plazi/treatments-xml
2
0
Fork 0
Code Issues Releases Activity

added 74

Browse source
This commit is contained in:
maintenance 2024-06-21 12:40:28 +02:00
parent a17ca631db
commit 618d504b97
1502 changed files with 305662 additions and 0 deletions
Download patch file Download diff file Expand all files Collapse all files

358
data/74/C3/4C/74C34C11DF7CD2626C4E2F0DD0920736.xml Normal file
View file

@ -0,0 +1,358 @@
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.364.6288" ID-GBIF-Dataset="83526711-5339-4594-99d2-9fe05215ad4d" ID-PMC="PMC3890663" ID-Pensoft-Pub="1313-2970-364-29" ID-PubMed="24453544" ID-ZBK="295E11F9A48E4CA98C8EDA10904BFBAC" ModsDocAuthor="" ModsDocDate="2013" ModsDocID="1313-2970-364-29" ModsDocOrigin="ZooKeys 364" ModsDocTitle="Pseudouroctonus peccatum, a new scorpion from the Spring Mountains near “Sin City,” Nevada (Scorpiones, Vaejovidae)" checkinTime="1451246546150" checkinUser="pensoft" docAuthor="Tate, Amanda E., Riddle, Rebecca R., Soleglad, Michael E. &amp; Graham, Matthew R." docDate="2013" docId="74C34C11DF7CD2626C4E2F0DD0920736" docLanguage="en" docName="ZooKeys 364: 29-45" docOrigin="ZooKeys 364" docSource="http://dx.doi.org/10.3897/zookeys.364.6288" docTitle="Pseudouroctonus peccatum Tate, Riddle, Soleglad &amp; Graham, 2013, sp. n." docType="treatment" docUuid="0392FDFD-1BC6-4D7D-B80A-C232C9BDEBCB" docUuidSource="ZooBank" docVersion="4" lastPageNumber="34" masterDocId="095DFFD97165505BFC6B1179FFF9FF82" masterDocTitle="Pseudouroctonus peccatum, a new scorpion from the Spring Mountains near &quot; Sin City, &quot; Nevada (Scorpiones, Vaejovidae)" masterLastPageNumber="45" masterPageNumber="29" pageNumber="30" updateTime="1668157217773" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Pseudouroctonus peccatum, a new scorpion from the Spring Mountains near &quot; Sin City, &quot; Nevada (Scorpiones, Vaejovidae)</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Tate, Amanda E.</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Riddle, Rebecca R.</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Soleglad, Michael E.</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Graham, Matthew R.</mods:namePart>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>ZooKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2013</mods:date>
<mods:detail type="volume">
<mods:number>364</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>29</mods:start>
<mods:end>45</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/zookeys.364.6288</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.364.6288</mods:identifier>
<mods:identifier type="Pensoft-Pub">1313-2970-364-29</mods:identifier>
<mods:identifier type="ZBK">295E11F9A48E4CA98C8EDA10904BFBAC</mods:identifier>
<mods:identifier type="ZooBank">295E11F9A48E4CA98C8EDA10904BFBAC</mods:identifier>
</mods:mods>
<treatment ID-GBIF-Taxon="152050202" LSID="urn:lsid:zoobank.org:act:0392FDFD-1BC6-4D7D-B80A-C232C9BDEBCB" httpUri="http://treatment.plazi.org/id/74C34C11DF7CD2626C4E2F0DD0920736" lastPageId="5" lastPageNumber="34" pageId="1" pageNumber="30">
<subSubSection pageId="1" pageNumber="30" type="nomenclature">
<paragraph pageId="1" pageNumber="30">
<taxonomicName LSID="http://zoobank.org/0392FDFD-1BC6-4D7D-B80A-C232C9BDEBCB" class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="1" pageNumber="30" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
<taxonomicNameLabel pageId="1" pageNumber="30">sp. n.</taxonomicNameLabel>
Figs 1-17; Table 1-2
</paragraph>
</subSubSection>
<subSubSection lastPageId="2" lastPageNumber="31" pageId="1" pageNumber="30" type="type material">
<paragraph pageId="1" pageNumber="30">Type material.</paragraph>
<paragraph lastPageId="2" lastPageNumber="31" pageId="1" pageNumber="30">
United States:
<pageBreakToken pageId="2" pageNumber="31" start="start">Nevada</pageBreakToken>
: female holotype, Kyle Canyon Road, Spring Mountains,
<geoCoordinate direction="north" orientation="latitude" precision="5" value="36.2666">36.2666°N</geoCoordinate>
,
<geoCoordinate direction="west" orientation="longitude" precision="5" value="-115.5988">115.5988°W</geoCoordinate>
, 10 May 2013, A.E. Tate, R.R. Riddle, and M.R. Graham leg. (AMNH, MRG1251); paratype, mature male, same location as holotype, A.E. Tate and R.R. Riddle leg. (AMNH, MRG1252); paratype, juvenile female, collected with holotype (AMNH, MRG1222); paratype, juvenile female, same location as holotype, 23 April 2013, A.E. Tate, R.R. Riddle, and D.R. Tate leg. (AMNH, MRG1221); juvenile female, same location as holotype, 2 July 2013, R.R. Riddle leg. (AMNH, MRG1253).
</paragraph>
</subSubSection>
<subSubSection pageId="2" pageNumber="31" type="etymology">
<paragraph pageId="2" pageNumber="31">Etymology.</paragraph>
<paragraph pageId="2" pageNumber="31">
The specific epithet is Latin for
<normalizedToken originalValue="“sin”">&quot;sin&quot;</normalizedToken>
in reference to the proximity of the type locality to Las Vegas, which is known informally as &quot;Sin City.&quot;
</paragraph>
</subSubSection>
<subSubSection lastPageId="3" lastPageNumber="32" pageId="2" pageNumber="31" type="diagnosis">
<paragraph pageId="2" pageNumber="31">Diagnosis.</paragraph>
<paragraph lastPageId="3" lastPageNumber="32" pageId="2" pageNumber="31">
Medium to large sized species for the genus, females reaching 50 mm; pectinal tooth counts 13-14 for females and 15 for males. Hemispermatophore lacking secondary lamellar hook; lamellar hook protrudes somewhat from the lamina base creating a modest basal constriction; lamina terminus with a distinct distal crest. Cheliceral movable finger ventral edge with low-profiled pigmented crenulated teeth; fixed
<pageBreakToken pageId="3" pageNumber="32" start="start">finger</pageBreakToken>
ventral edge with several small flat pigmented protuberances; movable finger dorsal edge with two subdistal (sd) denticles. Chelal movable finger with seven inner denticles (ID). Metasomal segment V somewhat stout in adults, length compared to width 1.908 in females and 1.953 in males.
