph id="FB8551A4C5934CD68AE3033A01A9EE65" pageId="0" pageNumber="137">
This species is widespread in the Mediterranean Sea and Canary Islands (
<bibRefCitation id="E492B3DFB9F9FC233BFF339DED939C44" author="Blanfune, A" journalOrPublisher="Sargassaceae, Fucales, Phaeophyceae. Presses Universitaries de Provence" pageId="0" pageNumber="137" refId="B4" refString="Blanfune, A, Verlaque, M, Boudouresque, CF, Rozis, E, Thibaut, T, 2022. Les forets marines de France et de Mediterranee. Guide de determination des especes-ingenieurs. Sargassaceae, Fucales, Phaeophyceae. Presses Universitaries de Provence" title="Les forets marines de France et de Mediterranee. Guide de determination des especes-ingenieurs." year="2022">
<normalizedToken id="7FFC1D56C6068D554057611F0E25FE76" originalValue="Blanfuné">Blanfune</normalizedToken>
et al. 2022
</bibRefCitation>
).
</paragraph>
</subSubSection>
<subSubSection id="B172298BE07378ACAE09848AC9FB9974" pageId="0" pageNumber="137" type="remarks">
<paragraph id="E8EE1635EEC6709A4A931AFDBE53C8E1" pageId="0" pageNumber="137">Remarks.</paragraph>
<paragraph id="C10A67E501F1EDA409AB663B5F632C0D" pageId="0" pageNumber="137">
This species was found by
<bibRefCitation id="9BC3DECFC50B61B366EC7C3CC9A31DC8" DOI="https://doi.org/10.1080/11263507209426550" author="Giaccone, G" journalOrPublisher="Giornale Botanico Italiano" pageId="0" pageNumber="137" pagination="211 - 229" refId="B13" refString="Giaccone, G, Scammacca, B, Cinelli, F, Sartoni, G, Furnari, G, 1972. Studio preliminare sulla tipologia della vegetazione sommersa del Canale di Sicilia e isole vicine. Giornale Botanico Italiano 106 (4): 211 - 229, DOI: https://doi.org/10.1080/11263507209426550" title="Studio preliminare sulla tipologia della vegetazione sommersa del Canale di Sicilia e isole vicine." url="https://doi.org/10.1080/11263507209426550" volume="106" year="1972">Giaccone et al. (1972)</bibRefCitation>
in several sites of the island. Subsequently, it was not reported by
<bibRefCitation id="6974759A8459727F30F7CC22EE5DD0E2" DOI="https://doi.org/10.1127/0029-5035/2004/0079-0447" author="Alongi, G" journalOrPublisher="Nova Hedwigia" pageId="0" pageNumber="137" pagination="447 - 478" refId="B1" refString="Alongi, G, Catra, M, Cormaci, M, Furnari, G, Serio, D, 2004. Spring marine vegetation on rocky substrata of Pantelleria Island (the Straits of Sicily, Italy). Nova Hedwigia 79 (3-4): 447 - 478, DOI: https://doi.org/10.1127/0029-5035/2004/0079-0447" title="Spring marine vegetation on rocky substrata of Pantelleria Island (the Straits of Sicily, Italy)." url="https://doi.org/10.1127/0029-5035/2004/0079-0447" volume="79" year="2004">Alongi et al. (2004)</bibRefCitation>
. Our record seems to suggest that
<taxonomicName id="54F2ABB05AC157E8BF130911A032FA7A" lsidName="E. crinita" pageId="0" pageNumber="137" rank="species" species="crinita">
<emphasis id="D45C2DE4EA5A9B9A9BD3D8CFAB7ECA3B" italics="true" pageId="0" pageNumber="137">E. crinita</emphasis>
</taxonomicName>
might be in a phase of recovery and expansion on the island. According to
