diff --git a/data/00/19/9A/00199A53C7D85E0193560081EBCF84FA.xml b/data/00/19/9A/00199A53C7D85E0193560081EBCF84FA.xml new file mode 100644 index 00000000000..248145ef19c --- /dev/null +++ b/data/00/19/9A/00199A53C7D85E0193560081EBCF84FA.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Kahvenales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Kahvenaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1634339 and EUK 1630771 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Kahvenaceae + +. + + + + \ No newline at end of file diff --git a/data/01/C2/B1/01C2B117049054D9944492E16980CE17.xml b/data/01/C2/B1/01C2B117049054D9944492E16980CE17.xml new file mode 100644 index 00000000000..386e48f2328 --- /dev/null +++ b/data/01/C2/B1/01C2B117049054D9944492E16980CE17.xml @@ -0,0 +1,141 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Densosporaceae Desirò, M. E. Sm., Bidartondo, Trappe & Bonito +, emend. Tedersoo + + + + + +Type +genus. + + + + +Densospora +McGee. + + + + + +Description. + + +Phylogenetic diagnosis as in +Desiro et al. (2017) +, but includes a more limited phylogenetic group - the least inclusive clade comprised of + +Densospora +spp. + +(accessions + +JF 414167 + +and UDB 28692), + +Sphaerocreas pubescens + +(accession + +LC 107618 + +) and accession EUK 1601029 (Suppl. material +3 +). + + + + +Notes. + + +Based on +SSU +phylogeny (Suppl. material +4 +), one or both of the genera + +Densospora + +and + +Sphaerocreas + +are paraphyletic, and their relationships require further research. Most species in both genera remain to be sequenced, including + +D. tubiformis +(P. A. Tandy) McGee + +- the +type +species of + +Densospora + +. + + + + \ No newline at end of file diff --git a/data/04/D6/E4/04D6E4EC698B5CA49FE1217FEDFA3169.xml b/data/04/D6/E4/04D6E4EC698B5CA49FE1217FEDFA3169.xml new file mode 100644 index 00000000000..8243d53a75d --- /dev/null +++ b/data/04/D6/E4/04D6E4EC698B5CA49FE1217FEDFA3169.xml @@ -0,0 +1,136 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Tammsaarea +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Tammsaarea vivikae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Tammsaareaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1602762 and EUK 1635767 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +sequences, + +Tammsaarea + +is comprised of two species; the other being represented by +LSU +sequences EUK 1601269, EUK 1635767 and EUK 1635768 (all +GSMc +plot +G +4185, + +Picea +- +Pinus + +forest soil in Ristipalo, +Estonia +, + +58.10241 ° N +, +27.47874 ° E + +). + + + + \ No newline at end of file diff --git a/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml b/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml new file mode 100644 index 00000000000..43846b6bf9d --- /dev/null +++ b/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml @@ -0,0 +1,196 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Moostea stephanieae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Moostea + +based on the + +ITS + +region (positions 68–97 gcagatgatcgtgagggagttctcttcttc; one mismatch allowed) and +LSU +(positions 436–455 tgggcttctgctccggcgta; one mismatch allowed) as indicated in Fig. +11 +. + + + + + + +Diagnostic barcodes for + +Moostea stephanieae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 128417 ( + +holotype + +); +eDNA +sequence EUK 1604044 ( + +lectotype + +); +GSMc +plot +G +5828, + +Malus domestica + +orchard (soil sample TUE 028417) in Mooste, +Estonia +, + +58.15335 ° N +, +27.19642 ° E + +. + + + + +Description. + + +Other sequences: EUK 1600287 ( +LSU +: +type +locality); EUK 1604043 and EUK 1603823 (both +GSMc +plot +G +5835, airfield soil in Ridali, +Estonia +, + +57.93692 ° N +, +26.98099 ° E + +). + + + + +Etymology. + + +Mooste +(Estonian) refers to +type +locality; and +Stephanie +(English) refers to the first name of Stephanie +A +. Eichorst who collected the first materials from the respective family. + + + + +Notes. + + +Found in two sites in +Estonia +, with + +ITS + +and +LSU +sequences displaying up to 1 % and 0.3 % differences, respectively. + + + + \ No newline at end of file diff --git a/data/11/8E/75/118E75892DE250538FC7469A0F7D1B6C.xml b/data/11/8E/75/118E75892DE250538FC7469A0F7D1B6C.xml new file mode 100644 index 00000000000..122f631b4f8 --- /dev/null +++ b/data/11/8E/75/118E75892DE250538FC7469A0F7D1B6C.xml @@ -0,0 +1,164 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Lokruma +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Lokruma stenii +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Lokrumaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1203766, EUK 1600125 and EUK 1600078 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +sequences, + +Lokruma + +is comprised of 35–40 species, some of which are represented by sequences EUK 1200048 ( +GSMc +plot +G +5130, grassland soil in Angera, +Italy +, + +45.77336 ° N +, +8.59657 ° E + +); EUK 1602967 ( +GSMc +plot +G +4626, + +Picea +- +Populus + +forest soil in Kõrve, +Estonia +, + +59.07754 ° N +, +26.76144 ° E + +); and EUK 1603058 ( + +Picea abies + +forest soil in Serga, +Estonia +, + +57.76052 ° N +, +27.47502 ° E + +). Given the relatively high intraspecific differences and low interspecific differences, the +LSU +region is not optimal for distinguishing species of + +Lokruma + +. + + + + \ No newline at end of file diff --git a/data/12/C8/B8/12C8B80814E05604BAF230B66BF99003.xml b/data/12/C8/B8/12C8B80814E05604BAF230B66BF99003.xml new file mode 100644 index 00000000000..406522e4cca --- /dev/null +++ b/data/12/C8/B8/12C8B80814E05604BAF230B66BF99003.xml @@ -0,0 +1,172 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Ruua +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Ruua coralieae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Ruuaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603424, EUK 1600239, EUK 1600169 and EUK 1600180 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Ruua + +is comprised of 3–4 potential species that are represented by sequences EUK 1632165 ( +GSMc +plot +S +510, village habitat soil in Kihnu, +Estonia +, + +58.1282 ° N +, +23.9815 ° E + +); EUK 1603289 ( +GSMc +plot +G +4450, + +Fraxinus +- +Tilia + +forest soil in Nigula, +Estonia +, + +58.0190 ° N +, +24.6803 ° E + +); EUK 1103406 (freshwater in Skogaryd, +Sweden +, + +58.37 ° N +, +12.16 ° E + +); and +FN 610984 +( + +Fagus sylvatica + +forest soil in Breuil-Chenue, +France +, + +47.301 ° N +, +4.076 ° E + +), isolated by Coralie Damon ( +Damon et al. 2010 +). + + + + \ No newline at end of file diff --git a/data/16/13/A7/1613A7B6E4AE55A3A34A9797979835A7.xml b/data/16/13/A7/1613A7B6E4AE55A3A34A9797979835A7.xml new file mode 100644 index 00000000000..07561f383b9 --- /dev/null +++ b/data/16/13/A7/1613A7B6E4AE55A3A34A9797979835A7.xml @@ -0,0 +1,103 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Diversispora +C. Walker & A. Schüssler emend. Tedersoo & Magurno + + + + + + +Type +species. + + + + +Diversispora spurca +(C. M. Pfeiffer, C. Walker & Bloss) C. Walker & Schüssler. + + + + + +Description. + + +Spores diversisporoid, rarely otosporoid or tricisporoid. Diversisporoid spores formed singly, in clusters or in large disorganised fruiting bodies with high spore numbers. Spores with 1–4 wall layers; pores often closed with a septum. Subtending hyphal pores rarely open. Otosporoid spores formed laterally on the persistent neck of a sporiferous saccule. Tricisporoid spores with inner flexible hyaline wall layers (formed de novo) without granular beaded surface and no Melzer reaction. Spore pores generally closed by a septum at the spore base, arising from the innermost wall lamina or inner layer or from both. Forms a monophyletic group within +Diversisporaceae +based on the SSU- + +ITS + +- +LSU +phylogram (Fig. +1 +, Suppl. material +1 +). + + + + \ No newline at end of file diff --git a/data/18/0E/F3/180EF3274C34574CB09B21F423A4C97D.xml b/data/18/0E/F3/180EF3274C34574CB09B21F423A4C97D.xml new file mode 100644 index 00000000000..d7ca6316ebc --- /dev/null +++ b/data/18/0E/F3/180EF3274C34574CB09B21F423A4C97D.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Kungsaengenales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Kungsaengenaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603402 and EUK 1602136 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Kungsaengenaceae + +. + + + + \ No newline at end of file diff --git a/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml b/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml new file mode 100644 index 00000000000..795897bce9d --- /dev/null +++ b/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml @@ -0,0 +1,191 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Hoforsa rebekkae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Hoforsa + +based on the + +ITS + +region ( +ITS +2 positions 108–127 ggratcycccgaggtgtgaaac; one mismatch allowed) and +LSU +(positions 546–565 ctcctggtgctctcacccgt; no mismatch allowed) as indicated in Fig. +4 +. + + + + + + +Diagnostic barcodes for + +Hoforsa rebekkae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample: TUE 128830 ( + +holotype + +); +eDNA +sequence EUK 1100001 ( + +lectotype + +); + +Pinus sylvestris + +forest near Hofors, +Sweden +( + +60.49 ° N +, +16.30 ° E + +). + + + + +Description. + + +Other sequences: EUK 1104560 ( +type +locality); + +OU +004104 + +(San Francisco, +Ecuador +, root sample); and +KP 889387 +and +KP 889486 +(both coniferous forest soil in +British Columbia +, +Canada +). + + + + +Etymology. + + +Hofors +(Swedish) refers to +type +locality; and +Rebekka +(Scotch) refers to the first name Rebekka Artz who was the first to collect materials from this genus. + + + + +Notes. + + +Found from three sites across three continents, with + +ITS + +sequences differing up to 3.5 % and +LSU +sequences up to 0.5 %. + + + + \ No newline at end of file diff --git a/data/21/AC/C3/21ACC375A4D85CC7BA4A8CED06A36780.xml b/data/21/AC/C3/21ACC375A4D85CC7BA4A8CED06A36780.xml new file mode 100644 index 00000000000..473a07347c5 --- /dev/null +++ b/data/21/AC/C3/21ACC375A4D85CC7BA4A8CED06A36780.xml @@ -0,0 +1,137 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Lokrumales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Lokrumaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1203766, EUK 1600125 and EUK 1600268 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes Lokrumaceae and another potentially family-level taxon, represented by sequences EUK 1602809 ( +GSMc +plot +G +4499, rich, calcareous + +Picea abies + +forest soil in Kurisoo, +Estonia +; + +59.12808 ° N +, +25.76395 ° E + +); EUK 1603041 and EUK 1603145 (both +GSMc +plot +G +4185, + +Picea +- +Pinus + +forest soil in Ristipalo, +Estonia +, + +58.10241 ° N +, +27.47874 ° E + +). + + + + \ No newline at end of file diff --git a/data/25/3A/D9/253AD908CEEC516A96488AF7F4409EF3.xml b/data/25/3A/D9/253AD908CEEC516A96488AF7F4409EF3.xml new file mode 100644 index 00000000000..24bb6783c12 --- /dev/null +++ b/data/25/3A/D9/253AD908CEEC516A96488AF7F4409EF3.xml @@ -0,0 +1,109 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Moosteales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Moosteaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1604044, +JQ 311412 +and EUK 1600278 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Moosteaceae + +. + + + + \ No newline at end of file diff --git a/data/2E/5A/33/2E5A33C37C775BC38FE83A22AA0ADEB6.xml b/data/2E/5A/33/2E5A33C37C775BC38FE83A22AA0ADEB6.xml new file mode 100644 index 00000000000..ff42084e480 --- /dev/null +++ b/data/2E/5A/33/2E5A33C37C775BC38FE83A22AA0ADEB6.xml @@ -0,0 +1,153 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Endogonomycetes +Doweld emend. Tedersoo + + + + + + +Type +order. + + + +Endogonales Jacz. & P. A. Jacz. + + + + +Description. + + +Fruiting body absent, rarely present - hypogeous or on debris, globose, irregular, sometimes resupinate, +1–20 mm +in diam., may be composed of aggregated zygosporangial clusters. Reproductive structures as zygosporangia (in + +Endogone + +, + +Jimgerdemannia + +) or chlamydospores (in + +Vinositunica + +, + +Densospora + +), aggregated in the fruiting body or as chlamydospores on extraradical hyphae (in + +Planticonsortium + +). Chlamydospore wall continuous, multilayered, with dense subtending hyphae, lacking septa. Hyphae filamentous, coenocytic, sometimes with secondary septa, rarely yeast-like (in + +Bifiguratus + +). Forms a monophyletic group in Mucoromycota, as the least inclusive clade covering accessions UDB 025468, UDB 28692, EUK 1201418, EUK 1203196, EUK 1602762, EUK 1202520, EUK 1203766, EUK 1107335 and EUK 1602357 (Suppl. material +3 +). + + + + +Notes. + + +Endogonomycetes +harbours currently 17 orders and two unassigned, potentially order-level groups represented by sequences EUK 1604020 and EUK 1603073 ( +GSMc +plot +G +3308, + +Juniperus communis + +coppiced grassland soil in Atla, +Estonia +, + +58.30122 ° N +, +21.93600 ° E + +); and EUK 1602478 ( +GSMc +plot +G +4627, mixed forest soil in Tudusoo, +Estonia +, + +59.11368 ° N +, +26.75944 ° E + +). + + + + \ No newline at end of file diff --git a/data/2E/EC/47/2EEC473B405C52F3AFFEF114FBBC1D31.xml b/data/2E/EC/47/2EEC473B405C52F3AFFEF114FBBC1D31.xml new file mode 100644 index 00000000000..cb96dd6f9b7 --- /dev/null +++ b/data/2E/EC/47/2EEC473B405C52F3AFFEF114FBBC1D31.xml @@ -0,0 +1,178 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Riederberga +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Riederberga sylviae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Riederbergaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1602903, EUK 1602242 and EUK 1602243 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Riederberga + +is comprised of 5–6 species, some of which are represented by sequences EUK 1602859 ( +GSMc +plot +G +4770, + +Populus berolinensis + +dominated coppiced garden in Ubasalu, +Estonia +, + +59.06755 ° N +, +24.47842 ° E + +); EUK 1602912 ( +GSMc +plot +G +4772, + +Juniperus communis + +calcareous woodland soil in Kohatu, +Estonia +, + +58.95934 ° N +, +24.30017 ° E + +); EUK 1602761 ( +GSMc +plot +G +4434, mixed woodland soil in Kalli, +Estonia +, + +58.53770 ° N +, +24.06659 ° E + +); and EUK 1603687 ( +GSMc +plot +G +4229, + +Quercus robur + +woodland soil in Niidiaia, +Estonia +, + +58.88603 ° N +, +24.47280 ° E + +). + + + + \ No newline at end of file diff --git a/data/35/B2/41/35B241B1E9A251F5B40CEE7943B4FEDF.xml b/data/35/B2/41/35B241B1E9A251F5B40CEE7943B4FEDF.xml new file mode 100644 index 00000000000..549a5247db3 --- /dev/null +++ b/data/35/B2/41/35B241B1E9A251F5B40CEE7943B4FEDF.xml @@ -0,0 +1,166 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Parvocarpum badium +(Oehl, Redecker & Sieverd.) Magurno + +comb. nov. + + + + + + + + +Glomus badium +Oehl, D. Redecker & Sieverd., Angew. Botan. + +79: 39 (2005) + +. Basionym. + + + + + + + +Funneliformis badius +(Oehl, Redecker & Sieverd.) C. Walker & A. Schüssler. + +Synonymy. \ + + + + + + +Description. + + +See +Oehl et al. (2005) +. + + + + +Etymology. + + +parvus +(Latin) = small; and +carpum +(Latin) = body, referring to the small size of fruiting bodies produced. + + + + +Diagnosis. + + + +P. badium + +differs from other genera of the +Glomeraceae +by producing glomoid-like spores surrounding a central plexus of interwoven hyphae in small organised fruiting bodies, lacking a peridium. Spores with inner flexible hyaline layer and short subtending hyphae. Phylogenetically distinct from + +G. macrocarpum + +and other + +Glomus sens +. str. + +species based on the SSU- + +ITS + +- +LSU +phylogram (Fig. +1 +, Suppl. material +1 +). + + + + +Notes. + + +Phylogenetic position of + +P. badium + +within the genus + +Parvocarpum + +is unresolved because of a single available short read. + + + + \ No newline at end of file diff --git a/data/41/15/17/41151731FF814F4BFF12E1D585F98351.xml b/data/41/15/17/41151731FF814F4BFF12E1D585F98351.xml new file mode 100644 index 00000000000..fcfcdf2c53e --- /dev/null +++ b/data/41/15/17/41151731FF814F4BFF12E1D585F98351.xml @@ -0,0 +1,89 @@ + + + +Redescription of two species of Naineris (Annelida, Orbiniidae) with multiple dorsal organs and description of a new species from the NE Pacific + + + +Author + +Álvarez, Ricardo +Graduate program in Oceanic Coastal Systems (PGSISCO), Federal University of Paraná, Pontal do Paraná, Paraná, Brazil & Departamento de Invertebrados, Campus de Ensino e Pesquisa do Museu Nacional, Universidade Federal do Rio de Janeiro, 20941 - 160, São Cristóvão, Rio de Janeiro, Rio de Janeiro, Brazil + + + +Author + +Haggin, Brent M. +Los Angeles