</paragraph>
</subSubSection>
<subSubSection lastPageId="4" lastPageNumber="33" pageId="3" pageNumber="32" type="description of holotype">
<paragraph pageId="3" pageNumber="32">Description of holotype.</paragraph>
<paragraph pageId="3" pageNumber="32">Color: Carapace, trochanter, femur, patella, tergites, and metasoma have a yellow-orange base color with dark brown to black markings along the carinae of the pedipalp and metasoma. Legs are light yellow. Pedipalp chelae are dark brown in color with darker reddish-brown coloration at the anterior portion of the palm where the fixed finger and movable finger meet. Chelicerae are light yellow on proximal half with dark reddish-brown fingers. Vesicle portion of the telson is yellow-orange with a dark reddish-brown to black aculeus. Pectines and genital operculum are light yellow.</paragraph>
<paragraph pageId="4" pageNumber="33">
<pageBreakToken pageId="4" pageNumber="33" start="start">Morphology</pageBreakToken>
: Carapace: trapezoidal with noticeably emarginated anterior margin; surface finely granular with scattered small granules, with larger granules symmetrically flanking the lateral and median eyes; median furrow is slight and traverses length of carapace; ratio of location of median eyes location (from anterior edge)/carapace length = 0.338. Tergites: surface with small granules on distal 1/3-1/2 of tergites
<normalizedToken originalValue="I–VI">I-VI</normalizedToken>
; tergite VII with two pairs of granular lateral carinae, and a slight median hump. Sternites:
<normalizedToken originalValue="III–VI">III-VI</normalizedToken>
smooth to very finely granular and without carinae; VII with granular ventral lateral carinae on posterior 4/5, median carinal pair essentially obsolete. Spiracles: ellipsoid and with median side rotated 40° away from posterior sternite margin. Genital Operculum: sclerites separated on posterior 1/5. Pectines: tooth count 13/13; middle lamellae 8/8; sensorial areas present on all pectine teeth. Metasoma: ratio of segment I length/width 0.91; segment II length/width 1.00; segment III length/width 1.06; segment IV length/width 1.36; segment V length/width 1.91. Segments
<normalizedToken originalValue="I–IV">I-IV</normalizedToken>
: dorsal carinae are moderately denticulate on segments
<normalizedToken originalValue="I–IV">I-IV</normalizedToken>
and have slightly enlarged distal denticles; dorsolateral carinae are moderately crenulate on segment I and moderately denticulate on segments
<normalizedToken originalValue="II–IV">II-IV</normalizedToken>
with enlarged posterior denticles; posterior denticles are largest and most pronounced on dorsolateral carinae IV; ventrolateral carinae are moderately crenulate on segments
<normalizedToken originalValue="I–IV">I-IV</normalizedToken>
; segments II and III have sparse and moderately crenulate intermediary carinae forming an approximately 30° angle with the dorsolateral carinae on the posterior 2/3 on segment II and posterior 1/3 segment III; ventromedian carinae are smooth to obsolete on segment I, and crenulate on segments
<normalizedToken originalValue="II–IV">II-IV</normalizedToken>
; ventrolateral setae 2/2:2/2:2/2:2/2; ventral submedian setae 3/3:3/3:3/3:3/3. Segment V: dorsolateral carinae subtly denticulate; lateral carinae crenulate and obsolete on posterior 1/3; ventrolateral carinae crenulate; ventromedian carinae crenulate; intercarinal spaces finely granular; dorsolateral setation 3/3; lateral setation 3/3; ventrolateral setation 4/4; ventromedian setation 4/4. Telson: smooth to slightly granular with no subaculear tubercule and lacking LAS denticles (Fet et al. 2006). Chelicerae: dorsal edge of fixed finger with four teeth, one distal, one subdistal, one median, and one basal, the latter two denticles formed as a bicuspid; ventral edge with seven low-profile pigmented protuberances, the distal two smaller in size; dorsal edge of movable finger has five teeth total comprised of one distal, two subdistal, one median tooth, and one basal tooth; ventral edge of movable finger has seven small pigmented crenulated teeth; serrula with approximately 23 tines. Pedipalps:trichobothrial pattern type C, orthobothriotaxic: trichobothria ib-it positioned on extreme base of fixed finger, Dt located considerably basal of palm midpoint, Db ventral of digital carina, patellar trichobothria v3 adjacent to et3; ratio of chela length/width 3.57; femur length/width 2.60; patella length/width 2.79; fixed finger length/carapace length 0.78. Chela: median denticles (MD) of fixed finger aligned and divided into six subrows by five outer denticles (OD); flanked by six inner denticles (ID); movable finger with six subrows of MD, five OD and seven ID. Chela carinae: Digital carina rounded, rough, and somewhat flattened; subdigital essentially obsolete, formed by two granules; dorsosecondary flat, rounded, and roughly textured; dorsomarginal very rounded, with large scattered granules; dorsointernal rounded, with scattered granules; ventroexternal rounded, roughly textured, terminating at external condyle of movable finger; ventromedian flat, essentially obsolete; ventrointernal rounded, with small granules scattered distally; external carina very rounded, roughly textured. Femur: dorsointernal, and ventrointernal carinae denticulate and black in color, ventroexternal and dorsoexternal carinae denticulate with small granules throughout, internal surface has 6 prominent dentate granules. Patella:dorsointernal carinae are denticulate, dorsoexternal carinae are mildly crenate, ventral internal carinae are dentate, ventroexternal carinae are moderately denticulate, internal surface has 11 prominent granules. Legs: Ventral surface of tarsus with single median row of 7-17 spinules terminating distally with one to two pairs of spinules. The terminal spinules are slightly stouter than the those comprising the median row. Flanking setal pairs are essentially absent in legs
<normalizedToken originalValue="I–II">I-II</normalizedToken>
, with 2-3 irregularly positioned and sized pairs on legs
<normalizedToken originalValue="III–IV">III-IV</normalizedToken>
. Basitarsus spinule rows are limited, 2 rows on leg I, 1 row on leg II, 1 weak row on III, and absent on IV. Basitarsus populated with large irregularly placed darkly pigmented setae. Hemispermatophore: Left hemispermatophore is 5.7 mm in length; lamina length 3.71, lamellar hook length 1.03, and trough different (vertical distance between ventral and dorsal troughs) 0.55. Lamellar edges sub-parallel, except for slight expansion on mid-area of the internal edge; terminus blunted with a distinct distal crest on the dorsal side. Lamellar hook extends somewhat from lamina base, is distinctly bifurcated, and is formed entirely from the dorsal trough. A modest basal constriction and a deep truncal flexure are present. Sclerotized mating plugs with smooth barbs were extracted from the ventrointernal aspect of both hemispermatophore median areas.