<bibRefCitation id="C8DE183179209D995ED2C37110334FBA" DOI="https://doi.org/10.1080/09670262.2022.2126894" author="Neiva, J" journalOrPublisher="Cryptogamie, Algologie" pageId="0" pageNumber="137" refId="B21" refString="Neiva, J, Bermejo, R, Medrano, A, Capdevila, P, MillaFigueras, D, Afonso, P, Ballesteros, E, Sabour, B, Serio, D, Nobrega, E, Soares, J, Valdazo, J, Tuya, F, Mulas, M, Israel, A, Sadogurska, SS, Guiry, MD, Pearson, GA, Serrao, EA, 2022. DNA barcoding reveals cryptic diversity, taxonomic conflicts and novel biogeographical insights in Cystoseira s.l. (Phaeophyceae). European Journal of Phycology: 1-25. https://doi.org/10.1080/09670262.2022.2126894" title="DNA barcoding reveals cryptic diversity, taxonomic conflicts and novel biogeographical insights in Cystoseira s. l. (Phaeophyceae). European Journal of Phycology: 1 - 25." url="https://doi.org/10.1080/09670262.2022.2126894" year="2022">Neiva et al. (2022)</bibRefCitation>
, this entity is part of the
<taxonomicName id="68F5954515EBF3E21A8E0E92C6D57A6A" authorityName="Molinari &amp; Guiry" authorityYear="2020" baseAuthorityName="Duby" family="Fucaceae" genus="Ericaria" kingdom="Chromista" lsidName="Ericaria crinita" order="Fucales" pageId="0" pageNumber="137" rank="species" species="crinita">
<emphasis id="32E702F596061190523878107C77DC08" italics="true" pageId="0" pageNumber="137">Ericaria crinita</emphasis>
</taxonomicName>
complex, which includes samples identified as
<taxonomicName id="297ECBF49117A29D10F9BE1F5450129E" lsidName="E. crinita" pageId="0" pageNumber="137" rank="species" species="crinita">
<emphasis id="155F927196F8C4E8F5D14C816DB0B7B1" italics="true" pageId="0" pageNumber="137">E. crinita</emphasis>
</taxonomicName>
,
<taxonomicName id="6BD54AA2DA8C083B7BE149E71688A68C" lsidName="E. barbatula" pageId="0" pageNumber="137" rank="species" species="barbatula">
<emphasis id="0788CDB42E4638B06740F34C00DDF8C3" italics="true" pageId="0" pageNumber="137">E. barbatula</emphasis>
</taxonomicName>
and
<taxonomicName id="B1C6A433651077645E83EAD8CB7ED7D6" lsidName="E. giacconei" pageId="0" pageNumber="137" rank="species" species="giacconei">
<emphasis id="5840542D33565D3CDEA510A301E11398" italics="true" pageId="0" pageNumber="137">E. giacconei</emphasis>
</taxonomicName>
.
</paragraph>
<caption id="C7E1D300735CA93C08DE21838278A41D" doi="10.3897/italianbotanist.15.103217.figure13" httpUri="https://binary.pensoft.net/fig/864667" pageId="0" pageNumber="137" start="Figure 13" startId="F13">
<paragraph id="EE041B32668CEE896FEE00AAFFE5EF54" pageId="0" pageNumber="137">
<emphasis id="BB213818B5DF1879DA10094CFD1F0764" bold="true" pageId="0" pageNumber="137">Figure 13.</emphasis>
<taxonomicName id="7BE1650A9C872B5A5CEDF522AAB7B49D" authorityName="Molinari &amp; Guiry" authorityYear="2020" baseAuthorityName="Duby" family="Fucaceae" genus="Ericaria" kingdom="Chromista" lsidName="Ericaria crinita" order="Fucales" pageId="0" pageNumber="137" rank="species" species="crinita">
<emphasis id="63F30B5923BC87D9D412B704C8CDB8F1" italics="true" pageId="0" pageNumber="137">Ericaria crinita</emphasis>
</taxonomicName>
<emphasis id="F739B20A0A828249FB18DFA4A86C7654" bold="true" pageId="0" pageNumber="137">A</emphasis>
habit
<emphasis id="176904FAB2652150D866301589308156" bold="true" pageId="0" pageNumber="137">B</emphasis>
detail of receptacles
<emphasis id="54D6E1A28801F0FC933FEB05B0C15CFC" bold="true" pageId="0" pageNumber="137">C</emphasis>
detail of prominent apex with spinose appendages.