County Sanitation Districts, Marine Biology Group, 24501 Figueroa Street, Carson, California, 90745, USA. + +text + + +Zootaxa + + +2024 + +2024-08-06 + + +5492 + + +3 + + +395 +408 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.3.6 + +journal article +10.11646/zootaxa.5492.3.6 +1175-5326 +13234903 +DD79929A-C343-467F-A3AB-31FC7E59705C + + + + + + +Genus: + +Naineris +Blainville, 1828 + + + + + + + + +Type +species: + + +Naineris quadricuspida +( +Fabricius, 1780 +) + +. + + + + +Diagnosis. +(after +Álvarez & Budaeva 2023 +) Prostomium rounded, truncated, or weakly bifid on anterior margin. Peristomium with one or two achaetous rings. Thorax with 12–30 or more segments; branchiae first present from chaetigers 2–23. Thoracic neuropodia with 0–2 postchaetal lobes; no subpodial lobes. Thoracic neurochaetae include capillaries, or capillaries mixed with blunt-tipped uncini, sometimes hooded, or uncini and subuluncini. Abdominal chaetae include capillaries, sometimes furcate chaetae in notopodia, and capillaries and embedded or protruding aciculae in neuropodia. Dorsal sensory organs paired or multiple, rounded or as elongated semicircles. Dorsal cilia present at base of branchiae in some species, either forming flat bands or crests. + + + + \ No newline at end of file diff --git a/data/41/15/17/41151731FF814F4BFF12E38484FB82CB.xml b/data/41/15/17/41151731FF814F4BFF12E38484FB82CB.xml new file mode 100644 index 00000000000..3c8be98bf94 --- /dev/null +++ b/data/41/15/17/41151731FF814F4BFF12E38484FB82CB.xml @@ -0,0 +1,145 @@ + + + +Redescription of two species of Naineris (Annelida, Orbiniidae) with multiple dorsal organs and description of a new species from the NE Pacific + + + +Author + +Álvarez, Ricardo +Graduate program in Oceanic Coastal Systems (PGSISCO), Federal University of Paraná, Pontal do Paraná, Paraná, Brazil & Departamento de Invertebrados, Campus de Ensino e Pesquisa do Museu Nacional, Universidade Federal do Rio de Janeiro, 20941 - 160, São Cristóvão, Rio de Janeiro, Rio de Janeiro, Brazil + + + +Author + +Haggin, Brent M. +Los Angeles County Sanitation Districts, Marine Biology Group, 24501 Figueroa Street, Carson, California, 90745, USA. + +text + + +Zootaxa + + +2024 + +2024-08-06 + + +5492 + + +3 + + +395 +408 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.3.6 + +journal article +10.11646/zootaxa.5492.3.6 +1175-5326 +13234903 +DD79929A-C343-467F-A3AB-31FC7E59705C + + + + + + +Key for species of + +Naineris + +recorded in the +US +North-Pacific + + + + + + + + +1. Thoracic neurochaetae with capillaries only............................ + +Naineris +sp. + +(sensu +Álvarez & Budaeva, 2023 +) + + + + +1’. Thoracic neurochaetae include other +types +of chaetae......................................................... 2 + + + + + + +2. Dorsal organs multiple pairs on all segments.................................................. + +N. elegans + + +sp. nov. + + + + +2’. Dorsal organs only a single pair per segment................................................................ 3 + + + + + +3. Thoracic neurochaetae including capillaries, uncini and subuluncini...................... + +N. dendritica +( +Kinberg, 1867 +) + + + + +3’. Thoracic neurochaetae including capillaries and uncini, subuluncini absent........................................ 4 + + + + + +4. Thoracic neuropodia with a single postchaetal lobe................................ + +N. quadricuspida +( +Fabricius, 1780 +) + + + + + +4’. Thoracic neuropodia with two postchaetal lobes........................................ + +N. uncinata +Hartman, 1957 + + + + + + + \ No newline at end of file diff --git a/data/41/15/17/41151731FF824F4CFF12E5B085D1841D.xml b/data/41/15/17/41151731FF824F4CFF12E5B085D1841D.xml new file mode 100644 index 00000000000..a6ec4fa6f4f --- /dev/null +++ b/data/41/15/17/41151731FF824F4CFF12E5B085D1841D.xml @@ -0,0 +1,941 @@ + + + +Redescription of two species of Naineris (Annelida, Orbiniidae) with multiple dorsal organs and description of a new species from the NE Pacific + + + +Author + +Álvarez, Ricardo +Graduate program in Oceanic Coastal Systems (PGSISCO), Federal University of Paraná, Pontal do Paraná, Paraná, Brazil & Departamento de Invertebrados, Campus de Ensino e Pesquisa do Museu Nacional, Universidade Federal do Rio de Janeiro, 20941 - 160, São Cristóvão, Rio de Janeiro, Rio de Janeiro, Brazil + + + +Author + +Haggin, Brent M. +Los Angeles County Sanitation Districts, Marine Biology Group, 24501 Figueroa Street, Carson, California, 90745, USA. + +text + + +Zootaxa + + +2024 + +2024-08-06 + + +5492 + + +3 + + +395 +408 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.3.6 + +journal article +10.11646/zootaxa.5492.3.6 +1175-5326 +13234903 +DD79929A-C343-467F-A3AB-31FC7E59705C + + + + + + + +Naineris bicornis +Hartman, 1951 + + + + + + + +( +Figs 1–3 +) + + + + + + + +Naineris bicornis +Hartman, 1951: 72–74 + + +, pl. 19, figs 1–6; 1957: 304–305, pl. 40, figs 1–6; 1959: 366.— + +Perkins & Savage 1975: 43 + +.— + +Taylor 1984: 1–9 + +, figs 1–5, 1–6a–f.— + +Salazar-Vallejo 1996: 26 + +.— + +Perkins 1998: 88 + +.—Felder & Camp 2009: 764. + + + + + +FIGURE 1 +. + +Naineris bicornis + +. Holotype (LACM-AHF Poly 674). A, anterior end, dorsal view; B, thorax, dorsal view; C, thoracic parapodia, lateral view; D, thorax, ventral view; E, transverse section of thoracic segment, posterior view; F, transverse section of abdominal segment, posterior view; G, abdominal parapodia, lateral view. br—branchia, dc—dorsal crest, do—dorsal organs, NeL—neuropodial lobe, NoL—notopodial lobe, on—nuchal organ, pa—papilla, pb—proboscis (Scales: A–F: 1 mm; G: 0.2 mm). + + + + +Material examined. + + +USA +, +Florida + +, +Franklin County +, +Alligator Harbor +, Florida, +Gulf of Mexico +, US, North Atlantic Ocean, +Sta. +3, coll. + +04 Feb 1950 + +, +29.910000°N +, +84.395278°W +, + +holotype + +( +LACM-AHF +Poly +674). + + +— + +off +Saint George Sound + +, +MAFLA +, +Sta. +2421, coll. +D. Savelle +, +H. Kritzler +, +D. Garlick +, + +Sep 1975 + +, +29.62°N +, +84.28°W +, + +19 m + +, box core (1, +USNM 1284135 +); + + +MAFLA +Sta. +2421, coll. +D. Savelle +, +H. Kritzler +, +D. Garlick +, + +Sep 1975 + +, +29.616667°N +, +84.283333°W +, + +19 m + +, box core (1, +USNM 1284134 +); + + +MAFLA +, +Sta. +2420, coll. +D. Savelle +, +H. Kritzler +, +D. Garlick +, 1975, +29.6994°N +, +84.1836°W +, + +19 m + +(1, +USNM 1284133 +); + + +MAFLA +, +Sta. +2420, D. +Savelle +, +H. Kritzler +, +D. Garlick +, + +Jun 1975 + +, +29.6994°N +, +84.1836°W +, + +14 m + +, (1, +USNM 1284132 +); + + +MAFLA +, +Sta. +2420, coll. +D. Savelle +, +H. Kritzler +, +D. Garlick +, 1975, +29.6994°N +, +84.1836°W +, + +14 m + +(1, +USNM 1284131 +). + + + +—off +Cedar Key + +, +MAFLA +Sta. +2317, coll. +D. Savelle +, +H. Kritzler +, +D. Garlick +, + +19 Sep 1975 + +, +28.933333°N +, +84.100000°W +, + +29 m + +, box core (1, +USNM 1284136 +; 1, +USNM 1284137 +; 1, +USNM 1284138 +; 1, +USNM 1284139 +). + + +— + +off +Crystal River + +, +MAFLA +Sta. +2316, + +Nov 1977 + +, +28.700000° N +, +84.333333° W +, + +35 m + +(1, +USNM 090156 +) (parapodia slides). + + +— + +off +Florida + +, +SOFLA +Sta. +16, coll. +Mote Marine Lab For Bureau +of the +Land Management +/ +Minerals Management Service +( +BLM +/ +MMS +), + +Jul 1981 + +, +25.761667°N +, +83.184444°W +, + +54 m + +(1, +USNM 090154 +); + + +SOFLA +Sta. +02, coll. +Mote Marine Lab For +BLM/ +MMS +, + +May 1981 + +, +26.763889°N +, +82.753056°W +, + +24 m + +(1, +USNM 090153 +); + + +SOFLA +Sta. +46, coll. +Environmental Science +and +Engineering +, +Inc. +/LGL +Ecological Research Associates +( +Ese +/ +Lgl +) +For +BLM/ +MMS +, + +May 1984 + +, +26.0144 °N +, +82.1319°W +, + +18 m + +(2, +USNM 112302 +); + + +SABP +Sta. +7B, coll. +Texas +Instruments +for BLM/ +MMS +, + +May 1977 + +, +29.4664°N +, +80.9525°W +, + +20 m + +(1, +USNM 59369 +); + + +MAFLA +Sta. +2960, + +Nov 1977 + +, +25.67°N +, +82.33°W +, + +27 m + +(1, +USNM 90164 +). + + +— + +off +St. Petersburg + +, +MAFLA +Sta. +2207, coll. + +Aug 1977 + +, +27.950000°N +, +83.150000°W +, + +19 m + +, (1, +USNM 090155 +). + + +— + +off +Apalachicola Bay + +, +MAFLA +, +Sta. +2316, coll. +D. Savelle +, +H. Kritzler +, +D. Garlick +, + +Jul 1975 + +, +28.7003°N +, +84.3336°W +, + +35 m + +, (2, +USNM 1284140 +; 1, +USNM 1284141 +; 1, +USNM 1284670 +); + + +MAFLA +, +Sta +48, coll. DG., + +Jun 1974 + +, +28.48°N +, +84.35°W +(2, +USNM 1284677 +); + + +MAFLA +, +Sta +42, coll. DG., + +Jun 1974 + +, +28.7°N +, +84.44°W +(1, +USNM 1284679 +). + + +— + +off +Clear Water + +, +MAFLA +, +Sta. +2207, coll. +D. Bishof +, +D. Savelle +, + +Jul 1975 + +, +27.9497°N +, +83.15°W +, + +19 m + +, (1, +USNM 1284671 +); + + +MAFLA +, +Sta. +2209, coll. +D. Bishof +, +D. Savelle +, + +Jul 1975 + +, +27.875°N +, +83.5667°W +, + +34 m + +, (3, +USNM 1284672 +). + + +— + +off +Charlotte Harbor + +, +MAFLA +, +Sta. +2104, coll. +D. Bishof +, +D. Savelle +, + +May 1975 + +, +26.4164°N +, +83.3833°W +, + +53 m + +, (1, +USNM 1284678 +). + + +— + +off +Sanibel Island + +, +MAFLA +, +Sta. +2101, coll. +D. Bishof +, +D. Savelle +, + +May 1975 + +, +26.4167°N +, +82.4169°W +, + +11 m + +, (1, +USNM 1284683 +) + +. + + + + +Measurements +. +Holotype +is fragmented in three parts. The most anterior +0.75 mm +long, +3 mm +wide, for 27 chaetigers. +Hartman (1951) +and +Taylor (1984) +reported animals reaching +30 mm +length and +5 mm +width for over 100 segments for specimens from the same localities and sampling events studied. + + + + +Diagnosis +. Spatulate to slightly indented prostomium. Multiple dorsal sensory organs grouped ten per side in a one row anteriorly, increasing to two on posterior thoracic segments, almost crossing midline; abdominal sensory organs forming two distinct groups irregularly arranged, reduced in number (four to five). Thoracic notopodial lobes may be acute-to-rounded-tipped and with median restriction. Thoracic neuropodial lobe with an upper subtriangular papilla. Thoracic neurochaetae with 5–6 transverse, posterior rows of numerous subuluncini; a transverse, anterior row of about 20 crenulate capillaries; an inferior, anterior, oblique row of about 20 hooded uncini and an inferior, posterior, oblique row of capillaries. + + + + +Redescription +. +Holotype +medium-sized specimen. Color in alcohol pale yellow. Thorax and abdomen distinct, with parapodia inserted laterally in thorax and dorsally in abdomen. Most abdominal branchiae lacking. Ventrally thorax smooth, but abdomen tri-annulate with central ring wider than others. + + +Prostomium long, spatulate, slightly indented in front end; no eyespots; nuchal organs present at between posterior end of prostomium and anterior end of peristomium ( +Fig. 1A–B +). Peristomium achaetous, as short as following rings. Mouth opening with striated lips; proboscis wide, lobed ( +Fig. 1D +). + + +Branchiae from chaetiger 6 onward ( +Figs 1B +, +3A +), lanceolate, densely ciliated ( +Fig. 1E–F +); first branchiae approximately ⅓ size of abdominal branchiae. Dorsal sensory organs present from chaetiger 12 ( +Figs 1B +, +2B–C +, +3B +), multiple per segment, oval-shaped; most anterior grouped ten per side forming one row, increasing to two on posterior thoracic segments, almost crossing midline; abdominal sensory organs forming two distinct groups irregularly disposed, reduced in number (four to five). Dorsal crest represented by a straight, consistent, flat curve, low and ciliated ( +Fig. 1F +). + + +Thorax slightly depressed ( +Fig. 1E +), both fragments with 45 chaetigers (~3 transitional segments with intermediate characteristics between thoracic and abdominal segments) ( +Fig. 1B–C +). Parapodia biramous. Thoracic notopodial postchaetal lobes slightly constricted, lanceolate, with elongated tips ( +Figs 1E +, +2D +). Thoracic neuropodial postchaetal lobes represented by a flange with an upper papilla, subtriangular ( +Figs 1C, E +, +2A, D +). Abdominal notopodia with postchaetal lobes hardly constricted, pyriform. Abdominal neuropodial lobes are represented by a flange with a triangular lobe, shorter than thoracic ( +Figs 1F–G +, +2E +). + + +Thoracic notochaetae with 20–25 crenulate capillaries in two bundles ( +Fig. 2D +). Abdominal notochaetae with about 20 capillaries and a few furcate chaetae each with unequal tines ( +Fig. 2E +). Thoracic neurochaetae with 5–6 transverse, posterior rows of numerous subuluncini; a transverse, anterior row of about 20 crenulate capillaries; an inferior, anterior, oblique row of about 20 hooded uncini and an inferior, posterior, oblique row of capillaries ( +Figs 2D +, +3C +). Abdominal neurochaetae include three acicular spines ( +Fig. 3D +) and 5–8 crenulate capillaries intermixed ( +Fig. 2E +). + + + +FIGURE 2 +. + +Naineris bicornis + +(USNM 1284134) (Shirlastain stained).A, anterior end, dorsal view; B, thorax, dorsal view; C, last thoracic segments, dorsal view. + +Naineris bicornis + +(USNM 090156). D, thoracic chaetiger; E, abdominal chaetiger. a—acicular spines, br—branchiae, cc—crenulate capillaries, do—dorsal organs, NoL—Abdominal notopodial lobe, pa—neuropodial papilla, pr—prostomium, su—subuluncini, u—uncini (Scales: A: 0.5 mm; B–C: 0.25 mm; D–E: 0.25 mm). + + +Pygidium unknown. + + + +Remarks +: + +Naineris bicornis + +is mainly distinguished by its slightly indented prostomium. Nevertheless, care is required when using the shape of the prostomium as the main diagnostic character. The shape of the prostomium is as it appears in the +holotype +is only seen occasionally and tends to be spatulate in specimens from other collections, probably due to fixation ( +Figs 2A +, +3A +). + + +Paired, dark segmental spots at bases of branchiae were not observed in the +holotype +but were present in chaetigers +5–6 in +the additional specimens examined from the type locality or vicinity. They seem to correspond to internal structures that are transparent through the epidermis and must not be confused with the dorsal sensory organs ( +Fig. 2A–B +). These dark, segmental spots were also present in the juveniles of + +N. australis + +, the most similar species (see + +Zhadan +et al +. 2015 + +, fig. 12D). In addition, dorsal sensory organs were not originally described in + +N. bicornis + +. As in + +N. australis + +, they are multiple ( +Figs 2B–C +, +3B +) and difficult to see in old, preserved specimens. + + + +FIGURE 3 +. + +Naineris bicornis + +(USNM 1284137). A, anterior end; B, abdominal segments, dorsal view, multiple dorsal organs; C, thoracic neurochaetae; D, abdominal neurochaetae. a—acicula, cc—crenulate capillaries, do—dorsal organs, pe—peristomium, pr—prostomium, su—subuluncini, u—uncini (Scales: A: 400 μm; B: 100 μm.; C–D: 20 μm). + + + +The chaetal arrangements of the thoracic neuropodia of + +N. bicornis + +, + +N. australis + +, and + +N. elegans + +sp. nov. +are all similar. It includes the subuluncini, crenulate capillaries, and hooded uncini. The characters distinguishing + +N. bicornis + +from other similar species is based mainly on the features of thoracic notopodial lobes, distribution of multiple dorsal organs, geographic distribution and bathymetry. Thoracic notopodial lobes may be acute-to-rounded-tipped and possess a constriction in the middle, as in + +N. bicornis + +. Likewise, dorsal organs they may be grouped in rows or be irregularly distributed and may cross the midline depending on the species. Concerning their distribution, + +Naineris bicornis + +is distributed mostly in the Tropical Atlantic, whereas the other species are from the Pacific. Finally, + +N. bicornis + +occurs at continental shelf depths, whereas the other similar species are intertidal. + + +Recent molecular data have shown that + +N. bicornis + +is a species complex, and at least two species occur in +Brazil +(RA unpublished data). Molecular characterization of specimens from the +type +locality and Brazilian records of + +N. bicornis + +are necessary, but they are outside the scope of this study. This species was recorded only once in +Brazil +( +Nonato 1981 +) and was not abundant in the area ( + +Amaral +et al +. 