</paragraph>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Figure 1. Map depicting the distribution of
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n. (black star) and type localities of geographically proximate species in genus
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="genus">Pseudouroctonus</taxonomicName>
(blue diamonds) and
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Uroctonites" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Uroctonites" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="genus">Uroctonites</taxonomicName>
(red circles): 1
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus glimmei" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="glimmei">Pseudouroctonus glimmei</taxonomicName>
(Hjelle, 1972) 2
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Uroctonites" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Uroctonites montereus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="montereus">Uroctonites montereus</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 3
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Uroctonites" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Uroctonites giulianii" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="giulianii">Uroctonites giulianii</taxonomicName>
William &amp; Savary, 1991 4
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Uroctonites" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Uroctonites sequoia" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="sequoia">Uroctonites sequoia</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 5
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus minimus subsp. thompsoni" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="subSpecies" species="minimus" subSpecies="thompsoni">Pseudouroctonus minimus thompsoni</taxonomicName>
(Kraepelin, 1911) 6
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus angelenus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="angelenus">Pseudouroctonus angelenus</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 7
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus minimus subsp. minimus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="subSpecies" species="minimus" subSpecies="minimus">Pseudouroctonus minimus minimus</taxonomicName>
(Kraepelin, 1911) 8
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus bogerti" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="bogerti">Pseudouroctonus bogerti</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 9
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus andreas" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="andreas">Pseudouroctonus andreas</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 10
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus williamsi" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="williamsi">Pseudouroctonus williamsi</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 11
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus minimus subsp. castaneus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="subSpecies" species="minimus" subSpecies="castaneus">Pseudouroctonus minimus castaneus</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 12
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus rufulus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="rufulus">Pseudouroctonus rufulus</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 13
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Uroctonites" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Uroctonites huachuca" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="huachuca">Uroctonites huachuca</taxonomicName>
(Gertsch &amp; Soleglad, 1972) 14
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus apacheanus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="apacheanus">Pseudouroctonus apacheanus</taxonomicName>
(Gertsch &amp; Soleglad, 1972).
</paragraph>
</caption>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Figure 2-3. Dorsal view of male (2) and female (3)
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n. in vivo.
</paragraph>
</caption>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Figures 4-15.
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n., Spring Mountains, Clark Co., Nevada, USA. Female holotype. 4 Carapace and close-up of lateral eyes. 5-8 Right pedipalp 5 Chela, external view 6 Chelal finger dentition, fixed and movable fingers 7 Patella, dorsal view 8 Femur, dorsal view 9 Right leg II, tarsus close-up, partial ventral view. Right leg III, tarsus and basitarsus, ventral view 10 Cheliceral movable and fixed fingers, ventral view. Chelicera, dorsal view 11 Sternite VII 12 Left stigma I 13 Metasoma and telson, ventral and lateral views 14 Sternopectinal area 15 Male paratype, sternopectinal area.
</paragraph>
</caption>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Figure 16.
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n. female holotype, Spring Mountains, Clark Co., Nevada, USA. Trichobothrial pattern.
</paragraph>
</caption>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Figure 17.
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n., male paratype, Spring Mountains, Clark Co., Nevada, USA. Left hemispermatophore and mating plug (both reversed, photographed submerged in alcohol). Outside hemispermatophore, dorsal and ventral views. Top closeup of median area, dorsal and ventral views. Note, due to the translucency of the hemispermatophore,the sclerotized ventral trough is partially visible from the dorsal side. Bottom mating plug. dorsal and ventral views. Note, the sclerotized edge of the mating plug barb is located on the dorsal surface and is partially visible from the ventral side due to the translucency of the plug.
</paragraph>
</caption>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Figure 18. Type locality of
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n. on the eastern slope of the Spring Mountains, Nevada. Red arrow indicates where the holotype was discovered.
</paragraph>
</caption>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Table 1. Measurements (in millimeters) of all known specimens of
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
.
</paragraph>
</caption>
<paragraph pageId="4" pageNumber="33">
<table pageId="4" pageNumber="33">
<tr pageId="4" pageNumber="33">
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Scorpion ID</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Holotype MRG1251</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Female MRG1221</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Female MRG1222</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Male MRG1252</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Female MRG1253</th>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">Pectine count</td>
</tr>
</table>
</paragraph>
<caption pageId="4" pageNumber="33">
<paragraph pageId="4" pageNumber="33">
Table 2. Matrix showing character set that distinguishes
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n. from the other seventeen species in the genus. If a species differs significantly for a given data character, its state is shaded. Note, except for
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
sp. n., most of the data contained in this table is based on published information (see reference list). ID = inner denticle.
</paragraph>
</caption>
<paragraph pageId="4" pageNumber="33">
<table pageId="4" pageNumber="33">
<tr pageId="4" pageNumber="33">
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Hemispermatophore</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Cheliceral&lt;br/&gt; Dentition</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Chelal Movable Finger ID</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Pectinal Tooth Counts</th>
<th colspan="1" pageId="4" pageNumber="33" rowspan="1">Metasoma Seg V (Length/Width)</th>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus peccatum" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="peccatum">Pseudouroctonus peccatum</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">va</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus andreas" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="andreas">Pseudouroctonus andreas</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus angelenus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="angelenus">Pseudouroctonus angelenus</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus apacheanus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="apacheanus">Pseudouroctonus apacheanus</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus bogerti" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="bogerti">Pseudouroctonus bogerti</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus cazieri" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="cazieri">Pseudouroctonus cazieri</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">va</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus chicano" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="chicano">Pseudouroctonus chicano</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus glimmei" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="glimmei">Pseudouroctonus glimmei</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus iviei" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="iviei">Pseudouroctonus iviei</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus lindsayi" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="lindsayi">Pseudouroctonus lindsayi</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus minimus subsp. castaneus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="subSpecies" species="minimus" subSpecies="castaneus">Pseudouroctonus minimus castaneus</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus minimus subsp. minimus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="subSpecies" species="minimus" subSpecies="minimus">Pseudouroctonus minimus minimus</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus minimus subsp. thompsoni" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="subSpecies" species="minimus" subSpecies="thompsoni">Pseudouroctonus minimus thompsoni</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus reddelli" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="reddelli">Pseudouroctonus reddelli</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">va</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus rufulus" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="rufulus">Pseudouroctonus rufulus</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus saavasi" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="saavasi">Pseudouroctonus saavasi</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">sd</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus sprousei" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="sprousei">Pseudouroctonus sprousei</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">va</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
<tr pageId="4" pageNumber="33">
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Pseudouroctonus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudouroctonus williamsi" order="Scorpiones" pageId="4" pageNumber="33" phylum="Arthropoda" rank="species" species="williamsi">Pseudouroctonus williamsi</taxonomicName>
</td>
<td colspan="1" pageId="4" pageNumber="33" rowspan="1">ID</td>
</tr>
</table>
</paragraph>
</subSubSection>
<subSubSection lastPageId="5" lastPageNumber="34" pageId="4" pageNumber="33" type="dna barcodes">
<paragraph pageId="4" pageNumber="33">DNA barcodes</paragraph>
<paragraph pageId="4" pageNumber="33">(COI) - MRG1221 (paratype, GenBank no. KF841448):</paragraph>
<paragraph lastPageId="5" lastPageNumber="34" pageId="4" pageNumber="33">
CTCTAAGTTTAATGATTCGTGCGGAAATTGGTAGACCTGGGTCTTTTATCGGGGATGATCAAATTTATAATGTTGTGGTTACTGCTCATGCTTTTGTCATAATTTTTTTTATGGTTATGCCAATTATGATTGGGGGTTTTGGTAATTGGTTAGTTCCTTTGATGTTAGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTACCACCTGCATTTTTTATGCTTTTAGGTTCGGCATCGTTGGAAAGAGGGGCAGGTACAGGCTGAACTGTGTACCCTCCTCTTTCCTCATA
<pageBreakToken pageId="5" pageNumber="34" start="start">TATGTTTCATTCTGGGGGGTCTGTTGATATGACTATTTTTTCGTTACATTTGGCTGGTGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTTTGAATATGCGAAGATCTGGAATATTGTTGGAGCGTGTGCCTTTATTTGTATGGTCTGTTAAGATTACTGCTATTCTTCTGTTGTTGTCTCTTCCAGTTCTTGCGGGTGCAATTACTATGCTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCAGCGGGTGGAGGGGATCCTATTTTGTACCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTCTTCCGGGATTTGGAATGATTTCTCATATTATTAGTCATCATACTGGGAAGAGGGAACCTTTCGGAGCTTTAGGAATGATTTATGCTATGGTGGCTATTGGGTTTTTGGGTTTTGTGGTTTG</pageBreakToken>
.