</paragraph>
</caption>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,403 @@
<document ID-DOI="http://dx.doi.org/10.3897/CompCytogen.v13i4.47395" ID-GBIF-Dataset="d67483c5-9733-4c64-96b7-3146b4e199fa" ID-PMC="PMC6879664" ID-Pensoft-Pub="1993-078X-4-367" ID-Pensoft-UUID="009213FDF23A5543B5D82B35D8BD0706" ID-PubMed="31798796" ID-ZooBank="32E091B44FDF4FCA89373A83AA387DFB" ModsDocID="1993-078X-4-367" checkinTime="1574358771261" checkinUser="pensoft" docAuthor="Nokkala, Christina, Kuznetsova, Valentina G., Rinne, Veikko &amp; Nokkala, Seppo" docDate="2019" docId="852BE45BEDBF503ABA01EF4CAC31553F" docLanguage="en" docName="CompCytogen 13(4): 367-382" docOrigin="Comparative Cytogenetics 13 (4)" docSource="http://dx.doi.org/10.3897/CompCytogen.v13i4.47395" docTitle="Cacopsylla lapponica S. Nokkala &amp; Ch. Nokkala, sp. nov." docType="treatment" docVersion="4" id="009213FDF23A5543B5D82B35D8BD0706" lastPageNumber="367" masterDocId="009213FDF23A5543B5D82B35D8BD0706" masterDocTitle="Description of two new species of the genus Cacopsylla Ossiannilsson, 1970 (Hemiptera, Psylloidea) from northern Fennoscandia recognized by morphology, cytogenetic characters and COI barcode sequence" masterLastPageNumber="382" masterPageNumber="367" pageNumber="367" updateTime="1668127288575" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Description of two new species of the genus Cacopsylla Ossiannilsson, 1970 (Hemiptera, Psylloidea) from northern Fennoscandia recognized by morphology, cytogenetic characters and COI barcode sequence</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Nokkala, Christina</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Kuznetsova, Valentina G.</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Rinne, Veikko</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Nokkala, Seppo</mods:namePart>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Comparative Cytogenetics</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2019</mods:date>
<mods:detail type="volume">
<mods:number>13</mods:number>
</mods:detail>
<mods:detail type="issue">
<mods:number>4</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>367</mods:start>
<mods:end>382</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/CompCytogen.v13i4.47395</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/CompCytogen.v13i4.47395</mods:identifier>
<mods:identifier type="Pensoft-Pub">1993-078X-4-367</mods:identifier>
<mods:identifier type="ZooBank">32E091B44FDF4FCA89373A83AA387DFB</mods:identifier>
<mods:identifier type="Pensoft-UUID">009213FDF23A5543B5D82B35D8BD0706</mods:identifier>
</mods:mods>
<treatment ID-GBIF-Taxon="160511110" LSID="urn:lsid:plazi:treatment:852BE45BEDBF503ABA01EF4CAC31553F" httpUri="http://treatment.plazi.org/id/852BE45BEDBF503ABA01EF4CAC31553F" lastPageNumber="367" pageId="0" pageNumber="367">
<subSubSection pageId="0" pageNumber="367" type="nomenclature">
<paragraph pageId="0" pageNumber="367">
<taxonomicName LSID="852BE45B-EDBF-503A-BA01-EF4CAC31553F" authority="S. Nokkala &amp; Ch. Nokkala" class="Insecta" family="Psyllidae" genus="Cacopsylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Cacopsylla lapponica" order="Hemiptera" pageId="0" pageNumber="367" phylum="Arthropoda" rank="species" species="lapponica">Cacopsylla lapponica S. Nokkala &amp; Ch. Nokkala</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="367">sp. nov.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="367" type="type material">
<paragraph pageId="0" pageNumber="367">Type material.</paragraph>
<paragraph pageId="0" pageNumber="367">
<emphasis bold="true" italics="true" pageId="0" pageNumber="367">Holotype</emphasis>
: Female; Finland, Utsjoki Ailigas;
<geoCoordinate degrees="69" direction="north" minutes="53" orientation="latitude" precision="15" seconds="51" value="69.8975">
69°53'51
<normalizedToken originalValue="">''</normalizedToken>
N
</geoCoordinate>
,
<geoCoordinate degrees="27" direction="east" minutes="03" orientation="longitude" precision="15" seconds="32" value="27.058887">
27°03'32
<normalizedToken originalValue="">''</normalizedToken>
E
</geoCoordinate>
; 320 m; 05 Aug 2016; Seppo &amp; Christina Nokkala leg.; above tree line, host
<taxonomicName class="Magnoliopsida" family="Ericaceae" genus="Vaccinium" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Vaccinium uliginosum" order="Ericales" pageId="0" pageNumber="367" phylum="Tracheophyta" rank="species" species="uliginosum">
<emphasis italics="true" pageId="0" pageNumber="367">Vaccinium uliginosum</emphasis>
</taxonomicName>
; http://mus.utu.fi/ZMUT.TYPE794.