2022 + +). Recent sampling along the Brazilian coast resulted in +two specimens +, which were similar to + +N. bicornis + +, but with consistent molecular differences between them (RA unpublished data). + + +We also examined the +holotype +of + +Naineris bicornis minuta +Hartmann-Schröder, 1965 + +(ZMH P-14869, type locality: Oahu, +Hawaii +). Because of the juvenile morphology of the +holotype +, it was impossible to find any morphological differences with + +N. bicornis + +. Further studies covering different oceans are necessary to clarify the species remaining in this group. + + + + +Distribution +. Warm Temperate Northwest Atlantic province: Northern Gulf of +Mexico +ecoregion and Tropical +Northwestern +Atlantic province: Floridian and Southern Gulf of +Mexico +ecoregions, + +11– +54 m + +. + + + + \ No newline at end of file diff --git a/data/41/15/17/41151731FF864F42FF12E44883C887A9.xml b/data/41/15/17/41151731FF864F42FF12E44883C887A9.xml new file mode 100644 index 00000000000..f3d34cb9c14 --- /dev/null +++ b/data/41/15/17/41151731FF864F42FF12E44883C887A9.xml @@ -0,0 +1,368 @@ + + + +Redescription of two species of Naineris (Annelida, Orbiniidae) with multiple dorsal organs and description of a new species from the NE Pacific + + + +Author + +Álvarez, Ricardo +Graduate program in Oceanic Coastal Systems (PGSISCO), Federal University of Paraná, Pontal do Paraná, Paraná, Brazil & Departamento de Invertebrados, Campus de Ensino e Pesquisa do Museu Nacional, Universidade Federal do Rio de Janeiro, 20941 - 160, São Cristóvão, Rio de Janeiro, Rio de Janeiro, Brazil + + + +Author + +Haggin, Brent M. +Los Angeles County Sanitation Districts, Marine Biology Group, 24501 Figueroa Street, Carson, California, 90745, USA. + +text + + +Zootaxa + + +2024 + +2024-08-06 + + +5492 + + +3 + + +395 +408 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.3.6 + +journal article +10.11646/zootaxa.5492.3.6 +1175-5326 +13234903 +DD79929A-C343-467F-A3AB-31FC7E59705C + + + + + + + +Naineris australis +Hartman, 1957 + + + + + + + +( +Fig. 4 +) + + + + + + + +Naineris grubei australis +Hartman, 1957: 303–304 + + +, pl. 39, figs 1–4; 1959: 366.— + +Day 1977: 238 + +.— + +Hutchings & Rainer 1979: 761 + +.— + +Hutchings & Murray 1984: 53 + +.— + + +Zhadan +et al. +2015: 793–797 + + +, figs 10A–G, 11A–C, 12D. + + + + + +Naineris grubei + +.— + +Day 1977: 237–238 + +. + + + + + +Naineris australis + +.— + +Blake 2017: 103 + +; + +Zhadan 2020: 479–480 + +, fig. 15A–E (in part). + + + + + + +Material examined. +Australia +, +Queensland + +: off +Casuarina Beach, Lizard +Island, coll. K. Meissner and +T +. Alvestad, +14Aug 2013 +, +1 m +, fine sand, +14.67944°S +, +145.44703°E +, intertidal, (1, +AM +W.44038); Heron Island, coll. G. Hartmann-Schröder, coral sand from residual ponds between coral colonies at the North Reef, probably intertidal, +02 Apr 1976 +(1, +ZMH +P-21075). + +New South Wales + +: Broughton Island, coll. NSW Fisheries, +01 Sep 1976 +, + +Posidonia + +diving cores, +32.62°S +, +152.32°E +, intertidal, (1, +AM +W.13138); Botany Bay, Towra Point, coll. K. Robinson, +Jul 1981 +, + +Zostera + +, sand/mud sediment, +34°S +, +151.16°E +, intertidal, (2, +AM +W.195061). + +South Australia + +: Port Noarlunga, Onkaparinga, Adelaide, Sta. 104a, coll. S. J. Edmonds, +35.150004°S +, +138.466649 °E +, intertidal, + +holotype + +of + +Naineris australis + +( +LACM-AHF +Poly 676). + +Western Australia + +: Exmouth, Town Beach, coll. G. Hartmann-Schröder, +10 Oct 1975 +, ripple-marked flat, fine silt with little sand, probably intertidal, (5, +ZMH +P-16592). + + + + +Measurements +. +Holotype +48 mm +long, +1.5 mm +wide, for 173 chaetigers. + + + + +Diagnosis +. Spatulate prostomium. Multiple dorsal sensory organs small, oval-shaped, 2–10 per side, grouped in a single longitudinal row throughout body; first segments a pair per side, increasing in number posteriorly, up to ten in abdominal segments, not crossing midline. Thoracic notopodial lobes digitiform. Thoracic neuropodial lobe with an upper tongue-like papilla. Thoracic neurochaetae with 5–6 transverse, posterior rows of numerous subuluncini; a transverse, anterior row of about 20 crenulate capillaries; an inferior, anterior, oblique row of about 20 hooded uncini and an inferior, posterior, oblique row of capillaries. + + + + +Redescription +. +Holotype +medium-sized specimen. Color in alcohol pale yellow. Body long, with thorax and abdomen about the same width ( +Fig. 4A +). Ventrally thorax smooth, but abdomen, tri-annulate with central ring wider than others. + + +Prostomium spatulate ( +Fig. 4B +); eyespots absent; nuchal organs present at posterior end of prostomium and anterior end of peristomium ( +Fig. 4B +). Peristomium with two achaetous rings, weakly delimited. Mouth opening with lips striated; proboscis only partially everted, represented by a lobe ( +Fig. 4B +). + + +Branchiae from chaetiger 6 onwards; long, glandular, and ciliated ( +Fig. 4C, D +); first digitiform, half size of abdominal branchiae, then increasing in size and a triangular shape. Abdominal branchiae longer, crossing midline, not reaching opposite branchial base. Multiple dorsal sensory organs per segment present from mid-thoracic chaetigers; small, oval-shaped, 2–10 per side, grouped in single longitudinal row throughout body; first segments one pair per side, increasing in number posteriorly, up to ten in abdominal segments ( +Fig. 4F +), not crossing midline. Dorsal crest straight, consistent, flat, forming a low curve ( +Fig. 4C, D +). + + +Thorax weakly depressed, with 38 chaetigers (~4 transitional segments with intermediate characteristics between thoracic and abdominal segments) ( +Fig. 4A +). Parapodia biramous. Thoracic notopodial lobes digitiform ( +Fig. 4B, C +). Thoracic neuropodial lobes represented by a flange with a tongue-like papillae on superior tip ( +Fig. 4B, C +). Abdominal notopodial lobes cirriform ( +Fig. 4D, G +). Abdominal neuropodial lobes triangular with a thin projection on tips ( +Fig. 4D, G +). + + +Thoracic notochaetae: 20–30 crenulate capillaries in two bundles.Abdominal notochaetae: two groups of 10–20 crenulate capillaries. Thoracic neurochaetae: a transverse, anterior row of small capillaries, six transverse, posterior rows of numerous subuluncini; an inferior, posterior, oblique row of about 20 crenulate capillaries and an inferior, anterior, oblique row of about 20 hooded uncini ( +Fig. 4E +). Abdominal neurochaetae: 3 acicular spines and 5–10 crenulate capillaries. + +Pygidium unknown. + + +FIGURE 4 +. + +Naineris australis + +. Holotype (LACM-AHF Poly 676). A, complete specimen; B, anterior end, lateral view; C, thoracic segments, dorsal view; D, abdominal segments, dorsal view. + +N. australis + +(ZMH P-16592). E, thoracic neurochaetae, lateral view. + +N. australis + +(AM W.195061). F, abdominal segments, dorsal view; G, abdominal postchaetal lobes. br—branchiae, cc—crenulate capillaries, dc—dorsal crest, do—dorsal organs, NeL—Neuropodial lobe, NoL—Notopodial lobe, no—nuchal organ, pb—proboscis, pr—prostomium, su—subuluncini, u—uncini (Scales: A: 1 mm; B–E, G: 0.5 mm; F: 0.2 mm). + + + +Variation +: The number of thoracic chaetigers of the specimens studied ranged between 36–50, as in other species it is size-related. Dorsal sensory organs ranged from two to five pairs on posterior segments. + + + + +Remarks +: + +Naineris australis + +was originally described as a subspecies of + +Naineris grubei +( +Gravier, 1908 +) + +by +Hartman (1957) +, redescribed by + +Zhadan +et al. +(2015) + +and was elevated to species rank by +Blake (2017) +, based on differences in the structure of the thoracic neurochaetae and the presence of subuluncini in + +N. australis + +. + + +Dorsal sensory organs were not described for + +N. australis + +by +Hartman (1957) +, but + +Zhadan +et al. +(2015) + +, noted the presence of up to five pairs per segment in specimens from Lizard Island. After examining the +holotype +and other collections, we observed that they varied throughout the body. We stress that it is difficult to see multiple dorsal organs in preserved specimens, and they are usually visible as small transparent scars. It is necessary to use an appropriate light and contrast medium to facilitate its observation; explaining why often overlooked. + + +We examined some of the specimens examined by +Zhadan (2020) +, and the voucher AM W.22470 (Fig. 15D, E) was misidentified, corresponding to a specimen of the + +N. setosa +( +Verril, 1900 +) + +species complex, bearing only capillaries in thoracic neuropodia, and paired dorsal organs. + + + + +Distribution +. Southwest Australian Shelf, Southeast Australian Shelf, East-Central Australian Shelf, and Northeast Australian Shelf provinces, intertidal. + + + + \ No newline at end of file diff --git a/data/41/15/17/41151731FF884F40FF12E7D48588825A.xml b/data/41/15/17/41151731FF884F40FF12E7D48588825A.xml new file mode 100644 index 00000000000..8b0a5b0af4c --- /dev/null +++ b/data/41/15/17/41151731FF884F40FF12E7D48588825A.xml @@ -0,0 +1,405 @@ + + + +Redescription of two species of Naineris (Annelida, Orbiniidae) with multiple dorsal organs and description of a new species from the NE Pacific + + + +Author + +Álvarez, Ricardo +Graduate program in Oceanic Coastal Systems (PGSISCO), Federal University of Paraná, Pontal do Paraná, Paraná, Brazil & Departamento de Invertebrados, Campus de Ensino e Pesquisa do Museu Nacional, Universidade Federal do Rio de Janeiro, 20941 - 160, São Cristóvão, Rio de Janeiro, Rio de Janeiro, Brazil + + + +Author + +Haggin, Brent M. +Los Angeles County Sanitation Districts, Marine Biology Group, 24501 Figueroa Street, Carson, California, 90745, USA. + +text + + +Zootaxa + + +2024 + +2024-08-06 + + +5492 + + +3 + + +395 +408 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.3.6 + +journal article +10.11646/zootaxa.5492.3.6 +1175-5326 +13234903 +DD79929A-C343-467F-A3AB-31FC7E59705C + + + + + + + +Naineris elegans + +sp. nov. + + + + + +urn:lsid:zoobank.org:act: +DF84D183-FA7D-442D-B0E1-9E193A959555 + + + + + +( +Fig. 5 +) + + + + +Material examined +. + + +USA + +, +North Pacific Ocean +, +California +, +Los Angeles County +, +Palos Verdes Peninsula +, +Lunada Bay +, Sta. +MBC 20801 +, coll. R. +Wetzer +et al., + +18 Feb 2019 + +, ~ +33.769°N +, ~ +118.422°W +, intertidal algae wash, hand collected, + +holotype + +( +LACM-AHF +Poly 11164); + + +west of +Redondo Beach +, +Sta. Bight +13 9257, +33.82928°N +, +118.416°W +, + +18 m + +, soft sediment, +van Veen +grab, 1.0 mm sieve, coll. +Southern +California +Coastal Water Research Project +, + +26 July 2013 + +, + +paratype + +( +LACM-AHF +Poly 13426) + +. + + + + +Measurements +: +Holotype +37 mm +long, +2.2 mm +wide, for 84 chaetigers. + + + + +Diagnosis +. Spatulate prostomium. Multiple dorsal sensory organs oval to rounded, voluminous, seven per side in most chaetigers, with a brown pigmented base; arranged in two distinct groups in the most anterior segments, then forming two subtriangular groups with apex displaced medially in the following ones, reaching each other. Thoracic notopodial lobes pear-shaped with blunt tips. Thoracic neuropodial lobe with an upper rounded papilla. Thoracic neurochaetae with 5–6 transverse, posterior rows of numerous subuluncini; a transverse, anterior row of about 20 crenulate capillaries; an inferior, anterior, oblique row of about 20 hooded uncini and an inferior, posterior, oblique row of capillaries. + + + + +Description +: A medium-sized species. Color in alcohol pale yellow with a conspicuous brown pigmentation around base of dorsal organs, adopting a V-shaped form in abdominal segments ( +Fig. 5A +). Body narrow without width distinction between thorax and abdomen. Changes in parapodia mark distinction between thorax-abdomen. Ventrally thorax smooth, but abdominal chaetigers tri-annulate with central ring widest. + + +Prostomium spatulate, with rounded borders ( +Fig. 5B +); eyespots diffuse; nuchal organs present at posterior end of prostomium and anterior end of peristomium. Peristomium with two achaetous rings well defined ( +Fig. 5B +). Mouth opening with lips striated; proboscis wide, multi-lobed ( +Fig. 5A–D +). + + +Branchiae from chaetiger 6, long, cirriform, with fine prolonged apex, glandular, ciliated, with dark pigmentation along axis; thoracic branchiae reaching midline in thoracic segments; abdominal branchiae longer, reaching across the midline to the opposite branchial base in the abdomen. Dorsal sensory organs per segment present from chaetiger 10; oval to rounded, voluminous, seven per side in most chaetigers, with a brown pigmented base ( +Fig. 5F +); arranged in two distinct groups in the most anterior segments, then forming two subtriangular groups with apex displaced medially in the following ones, reaching each other ( +Fig. 5F +). Dorsal crest reduced, straight, thin, with no evidence of cilia ( +Fig. 5A +). + + +Thorax with 36 chaetigers (~6 transitional segments with intermediate characteristics between thoracic and abdominal segments), dorsoventrally depressed, straight ( +Fig. 5C +). Parapodia biramous, interramal papillae and prechaetal lobe absent. Thoracic notopodial lobes pear-shaped with blunt tips ( +Fig. 5E +). Abdominal notopodial lobes lanceolate, with evident constriction ( +Fig. 5G +). Thoracic neuropodial lobes represented by a flange with upper rounded papillae ( +Fig. 5E +). Abdominal neuropodial lobes triangular, laterally projected ( +Fig. 5G +). + + + +FIGURE 5 +. + +Naineris elegans + + +sp. nov. + +Holotype (LACM-AHF Poly 11164). A, incomplete live specimen, dorsal view; B, anterior end, dorsal view; C, thorax, lateral view; D, thorax, ventro-lateral view; E, thoracic parapodia, lateral view; F, dorsal organs from thorax; G, abdominal parapodia, ventro-lateral view. br—branchia, cc—crenulate capillaries, dc—dorsal crest, do—dorsal organs, NeL—Neuropodial lobe, NoL—Notopodial lobe, pe—peristomium, pr—prostomium, su—subuluncini, u—uncini (Scales: A, D: 1 mm; B, C, E–G: 0.5 mm). + + + +Thoracic notochaetae include 20–30 crenulate capillaries in two groups ( +Fig. 5E +). Abdominal notochaetae with 20–30 crenulate capillaries in two groups; furcate chaetae not observed. Thoracic neurochaetae with seven transverse rows of 20–30 subuluncini and an inferior, oblique row of uncini intermixed with crenulate capillaries ~20–25 each ( +Fig. 5E +). Abdominal neurochaetae include 10–15 crenulate capillaries and three acicular spines intermixed. + + +Pygidium unknown (complete +paratype +bears four anal cirri as typical in + +Naineris +species. + + + +Variation +: Thorax with 35 chaetigers (~4 transitional) and dorsal sensory organs from chaetiger +13 in +paratype +. +Paratype +width at chaetiger 50: +1.4 mm +. + + + + +Remarks +: The material examined here were identified as + +Naineris +sp. + +DC1 (T. Phillips, unpublished data) by SCAMIT. A comparison of these specimens with + +N. bicornis + +( +type +locality Florida, Gulf of Mexico) and + +N. australis + +( +type +locality Adelaide, +Australia +) showed that the material from the Northeastern Pacific Ocean represents a separate species. + +Naineris elegans + + +sp. nov. + +resembles + +N. bicornis + +and + +N. australis + +in the chaetal arrangement and presence of multiple dorsal organs. However, the thoracic notopodial lobes of + +N. australis + +are cirriform, whereas those of + +N. bicornis + +are lanceolate, with triangular tips, but pear-shaped with blunt tips in + +N. elegans + + +sp. nov. + +( +Fig. 6- C +). Abdominal notopodial lobes also differ; in + +N. australis + +, they are cirriform, whereas in + +N. bicornis + +and + +N. elegans + + +sp. nov. + +they are lanceolate ( +Fig. 6D–F +). Another consistent difference between + +N. elegans + + +sp. nov. + +and + +N. bicornis + +are the thoracic neuropodial lobes. In + +N. elegans + + +sp. nov. + +these lobes have a rounded projection, whereas they are a triangular, in + +N. bicornis + +( +Fig. 6A–C +). + + + + +FIGURE 6 +. Parapodial lobes scheme of species of + +Naineris + +with multiple dorsal organs studied. A, thoracic parapodia of + +Naineris bicornis + +; B, thoracic parapodia of + +Naineris australis + +; C, thoracic parapodia of + +Naineris elegans + + +sp. nov +. + +; D, abdominal parapodia of + +Naineris bicornis + +; E, abdominal parapodia of + +Naineris australis + +; F, abdominal parapodia of + +Naineris elegans + + +sp. nov. + +NeL—Neuropodial lobe, NoL—Notopodial lobe (Scales: A, D: 250 μm; B, E: 200 μm; C–F: 500 μm). + + + + +Etymology +: Latin for elegant, referring to the conspicuous delicate multiple dorsal organs, especially those from thoracic segments. + + + + +Distribution +: +USA +, Southern +California +Bight province, Santa Monica Bay; intertidal to + +18 m +. + + + + + \ No newline at end of file diff --git a/data/42/10/06/4210064371025F0F871D8A0DB31BB616.xml b/data/42/10/06/4210064371025F0F871D8A0DB31BB616.xml new file mode 100644 index 00000000000..3f3c05e6e5a --- /dev/null +++ b/data/42/10/06/4210064371025F0F871D8A0DB31BB616.xml @@ -0,0 +1,116 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Bifigurataceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Bifiguratus +T. J. Torres-Cruz & A. Porras-Alfaro. + + + + + +Description. + + +Cultured