</paragraph>
<paragraph pageId="5" pageNumber="34">MRG1222 (paratype, GenBank no. KF841449):</paragraph>
<paragraph pageId="5" pageNumber="34">CTCTAAGTTTAATGATTCGTGCGGAAATTGGTAGACCTGGGTCTTTTATCGGGGATGATCAAATTTATAATGTTGTGGTTACTGCTCATGCTTTTGTCATAATTTTTTTTATGGTTATGCCAATTATGATTGGGGGTTTTGGTAATTGGTTAGTTCCTTTGATGTTAGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTACCACCTGCATTTTTTATGCTTTTAGGTTCGGCATCGTTGGAAAGAGGGGCAGGTACAGGCTGAACTGTGTACCCTCCTCTTTCCTCATATATGTTTCATTCTGGGGGGTCTGTTGATATGACTATTTTTTCGTTACATTTGGCTGGTGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTTTGAATATGCGAAGATCTGGAATATTGTTGGAGCGTGTGCCTTTATTTGTATGGTCTGTTAAGATTACTGCTATTCTTCTGTTGTTGTCTCTTCCAGTTCTTGCGGGTGCAATTACTATACTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCAGCGGGTGGAGGGGATCCTATTTTGTACCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTCTTCCGGGATTTGGAATGATTTCTCATATTATTAGTCATCATACTGGGAAGAGGGAACCTTTCGGAGCTTTAGGAATGATTTATGCTATGGTGGCTATTGGGTTTTTGGGTTTTGTGGTTTG.</paragraph>
</subSubSection>
</treatment>
</document>

114
data/74/C3/99/74C39958F0BE50D5A00B41C2CEDF0199.xml Normal file
View file

@ -0,0 +1,114 @@
<document ID-DOI="http://dx.doi.org/10.3897/phytokeys.181.69740" ID-GBIF-Dataset="dca39c99-b65a-42c7-accd-4f7d8e8b421a" ID-PMC="PMC8421323" ID-Pensoft-Pub="1314-2003-181-29" ID-Pensoft-UUID="25B16C1AE4375702BC69E64E28291B0A" ID-PubMed="34557054" ModsDocID="1314-2003-181-29" checkinTime="1630349217782" checkinUser="pensoft" docAuthor="Moroni, Pablo, Martinez, Agustina &amp; Simpson, Michael G." docDate="2021" docId="74C39958F0BE50D5A00B41C2CEDF0199" docLanguage="en" docName="PhytoKeys 181: 29-47" docOrigin="PhytoKeys 181" docPubDate="2021-08-30" docSource="http://dx.doi.org/10.3897/phytokeys.181.69740" docTitle="Cryptantha patagonica (Speg.) I. M. Johnst., Contr. Gray Herb. 68: 54. 1923." docType="treatment" docVersion="4" id="25B16C1AE4375702BC69E64E28291B0A" lastPageNumber="29" masterDocId="25B16C1AE4375702BC69E64E28291B0A" masterDocTitle="Nomenclatural revision of Cryptantha (Boraginaceae s. str.) names linked to South American taxa" masterLastPageNumber="47" masterPageNumber="29" pageNumber="29" updateTime="1668140413250" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Nomenclatural revision of Cryptantha (Boraginaceae s. str.) names linked to South American taxa</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Moroni, Pablo</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-5306-476X</mods:nameIdentifier>
<mods:affiliation>Instituto de Botanica Darwinion (ANCEFN-CONICET), Labarden 200, CC 22, B 1642 HYD, San Isidro, Buenos Aires, Argentina</mods:affiliation>
<mods:nameIdentifier type="email">pmoroni@darwin.edu.ar</mods:nameIdentifier>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Martinez, Agustina</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-4768-664X</mods:nameIdentifier>
<mods:affiliation>Instituto de Botanica Darwinion (ANCEFN-CONICET), Labarden 200, CC 22, B 1642 HYD, San Isidro, Buenos Aires, Argentina</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Simpson, Michael G.</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-6197-2132</mods:nameIdentifier>
<mods:affiliation>Department of Biology, San Diego State University, San Diego, California 92182, USA</mods:affiliation>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>PhytoKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2021</mods:date>
<mods:detail type="pubDate">
<mods:number>2021-08-30</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>181</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>29</mods:start>
<mods:end>47</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/phytokeys.181.69740</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/phytokeys.181.69740</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2003-181-29</mods:identifier>
<mods:identifier type="Pensoft-UUID">25B16C1AE4375702BC69E64E28291B0A</mods:identifier>
</mods:mods>
<treatment ID-GBIF-Taxon="185371630" LSID="urn:lsid:plazi:treatment:74C39958F0BE50D5A00B41C2CEDF0199" httpUri="http://treatment.plazi.org/id/74C39958F0BE50D5A00B41C2CEDF0199" lastPageNumber="29" pageId="0" pageNumber="29">
<subSubSection pageId="0" pageNumber="29" type="nomenclature">
<paragraph pageId="0" pageNumber="29">
17.
<taxonomicName LSID="74C39958-F0BE-50D5-A00B-41C2CEDF0199" authority="(Speg.) I. M. Johnst., Contr. Gray Herb. 68: 54. 1923." authorityName="(Speg.) I. M. Johnst., Contr. Gray Herb. 68: 54. 1923." class="Magnoliopsida" family="Boraginaceae" genus="Cryptantha" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Cryptantha patagonica" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="patagonica">Cryptantha patagonica (Speg.) I.M. Johnst., Contr. Gray Herb. 68: 54. 1923.</taxonomicName>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="29" type="reference_group">
<paragraph pageId="0" pageNumber="29">
<taxonomicName class="Magnoliopsida" family="Boraginaceae" genus="Cryptantha" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Cryptantha patagonica" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="patagonica">Cryptantha patagonica</taxonomicName>
≡
<taxonomicName class="Magnoliopsida" family="Boraginaceae" genus="Amsinckia" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Amsinckia patagonica" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="patagonica">Amsinckia patagonica</taxonomicName>
Speg., Nov. Add. Fl. Patag. 39. 1902. Type: Argentina. [Unknown province:] &quot;Hab. in aridis secus
<normalizedToken originalValue="Río">Rio</normalizedToken>
S. Cruz&quot;, Feb. 1882,
<emphasis italics="true" pageId="0" pageNumber="29">C. Spegazzini s.n.</emphasis>
(lectotype, designated here: GH [GH00096569 digital image!]).