<emphasis bold="true" italics="true" pageId="0" pageNumber="367">Paratypes</emphasis>
: 9 females,1male; Finland, Utsjoki Ailigas;
<geoCoordinate degrees="69" direction="north" minutes="53" orientation="latitude" precision="15" seconds="51" value="69.8975">
69°53'51
<normalizedToken originalValue="">''</normalizedToken>
N
</geoCoordinate>
,
<geoCoordinate degrees="27" direction="east" minutes="03" orientation="longitude" precision="15" seconds="32" value="27.058887">
27°03'32
<normalizedToken originalValue="">''</normalizedToken>
E
</geoCoordinate>
; 320 m; 05 Aug 2016; Seppo &amp; Christina Nokkala leg.; above tree line, host
<taxonomicName class="Magnoliopsida" family="Ericaceae" genus="Vaccinium" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Vaccinium uliginosum" order="Ericales" pageId="0" pageNumber="367" phylum="Tracheophyta" rank="species" species="uliginosum">
<emphasis italics="true" pageId="0" pageNumber="367">Vaccinium uliginosum</emphasis>
</taxonomicName>
; http://mus.utu.fi/ZMUT.TYPE795 - http://mus.utu.fi/ZMUT.TYPE797. The holotype and paratypes are deposited at the Zoological Museum, University of Turku, Finland.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="367" type="description">
<paragraph pageId="0" pageNumber="367">Description.</paragraph>
<paragraph pageId="0" pageNumber="367">
Adult coloration resembles that of cohabitating
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
, but is much paler with dark markings. Wings are very pale yellow and transparent with dark veins (
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Adult females of C. lapponica sp. nov. (above) and C. myrtilli (below) showing conspicuously different sized wings." httpUri="https://binary.pensoft.net/fig/357942" pageId="0" pageNumber="367">Fig. 3</figureCitation>
). Adults are clearly smaller in size (
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. Adult females of C. lapponica sp. nov. (above) and C. myrtilli (below) showing conspicuously different sized wings." httpUri="https://binary.pensoft.net/fig/357942" pageId="0" pageNumber="367">Fig. 3</figureCitation>
), the overall length of males being 1.9-2.1 mm (N = 8) and females 2.3-2.5 mm (N = 10) compared to 2.75-3.25 mm of
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
females (
<bibRefCitation author="Ossiannilsson, F" journalOrPublisher="Fauna Entomologica Scandinavica" pageId="0" pageNumber="367" pagination="1 - 346" refId="B10" refString="Ossiannilsson, F, 1992. The Psylloidea (Homoptera) of Fennoskandia and Denmark. Fauna Entomologica Scandinavica 26: 1 - 346" title="The Psylloidea (Homoptera) of Fennoskandia and Denmark." volume="26" year="1992">Ossiannilsson 1992</bibRefCitation>
).
</paragraph>
<caption httpUri="https://binary.pensoft.net/fig/357942" pageId="0" pageNumber="367" start="Figure 3" startId="F3">
<paragraph pageId="0" pageNumber="367">
<emphasis bold="true" pageId="0" pageNumber="367">Figure 3.</emphasis>
Adult females of
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
sp. nov. (above) and
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
(below) showing conspicuously different sized wings.
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="367" type="diagnosis">
<paragraph pageId="0" pageNumber="367">Diagnosis.</paragraph>
<paragraph pageId="0" pageNumber="367">
The most conspicuous difference in external morphology between
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
and
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
is the length of wings. In
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
, the wing is much shorter than in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
(
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Comparison of forewings in C. borealis sp. nov., C. lapponica sp. nov., C. ledi and C. myrtilli." httpUri="https://binary.pensoft.net/fig/357943" pageId="0" pageNumber="367">Fig. 4</figureCitation>
). In
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
, the wings are just slightly longer than the abdomen, while in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
the wings are almost twice as long as the abdomen.