mycelium filamentous, aseptate, coenocytic, 2 μm diam., mucose in appearance, commonly producing budding yeast-like cells; chlamydospores intercalary, 5–10 μm diam., forming on hyphal tips. Phylogenetically delimited by the least inclusive clade covering sequence accessions + +HM +123225 + +, EUK 1104879, +KF 568171 +and +KF 567389 +. + + + + +Notes. + + +Comprised of a single genus + +Bifiguratus + +that is commonly found in soil and occasionally in roots of non- + +AM + +plants. No sexual structures have been revealed. Family description is adapted from +Torres-Cruz et al. (2017) +. + + + + \ No newline at end of file diff --git a/data/43/9F/61/439F61CA62E7587A925FF81FC46C1DBE.xml b/data/43/9F/61/439F61CA62E7587A925FF81FC46C1DBE.xml new file mode 100644 index 00000000000..4c078055e49 --- /dev/null +++ b/data/43/9F/61/439F61CA62E7587A925FF81FC46C1DBE.xml @@ -0,0 +1,105 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Pseudoentrophosporaceae Tedersoo & Magurno +fam. nov. + + + + + +Type +genus. + + + + +Pseudoentrophospora +Tedersoo & Magurno. + + + + + +Description. + + +Covers the monophyletic group in +Entrophosporales +(Fig. +1 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1631429, EUK 1105140 and EUK 0135500 (Suppl. material +1 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently monogeneric. + + + + \ No newline at end of file diff --git a/data/45/35/1A/45351A6160795AB784BCA513AA72CD3E.xml b/data/45/35/1A/45351A6160795AB784BCA513AA72CD3E.xml new file mode 100644 index 00000000000..6691e05e234 --- /dev/null +++ b/data/45/35/1A/45351A6160795AB784BCA513AA72CD3E.xml @@ -0,0 +1,111 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Riederbergaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Riederberga +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Riederbergales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1602903, EUK 1602242 and EUK 1602243 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Riederberga + +. + + + + \ No newline at end of file diff --git a/data/4E/81/5F/4E815FED51755ABFBDE7D2E8BCEEDB04.xml b/data/4E/81/5F/4E815FED51755ABFBDE7D2E8BCEEDB04.xml new file mode 100644 index 00000000000..56630cf6dec --- /dev/null +++ b/data/4E/81/5F/4E815FED51755ABFBDE7D2E8BCEEDB04.xml @@ -0,0 +1,176 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Riederbergales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Riederbergaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1602903, EUK 1603115, EUK 1602258, EUK 1602253, EUK 1602251 and EUK 1104709 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes Riederbergaceae and four additional potentially family-level taxa represented by sequences EUK 1100540 (bog peat soil in Svartberget, +Sweden +, + +64.24 ° N +, +19.76 ° E + +); EUK 1602254 ( +GSMc +plot +G +5826, + +Malus domestica + +orchard in Tabivere, +Estonia +, + +58.54286 ° N +, +26.61575 ° E + +); EUK 1602251, EUK 1602253 and EUK 1602257 (all +GSMc +plot +G +5828, +Estonia +, + +Malus domestica + +orchard soil in Mooste, +Estonia +, + +58.15335 ° N +, +27.19642 ° E + +). Sequences EUK 0031975 ( +GSMc +plot +S +1082, + +Araucaria araucana + +forest, Nahuelbuta, +Chile +, + +- +37.78985 ° N +, - +73.0038 ° E + +) and EUK 1217433 ( +GSMc +plot +G +4777, maritime grassland (saltmarsh) soil in Härs-hämani, +Estonia +, + +59.33103 ° N +, +23.92720 ° E + +) represent additional, monospecific, potentially family-level groups not included in the phylograms due to the lack of +LSU +sequences. + + + + \ No newline at end of file diff --git a/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml b/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml new file mode 100644 index 00000000000..42f2e2048e1 --- /dev/null +++ b/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml @@ -0,0 +1,240 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Kungsaengena shadiae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +separation from other species of + +Kungsaengena + +based on the + +ITS + +region ( +ITS +2 positions 25–44 tgggaacccatttcgtcgga; one mismatch allowed) and +LSU +(positions 665–694 cgttggggctgggacgcccgtcgctcgcac; one mismatch allowed) as indicated in Fig. +7 +. + + + + + + +Diagnostic barcodes for + +Kungsaengena shadiae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +eDNA +sample TUE 128324 ( + +holotype + +); +eDNA +sequence EUK 1603402 ( + +lectotype + +); +GSMc +plot +G +5763, wet grassland (soil sample TUE 028324) in Haage, +Estonia +, + +58.35555 ° N +, +26.61277 ° E + +). + + + + +Description. + + +other sequences: EUK 1604022 ( +GSMc +plot +G +5906, football field soil in Karksi-Nuia, +Estonia +, + +58.10088 ° N +, +25.55959 ° E + +); EUK 1604023 ( +GSMc +plot +G +5844, wet pasture soil in Tuhala, +Estonia +, + +59.23003 ° N +, +25.00283 ° E + +); EUK 1604025 ( +GSMc +plot +G +4444, +Estonia +, mixed forest soil in Altnurga, +Estonia +, + +58.53676 ° N +, +26.28321 ° E + +); and + +OU +942286 + +(grassland soil in Kungsängen, +Sweden +, + +59.837 ° N +, +17.661 ° E + +), isolated by Shadi Eshghi Sahraei ( +Eshghi Sahraei et al. 2022 +). + + + + +Etymology. + + +Kungsängen +(Swedish) refers to +type +locality; and +Shadi +(Persian) refers to the first name of Shadi Eshghi Sahraei who analysed materials collected from the +type +locality. + + + + +Notes. + + +Found from the Baltic States and +Sweden +, with + +ITS + +and +LSU +sequences differing up to 15 % and 1 %, respectively. The + +ITS + +region is infested with microsatellite-like regions and homopolymers, and many sequence variants have long deletions in multiple positions. + +K. shadiae + +seems to be generalist in terms of habitat +type +. + + + + \ No newline at end of file diff --git a/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml b/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml new file mode 100644 index 00000000000..9aff5fe665b --- /dev/null +++ b/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml @@ -0,0 +1,220 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Langduoa dianae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Langduoa + +based on the + +ITS + +region (positions 87–106 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and +LSU +(positions 617–636 ccctctcggggggctgggga; no mismatch allowed) as indicated in Fig. +8 +. + + + + + + +Diagnostic barcodes for + +Langduoa dianae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 128827 ( + +holotype + +); +eDNA +sequence: EUK 1107335 ( + +lectotype + +); montane grassland in Langduo, +Tibet +, + +29.4 ° N +, +94.4 ° E + +. + + + + +Description. + + +Other sequences: EUK 1602727 and EUK 1602728 (both from +GSMc +plot +G +5906, stadium grassland soil in Karksi-Nuia, +Estonia +, + +58.10088 ° N +, +25.55959 ° E + +); EUK 1604031 ( +GSMc +plot +G +4185, + +Picea +- +Pinus + +forest soil in Ristipalo, +Estonia +, + +58.10241 ° N +, +27.47874 ° E + +); and EUK 1604032 ( +GSMc +plot +G +4766, soil of coppiced garden dominated by + +Fraxinus + +and + +Ulmus + +in Ruudiküla, +Estonia +, + +58.33630 ° N +, +25.78084 ° E + +). + + + + +Etymology. + + +Langduo +(Tibetan) refers to +type +locality; and +Diana +(Lithuanian) refers to the first name of Diana Marčiulynienė who was the first to record this genus. + + + + +Notes. + + +Found from grassland soils in +Estonia +and Tibet, with + +ITS + +and +LSU +sequences differing up to 0.2 %. So far, not found from the roots. + + + + \ No newline at end of file diff --git a/data/57/DD/4D/57DD4DAD2A4B500C8AB0FBBC3019945B.xml b/data/57/DD/4D/57DD4DAD2A4B500C8AB0FBBC3019945B.xml new file mode 100644 index 00000000000..a13e8d30b08 --- /dev/null +++ b/data/57/DD/4D/57DD4DAD2A4B500C8AB0FBBC3019945B.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Nikkaluoktales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Nikkaluoktaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1203196, EUK 1600291 and EUK 1600248 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Nikkaluoktaceae + +. + + + + \ No newline at end of file diff --git a/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml b/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml new file mode 100644 index 00000000000..bb3da2d56ff --- /dev/null +++ b/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml @@ -0,0 +1,185 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Tammsaarea vivikae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Tammsaarea + +and other species of +Endogonomycetes +based on + +ITS + +(positions 228–257 ggaccgagaaggcgcaatagttgaacaatt; one mismatch allowed) and +LSU +(positions 585–604 ataactatcggacaaagttt; one mismatch allowed) as indicated in Fig. +16 +. + + + + + + +Diagnostic barcodes for + +Tammsaarea vivikae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +eDNA +sample TUE 100731 ( + +holotype + +); +eDNA +sequence EUK 1602762 ( + +lectotype + +); +GSMc +plot +G +4189, + +Populus tremula + +forest (soil sample TUE 000731) in +Tammsaare +, +Estonia +, + +57.84444 ° N +, +27.20141 ° E + +. + + + + +Description. + + +Other sequences EUK 1604048 and EUK 1604049 ( +type +locality). + + + + +Etymology. + + +Tammsaare +(Estonian) refers to the +type +locality and one of the most famous Estonian writers, Anton Hansen Tammsaare; and +Vivika +(Estonian) refers to the first name of Vivika Adamson who provided access to the +type +locality. + + + + +Notes. + + +Found from a single locality in +Estonia +, with + +ITS + +and +LSU +sequences differing up to 0.5 % and 0.3 %, respectively. + + + + \ No newline at end of file diff --git a/data/5D/E2/9B/5DE29B8FAEEF59BB8DB13345828F9AE4.xml b/data/5D/E2/9B/5DE29B8FAEEF59BB8DB13345828F9AE4.xml new file mode 100644 index 00000000000..e264bb8870d --- /dev/null +++ b/data/5D/E2/9B/5DE29B8FAEEF59BB8DB13345828F9AE4.xml @@ -0,0 +1,162 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Nikkaluokta +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Nikkaluokta mahdiehiae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Nikkaluoktales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1203196, EUK 1600291, EUK 1600289, EUK 1600235, EUK 1600225, EUK 1600250 and EUK 1600248 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Nikkaluokta + +is comprised of 15–20 species, some of which are represented by sequences EUK 1603884 ( +GSMc +plot +G +4406, mixed coniferous forest soil in Tarumaa, +Estonia +, + +59.20745 ° N +, +27.15333 ° E + +); EUK 1603411 ( +GSMc +plot +G +4462, + +Salix viminalis + +energy plantation soil in Kambja, +Estonia +, + +58.25166 ° N +, +26.71276 ° E + +); and EUK 0006485 ( +GSMc +plot +MX +23, + +Pinus hartwegii + +montane forest soil in Iztaccihuatl, +Mexico +, + +19.12622 ° N +, - +98.65972 ° E + +). + + + + \ No newline at end of file diff --git a/data/62/27/D9/6227D9416F9F51398DEEA97F9BE5A65B.xml b/data/62/27/D9/6227D9416F9F51398DEEA97F9BE5A65B.xml new file mode 100644 index 00000000000..aa11d56eeac --- /dev/null +++ b/data/62/27/D9/6227D9416F9F51398DEEA97F9BE5A65B.xml @@ -0,0 +1,179 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Parniguaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Parnigua +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Parniguales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1635261, EUK 1602353, EUK 1602857 and EUK 1602732 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently represented by + +Parnigua + +and another potentially genus-level group, which is characterised by sequences EUK 0016514 ( +GSMc +plot +S +1218, urban park soil in Qujing, +China +, + +25.52619 ° N +, +103.74497 ° E + +), EUK 0028452 ( +GSMc +plot +G +3060, + +Vateria indica + +forest in Hebri, +India +, + +13.45437 ° N +, +75.02213 ° E + +), EUK 1602857 ( +GSMc +plot +G +5771, grassland soil in Hino, +Estonia +, + +57.57566 ° N +, +27.22649 ° E + +), EUK 1602732 ( +GSMc +plot +G +5777, grassland soil in Eoste, +Estonia +, + +58.11427 ° N +, +27.08404 ° E + +) and EUK 1602733 ( +GSMc +plot +G +5816, + +Trifolium pratense + +cropland soil in Hermani, +Estonia +, + +58.80705 ° N +, +25.75639 ° E + +). + + + + \ No newline at end of file diff --git a/data/66/AC/7F/66AC7F74232A527399D5FF5E6CA159D3.xml b/data/66/AC/7F/66AC7F74232A527399D5FF5E6CA159D3.xml new file mode 100644 index 00000000000..b40447e34a3 --- /dev/null +++ b/data/66/AC/7F/66AC7F74232A527399D5FF5E6CA159D3.xml @@ -0,0 +1,132 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Unemaeea +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Unemaeea nathalieae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Unemaeeales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1630871 and EUK 1635889 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Unemaeea + +is comprised of three species; others represented by sequences EUK 1217289 (freshwater lake sediment near Bezdan, +Serbia +, + +45.82031 ° N +, +18.9599 ° E + +) and +KX 196132 +(deciduous forest soil in Champaign County, +IL +, +USA +). + + + + \ No newline at end of file diff --git a/data/6B/88/74/6B88749CF6F5588CA1D97124A2204C64.xml b/data/6B/88/74/6B88749CF6F5588CA1D97124A2204C64.xml new file mode 100644 index 00000000000..07ee0da0732 --- /dev/null +++ b/data/6B/88/74/6B88749CF6F5588CA1D97124A2204C64.xml @@ -0,0 +1,175 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Lehetua +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Lehetua indrekii +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Lehetuaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603180, EUK 1602366 and EUK 1602374 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Lehetua + +is comprised of 8–10 species. Other putative + +ITS + +- based species in + +Lehetua + +are represented by sequences EUK 1602811 ( +GSMc +plot +G +4105, + +Picea abies + +forest soil in Lepa, +Estonia +, + +57.70158 ° N +, +26.23993 ° E + +); EUK 1603124 ( +GSMc +plot +G +5003, + +Pinus sylvestris + +forest soil in Naissaar, +Estonia +; + +59.5634 ° N +, +24.5451 ° E + +); and EUK 0022184 ( +GSMc +plot +AV +106, + +Pseudomonotes tropenbosii + +rainforest soil in El Zafire, +Colombia +, + +- +3.995 ° N +, - +69.898 ° E + +). + + + + \ No newline at end of file diff --git a/data/6C/93/DE/6C93DE73BECB54828FDEAC38CD9FDEE3.xml b/data/6C/93/DE/6C93DE73BECB54828FDEAC38CD9FDEE3.xml new file mode 100644 index 00000000000..e6225004927 --- /dev/null +++ b/data/6C/93/DE/6C93DE73BECB54828FDEAC38CD9FDEE3.xml @@ -0,0 +1,205 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Moosteaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Moostea +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Moosteales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1604044, +JQ 311412 +and EUK 1600278 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Moostea + +and two other potential genera. One of these is represented by sequences EUK 0030179 ( +GSMc +plot +G +4146, mixed forest soil in High Point Reserve Park, +NJ +, +USA +, + +41.31569 ° N +, - +74.66485 ° E + +); EUK 1600279 ( +GSMc +plot +G +5826, + +Malus domestica + +orchard soil in Tabivere, +Estonia +, + +58.54286 ° N +, +26.61575 ° E + +); and +JQ 311412 +(microcosm soil in Los Alamos, +NM +, +USA +), isolated by Stephanie +A +. Eichorst ( +Eichorst and Kuske 2012 +). The other genus is represented by sequences EUK 1600278 ( +GSMc +plot +S +570, + +Betula pubescens + +wetland forest soil in Nõmme, +Estonia +, + +58.47962 ° N +, +22.94584 ° E + +); EUK 0029679 ( +GSMc +plot +G +2749, + +Eucalyptus +spp. + +woodland soil near Lake Copperfield, +Australia +, + +- +13.84191 ° N +, +131.81858 ° E + +); and EUK 0028885 ( +GSMc +plot +G +5081, + +Coccoloba +sp. + +woodland soil near Lagoa Grande, +Brazil +, + +- +10.6342 ° N +, - +36.7579 ° E + +). + + + + \ No newline at end of file diff --git a/data/72/EA/30/72EA30F4A8C0596CA6E985F1EAE8E3B5.xml b/data/72/EA/30/72EA30F4A8C0596CA6E985F1EAE8E3B5.xml new file mode 100644 index 00000000000..a1af8c29dba --- /dev/null +++ b/data/72/EA/30/72EA30F4A8C0596CA6E985F1EAE8E3B5.xml @@ -0,0 +1,152 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Moostea +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Moostea stephanieae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Moosteaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1604044, EUK 1103239 and EUK 1600287 (Suppl. material +3 +). + + + + +Notes. + + +The + +ITS + +sequences are poorly alignable because of long deletions and inserts in certain species. Based on + +ITS + +sequences, + +Moostea + +is comprised of 25–30 species, some of which are represented by sequences EUK 1103239 (tropical rainforest soil in El Yunque, +Puerto Rico +, + +18.29 ° N +, - +65.78 ° E + +); EUK 1603515 ( +GSMc +plot +G +5835, airfield soil in Ridali, +Estonia +, + +57.93692 ° N +, +26.98099 ° E + +); and EUK 0014332 ( +GSMc +plot +S +1225, grassland soil in Ayapel, +Colombia +, + +8.27825 ° N +, - +75.1257 ° E + +). + + + + \ No newline at end of file diff --git a/data/76/66/44/7666441803815937993CE8A1D5B82667.xml b/data/76/66/44/7666441803815937993CE8A1D5B82667.xml new file mode 100644 index 00000000000..f379e7bfe59 --- /dev/null +++ b/data/76/66/44/7666441803815937993CE8A1D5B82667.xml @@ -0,0 +1,254 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Lokruma stenii +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Lokruma + +based on the + +ITS + +region (positions 159–178 taacttaattttttcccgag; one mismatch allowed) as shown in Fig. +10 +. There are no short barcodes in the first 700 bp of +LSU +that allow distinguishing + +L. stenii + +all from other congeners. + + + + + + +Diagnostic barcodes for + +Lokruma stenii + +relative to closely-related taxa in ITS 2. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 103193 ( + +holotype + +); type sequence EUK 1203766 ( + +lectotype + +); +GSMc +plot +S +689, + +Pinus halepensis + +forest (soil sample TUE 003193) in Lokrum, +Croatia +, + +42.6223 ° N +, +18.1241 ° E + +. + + + + +Description. + + +Other sequences: EUK 1603283 ( +GSMc +plot +G +4301, + +Betula pendula + +forest soil in Männamaa, +Estonia +, + +58.83258 ° N +, +22.63346 ° E + +); EUK 1604041 ( +GSMc +plot +S +480, + +Populus +- +Picea + +forest soil in Käru, +Estonia +, + +58.80407 ° N +, +25.22249 ° E + +); EUK 1604042 ( +GSMc +plot +G +4734, + +Populus +- Alnus + +forest soil in Urissaare, +Estonia +, + +58.02673 ° N +, +24.65739 ° E + +); and EUK 1600039 ( +LSU +: +GSMc +plot +HB +19, + +Populus +x wettsteinii + +forest plantation soil, Oja, +Estonia +, + +58.82747 ° N +, +26.37799 ° E + +). + + + + +Etymology. + + +Lokrum +(Serbo-Croatian) refers to +type +locality; and +Sten +(Estonian) refers to the first name of Sten Anslan who collected the materials from the +type +locality. + + + + +Notes. + + +Found in +Croatia +and +Estonia +, with + +ITS + +and +LSU +sequences displaying up to 1 % of differences. + + + + \ No newline at end of file diff --git a/data/77/43/1B/77431B6A8B3B5CCCA7162450B6002A98.xml b/data/77/43/1B/77431B6A8B3B5CCCA7162450B6002A98.xml new file mode 100644 index 00000000000..9b546943e91 --- /dev/null +++ b/data/77/43/1B/77431B6A8B3B5CCCA7162450B6002A98.xml @@ -0,0 +1,127 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Planticonsortiaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Planticonsortium +C. Walker & D. Redecker. + + + + + +Description. + + +Emanating hyphae 0.5–4 μm diam., forming colourless to brown chlamydospores (10–12 μm, up to 35 μm diam.), sometimes rope-like strands; appressoria swollen, frequently with several thin hyphae giving an insect-like appearance. Intraradical mycelium 0.5–4 μm diam., smooth to angular, with (sub-) globose swellings, forming comb-like (ctenoid), fan-shaped, palmate, antler-like, digitate or feather-like structures appearing clasped around epidermal and cortical cells; forming finely branched arbuscules. All hyphae stain darkly in acidic blue stains, more strongly for extraradical hyphae. Monophyletic group in +Densosporales +(Fig. +2 +, Suppl. materials +3 +, +4 +). + + + + +Notes. + + +Planticonsortiaceae covers roughly one third of +Endogonomycetes +reads based on +LSU +(Suppl. material +3 +) and +SSU +(Suppl. material +4 +), but is poorly represented in the + +ITS + +dataset. This may be due to the highly divergent and relatively long + +ITS + +region (800–1200 bases). Based on the +LSU +phylogram, Planticonsortiaceae harbours seven genus-level groups with> 100 putative species. The description is adapted from +Walker et al. (2018) +. + + + + \ No newline at end of file diff --git a/data/79/4A/32/794A32398DBB56F1832D0144835F524F.xml b/data/79/4A/32/794A32398DBB56F1832D0144835F524F.xml new file mode 100644 index 00000000000..95e5989490f --- /dev/null +++ b/data/79/4A/32/794A32398DBB56F1832D0144835F524F.xml @@ -0,0 +1,128 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Endogonales Jacz. & P. A. Jacz. +, emend. Tedersoo + + + + + +Type +family. + + + +Endogonaceae Paol. + + + + +Description. + + +Fruiting body hypogeous or on debris, globose, irregular, sometimes resupinate, +1–10 mm +in diam., may be composed of aggregated zygosporangial clusters, with zygospores formed on apposed suspensors. Hyphae of fruiting body tissue coenocytic, aseptate, sometimes with secondary septa that form micropores. Reproductive structures as zygosporangia, rarely azygosporangia (co-existing with zygosporangia in + +Endogone pisiformis + +) or chlamydospores (in + +Vinositunica + +), distributed randomly or radially in fruiting bodies, 100–700 μm diam., with yellow granular contents. Zygosporangial wall comprises outer sporangiothecium with 1–4 openings and inner eusporium with no openings. Azygosporangia rare, with a single-layered wall and separated from the single suspensor by a gametangial septum. Chlamydospore wall continuous, multilayered, with dense subtending hyphae, lacking septa. Forms a monophyletic group in +Endogonomycetes +as the least inclusive clade covering accessions EUK 1601498, EUK 1100757, + +LC 002628 + +, + +LC 431107 + +, EUK 1104693 and UDB 025468. + + + + +Notes. + + +Includes taxa with or without fruiting bodies and with ectomycorrhizal, arbuscular mycorrhizal and saprotrophic lifestyles. +Endogonales +harbours +Endogonaceae +, Jimgerdemanniaceae and Vinositunicaceae families, as well as seven potentially family-level taxa, collectively comprising> 200 species based on + +ITS + +and +LSU +sequences. Order description is adapted from +Morton and Benny (1990) +and +Yamamoto et al. (2020) +. + + + + \ No newline at end of file diff --git a/data/80/22/98/8022981E75365C66A1D685E1C7E5E358.xml b/data/80/22/98/8022981E75365C66A1D685E1C7E5E358.xml new file mode 100644 index 00000000000..d6964926233 --- /dev/null +++ b/data/80/22/98/8022981E75365C66A1D685E1C7E5E358.xml @@ -0,0 +1,340 @@ + + + +Three new species of Cyanosporus (Polyporales, Basidiomycota) from China + + + +Author + +Wang, Chao-Ge +0000-0003-4381-5720 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + + + +Author + +Liu, Shun +0000-0001-9261-4365 +Institute of Ecology and Key Laboratory for Earth Surface Processes of the Ministry of Education, College of Urban and Environmental Sciences, Peking University, Beijing 100871, China + + + +Author + +Ghobad-Nejhad, Masoomeh +0000-0002-7807-4187 +Department of Biotechnology, Iranian Research Organization for Science and Technology (IROST), Tehran 3353 - 5111, Iran + + + +Author + +Liu, Hong-Gao +0000-0002-9508-3245 +Yunnan Key Laboratory of Gastrodia and Fungi Symbiotic Biology, Zhaotong University, Zhaotong 657000, China + + + +Author + +Dai, Yu-Cheng +0000-0002-6523-0320 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + + + +Author + +Yuan, Yuan +0000-0001-6674-9848 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +272 + + + +journal article +10.3897/mycokeys.107.126139 + + + + + +Cyanosporus tabuliformis +Y. C. Dai, Chao G. Wang, Yuan Yuan & Ghobad-Nejhad + +sp. nov. + + + + +Figs 6 +, +7 + + + + + +Holotype +. + + + + +China +. • +Shanxi Province +: +Changzhi +, +Qinyuan County +, + +Taiyueshan Forest +Park + +, + +31 Aug. 2023 + +, on fallen branch of + +Pinus tabuliformis +, Dai + +26063 ( + +BJFC +043612 + +, Genbank: +ITS + +PP 479788 + +, +LSU + +PP 479810 + +, +mtSSU + +PP 510203 + +, nrSSU + +PP 488295 + +, RPB 1 + +PP 526265 + +, RPB 2 + +PP 526274 + +, +TEF 1 + +PP 526279 + +). + + + + + +Etymology. + + +In reference to the specific epithet of the substrate, + +Pinus tabuliformis + +in which this species was found. + + + + +Diagnosis. + + + +Cyanosporus tabuliformis + +is characterized by a pileate basidiomata with cream, buff to grayish blue and hirsute azonate pileal surface when fresh, angular pores, 4–5 per mm, fusoid cystidioles, and cylindrical to allantoid basidiospores, 4.3–5.5 × 1. 5–2 μm. + + + + + + +Basidiomata of + +Cyanosporus tabuliformis + +(Dai 26063, holotype). Scale bar: 1 cm. + + + +Basidiomata +annual, pileate, soft and without odor or taste when fresh, becoming more or less fragile to corky upon drying. Pileus flabelliform, projecting up to +1.5 cm +, +3.5 cm +wide and +5 mm +thick at the base. Pileal surface cream to buff at the base, grayish blue at the margin when fresh, becoming olivaceous buff to ash gray upon drying, hirsute, azonate when dry; margin blunt. Hymenophore poroid, white to sulphur yellow when fresh, unchanged when bruised, becoming cream, pale cinnamon buff to pale mouse gray upon drying; sterile margin white when fresh, cream to buff when dry, up to +0.2 mm +wide; pores angular to irregular, 4–5 per mm, with thin dissepiments, becoming lacerate. Context white, soft corky, up to +2 mm +thick. Tubes concolorous with pore surface, fragile to soft corky when dry, up to +3 mm +long. + + + + + + + +Cyanosporus tabuliformis + +(Dai 26063, holotype) +A +basidiospores +B +basidia and basidioles +C +cystidioles +D +hyphae from context +E +hyphae from trama. Scale bars: 5 µm ( +A +); 10 µm ( +B-E +). + + + +Hyphal system +monomitic, hyphae clamped, hyaline, slightly thick-walled with a wide lumen, in the context frequently branched, straight, distinctly interwoven, 3–4 µm in diam; in the tubes rarely branched, more or less flexuous, subparallel along the tubes, agglutinated, 2.8–3.5 µm in diam. + + +Cystidia +absent, but cystidioles fusoid present, 10–12 × 4 µm. + + +Basidia +clavate, 13–16 × 4.5–5 µm, with basal clamp and four sterigmata. + + +Basidiospores +cylindrical to allantoid, 4.3–5.5 × 1. 5–2 μm, +L += 4.8 µm, +W += 1.9 µm, +Q += 2.6 (n = 60 / 2), hyaline, thin-walled, sometimes with one or two small guttules, +IKI +-, + +CB + +-. + + + + +Type of rot. + +Brown rot. + + + +Additional specimen examined. + + + +China +. • +Shanxi +: +Changzhi +, +Qinyuan County +, + +Taiyueshan Forest +Park + +, + +31 Aug. 2023 + +, on fallen branch of + +Pinus tabuliformis +, Dai + +26066 ( + +BJFC +043615 + +, Genbank: +ITS + +PP 479789 + +, +LSU + +PP 479811 + +, +mtSSU + +PP 510204 + +, nrSSU + +PP 488296 + +, RPB 1 + +PP 526266 + +, +TEF 1 + +PP 526280 + +) + +. + + + + \ No newline at end of file diff --git a/data/80/B9/FA/80B9FA9ADD5D56D087AEA603667661BB.xml b/data/80/B9/FA/80B9FA9ADD5D56D087AEA603667661BB.xml new file mode 100644 index 00000000000..969a8dc7ccf --- /dev/null +++ b/data/80/B9/FA/80B9FA9ADD5D56D087AEA603667661BB.xml @@ -0,0 +1,151 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Hoforsa +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Hoforsa rebekkae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Hoforsaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1100001, EUK 1107311 and EUK 1602325 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. There are potentially about 20 species in + +Hoforsa + +based on + +ITS + +and +LSU +sequences, with examples including taxa represented by sequences EUK 1107311 (bog peat in Svartberget, +Sweden +, + +64.24 ° N +, +19.76 ° E + +) and + +AM +260926 + +(bog peat, +Scotland +) first isolated by Rebekka Artz ( +Artz et al. 2007 +). Most taxa are found from various soils, but the +LSU +sequence +AB 982123 +originates from an ectomycorrhizal root of +Dipterocarpaceae +(Lambir, +Malaysia +). The most common taxon at 99 % +LSU +sequence similarity (EUK 1602281) has been recorded from 31 localities in +Estonia +and +Latvia +. The genus has a global distribution and it occurs commonly in soil samples but rarely in roots. + + + + \ No newline at end of file diff --git a/data/82/6E/EC/826EEC8FA6E855EBAC2E0EEBCAE0171C.xml b/data/82/6E/EC/826EEC8FA6E855EBAC2E0EEBCAE0171C.xml new file mode 100644 index 00000000000..8de52b3d04e --- /dev/null +++ b/data/82/6E/EC/826EEC8FA6E855EBAC2E0EEBCAE0171C.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Unemaeeales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Unemaeeaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1630871 and EUK 1635889 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Unemaeeaceae + +. + + + + \ No newline at end of file diff --git a/data/84/53/01/84530192F9FD5536B614A92CE860FCCC.xml b/data/84/53/01/84530192F9FD5536B614A92CE860FCCC.xml new file mode 100644 index 00000000000..9d3c26a5b51 --- /dev/null +++ b/data/84/53/01/84530192F9FD5536B614A92CE860FCCC.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Parniguales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Parniguaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1635261, EUK 1602353, EUK 1602857 and EUK 1602732 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently represented by + +Parniguaceae + +. + + + + \ No newline at end of file diff --git a/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml b/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml new file mode 100644 index 00000000000..eefbe2529cf --- /dev/null +++ b/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml @@ -0,0 +1,211 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Ruua coralieae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Ruua + +based on the + +ITS + +region (positions 217–243 gaaaaaaaaagaaaggaaagaaaaggt; one mismatch allowed) and +LSU +(positions 470–489 tagtgcacttgctttcgcac; no mismatch allowed) as indicated in Fig. +15 +. + + + + + + +Diagnostic barcodes for + +Ruua coralieae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +eDNA +sample TUE 101598 ( + +holotype + +); +eDNA +sequence EUK 1603424; +GSMc +plot +G +4464, + +Quercus robur + +forest (soil sample TUE 101598) in Ruu, +Estonia +, + +59.45059 ° N +, +25.22166 ° E + +. + + + + +Description. + + +Other sequences: EUK 1602853 and EUK 1600135 ( +type +locality); EUK 1604050 ( +GSMc +plot +G +5002, + +Tilia +- +Quercus + +forest soil in Naissaar, +Estonia +, + +59.57530 ° N +, +24.53590 ° E + +); and EUK 1604051 ( +GSMc +plot +S +480, + +Populus +- +Picea + +forest soil in Käru, +Estonia +, + +58.80407 ° N +, +25.22249 ° E + +). + + + + +Etymology. + + +Ruu +(Estonian) refers to +type +locality; and +Coralie +(French) refers to the first name of Coralie Damon, who collected the first materials belonging to this genus. + + + + +Notes. + + +Found from three sites in +Estonia +, with + +ITS + +and +LSU +sequences displaying up to 0.3 % differences. + + + + \ No newline at end of file diff --git a/data/86/1C/E3/861CE3AB89AA5874BB2A133E6C3004A1.xml b/data/86/1C/E3/861CE3AB89AA5874BB2A133E6C3004A1.xml new file mode 100644 index 00000000000..eefaa6ca28e --- /dev/null +++ b/data/86/1C/E3/861CE3AB89AA5874BB2A133E6C3004A1.xml @@ -0,0 +1,137 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Densosporales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Densosporaceae Desirò, M. E. Sm., Bidartondo, Trappe & Bonito. + + + + +Description. + + +Densosporales +is defined as a monophyletic group in +Endogonomycetes +(Fig. +2 +, Suppl. material +3 +) that corresponds to + +Densosporaceae sensu +Desiro et al. (2017) + +. Covers +Densosporacae +and Planticonsortiaceae and the least inclusive clade with sequence accessions UDB 028692, EUK 1104889, EUK 1104816 and EUK 1601509 (Suppl. material +3 +). + + + + +Notes. + + +Densosporales +harbours roughly one half of the +Endogonomycetes +based on +LSU +data. It comprises +Densosporacae +, Planticonsortiaceae and 16 additional family-level groups collectively covering> 200 species. +LSU +has much greater phylogenetic resolution compared with +SSU +(Suppl. materials +3 +, +4 +), and the potential utility of the + +ITS + +region seems to vary greatly by family. Many more + +ITS + +- +LSU +sequences are needed to understand family- and genus-level composition of +Densosporales +. + + + + \ No newline at end of file diff --git a/data/87/BB/C8/87BBC8994CD053E28551701053D6C46F.xml b/data/87/BB/C8/87BBC8994CD053E28551701053D6C46F.xml new file mode 100644 index 00000000000..f9da350f406 --- /dev/null +++ b/data/87/BB/C8/87BBC8994CD053E28551701053D6C46F.xml @@ -0,0 +1,123 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Kungsaengenaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Kungsaengena +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Kungsaengenales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603402 and EUK 1602136 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Kungsaengena + +and a genus-level unassigned species represented by sequence EUK 0013897 ( +GSMc +plot +G +2907, subtropical forest soil in Cuc Phuong, +Viet Nam +, + +20.34902 ° N +, +105.59649 ° E + +). + + + + \ No newline at end of file diff --git a/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml b/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml new file mode 100644 index 00000000000..7219cba0723 --- /dev/null +++ b/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml @@ -0,0 +1,208 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Unemaeea nathalieae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Unemaeea + +based on the + +ITS + +region ( +5.8 S +positions 122–151 gtcagtgtttgccacggagtatgccggctt; no mismatch allowed) and from other species of +Endogonomycetes +based on +LSU +(positions 694–723 gggcttgtcatggcagagggacacgtcgta; no mismatch allowed) as indicated in Fig. +17 +. + + + + + + +Diagnostic barcodes for + +Unemaeea nathalieae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 100213 ( + +holotype + +); +eDNA +sequence EUK 1630871 ( + +lectotype + +); +GSMc +plot +G +3318, marshland (soil sample TUE 000213) in Unemäe, +Estonia +, + +58.28253 ° N +, +22.46296 ° E + +. + + + + +Description. + + +Other sequences: EUK 1635887 – EUK 1635890 ( +type +locality) and EUK 1213720 (FunAqua sample +W +0581 s, river sediment in Floresti, +Romania +, + +46.75472 ° N +, +23.49923 ° E + +). + + + + +Etymology. + + +Unemäe +(Estonian) refers to the +type +locality; and +Nathalie +(English) refers to the first name of Nathalie +J +. +A +. Curlevski who collected the first materials belonging to this genus. + + + + +Notes. + + +The end of +5.8 S +and start of +LSU +are strongly diverged compared with other species of + +Unemaeea + +and +Endogonomycetes +. As no other confamilial +LSU +sequences are available, the diagnostic positions are compared against the most divergent, unalignable part across +Endogonomycetes +. Found in anoxic soil in +Estonia +and +Romania +, with + +ITS + +sequences displaying up to 4 % differences. + + + + \ No newline at end of file diff --git a/data/8D/EB/CD/8DEBCDA3A18554F9BBA8F5B2295633EC.xml b/data/8D/EB/CD/8DEBCDA3A18554F9BBA8F5B2295633EC.xml new file mode 100644 index 00000000000..c698170eb0a --- /dev/null +++ b/data/8D/EB/CD/8DEBCDA3A18554F9BBA8F5B2295633EC.xml @@ -0,0 +1,111 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Kahvenaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Kahvena +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Kahvenales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1634339 and EUK 1630771 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Kahvena + +. + + + + \ No newline at end of file diff --git a/data/93/6D/5C/936D5CDDD979583DAA55A9DC8ED15EEC.xml b/data/93/6D/5C/936D5CDDD979583DAA55A9DC8ED15EEC.xml new file mode 100644 index 00000000000..c7f435661ac --- /dev/null +++ b/data/93/6D/5C/936D5CDDD979583DAA55A9DC8ED15EEC.xml @@ -0,0 +1,325 @@ + + + +Three new species of Cyanosporus (Polyporales, Basidiomycota) from China + + + +Author + +Wang, Chao-Ge +0000-0003-4381-5720 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + + + +Author + +Liu, Shun +0000-0001-9261-4365 +Institute of Ecology and Key Laboratory for Earth Surface Processes of the Ministry of Education, College of Urban and Environmental Sciences, Peking University, Beijing 100871, China + + + +Author + +Ghobad-Nejhad, Masoomeh +0000-0002-7807-4187 +Department of Biotechnology, Iranian Research Organization for Science and Technology (IROST), Tehran 3353 - 5111, Iran + + + +Author + +Liu, Hong-Gao +0000-0002-9508-3245 +Yunnan Key Laboratory of Gastrodia and Fungi Symbiotic Biology, Zhaotong University, Zhaotong 657000, China + + + +Author + +Dai, Yu-Cheng +0000-0002-6523-0320 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + + + +Author + +Yuan, Yuan +0000-0001-6674-9848 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +272 + + + +journal article +10.3897/mycokeys.107.126139 + + + + + +Cyanosporus linzhiensis +Y. C. Dai, Chao G. Wang, Yuan Yuan & Ghobad-Nejhad + +sp. nov. + + + + +Figs 2 +, +3 + + + + + +Holotype +. + + + + +China +. • +Xizang +Autonomous Region +: +Nyingchi +, +Zayü County +, + +27 Oct. 2023 + +, on fallen branch of + +Pinus yunnanensis +, Dai + +27023 ( + +BJFC +044575 + +, GenBank: +ITS + +PP 479782 + +, +LSU + +PP 479804 + +, +mtSSU + +PP 510197 + +, nrSSU + +PP 488289 + +, RPB 1 + +PP 526259 + +, +RPB 2 + +PP 526268 + +). + + + + + +Etymology. + + +In reference to the species being found in Linzhi (Nyingchi) of +Xizang +Autonomous Region, southwest +China +. + + + + +Diagnosis. + + + +Cyanosporus linzhiensis + +is characterized by their pileate basidiomata with a bluish tint and azonate pileal surface when fresh and dry, white to pale bluish gray pore surface when fresh, pores angular to irregular, 5–6 per mm, cystidioles fusoid and basidiospores allantoid, 4–5 × 1.2–1.5 µm. + + +Basidiomata +annual, pileate, soft and without odor or taste when fresh, becoming soft corky to fragile upon drying; pileus flabelliform, up to +3 cm +, +3.5 cm +wide and +8 mm +thick at the base. Pileal surface white, somewhat with a bluish tint when fresh, becoming white to pinkish buff when dry, velutinate, azonate. Hymenophore white to pale bluish gray when fresh, becoming pinkish buff to honey yellow and with a blue tint upon drying; sterile margin almost absent; pores angular to irregular, 5–6 per mm, with thin dissepiments becoming lacerate. Context white, soft corky, up to +5 mm +thick. Tubes concolorous with pore surface, soft corky to fragile when dry, up to +3 mm +long. Context and tubes turn dark olive green in +KOH +. + + + + + + +Basidiomata of + +Cyanosporus linzhiensis + +(Dai 27023, holotype). Scale bar: 1 cm. + + + +Hyphal system +monomitic; hyphae clamped, hyaline, slightly thick-walled, with a wide lumen, smooth; in the context frequently branched, more or less flexuous, loosely interwoven, 3–5 µm in diam; in the tubes unbranched, straight, subparallel along the tubes, agglutinated, 2–3.5 µm in diam. + + + + + + + +Cyanosporus linzhiensis + +(Dai 27023, holotype,) +A +basidiospores +B +basidia and basidioles +C +cystidioles +D +hyphae from context +E +hyphae from trama. Scale bars: 5 µm ( +A +); 10 µm ( +B-E +). + + + +Cystidia +absent, but cystidioles fusoid are present, thin-walled, 12–13.5 × 3 µm. + + +Basidia +clavate, 9–13 × 4–5 µm, with basal clamp and four sterigmata. + + +Basidiospores +allantoid, 4–5 × 1.2–1.5 µm, +L += 4.5 µm, +W += 1.4 µm, +Q += 3.1–3.5 (n = 60 / 2), thin-walled, smooth, hyaline, +IKI +-, + +CB + +-. + + + + +Type of rot. + +Brown rot. + + + +Additional specimen examined. + + + +China +. • +Xizang +Autonomous Region +: +Nyingchi +, +Bomê County +, + +27 Oct. 2023 + +, on fallen angiosperm trunk, +Dai +27141 ( + +BJFC +044575 + +, GenBank: +ITS + +PP 479781 + +, +LSU + +PP 479803 + +, +mtSSU + +PP 510196 + +, nrSSU + +PP 488288 + +, RPB 1 + +PP 526258 + +, +RPB 2 + +PP 526267 + +) + +. + + + + \ No newline at end of file diff --git a/data/93/DC/27/93DC27C516C85653865C946184177AD7.xml b/data/93/DC/27/93DC27C516C85653865C946184177AD7.xml new file mode 100644 index 00000000000..7c63b87b61c --- /dev/null +++ b/data/93/DC/27/93DC27C516C85653865C946184177AD7.xml @@ -0,0 +1,435 @@ + + + +Three new species of Cyanosporus (Polyporales, Basidiomycota) from China + + + +Author + +Wang, Chao-Ge +0000-0003-4381-5720 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + + + +Author + +Liu, Shun +0000-0001-9261-4365 +Institute of Ecology and Key Laboratory for Earth Surface Processes of the Ministry of Education, College of Urban and Environmental Sciences, Peking University, Beijing 100871, China + + + +Author + +Ghobad-Nejhad, Masoomeh +0000-0002-7807-4187 +Department of Biotechnology, Iranian Research Organization for Science and Technology (IROST), Tehran 3353 - 5111, Iran + + + +Author + +Liu, Hong-Gao +0000-0002-9508-3245 +Yunnan Key Laboratory of Gastrodia and Fungi Symbiotic Biology, Zhaotong University, Zhaotong 657000, China + + + +Author + +Dai, Yu-Cheng +0000-0002-6523-0320 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + + + +Author + +Yuan, Yuan +0000-0001-6674-9848 +State Key Laboratory of Efficient Production of Forest Resources, School of Ecology and Nature Conservation, Beijing Forestry University, Beijing 100083, China + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +272 + + + +journal article +10.3897/mycokeys.107.126139 + + + + + +Cyanosporus miscanthi +Y. C. Dai, Chao G. Wang, Yuan Yuan & Ghobad-Nejhad + +sp. nov. + + + + +Figs 4 +, +5 + + + + + +Holotype +. + + + + +China +. • +Xizang +Autonomous Region +: +Nyingchi +, +Medog County +, + +24 Oct. 2023 + +, on dead + +Miscanthus +, Dai + +26687 ( + +BJFC +044237 + +, GenBank: +ITS + +PP 479786 + +, +LSU + +PP 479808 + +, +mtSSU + +PP 510201 + +, nrSSU + +PP 488293 + +, RPB 1 + +PP 526263 + +, RPB 2 + +PP 526272 + +, +TEF 1 + +PP 526277 + +). + + + + + +Etymology. + + +In reference to + +Miscanthus + +the genus where this species was found. + + + + +Diagnosis. + + + +Cyanosporus miscanthi + +is characterized by effused-reflexed to pileate tiny basidiomata, slightly concentrically zonate pileal surface, white to pale bluish gray pore surface when fresh, angular pores, 7–9 per mm, fusoid cystidioles and cylindrical to allantoid basidiospores, 4–5 × 1.5–2 µm. + + + + + + +Basidiomata of + +Cyanosporus miscanthi + +(Dai 26687, holotype). Scale bar: 1 cm. + + + +Basidiomata +annual, effused-reflexed to pileate, soft and without odor or taste when fresh, becoming fragile to soft corky upon drying, up to +1 cm +long and +0.8 cm +wide when resupinate; pileus semicircular, projecting up to +0.8 cm +, +1.2 cm +wide and +1.2 mm +thick at the base. Pileal surface white, pale bluish gray to bluish green when fresh and dry, velutinate, slightly concentrically zonate when dry; margin sharp, slightly curved when dry. Hymenophore poroid, white to pale bluish gray when fresh, becoming bluish gray to ash gray when dry; sterile margin almost absent; pores angular, 7–9 per mm; dissepiments thin, entire to slightly lacerate. Context white, soft corky, up to +0.3 mm +thick. Tubes concolorous with pore surface, fragile to soft corky when dry, up to +0.9 mm +long. Context and tubes turn dark olive green in +KOH +. + + + + + + + +Cyanosporus miscanthi + +(Dai 26687, holotype) +A +basidiospores +B +basidia and basidioles +C +cystidioles +D +hyphae from context +E +hyphae from trama. Scale bars: 5 μm ( +A +); 10 μm ( +B-E +). + + + +Hyphal system +monomitic; hyphae clamped, hyaline, slightly thick-walled, smooth, with a wide lumen, frequently branched, more or less flexuous, in the context loosely interwoven, 3–4.5 µm in diam in the tubes subparallel along the tubes, agglutinated, 2.5–3 µm in diam. + + +Cystidia +absent, but cystidioles fusoid present, thin-walled, 11–15 × 4 µm. + + +Basidia +clavate, 9–13 × 4–5 µm, with four sterigmata and a basal clamp connection. + + +Basidiospores +cylindrical to allantoid, 4–5 (– 5.5) × 1.5–2 µm, +L += 4.2 µm, +W += 1.9 µm, +Q += 2.2–2.4 (n = 120 / 4), hyaline, thin-walled, +IKI +-, + +CB + +-. + + + + +Type of rot. + +Brown rot. + + + +Additional specimens examined. + + + +China +. • +Xizang +Autonomous Region +: +Nyingchi +, +Medog County +, + +24 Oct. 2023 + +, on dead + +Miscanthus +, Dai + +26684 ( +BJFC 044234 +, +ITS + +PP 479784 + +, +LSU + +PP 479806 + +, +mtSSU + +PP 510199 + +, nrSSU + +PP 488291 + +, RPB 1 + +PP 526261 + +, RPB 2 + +PP 526270 + +, +TEF 1 + +PP 526276 + +); Dai 26695 ( +BJFC 044245 +, +ITS + +PP 479787 + +, +LSU + +PP 479809 + +, +mtSSU + +PP 510202 + +, nrSSU + +PP 488294 + +, RPB 1 + +PP 526264 + +, RPB 2 + +PP 526273 + +, +TEF 1 + +PP 526278 + +); Dai 26689 ( +BJFC 044239 +, +ITS + +PP 479783 + +, +LSU + +PP 479805 + +, +mtSSU + +PP 510198 + +, nrSSU + +PP 488290 + +, RPB 1 + +PP 526260 + +, RPB 2 + +PP 526269 + +, +TEF 1 + +PP 526275 + +); Dai 26701 ( +BJFC 044251 +, +ITS + +PP 479785 + +, +LSU + +PP 479807 + +, +mtSSU + +PP 510200 + +, nrSSU + +PP 488292 + +, RPB 1 + +PP 526262 + +, +RPB 2 + +PP 526271 + +) + +. + + + + \ No newline at end of file diff --git a/data/95/DA/88/95DA88D2FCCD598FA2066AC87C816BAB.xml b/data/95/DA/88/95DA88D2FCCD598FA2066AC87C816BAB.xml new file mode 100644 index 00000000000..d1288813a69 --- /dev/null +++ b/data/95/DA/88/95DA88D2FCCD598FA2066AC87C816BAB.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Tammsaareales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Tammsaareaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1602762, EUK 1635767 and EUK 1602763 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Tammsaareaceae + +. + + + + \ No newline at end of file diff --git a/data/97/D1/36/97D136DCC849579BAA7CD1763568E03E.xml b/data/97/D1/36/97D136DCC849579BAA7CD1763568E03E.xml new file mode 100644 index 00000000000..f53ac933d38 --- /dev/null +++ b/data/97/D1/36/97D136DCC849579BAA7CD1763568E03E.xml @@ -0,0 +1,150 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Unemaeeaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Unemaeea +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Unemaeeales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1630871 and EUK 1635889 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Unemaeea + +and multiple poorly alignable + +ITS + +sequences with no +LSU +, for example EUK 1217297 (FunAqua sample +W +0006 s, lake sediment in Petrolandia, +Brazil +, + +- +8.9908 ° N +, - +38.2251 ° E + +) and +FJ 528738 +( + +Araucaria +spp. + +plantation soil, Gadgarra, +Australia +, + +- +17.1641 ° N +, +145.6469 ° E + +) that was isolated by Nathalie +J +. +A +. Curlevski ( +Curlevski et al. 2010 +). It seems that several Unemaeeaceae spp. have preferential habitat in anoxic soils and sediments. + + + + \ No newline at end of file diff --git a/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml b/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml new file mode 100644 index 00000000000..39db3ae83dc --- /dev/null +++ b/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml @@ -0,0 +1,203 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Riederberga sylviae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Riederberga + +based on the + +ITS + +region ( +ITS +2 positions 186–215 gctttggacggcatgcgaatctgcatcaca; one mismatch allowed) and +LSU +(positions 656–685 tcaccaatcgacgtcaatcggcatgcgtct; one mismatch allowed) as indicated in Fig. +14 +. + + + + + + +Diagnostic barcodes for + +Riederberga sylviae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 128372 ( + +holotype + +); +eDNA +sequence: EUK 1602903 ( + +lectotype + +); +GSMc +plot +G +5783, wet grassland (soil sample TUE 028372) in Altnurga, +Estonia +, + +58.55682 ° N +, +26.29259 ° E + +. + + + + +Description. + + +Other sequences: EUK 1604046 and EUK 1604047 (both +type +locality); and + +GU +055683 + +( + +ITS + +part considered; managed grassland soil in Riederberg, +Austria +, + +48.25 ° N +, +16.07 ° E + +), collected by Sylvia Klaubauf ( +Klaubauf et al. 2010 +). + + + + +Etymology. + + +Riederberg +(German) refers to +type +locality; and +Sylvia +(German) refers to the first name of Sylvia Klaubauf, who first collected the materials of +type +species and the entire order from the +type +habitat. + + + + +Notes. + + +Found in +Austria +and +Estonia +, with + +ITS + +and +LSU +sequences displaying up to 1 % differences. + + + + \ No newline at end of file diff --git a/data/9F/A5/34/9FA534401DC954F394C549B14EA58F10.xml b/data/9F/A5/34/9FA534401DC954F394C549B14EA58F10.xml new file mode 100644 index 00000000000..d33c5c27345 --- /dev/null +++ b/data/9F/A5/34/9FA534401DC954F394C549B14EA58F10.xml @@ -0,0 +1,118 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Jimgerdemanniaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Jimgerdemannia +Trappe, Desirò, M. E. Sm., Bonito & Bidartondo. + + + + + +Description. + + +Includes + +Jimgerdemannia + +and closely-related genera that form a monophyletic group in +Endogonales +, with the least inclusive clade covering accessions +KC 568319 +, EUK 1631035, +JN 890102 +, UDB 025468 and + +OU +942919 + +(Suppl. material +3 +). + + + + +Notes. + + +Jimgerdemanniaceae covers an ectomycorrhizal genus + +Jimgerdemannia + +and six genus-level taxa that are soil-inhabiting, potentially arbuscular mycorrhizal and probably not producing macroscopic fruiting bodies. + + + + \ No newline at end of file diff --git a/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml b/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml new file mode 100644 index 00000000000..d44ae403181 --- /dev/null +++ b/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml @@ -0,0 +1,200 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Nikkaluokta mahdiehiae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Nikkaluokta + +based on the + +ITS + +region (positions 97–116 cctgggcaaatttttttttc; one mismatch allowed) and +LSU +(positions 687–717 cttggatataagaagtggaatctacacaaat; one mismatch allowed) as indicated in Fig. +12 +. + + + + + + +Diagnostic barcodes for + +Nikkaluokta