</paragraph>
<paragraph pageId="0" pageNumber="29">
<taxonomicName class="Magnoliopsida" family="Boraginaceae" genus="Cryptantha" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Cryptantha patagonica" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="patagonica">Cryptantha patagonica</taxonomicName>
=
<taxonomicName class="Magnoliopsida" family="Boraginaceae" genus="Eritrichium" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Eritrichium parvulum" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="parvulum">Eritrichium parvulum</taxonomicName>
Phil., Anales Univ. Chile 90: 535. 1895.
<taxonomicName authorityName="Brand" authorityYear="1931" baseAuthorityName="Phil." class="Magnoliopsida" family="Boraginaceae" genus="Cryptantha" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Cryptantha parvula" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="parvula">Cryptantha parvula</taxonomicName>
(Phil.) Brand, Pflanzenr. (Engler) [Heft 97] 4, Fam. 252: 50. 1931. Type: Chile.
<normalizedToken originalValue="Región">Region</normalizedToken>
de Atacama: Caldera, Sep. 1885,
<emphasis italics="true" pageId="0" pageNumber="29">F. Philippi s.n.</emphasis>
(lectotype, designated here: SGO [SGO000004116 digital image!]; isolectotypes: CORD [CORD00003777 digital image!], GH [GH00096568 digital image!], SGO [SGO000004115 digital image!]).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="29" type="notes">
<paragraph pageId="0" pageNumber="29">Notes.</paragraph>
<paragraph pageId="0" pageNumber="29">
In describing
<taxonomicName class="Magnoliopsida" family="Boraginaceae" genus="Amsinckia" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Amsinckia patagonica" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="patagonica">
<emphasis italics="true" pageId="0" pageNumber="29">Amsinckia patagonica</emphasis>
</taxonomicName>
,
<bibRefCitation author="Spegazzini, CL" journalOrPublisher="Anales del Museo Buenos Aires" pageId="0" pageNumber="29" pagination="135 - 308" refId="B45" refString="Spegazzini, CL, 1902. Nova addenda ad Flora Patagonicam. Anales del Museo Buenos Aires 7: 135 - 308" title="Nova addenda ad Flora Patagonicam." volume="7" year="1902">Spegazzini (1902)</bibRefCitation>
cited a syntype from Patagonia, Argentina. The gathering consists of a collection he made in
<normalizedToken originalValue="Río">Rio</normalizedToken>
Santa Cruz, Argentina, in 1882. No specimen corresponding to the material cited in the protologue was located at LP, where Spegazzini worked (
<bibRefCitation author="Stafleu, FA" journalOrPublisher="Anales del Museo Buenos Aires" pageId="0" pageNumber="29" refId="B48" refString="Stafleu, FA, Cowan, RS, 1986. Taxonomic Literature Vol. 6, a Selective Guide to Botanical Publications and Collections with Dates, Commentaries and Types, ed. 2. Bohn, Scheltema &amp; Holkema, Utrecht." title="Taxonomic Literature Vol. 6, a Selective Guide to Botanical Publications and Collections with Dates, Commentaries and Types, ed. 2. Bohn, Scheltema &amp; Holkema, Utrecht." year="1986">Stafleu and Cowan 1986</bibRefCitation>
). However, a duplicate of the syntype in agreement with the protologue is kept at GH. This material matches the diagnosis coined by Spegazzini, and, thus, it is here chosen as the lectotype of the name.
<bibRefCitation DOI="https://doi.org/10.5354/0717-8883.2012.20872" author="Philippi, RA" journalOrPublisher="Anales de la Universidad de Chile" pageId="0" pageNumber="29" pagination="511 - 566" refId="B39" refString="Philippi, RA, 1895. Plantas nuevas chilenas de las familias que corresponden al tomo IV de la obra de Gay: (continuacion). Anales de la Universidad de Chile 90: 511 - 566, DOI: https://doi.org/10.5354/0717-8883.2012.20872" title="Plantas nuevas chilenas de las familias que corresponden al tomo IV de la obra de Gay: (continuacion)." url="https://doi.org/10.5354/0717-8883.2012.20872" volume="90" year="1895">Rudolph A. Philippi (1895)</bibRefCitation>
based the description of
<taxonomicName class="Magnoliopsida" family="Boraginaceae" genus="Eritrichium" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Eritrichium parvulum" order="Boraginales" pageId="0" pageNumber="29" phylum="Tracheophyta" rank="species" species="parvulum">
<emphasis italics="true" pageId="0" pageNumber="29">Eritrichium parvulum</emphasis>
</taxonomicName>
on three collections made by F. Philippi on a trip to the Atacama Region, Chile, in 1885. The first gathering consists of a collection from Caldera, while the other two were made in Piedra Colgada and
<normalizedToken originalValue="Chañarcillo">Chanarcillo</normalizedToken>
. Four duplicates of the syntype collected in Caldera are kept at CORD, GH, and SGO. Among the other syntypes, a duplicate of each collection is housed at SGO. All specimens are in agreement with the localities and the diagnosis cited in the protologue. The syntype from Caldera is preferred as it shows the best quality of preservation of the important diagnostic features of the taxon. Thus, a duplicate from this collection is here chosen as lectotype of the name.