</paragraph>
<caption httpUri="https://binary.pensoft.net/fig/357943" pageId="0" pageNumber="367" start="Figure 4" startId="F4">
<paragraph pageId="0" pageNumber="367">
<emphasis bold="true" pageId="0" pageNumber="367">Figure 4.</emphasis>
Comparison of forewings in
<taxonomicName lsidName="C. borealis" pageId="0" pageNumber="367" rank="species" species="borealis">
<emphasis italics="true" pageId="0" pageNumber="367">C. borealis</emphasis>
</taxonomicName>
sp. nov.,
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
sp. nov.,
<taxonomicName lsidName="C. ledi" pageId="0" pageNumber="367" rank="species" species="ledi">
<emphasis italics="true" pageId="0" pageNumber="367">C. ledi</emphasis>
</taxonomicName>
and
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
.
</paragraph>
</caption>
<paragraph pageId="0" pageNumber="367">
According to the species identification key, the distribution of surface spinules in the s+cs cell in the forewing has been used to separate the closely related species of
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
and
<taxonomicName lsidName="C. ledi" pageId="0" pageNumber="367" rank="species" species="ledi">
<emphasis italics="true" pageId="0" pageNumber="367">C. ledi</emphasis>
</taxonomicName>
(Ossialnnilsson, 1992). In
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
surface spinules cover the s+cs cell entirely, while in
<taxonomicName lsidName="C. ledi" pageId="0" pageNumber="367" rank="species" species="ledi">
<emphasis italics="true" pageId="0" pageNumber="367">C. ledi</emphasis>
</taxonomicName>
the spinules are absent in the apical third of the cell. In
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
(
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. The distribution of surface spinules in the s + cs cell in the forewing a C. lapponica sp. nov. The distribution of spinules is similar to that of C. myrtilli b C. borealis sp. nov. The distribution of spinules is similar to that of C. ledi." httpUri="https://binary.pensoft.net/fig/357944" pageId="0" pageNumber="367">Fig. 5a</figureCitation>
), the distribution of spinules is similar to that found in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
.
</paragraph>
<caption httpUri="https://binary.pensoft.net/fig/357944" pageId="0" pageNumber="367" start="Figure 5" startId="F5">
<paragraph pageId="0" pageNumber="367">
<emphasis bold="true" pageId="0" pageNumber="367">Figure 5.</emphasis>
The distribution of surface spinules in the s+cs cell in the forewing
<emphasis bold="true" pageId="0" pageNumber="367">a</emphasis>
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
sp. nov. The distribution of spinules is similar to that of
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
<emphasis bold="true" pageId="0" pageNumber="367">b</emphasis>
<taxonomicName lsidName="C. borealis" pageId="0" pageNumber="367" rank="species" species="borealis">
<emphasis italics="true" pageId="0" pageNumber="367">C. borealis</emphasis>
</taxonomicName>
sp. nov. The distribution of spinules is similar to that of
<taxonomicName lsidName="C. ledi" pageId="0" pageNumber="367" rank="species" species="ledi">
<emphasis italics="true" pageId="0" pageNumber="367">C. ledi</emphasis>
</taxonomicName>
.
</paragraph>
</caption>
<paragraph pageId="0" pageNumber="367">
Males can also be differentiated by their paramere structure (
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Male parameres from behind a C. lapponica sp. nov. b C. myrtilli." httpUri="https://binary.pensoft.net/fig/357945" pageId="0" pageNumber="367">Fig. 6</figureCitation>
). In males of
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
, the thickest region is in the middle of paramere viewed from behind (
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Male parameres from behind a C. lapponica sp. nov. b C. myrtilli." httpUri="https://binary.pensoft.net/fig/357945" pageId="0" pageNumber="367">Fig. 6a</figureCitation>
), and a similar region is seen in the apical part of paramere in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
(
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Male parameres from behind a C. lapponica sp. nov. b C. myrtilli." httpUri="https://binary.pensoft.net/fig/357945" pageId="0" pageNumber="367">Fig. 6b</figureCitation>
).
</paragraph>
<caption httpUri="https://binary.pensoft.net/fig/357945" pageId="0" pageNumber="367" start="Figure 6" startId="F6">
<paragraph pageId="0" pageNumber="367">
<emphasis bold="true" pageId="0" pageNumber="367">Figure 6.</emphasis>
Male parameres from behind
<emphasis bold="true" pageId="0" pageNumber="367">a</emphasis>
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
sp. nov.