mahdiehiae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 100497 ( + +holotype + +); +eDNA +sequence EUK 1203196 ( + +lectotype + +); subarctic + +Pinus sylvestris + +forest (soil sample TUE 000497) in + +Nikkaluokta + +, +Sweden +, + +67.85596 ° N +, +19.47575 ° E + +. + + + + +Description. + + +Other sequences: EUK 1203537 ( +type +locality) and EUK 1603797 ( +GSMc +plot +G +5003, + +Pinus sylvestris + +forest soil in Naissaare, +Estonia +, + +59.56340 ° N +, +24.54510 ° E + +). + + + + +Etymology. + + +Nikkaluokta +(Sami) refers to +type +locality; and +Mahdieh +(Persian) refers to the first name of Mahdieh Hosseyni Moghaddam who sequenced the +type +materials using target capture protocols. + + + + +Notes. + + +Found in +Sweden +and +Estonia +, with + +ITS + +and +LSU +sequences displaying up to 1 % and 0.2 % differences, respectively. + + + + \ No newline at end of file diff --git a/data/A5/F8/25/A5F825F33F1154D4BC46D16EE26D497C.xml b/data/A5/F8/25/A5F825F33F1154D4BC46D16EE26D497C.xml new file mode 100644 index 00000000000..2ef61e4a418 --- /dev/null +++ b/data/A5/F8/25/A5F825F33F1154D4BC46D16EE26D497C.xml @@ -0,0 +1,129 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Ruuaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Ruua +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Ruuales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603424, EUK 1600239, EUK 1600169 and EUK 1600180 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Ruua + +and another genus-level taxon represented by sequence EUK 1602764 ( +GSMc +plot +G +4189, + +Populus tremula + +forest soil in +Tammsaare +, +Estonia +, + +57.84444 ° N +, +27.20141 ° E + +). + + + + \ No newline at end of file diff --git a/data/A7/1A/CC/A71ACC989F38590AB2E617C3DCF2E964.xml b/data/A7/1A/CC/A71ACC989F38590AB2E617C3DCF2E964.xml new file mode 100644 index 00000000000..6346a4b9b0e --- /dev/null +++ b/data/A7/1A/CC/A71ACC989F38590AB2E617C3DCF2E964.xml @@ -0,0 +1,163 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Kungsaengena +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Kungsaengena shadiae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Kungsaengenaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603402 and EUK 1602136 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Kungsaengena + +comprises 5–6 species. Other putative species in this genus are represented by sequences EUK 1603803 ( +GSMc +plot +G +5906, stadium soil in Karksi-Nuia, +Estonia +, + +58.10088 ° N +, +25.55959 ° E + +); EUK 1603124 ( +GSMc +plot +G +5003, + +Pinus sylvestris + +forest soil in Naissaar, +Estonia +, + +59.5634 ° N +, +24.5451 ° E + +); EUK 1217319 (FunAqua sample +W +0279 s, lake sediment near Bezdan, +Serbia +, + +45.82031 ° N +, +18.9599 ° E + +); and + +MW +215857 + +(forest nursery soil in +Lithuania +). + + + + \ No newline at end of file diff --git a/data/B3/DE/A7/B3DEA7427B7D587B839E1117637F08A0.xml b/data/B3/DE/A7/B3DEA7427B7D587B839E1117637F08A0.xml new file mode 100644 index 00000000000..2144bc2746c --- /dev/null +++ b/data/B3/DE/A7/B3DEA7427B7D587B839E1117637F08A0.xml @@ -0,0 +1,111 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Vinositunicaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Vinositunica +Koh. Yamam., Degawa & A. Yamada. + + + + + +Description. + + +Fruiting bodies epigeous or semi-hypogeous, reniform or irregular, often with a short stipe-like sterile base, +2–20 mm +in diam. Peridium white, partly purple, in a single layer, composed of coenocytic aseptate hyphae. Gleba pale yellow to purplish-grey, composed of numerous radially or randomly distributed chlamydospores. Chlamydospores granular, with yellow contents, broadly ellipsoid, 50–700 μm diam, terminal on single subtending hypha. Cell wall composed of purplish to vinaceous outer layer and colourless inner layer. + + + + +Notes. + + +Vinositunicaceae includes the genus + +Vinositunica + +. This group has not been found from root or soil +eDNA +samples thus far, and + +ITS + +sequences are not available. Probably humus saprotrophs. Family description is adapted from +Yamamoto et al. (2020) +. + + + + \ No newline at end of file diff --git a/data/B4/4E/01/B44E017E4A615D53B31217EBAC90BB9D.xml b/data/B4/4E/01/B44E017E4A615D53B31217EBAC90BB9D.xml new file mode 100644 index 00000000000..581f485f6e9 --- /dev/null +++ b/data/B4/4E/01/B44E017E4A615D53B31217EBAC90BB9D.xml @@ -0,0 +1,116 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Endogonaceae Paol. +, emend. Tedersoo + + + + + +Type +genus. + + + + +Endogone +Link. + + + + + +Description. + + +Fruiting body hypogeous or on debris, globose, irregular, sometimes resupinate, +1–10 mm +diam., may be composed of aggregated zygosporangial clusters, with zygospores formed on apposed suspensors. Hyphae of fruiting body tissue coenocytic, aseptate, sometimes with secondary septa that form micropores. Reproductive structures as zygosporangia, rarely azygosporangia (co-existing with zygosporangia in + +Endogone pisiformis + +) distributed randomly or radially in fruiting bodies, 100–700 μm diam., with yellow granular contents. Zygosporangial wall comprises outer sporangiothecium with 1–4 openings and inner eusporium with no openings. Azygosporangia rare, with a single-layered wall, and separated from the single suspensor by a gametangial septum. Forms a monophyletic group in +Endogonales +as the least inclusive clade covering accessions + +LC 002628 + +, EUK 1601764 and EUK 1601442. + + + + +Notes. + + +Covers species of + +Endogone + +that are saprotrophic or potentially ectomycorrhizal (/ endogone 2 and / endogone 3 lineages, +sensu +Tedersoo and Smith (2017) +) and four closely-related genus-level taxa. + + + + \ No newline at end of file diff --git a/data/B9/4E/FD/B94EFDDD356D5FE4A92EA2C0ACB93E7A.xml b/data/B9/4E/FD/B94EFDDD356D5FE4A92EA2C0ACB93E7A.xml new file mode 100644 index 00000000000..99fa02f6332 --- /dev/null +++ b/data/B9/4E/FD/B94EFDDD356D5FE4A92EA2C0ACB93E7A.xml @@ -0,0 +1,163 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Kelottijaervia +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Kelottijaervia shannonae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Kelottijaerviaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1202520 and EUK 1633699 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Kelottijaervia + +is comprised of about five species that are represented by sequences EUK 1603128 ( +GSMc +plot +G +2755 X +, + +Pinus sylvestris + +forest soil, Liiva-Putla, +Estonia +, + +58.38859 ° N +, +22.65545 ° E + +); EUK 0302816 (plot +G +5403, mixed coniferous forest in Kõrveküla, +Estonia +, + +58.43789 ° N +, +26.75099 ° E + +); EUK 1104755 ( + +Pinus sylvestris + +forest soil near Hofors, +Sweden +, + +60.49 ° N +, +16.30 ° E + +); and +KP 889573 +(coniferous forest soil in +British Columbia +, +Canada +). The genus seems to prefer acidic coniferous forest habitats. + + + + \ No newline at end of file diff --git a/data/BB/C9/31/BBC931E5D7C251AF8556A9DB1B4080D9.xml b/data/BB/C9/31/BBC931E5D7C251AF8556A9DB1B4080D9.xml new file mode 100644 index 00000000000..d3e67766ee3 --- /dev/null +++ b/data/BB/C9/31/BBC931E5D7C251AF8556A9DB1B4080D9.xml @@ -0,0 +1,111 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Kelottijaerviaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Kelottijaervia +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Kelottijaerviales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1202520 and EUK 1633699 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Kelottijaervia + +. + + + + \ No newline at end of file diff --git a/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml b/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml new file mode 100644 index 00000000000..2b6f0171185 --- /dev/null +++ b/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml @@ -0,0 +1,153 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Fuscutata reticulata +(Koske, D. D. Mill. & C. Walker) Tedersoo & Magurno + +comb. nov. + + + + + + + + +Gigaspora reticulata +Koske, D. D. Mill. & C. Walker, Mycotaxon + +16 (2): 429 (1983) + +. Basionym. + + + + + + + + +Dentiscutata reticulata +(Koske, D. D. Mill. & C. Walker) Sieverd., F. A. Souza & Oehl, Mycotaxon + +106: 342 (2009) + +. Synonym. + + + + + + +Description. + + +See +Koske et al. (1983) +. + + + + +Diagnosis. + + + +Fuscutata reticulata + +differs from other species of the + +Fuscutata + +by spore wall ornamentation, three-walled spores and dark-pigmented, multilobed germinal shield produced in the inner wall. Phylogenetically forms a monophyletic clade with + +F. heterogama + +- +type +species of genus - based on the SSU- + +ITS + +- +LSU +phylogram (Fig. +1 +, Suppl. material +1 +). + + + + +Notes. + + +See note of + +F. cerradensis + +. + + + + \ No newline at end of file diff --git a/data/BE/12/D3/BE12D337D71057AD9C3DBA3EBCFB80C5.xml b/data/BE/12/D3/BE12D337D71057AD9C3DBA3EBCFB80C5.xml new file mode 100644 index 00000000000..40e4e9db966 --- /dev/null +++ b/data/BE/12/D3/BE12D337D71057AD9C3DBA3EBCFB80C5.xml @@ -0,0 +1,121 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Hoforsales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Hoforsaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1100001, EUK 1602331 and EUK 1602346 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes Hoforsaceae and another potentially family-level group, which is represented by sequence EUK 1631675 ( +GSMc +plot +G +4124, + +Populus tremula + +forest soil in Mäla, +Estonia +, + +58.58693 ° N +, +23.28597 ° E + +). Hoforsales corresponds to clade GS 22 (sensu +Tedersoo et al. (2017) +). + + + + \ No newline at end of file diff --git a/data/CA/D1/00/CAD10076055E5EC8B4C1E73F5316175F.xml b/data/CA/D1/00/CAD10076055E5EC8B4C1E73F5316175F.xml new file mode 100644 index 00000000000..cb2bf91942b --- /dev/null +++ b/data/CA/D1/00/CAD10076055E5EC8B4C1E73F5316175F.xml @@ -0,0 +1,168 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Lehetuaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Lehetua +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Lehetuales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603180, EUK 1602375 and EUK 1602377 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Lehetua + +and another potentially genus-level group that is represented by sequences EUK 1602869 ( +GSMc +plot +G +4531, + +Picea abies + +forest soil in Selisoo, +Estonia +, + +57.621658 ° N +, +27.179296 ° E + +) and EUK 1603296 ( +GSMc +plot +S +590, + +Populus tremula + +forest soil in Lehetu, +Estonia +, + +59.01857 ° N +, +24.28041 ° E + +); and unassigned sequences EUK 0025664 ( +GSMc +plot +G +5536, tropical rainforest soil in Bamboesi, +Suriname +, + +5.54086 ° N +, - +54.03131 ° E + +) and EUK 0030289 ( +GSMc +plot +AV +120, tropical rainforest soil in El Zafire, +Colombia +, + +- +3.9997 ° N +, +69.8947 ° E + +). + + + + \ No newline at end of file diff --git a/data/D1/78/89/D17889EB3E735C99A9AB5605ED77DBE2.xml b/data/D1/78/89/D17889EB3E735C99A9AB5605ED77DBE2.xml new file mode 100644 index 00000000000..4a5f1eeee25 --- /dev/null +++ b/data/D1/78/89/D17889EB3E735C99A9AB5605ED77DBE2.xml @@ -0,0 +1,143 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Langduoales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Langduoaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1107335, EUK 1103607 and EUK 1632831 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes Langduoaceae and another potentially family-level group, which is represented by sequences EUK 1632831 ( +GSMc +plot +G +4104, + +Salix alba + +wetland forest soil in Koiva, +Estonia +, + +57.68283 ° N +, +26.20146 ° E + +); EUK 1603795 ( +GSMc +plot +G +5906, football field in Karksi-Nuia, +Estonia +, + +58.10088 ° N +, +25.55959 ° E + +); and EUK 1602996 ( +GSMc +plot +G +4171, mixed coniferous forest soil in Nõmmeotsa, +Estonia +, + +58.48765 ° N +, +26.22523 ° E + +). + + + + \ No newline at end of file diff --git a/data/D6/6B/98/D66B982B488254A1B6F9D49D9073B6CD.xml b/data/D6/6B/98/D66B982B488254A1B6F9D49D9073B6CD.xml new file mode 100644 index 00000000000..31cd21c851a --- /dev/null +++ b/data/D6/6B/98/D66B982B488254A1B6F9D49D9073B6CD.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Kelottijaerviales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Kelottijaerviaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1202520 and EUK 1633699 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Kelottijaerviaceae + +. + + + + \ No newline at end of file diff --git a/data/D9/F0/E4/D9F0E42A593A5E2AAD53C7C9823073F6.xml b/data/D9/F0/E4/D9F0E42A593A5E2AAD53C7C9823073F6.xml new file mode 100644 index 00000000000..1e9b8360f31 --- /dev/null +++ b/data/D9/F0/E4/D9F0E42A593A5E2AAD53C7C9823073F6.xml @@ -0,0 +1,161 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Nikkaluoktaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Nikkaluokta +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Nikkaluoktales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1203196, EUK 1600291 and EUK 1600248 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Nikkaluokta + +and another potentially genus-level group that is represented by sequences EUK 1602730 ( +GSMc +plot +S +554, + +Betula +- +Quercus + +woodland soil in Mädapea, +Estonia +, + +59.32169 ° N +, +26.2621 ° E + +); EUK 1602729 ( +GSMc +plot +FF +14, + +Picea abies + +forest soil in Kõdesi, +Estonia +, + +58.61484 ° N +, +27.12781 ° E + +); and EUK 1600257 ( +GSMc +plot +G +4464, + +Quercus robur + +forest soil in Ruu, +Estonia +, + +59.45059 ° N +, +25.22166 ° E + +). + + + + \ No newline at end of file diff --git a/data/DA/57/AE/DA57AE5527B25141BD8F039113A0E4D3.xml b/data/DA/57/AE/DA57AE5527B25141BD8F039113A0E4D3.xml new file mode 100644 index 00000000000..5c843aea353 --- /dev/null +++ b/data/DA/57/AE/DA57AE5527B25141BD8F039113A0E4D3.xml @@ -0,0 +1,142 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Diversispora bareae +(Palenz., N. Ferrol & Oehl) Tedersoo & Magurno + +comb. nov. + + + + + + + +Otospora bareae + +Palenz., N. Ferrol & Oehl, in + + +Palenzuela, Ferrol, Boller, Azcón-Aguilar & Oehl, +Mycologia 100 (2): 298 (2008) + + +. Basionym. + + + + + + + + +Description. + + +As presented originally in +Palenzuela et al. (2008) +. + + + + +Diagnosis. + + + +Diversispora bareae + +differs from other species of the + +Diversispora + +by producing acaulosporoid (otosporoid) spores compared with diversisporoid and entrophosporoid (tricisporoid) spores in other described species. Glomerospores with inner flexible hyaline layer and pigmented sporiferous saccule. Phylogenetically belongs to + +Diversispora + +based on the SSU- + +ITS + +- +LSU +phylogram (Fig. +1 +, Suppl. material +1 +). + + + + +Notes. + + +The new combination invites an amendment of the genus + +Diversispora + +to accommodate species with otosporoid spores. + + + + \ No newline at end of file diff --git a/data/DC/72/5A/DC725A98B73655A58E83D039AA3741FE.xml b/data/DC/72/5A/DC725A98B73655A58E83D039AA3741FE.xml new file mode 100644 index 00000000000..d39c27781fa --- /dev/null +++ b/data/DC/72/5A/DC725A98B73655A58E83D039AA3741FE.xml @@ -0,0 +1,111 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Langduoaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Langduoa +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Langduoales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1107335, EUK 1103607 and EUK 1632829 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently represented by + +Langduoa + +. + + + + \ No newline at end of file diff --git a/data/DC/C9/36/DCC9362CCDEF56DDBFCC23F4F2B5B9C2.xml b/data/DC/C9/36/DCC9362CCDEF56DDBFCC23F4F2B5B9C2.xml new file mode 100644 index 00000000000..0605ce73456 --- /dev/null +++ b/data/DC/C9/36/DCC9362CCDEF56DDBFCC23F4F2B5B9C2.xml @@ -0,0 +1,211 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Parnigua +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Parnigua craigii +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Parniguaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1635261 and EUK 1602353 (Suppl. material +3 +). + + + + +Notes. + + +Based on stringent criteria, there are around five species in this genus, but all these may represent a single variable biological species. In this genus, across and within species, the + +ITS + +region has very low variability when compared with +LSU +(up to 3 % differences across species). Other putative species in + +Parnigua + +are represented by sequences EUK 1602947 ( +GSMc +plot +G +4444, mixed forest soil in Altnurga, +Estonia +, + +58.53676 ° N +, +26.28321 ° E + +); EUK 1603686 ( +GSMc +plot +G +5844, wet pasture land soil in Tuhala, +Estonia +, + +59.23003 ° N +, +25.00283 ° E + +); EUK 1633696 ( +GSMc +plot +G +4207 + +Tilia cordata + +forest soil in Ubari, +Estonia +, + +59.492609 ° N +, +25.285663 ° E + +); EUK 1603848 ( +GSMc +plot +G +5883, flooded grassland soil in Kasari, +Estonia +, + +58.73608 ° N +, +23.98599 ° E + +); EUK 1602353 ( +GSMc +plot +G +4389, + +Quercus +- +Tilia + +forest soil in Naha, +Estonia +, + +57.520914 ° N +, +26.601199 ° E + +); +MF 484762 +(agricultural soil in +England +); and + +MW +163928 + +( + +Crocus sativus + +cropland soil in +Aosta Valley +, +Italy +). The genus can be found from various soils but not from roots. However, +SSU +sequences are lacking, and links to + +AM + +fungi in SSU-based studies cannot be tested. + + + + \ No newline at end of file diff --git a/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml b/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml new file mode 100644 index 00000000000..321d37599f2 --- /dev/null +++ b/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml @@ -0,0 +1,251 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Kelottijaervia shannonae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Kelottijaervia + +based on the + +ITS + +region (positions 212–239 taatgtgagtgcaggaaatattatgact; one mismatch allowed) and +LSU +(positions 600–619 ctttggggtggcggtcgctg; one mismatch allowed) as indicated in Fig. +6 +. + + + + + + +Diagnostic barcodes for + +Kelottijaervia shannonae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +eDNA +sample TUE 100189 ( + +holotype + +); +eDNA +sequence EUK 1202520 ( + +lectotype + +); +GSMc +plot +G +2836 +Finland +, subpolar + +Betula pubescens + +forest (soil sample TUE 000189) in Kelottijärvi, +Finland +, + +68.60353 ° N +, +21.74517 ° E + +. + + + + +Description. + + +Other sequences: EUK 1603540, ( +GSMc +plot +G +4196, + +Populus +- +Picea +- +Pinus + +forest soil in + +Kahvena + +, +Estonia +, + +58.27991 ° N +, +25.23165 ° E + +); EUK 1603663 ( +GSMc +plot +G +4406, mixed coniferous forest soil in Tarumaa, +Estonia +, + +59.20745 ° N +, +27.15333 ° E + +); EUK 1602832 ( +GSMc +plot +G +5828, + +Malus domestica + +orchard soil in Mooste, +Estonia +, + +58.15335 ° N +, +27.19642 ° E + +); and +KP 889965 +(coniferous forest soil in +British Columbia +, +Canada +) that was first isolated by Shannon +H +. +A +. Guichon ( +Guichon 2015 +). + + + + +Etymology. + + +Kelottijärvi +(Finnish) refers to +type +locality; and +Shannon +(English) refers to the first name of Shannon +H +. +A +. Guichon who collected the first materials belonging to this genus. + + + + +Notes. + + +Found in +Estonia +, +Finland +and +Canada +, with + +ITS + +and +LSU +sequences displaying up to 2 % and 1 % of differences, respectively. + + + + \ No newline at end of file diff --git a/data/E6/4A/79/E64A7959C72F5134BD05FAC855682359.xml b/data/E6/4A/79/E64A7959C72F5134BD05FAC855682359.xml new file mode 100644 index 00000000000..3951b616fa0 --- /dev/null +++ b/data/E6/4A/79/E64A7959C72F5134BD05FAC855682359.xml @@ -0,0 +1,164 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Langduoa +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Langduoa dianae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Langduoaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1107335, EUK 1103607 and EUK 1632829 (Suppl. material +3 +). + + + + +Notes. + + +Based on + +ITS + +sequences, + +Langduoa + +is comprised of 40–50 species. The genus is distributed globally in multiple habitat +types +, but not found from roots so far. Most + +Langduoa +species + +are poorly separable based on the +LSU +marker. Other putative species in + +Langduoa + +are represented by sequences EUK 1103607 (tropical rainforest soil in El Yunque, +Puerto Rico +, + +18.29 ° N +, - +65.78 ° E + +); EUK 1631446 ( +GSMc +plot +G +4189, + +Populus tremula + +forest soil in +Tammsaare +, +Estonia +, + +57.84444 ° N +, +27.20141 ° E + +); and + +MW +215048 + +(tree nursery soil in +Lithuania +), which was recorded by Diana Marčiulynienė ( +Marčiulynienė et al. 2021 +). + + + + \ No newline at end of file diff --git a/data/E6/6B/1F/E66B1F7F6F8C5AEC9358ADF9EF53D43F.xml b/data/E6/6B/1F/E66B1F7F6F8C5AEC9358ADF9EF53D43F.xml new file mode 100644 index 00000000000..7f9357e16a2 --- /dev/null +++ b/data/E6/6B/1F/E66B1F7F6F8C5AEC9358ADF9EF53D43F.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Lehetuales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Lehetuaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603180, EUK 1602375 and EUK 1602377 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Lehetuaceae + +. + + + + \ No newline at end of file diff --git a/data/EA/B0/63/EAB06364E6B257A0BADEE28C34CA886E.xml b/data/EA/B0/63/EAB06364E6B257A0BADEE28C34CA886E.xml new file mode 100644 index 00000000000..a7889566bf6 --- /dev/null +++ b/data/EA/B0/63/EAB06364E6B257A0BADEE28C34CA886E.xml @@ -0,0 +1,122 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Parvocarpum +Magurno + +gen. nov. + + + + + +Type +species. + + + + +Parvocarpum badium +(Oehl, Redecker & Sieverd.) Magurno. + + + + + +Description. + + +Producing glomoid-like spores surrounding a central plexus of interwoven hyphae in small organised fruiting bodies, lacking a peridium. Spores with inner flexible hyaline layer and short subtending hyphae. Forms a monophyletic group within +Glomeraceae +based on SSU- + +ITS + +- +LSU +phylogram (Fig. +1 +, Suppl. material +1 +). + + + + +Notes. + + +Based on + +ITS + +and +LSU +sequences, + +Parvocarpum + +includes 10–20 species. + + + + \ No newline at end of file diff --git a/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml b/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml new file mode 100644 index 00000000000..7b670feb501 --- /dev/null +++ b/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml @@ -0,0 +1,259 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Kahvena rebeccae +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Kahvena + +based on the + +ITS + +region ( +ITS +2 positions 200–218 cattcgcaggaatagccag; one mismatch allowed) and from other species of +Endogonomycetes +based on +LSU +(positions 653–683 acgcaagctccagatcgaatctccgggctaa; one mismatch allowed) as indicated in Fig. +5 +. + + + + + + +Diagnostic barcodes for + +Kahvena rebeccae + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 100738 ( + +holotype + +); +eDNA +sequence EUK 1634339 ( + +lectotype + +); +GSMc +plot +G +4196, + +Populus +- +Picea +- +Pinus + +forest (soil sample TUE 000738) in + +Kahvena + +, +Estonia +( + +58.27991 ° N +, +25.23165 ° E + +). + + + + +Description. + + +Other sequences: EUK 1635883 – EUK 1635886 ( +type +locality); EUK 1631811 ( +GSMc +plot +G +2767, mixed woodland soil at Mäebe, +Estonia +, + +58.30937 ° N +, +22.07618 ° E + +); +KF 618358 +( + +Picea mariana + +forest soil, +AK +, +USA +); + +MT +596306 + +(Tobiotsuka Kofun, +Japan +, + +34.6355 ° N +, +133.6814 ° E + +); + +KU +062529 + +(unknown source); and +KF 565426 +(Duke Forest, +NC +, +USA +, + +35.97 ° N +, - +79.09 ° E + +), isolated by Rebecca C. Mueller ( +Mueller et al. 2014 +). + + + + +Etymology. + + +Kahvena +(Estonian) refers to +type +locality; and +Rebecca +(English) refers to the first name of Rebecca C. Mueller, who collected the first materials belonging to this genus and the +type +species. + + + + +Notes. + + +Found from temperate and subarctic forests in Europe, Asia and North America, with + +ITS + +and +LSU +sequences differing up to 4 % (excluding a 29 - base deletion in EUK 1631811 and + +KU +062529 + +) and 1.5 %, respectively. Considered as a single species because of high intraspecific variation amongst common sequence variants in the +type +locality (2 % in + +ITS + +and 1 % in +LSU +, representing both indels and substitutions). + + + + \ No newline at end of file diff --git a/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml b/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml new file mode 100644 index 00000000000..61cc934a37b --- /dev/null +++ b/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml @@ -0,0 +1,256 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Lehetua indrekii +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Lehetua + +based on the + +ITS + +region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and +LSU +(positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. +9 +. + + + + + + +Diagnostic barcodes for + +Lehetua indrekii + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 103095 ( + +holotype + +); type sequence EUK 1603180 ( + +lectotype + +); +GSMc +plot +S +590, + +Populus tremula + +forest (soil sample TUE 003095) in Lehetu, +Estonia +, + +59.01857 ° N +, +24.28041 ° E + +. + + + + +Description. + + +Other sequences: EUK 1603180 ( +type +locality); EUK 1602367 ( +LSU +only; +type +locality; also found in 50 other sites in +Estonia +); EUK 1634481 ( +GSMc +plot +G +4195, + +Quercus robur + +woodland soil in Lustivere, +Estonia +, + +58.66293 ° N +, +26.08465 ° E + +); EUK 1603818 ( +GSMc +plot +G +5824, managed grassland soil in Kuremaa, +Estonia +, + +58.74138 ° N +, +26.52727 ° E + +); EUK 1603131 ( +GSMc +plot +G +4105, + +Picea abies + +forest soil in Lepa, +Estonia +, + +57.70158 ° N +, +26.23993 ° E + +); EUK 0021956 ( +GSMc +plot +G +5150, subarctic grassland soil in Kokelv, +Norway +, + +70.61116 ° N +, +24.62483 ° E + +); and EUK 0023592 ( +GSMc +plot +S +035, mixed deciduous forest soil in Kedrovaya Pad, +Russia +, + +43.10834 ° N +, +131.55447 ° E + +). + + + + +Etymology. + + +Lehetu +(Estonian) refers to +type +locality (also meaning “ leafless ”); and +Indrek +(Estonian) refers to the first name of Indrek Hiiesalu who collected materials from the +type +locality. + + + + +Notes. + + +Found in Baltic States, Scandinavia and +Russia +, with + +ITS + +and +LSU +sequences differing up to 3.5 % and 0.2 %, respectively. Seems to be a generalist in terms of habitat +type +and soil pH; so far, not found from roots. + + + + \ No newline at end of file diff --git a/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml b/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml new file mode 100644 index 00000000000..ea0b13beb79 --- /dev/null +++ b/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml @@ -0,0 +1,295 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Parnigua craigii +Tedersoo + +sp. nov. + + + + +Diagnosis. + + +Separation from other species of + +Parnigua + +based on the + +ITS + +region (positions 51–80 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and +LSU +(positions 444–463 ggcgggaaatcagcccccct; no mismatch allowed) as indicated in Fig. +13 +. + + + + + + +Diagnostic barcodes for + +Parnigua craigii + +relative to closely-related taxa in ITS 2 and LSU. + + + + + + +Type +. + + + +Soil +eDNA +sample TUE 102228 ( + +holotype + +); type sequence: EUK 1635261 ( + +lectotype + +); +GSMc +plot +G +5251, + +Quercus robur + +woodland (soil sample TUE 002228) in Parnigu, +Estonia +, + +58.64096 ° N +, +26.38468 ° E + +. + + + + +Description. + + +Other sequences: EUK 1635874 ( +GSMc +plot +G +4499, calcareous + +Picea abies + +forest soil in Kurisoo, +Estonia +; + +59.12808 ° N +, +25.76395 ° E + +); EUK 1635875 ( +GSMc +plot +G +4746, + +Betula pendula + +forest soil in Karjamõisa, +Estonia +, + +57.59761 ° N +, +26.35493 ° E + +); EUK 1635878 ( +GSMc +plot +G +4794, + +Ulmus +- +Fraxinus + +forest soil in Lõhtsuu, +Estonia +, + +57.91781 ° N +, +26.52069 ° E + +); EUK 1603328 ( +GSMc +plot +G +4167, + +Salix pentandra + +peat soil in Tammispää, +Estonia +, + +58.92051 ° N +, +27.01118 ° E + +); EUK 1602985 ( +GSMc +plot +G +5923, + +Malus domestica + +orchard soil in Kalnabeites, +Latvia +, + +57.1333 ° N +, +24.8566 ° E + +); + +OU +939710 + +(grassland soil in Kungsängen, +Sweden +, + +59.837 ° N +, +17.661 ° E + +); and + +MH +625006 + +(grassland soil in Wakanui, +New Zealand +, + +- +43.668 ° N +, +172.470 ° E + +), first isolated by Craig +R +. Anderson ( +Anderson et al. 2018 +). + + + + +Etymology. + + +Parnigu +(Estonian) refers to +type +locality; and +Craig +(English) refers to the first name of Craig +R +. Anderson who was the first to record this species. + + + + +Notes. + + +Found from +Estonia +, +Sweden +and +New Zealand +, with + +ITS + +and +LSU +sequences differing up to 0.5 %. Found in all croplands, grasslands, deciduous and coniferous forests. + + + + \ No newline at end of file diff --git a/data/EC/7E/1D/EC7E1DA2F92256B7BB638064778B6AB6.xml b/data/EC/7E/1D/EC7E1DA2F92256B7BB638064778B6AB6.xml new file mode 100644 index 00000000000..3450b563286 --- /dev/null +++ b/data/EC/7E/1D/EC7E1DA2F92256B7BB638064778B6AB6.xml @@ -0,0 +1,140 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Lokrumaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Lokruma +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Lokrumales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1203766, EUK 1600125 and EUK 1600078 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Lokruma + +and a few sequences not assigned to any genus; these include EUK 0014543 and EUK 0006923 (both +GSMc +plot +G +5106, subtropical forest soil in Brejo da Lapa, +Brazil +, + +- +22.3582 ° N +, - +44.7383 ° E + +) and EUK 1602939 ( +GSMc +plot +G +4464, + +Quercus robur + +forest soil in Ruu, +Estonia +, + +59.45059 ° N +, +25.22166 ° E + +). + + + + \ No newline at end of file diff --git a/data/EE/E1/04/EEE1045F7B8B50D9BA6097274AFC4591.xml b/data/EE/E1/04/EEE1045F7B8B50D9BA6097274AFC4591.xml new file mode 100644 index 00000000000..584828e1b05 --- /dev/null +++ b/data/EE/E1/04/EEE1045F7B8B50D9BA6097274AFC4591.xml @@ -0,0 +1,112 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Bifiguratales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Bifigurataceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Cultured mycelium filamentous, aseptate, coenocytic, 2 μm diam., mucose in appearance, commonly producing budding yeast-like cells; chlamydospores intercalary, 5–10 μm diam., forming on hyphal tips. Phylogenetically delimited by the least inclusive clade covering sequence accessions + +HM +123225 + +, EUK 1104879, +KF 568171 +and +KF 567389 +. + + + + +Notes. + + +Comprised of a single family +Bifigurataceae +. Order description is adapted from +Torres-Cruz et al. (2017) +. + + + + \ No newline at end of file diff --git a/data/F2/4F/D4/F24FD4C720945DC7A432F2D97A5626EB.xml b/data/F2/4F/D4/F24FD4C720945DC7A432F2D97A5626EB.xml new file mode 100644 index 00000000000..3434c6c9ceb --- /dev/null +++ b/data/F2/4F/D4/F24FD4C720945DC7A432F2D97A5626EB.xml @@ -0,0 +1,147 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Kahvena +Tedersoo + +gen. nov. + + + + + +Type +species. + + + + +Kahvena rebeccae +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Kahvenaceae + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1634339 and EUK 1630771 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Based on + +ITS + +sequences, + +Kahvena + +is comprised of two species; the other represented by sequences EUK 1630771 ( +GSMc +plot +G +4185, + +Picea +- +Pinus + +forest soil in Ristipalo, +Estonia +, + +58.10241 ° N +, +27.47874 ° E + +) and + +ON +963629 + +( + +Pinus sylvestris + +forest soil, +Lithuania +). + + + + \ No newline at end of file diff --git a/data/F9/3E/6A/F93E6A4CD77E56ABBB21164B965DB770.xml b/data/F9/3E/6A/F93E6A4CD77E56ABBB21164B965DB770.xml new file mode 100644 index 00000000000..3ca4c7b639a --- /dev/null +++ b/data/F9/3E/6A/F93E6A4CD77E56ABBB21164B965DB770.xml @@ -0,0 +1,107 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Ruuales Tedersoo +ord. nov. + + + + + +Type +family. + + + +Ruuaceae Tedersoo +. + + + + +Description. + + +Covers the monophyletic group in +Endogonomycetes +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1603424, EUK 1600239, EUK 1600169 and EUK 1600180 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Ruuaceae + +. + + + + \ No newline at end of file diff --git a/data/F9/F1/30/F9F1308FB1A754BA933611364D537E08.xml b/data/F9/F1/30/F9F1308FB1A754BA933611364D537E08.xml new file mode 100644 index 00000000000..6b58eb4b098 --- /dev/null +++ b/data/F9/F1/30/F9F1308FB1A754BA933611364D537E08.xml @@ -0,0 +1,123 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Tammsaareaceae Tedersoo +fam. nov. + + + + + +Type +genus. + + + + +Tammsaarea +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Tammsaareales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1602762, EUK 1635767 and EUK 1602763 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently includes + +Tammsaarea + +and the sequence EUK 1602763 ( +GSMc +plot +G +5835, airfield soil in Ridali, +Estonia +, + +57.93692 ° N +, +26.98099 ° E + +). + + + + \ No newline at end of file