</paragraph>
</subSubSection>
</treatment>
</document>

246
data/74/C3/F7/74C3F777C7B1548A8CDAD15A392E60F9.xml Normal file
View file

@ -0,0 +1,246 @@
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.1091.79564" ID-GBIF-Dataset="64b1edd6-e277-4239-a230-3d87e367a13f" ID-PMC="PMC9005496" ID-Pensoft-Pub="1313-2970-1091-15" ID-Pensoft-UUID="441AFDF6A4B85C8198C4A84CBFDF0AA9" ID-PubMed="35586020" ID-ZooBank="BC5444151BC74724A186FB7ED12B0CAE" ModsDocID="1313-2970-1091-15" checkinTime="1648741050671" checkinUser="pensoft" docAuthor="Mai, Zuqi, Hu, Jian &amp; Jia, Fenglong" docDate="2022" docId="74C3F777C7B1548A8CDAD15A392E60F9" docLanguage="en" docName="ZooKeys 1091: 15-56" docOrigin="ZooKeys 1091" docPubDate="2022-03-31" docSource="http://dx.doi.org/10.3897/zookeys.1091.79564" docTitle="Coelostoma (Lachnocoelostoma) dactylopunctum Mai &amp; Jia 2022, sp. nov." docType="treatment" docUuid="4D897D7D-B3BD-48F1-A916-D47B042F9D1D" docUuidSource="ZooBank" docVersion="4" id="441AFDF6A4B85C8198C4A84CBFDF0AA9" lastPageNumber="15" masterDocId="441AFDF6A4B85C8198C4A84CBFDF0AA9" masterDocTitle="Additional fauna of Coelostoma Brulle, 1835 from China, with re-establishment of Coelostoma sulcatum Pu, 1963 as a valid species (Coleoptera, Hydrophilidae, Sphaeridiinae)" masterLastPageNumber="56" masterPageNumber="15" pageNumber="15" updateTime="1668151577155" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Additional fauna of Coelostoma Brulle, 1835 from China, with re-establishment of Coelostoma sulcatum Pu, 1963 as a valid species (Coleoptera, Hydrophilidae, Sphaeridiinae)</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Mai, Zuqi</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0003-3124-2021</mods:nameIdentifier>
<mods:affiliation>School of Agriculture, Sun Yat-sen University, Guangzhou, 511436, Guangdong, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Hu, Jian</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-4122-8533</mods:nameIdentifier>
<mods:affiliation>School of Agriculture, Sun Yat-sen University, Guangzhou, 511436, Guangdong, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Jia, Fenglong</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0003-2391-5038</mods:nameIdentifier>
<mods:affiliation>School of Agriculture, Sun Yat-sen University, Guangzhou, 511436, Guangdong, China &amp; Institute of Entomology, Life Sciences School, Sun Yat-sen University, Guangzhou, 510275, Guangdong, China</mods:affiliation>
<mods:nameIdentifier type="email">fenglongjia@aliyun.com</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>ZooKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-03-31</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>1091</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>15</mods:start>
<mods:end>56</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/zookeys.1091.79564</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.1091.79564</mods:identifier>
<mods:identifier type="Pensoft-Pub">1313-2970-1091-15</mods:identifier>
<mods:identifier type="ZooBank">BC5444151BC74724A186FB7ED12B0CAE</mods:identifier>
<mods:identifier type="Pensoft-UUID">441AFDF6A4B85C8198C4A84CBFDF0AA9</mods:identifier>
</mods:mods>
<treatment ID-GBIF-Taxon="194317832" LSID="urn:lsid:zoobank.org:act:4D897D7D-B3BD-48F1-A916-D47B042F9D1D" httpUri="http://treatment.plazi.org/id/74C3F777C7B1548A8CDAD15A392E60F9" lastPageNumber="15" pageId="0" pageNumber="15">
<subSubSection pageId="0" pageNumber="15" type="nomenclature">
<paragraph pageId="0" pageNumber="15">
<taxonomicName LSID="http://zoobank.org/4D897D7D-B3BD-48F1-A916-D47B042F9D1D" authority="Mai &amp; Jia" authorityName="Mai &amp; Jia" authorityYear="2022" class="Insecta" family="Hydrophilidae" genus="Coelostoma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Coelostoma (Lachnocoelostoma) dactylopunctum" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="dactylopunctum" status="sp. nov." subGenus="Lachnocoelostoma">Coelostoma (Lachnocoelostoma) dactylopunctum Mai &amp; Jia</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="15">sp. nov.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="description">
<paragraph pageId="0" pageNumber="15">
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Coelostoma (Lachnocoelostoma) dactylopunctum Mai &amp; Jia, sp. nov. A dorsal view B ventral view C lateral view D, E aedeagus (D dorsal view E ventral view). Scale bars: 1.0 mm (A-C); 0.5 mm (D, E)." figureDoi="10.3897/zookeys.1091.79564.figure2" httpUri="https://binary.pensoft.net/fig/666184" pageId="0" pageNumber="15">Figures 2A-E</figureCitation>
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Lateral view of Coelostoma spp. (the red figures indicate the serial number of elytral serial punctures; the white arrows indicate the punctures of series; the circles indicate the coarser punctures; the squares indicate the finer punctures) A Coelostoma dactylopunctum sp. nov. B Coelostoma fortunum sp. nov. Scale bar: 1 mm (A, B)." figureDoi="10.3897/zookeys.1091.79564.figure12" httpUri="https://binary.pensoft.net/fig/666194" pageId="0" pageNumber="15">, 12A</figureCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="type material">
<paragraph pageId="0" pageNumber="15">Type material examined.</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" italics="true" pageId="0" pageNumber="15">Holotype</emphasis>
: male (SYSU), China, Yunnan, Honghe Hani and Yi Autonomous Prefecture, Lvchun County, Huanglianshan Mountain, Huanglianshan Reservoir (黄连山水库),
<geoCoordinate degrees="22.8898" direction="north" orientation="latitude" precision="5" value="22.8898">22.8898°N</geoCoordinate>
,
<geoCoordinate degrees="102.2952" direction="east" orientation="longitude" precision="5" value="102.2952">102.2952°E</geoCoordinate>
, 1717.3 m, 30.iv.2021, in a forest stream at night, Jiang, Yang, Huang &amp; Mai leg.
<emphasis bold="true" italics="true" pageId="0" pageNumber="15">Paratypes</emphasis>
: 2 males (SYSU), same data as the holotype.
</paragraph>
<caption doi="10.3897/zookeys.1091.79564.figure2" httpUri="https://binary.pensoft.net/fig/666184" pageId="0" pageNumber="15" start="Figure 2" startId="F2">
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" pageId="0" pageNumber="15">Figure 2.</emphasis>
<taxonomicName authorityName="Mai &amp; Jia" authorityYear="2022" class="Insecta" family="Hydrophilidae" genus="Coelostoma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Coelostoma (Lachnocoelostoma) dactylopunctum" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="dactylopunctum" subGenus="Lachnocoelostoma">Coelostoma (Lachnocoelostoma) dactylopunctum</taxonomicName>
Mai &amp; Jia, sp. nov.
<emphasis bold="true" pageId="0" pageNumber="15">A</emphasis>
dorsal view
<emphasis bold="true" pageId="0" pageNumber="15">B</emphasis>
ventral view
<emphasis bold="true" pageId="0" pageNumber="15">C</emphasis>
lateral view
<emphasis bold="true" pageId="0" pageNumber="15">D, E</emphasis>
aedeagus (
<emphasis bold="true" pageId="0" pageNumber="15">D</emphasis>
dorsal view
<emphasis bold="true" pageId="0" pageNumber="15">E</emphasis>
ventral view). Scale bars: 1.0 mm (
<emphasis bold="true" pageId="0" pageNumber="15">A-C</emphasis>
); 0.5 mm (
<emphasis bold="true" pageId="0" pageNumber="15">D, E</emphasis>
).
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="diagnosis">
<paragraph pageId="0" pageNumber="15">Diagnosis.</paragraph>
<paragraph pageId="0" pageNumber="15">
Length 4.3-4.5 mm. Head and pronotum with similar punctation. Prosternum carinate medially, with a fine tooth anteromedially. Elytra not parallel-sided in the middle, each elytron with ten distinct rows of serial punctures; intervals between series with two sizes of punctures especially in posterior half of elytron, the finer punctures as on pronotum and much finer and shallower than the coarser punctures, coarser punctures almost as coarse as those of the series (Fig.
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Lateral view of Coelostoma spp. (the red figures indicate the serial number of elytral serial punctures; the white arrows indicate the punctures of series; the circles indicate the coarser punctures; the squares indicate the finer punctures) A Coelostoma dactylopunctum sp. nov. B Coelostoma fortunum sp. nov. Scale bar: 1 mm (A, B)." figureDoi="10.3897/zookeys.1091.79564.figure12" httpUri="https://binary.pensoft.net/fig/666194" pageId="0" pageNumber="15">12A</figureCitation>
). Mesofemora densely pubescent, except on extreme apex. First abdominal ventrite with complete median carina. Fifth ventrite slightly emarginate and with a row of stout setae apically.