<emphasis bold="true" pageId="0" pageNumber="367">b</emphasis>
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
.
</paragraph>
</caption>
<paragraph pageId="0" pageNumber="367">
Female
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
are easily distinguished from
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
females by differences in their terminalia structures (
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7</figureCitation>
). In
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
, the circumanal pore ring complex is symmetric, oval-shaped, and proctiger is sharply pointed (
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7a</figureCitation>
), whereas in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
, the same structure is clearly asymmetric and the apical part of proctiger is more rounded (
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7b</figureCitation>
). As shown below, the subgenital plate evenly decreases in width towards the apex in
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
(
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7c</figureCitation>
), while the width strongly decreased halfway of the plate in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
(
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7d</figureCitation>
). In the side view the subgenital plate differs clearly between the species. In
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
, the upper edge runs quite straight and is curved only near the apex (
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7e</figureCitation>
), while in
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
, there is a strong curve already near the middle of the plate (
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Morphology of female genital structures in C. lapponica sp. nov. (a, c, e) and C. myrtilli (b, d, f) a, b dorsal plate, proctiger from above c, d subgenital plate from below e, f genital plates from the left." httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367">Fig. 7f</figureCitation>
).
</paragraph>
<caption httpUri="https://binary.pensoft.net/fig/357946" pageId="0" pageNumber="367" start="Figure 7" startId="F7">
<paragraph pageId="0" pageNumber="367">
<emphasis bold="true" pageId="0" pageNumber="367">Figure 7.</emphasis>
Morphology of female genital structures in
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
sp. nov. (
<emphasis bold="true" pageId="0" pageNumber="367">a, c, e</emphasis>
) and
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
(
<emphasis bold="true" pageId="0" pageNumber="367">b, d, f</emphasis>
)
<emphasis bold="true" pageId="0" pageNumber="367">a, b</emphasis>
dorsal plate, proctiger from above
<emphasis bold="true" pageId="0" pageNumber="367">c, d</emphasis>
subgenital plate from below
<emphasis bold="true" pageId="0" pageNumber="367">e, f</emphasis>
genital plates from the left.
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="367" type="distribution">
<paragraph pageId="0" pageNumber="367">Distribution.</paragraph>
<paragraph pageId="0" pageNumber="367">
Specimens of
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
were found in three locations at high altitude above the tree line in northern Sweden and Finland (Table
<tableCitation captionStartId="T1" httpUri="http://table.plazi.org/id/94249AC026B7B024082137ECDE10D1D0" pageId="0" pageNumber="367" tableUuid="94249AC026B7B024082137ECDE10D1D0">1</tableCitation>
). In all these locations,
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
coexists with
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
on low growing
<taxonomicName lsidName="V. uliginosum" pageId="0" pageNumber="367" rank="species" species="uliginosum">
<emphasis italics="true" pageId="0" pageNumber="367">V. uliginosum</emphasis>
</taxonomicName>
plants in low numbers. As an example, in a sample collected on 6.8.2016 in Utsojki, Ailigas at 320 m altitude, there were 252 specimens of
<taxonomicName lsidName="C. myrtilli" pageId="0" pageNumber="367" rank="species" species="myrtilli">
<emphasis italics="true" pageId="0" pageNumber="367">C. myrtilli</emphasis>
</taxonomicName>
and among them 15 specimens (8 females and 7 males) of
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
, the proportion of
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
being 5.6% of the total. It is obvious, that
<taxonomicName lsidName="C. lapponica" pageId="0" pageNumber="367" rank="species" species="lapponica">
<emphasis italics="true" pageId="0" pageNumber="367">C. lapponica</emphasis>
</taxonomicName>
is a rare alpine species restricted to a high-altitude open habitat.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="367" type="etymology">
<paragraph pageId="0" pageNumber="367">Etymology.</paragraph>
<paragraph pageId="0" pageNumber="367">
The name
<normalizedToken originalValue="“lapponica”">&quot;lapponica&quot;</normalizedToken>
in Latin means &quot;from Lapponia&quot; or
<normalizedToken originalValue="“Lapponian”">&quot;Lapponian&quot;</normalizedToken>
reflecting the restricted distribution of the species to northern Fennoscandia in locations above the tree line.
</paragraph>
</subSubSection>
</treatment>
</document>