<emphasis bold="true" italics="true" pageId="0" pageNumber="15">Aedeagus</emphasis>
(Fig.
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Coelostoma (Lachnocoelostoma) dactylopunctum Mai &amp; Jia, sp. nov. A dorsal view B ventral view C lateral view D, E aedeagus (D dorsal view E ventral view). Scale bars: 1.0 mm (A-C); 0.5 mm (D, E)." figureDoi="10.3897/zookeys.1091.79564.figure2" httpUri="https://binary.pensoft.net/fig/666184" pageId="0" pageNumber="15">2D, E</figureCitation>
): 0.87 mm long. Median lobe emarginate apically, outer face nearly parallel-sided from basal to middle, then gradually narrowing towards apex, gonopore situated subapically, wider than long. Parameres slightly longer than median lobe, gradually expanded from anterior fourth to apex, broadly truncate apically, inner apical angle acute, pointed; middle part of parameres ca. 0.5
<normalizedToken originalValue="×">x</normalizedToken>
as wide as median lobe at the same level.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="description">
<paragraph pageId="0" pageNumber="15">Description.</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" italics="true" pageId="0" pageNumber="15">Form and colour</emphasis>
(Fig.
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Coelostoma (Lachnocoelostoma) dactylopunctum Mai &amp; Jia, sp. nov. A dorsal view B ventral view C lateral view D, E aedeagus (D dorsal view E ventral view). Scale bars: 1.0 mm (A-C); 0.5 mm (D, E)." figureDoi="10.3897/zookeys.1091.79564.figure2" httpUri="https://binary.pensoft.net/fig/666184" pageId="0" pageNumber="15">2D, E</figureCitation>
). Total length 4.3-4.5 mm (holotype: 4.5 mm); maximum width 2.8-3.0 mm (holotype: 3.0 mm); body broadly oval, not parallel-sided in the middle, moderately convex. Dorsum black to reddish brown, with lateral margin of pronotum and elytra paler. Labrum, maxillary palpi and labial palpi reddish brown, antennae yellowish to reddish brown with dark club. Ventral surface reddish brown. Femora and tibiae dark reddish brown, tarsi pale reddish.
</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" pageId="0" pageNumber="15">
<emphasis italics="true" pageId="0" pageNumber="15">Head</emphasis>
.
</emphasis>
Dorsal surface with dense fine punctures. Interstices between punctures smooth. Clypeus subtruncate anteriorly. Eyes of moderate size, slightly emarginated anteriorly in lateral view, separated by ca. 5.3
<normalizedToken originalValue="×">x</normalizedToken>
the width of one eye. Mentum emarginate anteriorly and depressed in anterior half, with sparse punctures except on the depressed portion. Antennae with nine antennomeres, antennal club (antennomeres 7-9) densely pubescent. Maxillary palpomere 2 strongly swollen, palpomere 4 truncate apically, slightly longer than palpomere 3. Gula narrow and glabrous.
</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" pageId="0" pageNumber="15">
<emphasis italics="true" pageId="0" pageNumber="15">Thorax</emphasis>
.
</emphasis>
Pronotum widest posteriorly, gradually narrowed anteriad, with punctures as on head, anterolateral angles obtusely rounded, posterolateral angles blunt, anterior and lateral margins with narrow marginal bead. Prosternum with a carina medially and slightly projecting anteromedially. Scutellum in shape of equilateral triangle, with punctures as on pronotum. Each elytron with ten distinct rows of serial punctures; intervals between series with two sizes of punctures especially in posterior half of elytron, the finer punctures as on pronotum and much finer and shallower than the coarser punctures, coarser punctures almost as coarse as those of the series (Fig.
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Lateral view of Coelostoma spp. (the red figures indicate the serial number of elytral serial punctures; the white arrows indicate the punctures of series; the circles indicate the coarser punctures; the squares indicate the finer punctures) A Coelostoma dactylopunctum sp. nov. B Coelostoma fortunum sp. nov. Scale bar: 1 mm (A, B)." figureDoi="10.3897/zookeys.1091.79564.figure12" httpUri="https://binary.pensoft.net/fig/666194" pageId="0" pageNumber="15">12A</figureCitation>
); series 1 and 2 reaching basal half of elytron, series 1 overlap with sutural stria; series 3 and 4 nearly reaching elytral base and fused together subposteriorly; series 5-10 reaching elytral base, slightly sulcate posteriorly; the outer four serial punctures coarser and stronger than the inner six serial punctures (Fig.
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Lateral view of Coelostoma spp. (the red figures indicate the serial number of elytral serial punctures; the white arrows indicate the punctures of series; the circles indicate the coarser punctures; the squares indicate the finer punctures) A Coelostoma dactylopunctum sp. nov. B Coelostoma fortunum sp. nov. Scale bar: 1 mm (A, B)." figureDoi="10.3897/zookeys.1091.79564.figure12" httpUri="https://binary.pensoft.net/fig/666194" pageId="0" pageNumber="15">12A</figureCitation>
). Lateral margin of elytra with bead and slightly explanate.
</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" pageId="0" pageNumber="15">
<emphasis italics="true" pageId="0" pageNumber="15">Legs</emphasis>
.
</emphasis>
Pro- and mesofemora bearing dense pubescence, except on extreme apex. Metafemora not pubescent, with dense microsculptures and spares fine punctures. Meso- and Metatibia slightly flattened, with strong apical spurs and series of sparse stout spines laterally. Tarsi with long dorsal setae and gold ventral setae; metatarsi with fifth tarsomere almost as long as third and fourth combined. Claws curved, with a pair of long setae beneath.
</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" pageId="0" pageNumber="15">
<emphasis italics="true" pageId="0" pageNumber="15">Abdomen</emphasis>
.
</emphasis>
Abdominal ventrites densely pubescent. First ventrite with complete median carina. Fifth ventrite slightly emarginate and with fine marginal bead, with a row of stout setae apically.
</paragraph>
<paragraph pageId="0" pageNumber="15">
<emphasis bold="true" italics="true" pageId="0" pageNumber="15">Male genitalia</emphasis>
(Fig.
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. Coelostoma (Lachnocoelostoma) dactylopunctum Mai &amp; Jia, sp. nov. A dorsal view B ventral view C lateral view D, E aedeagus (D dorsal view E ventral view). Scale bars: 1.0 mm (A-C); 0.5 mm (D, E)." figureDoi="10.3897/zookeys.1091.79564.figure2" httpUri="https://binary.pensoft.net/fig/666184" pageId="0" pageNumber="15">2D, E</figureCitation>
). Aedeagus ca. 0.87 mm long. Median lobe emarginate apically, widest basally, ca. 3.5
<normalizedToken originalValue="×">x</normalizedToken>
as long as wide; outer face nearly parallel-sided from base to middle, then gradually narrowing towards apex; gonopore situated subapically, wider than long. Parameres slightly longer than median lobe, gradually expanded from anterior fourth to apex, broadly truncate apically, inner apical angle acute, pointed; middle part of parameres ca. 0.5
<normalizedToken originalValue="×">x</normalizedToken>
as wide as median lobe at the same level.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="etymology">
<paragraph pageId="0" pageNumber="15">Etymology.</paragraph>
<paragraph pageId="0" pageNumber="15">
The species name is a combination of
<taxonomicName authorityName="Wollaston" authorityYear="1854" class="Insecta" family="Hydrophilidae" genus="Dactylosternum" kingdom="Animalia" lsidName="Dactylosternum" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="15">Dactylosternum</emphasis>
</taxonomicName>
, a genus in the same tribe
<taxonomicName lsidName="" pageId="0" pageNumber="15" rank="tribe" tribe="Coelostomatini">Coelostomatini</taxonomicName>
, and the Latin
<emphasis italics="true" pageId="0" pageNumber="15">punctum</emphasis>
. The name refers to the fact that this species with distinct serial punctures on elytra which is similar to many species of
<taxonomicName authorityName="Wollaston" authorityYear="1854" class="Insecta" family="Hydrophilidae" genus="Dactylosternum" kingdom="Animalia" lsidName="Dactylosternum" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="15">Dactylosternum</emphasis>
</taxonomicName>
Wollaston, 1854.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="biology_ecology">
<paragraph pageId="0" pageNumber="15">Biology.</paragraph>
<paragraph pageId="0" pageNumber="15">Aquatic. Adults were found on the edges of a forest stream at night.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="remarks">
<paragraph pageId="0" pageNumber="15">Remarks.</paragraph>
<paragraph pageId="0" pageNumber="15">
This species is easily recognized as a member of
<taxonomicName authorityName="Wollaston" authorityYear="1854" class="Insecta" family="Hydrophilidae" genus="Dactylosternum" kingdom="Animalia" lsidName="Dactylosternum" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="15">Dactylosternum</emphasis>
</taxonomicName>
by the ten rows of serial punctures on elytra, which is different to any known
<taxonomicName class="Insecta" family="Hydrophilidae" genus="Coelostoma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Coelostoma" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="15">Coelostoma</emphasis>
</taxonomicName>
species.
<taxonomicName authorityName="Hebauer" authorityYear="2002" class="Insecta" family="Hydrophilidae" genus="Coelostoma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Coelostoma martensi" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="martensi">
<emphasis italics="true" pageId="0" pageNumber="15">Coelostoma martensi</emphasis>
</taxonomicName>
Hebauer, 2002 and
<taxonomicName class="Malacostraca" kingdom="Animalia" lsidName="C. gentilii" order="Amphipoda" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="gentilii">
<emphasis italics="true" pageId="0" pageNumber="15">C. gentilii</emphasis>
</taxonomicName>
Jia, Aston &amp;
<normalizedToken originalValue="Fikáček">Fikacek</normalizedToken>
, 2014 (Fig.
<figureCitation captionStart="Figure 13" captionStartId="F13" captionText="Figure 13. Lateral view of Coelostoma spp. (the red figures indicate the serial number of elytral serial punctures; the white arrows indicate the punctures of series; the square indicates the elytral ground punctures) A Coelostoma pseudomartensi sp. nov. B Coelostoma gentilii Jia, Aston &amp; Fikacek, 2014. Scale bar: 1 mm (A, B)." figureDoi="10.3897/zookeys.1091.79564.figure13" httpUri="https://binary.pensoft.net/fig/666195" pageId="0" pageNumber="15">13B</figureCitation>
) are also known with serial punctures on elytra, but only visible laterally.
<taxonomicName authorityName="Hebauer" authorityYear="2002" class="Insecta" family="Hydrophilidae" genus="Coelostoma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Coelostoma rubens" order="Coleoptera" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="rubens">
<emphasis italics="true" pageId="0" pageNumber="15">Coelostoma rubens</emphasis>
</taxonomicName>
Hebauer, 2002 (
<bibRefCitation DOI="https://doi.org/10.1080/01650424.2019.1612072" author="Jia, F-L" journalOrPublisher="Aquatic Insects" pageId="0" pageNumber="15" pagination="291 - 299" refId="B16" refString="Jia, F-L, Angus, RB, Bian, D, 2019. Two new species of Coelostoma Brulle, 1835 from China (Coleoptera: Hydrophilidae: Sphaeridiinae). Aquatic Insects 40 (4): 291 - 299, DOI: https://doi.org/10.1080/01650424.2019.1612072" title="Two new species of Coelostoma Brulle, 1835 from China (Coleoptera: Hydrophilidae: Sphaeridiinae)." url="https://doi.org/10.1080/01650424.2019.1612072" volume="40" year="2019">Jia et al. 2019</bibRefCitation>
: figs 4, 5),
<taxonomicName class="Malacostraca" kingdom="Animalia" lsidName="C. jaculum" order="Amphipoda" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="jaculum">
<emphasis italics="true" pageId="0" pageNumber="15">C. jaculum</emphasis>
</taxonomicName>
Jia, Angus &amp; Bian, 2019 (
<bibRefCitation DOI="https://doi.org/10.1080/01650424.2019.1612072" author="Jia, F-L" journalOrPublisher="Aquatic Insects" pageId="0" pageNumber="15" pagination="291 - 299" refId="B16" refString="Jia, F-L, Angus, RB, Bian, D, 2019. Two new species of Coelostoma Brulle, 1835 from China (Coleoptera: Hydrophilidae: Sphaeridiinae). Aquatic Insects 40 (4): 291 - 299, DOI: https://doi.org/10.1080/01650424.2019.1612072" title="Two new species of Coelostoma Brulle, 1835 from China (Coleoptera: Hydrophilidae: Sphaeridiinae)." url="https://doi.org/10.1080/01650424.2019.1612072" volume="40" year="2019">Jia et al. 2019</bibRefCitation>
: figs 2, 3) and
<taxonomicName class="Malacostraca" kingdom="Animalia" lsidName="C. phototropicum" order="Amphipoda" pageId="0" pageNumber="15" phylum="Arthropoda" rank="species" species="phototropicum">
<emphasis italics="true" pageId="0" pageNumber="15">C. phototropicum</emphasis>
</taxonomicName>
Jia, Angus &amp; Bian (
<bibRefCitation DOI="https://doi.org/10.1080/01650424.2019.1612072" author="Jia, F-L" journalOrPublisher="Aquatic Insects" pageId="0" pageNumber="15" pagination="291 - 299" refId="B16" refString="Jia, F-L, Angus, RB, Bian, D, 2019. Two new species of Coelostoma Brulle, 1835 from China (Coleoptera: Hydrophilidae: Sphaeridiinae). Aquatic Insects 40 (4): 291 - 299, DOI: https://doi.org/10.1080/01650424.2019.1612072" title="Two new species of Coelostoma Brulle, 1835 from China (Coleoptera: Hydrophilidae: Sphaeridiinae)." url="https://doi.org/10.1080/01650424.2019.1612072" volume="40" year="2019">Jia et al. 2019</bibRefCitation>
: fig. 1) are similar to this new species in the shape of aedeagus. However, none of these species with serial punctures on elytra.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="15" type="distribution">
<paragraph pageId="0" pageNumber="15">Distribution.</paragraph>
<paragraph pageId="0" pageNumber="15">Only known from type locality. China (Yunnan).</paragraph>
</subSubSection>
</treatment>
</document>