From 3e1103a9598e208f197e538ab9fb88ad6e1b1e61 Mon Sep 17 00:00:00 2001 From: ggserver Date: Wed, 31 Jul 2024 03:05:27 +0000 Subject: [PATCH] Add updates up until 2024-07-31 02:59:22 --- .../87/03DB87BDAA6E3E5AFCD0F8D2FC12F89A.xml | 286 +++++++++++++++++ .../87/03EB87FCFFB0FFD0D18B902449060115.xml | 106 +++++++ .../87/03EB87FCFFB0FFD0D18B922F48E0053F.xml | 90 ++++++ .../87/03EB87FCFFB6FFD7D2629359496400EE.xml | 100 ++++++ .../87/03EB87FCFFB7FFD7D1B593824F83018C.xml | 94 ++++++ .../87/BC7687FC1700812B178EFC4BFC74FB22.xml | 217 +++++++++++++ .../87/BC7687FC1700812C1437FB2DFC52FBF5.xml | 182 +++++++++++ .../87/BC7687FC1701812B17B0FC6AFE9AFC04.xml | 258 +++++++++++++++ .../87/BC7687FC1702812A178EFD48FDDDFCE7.xml | 295 ++++++++++++++++++ .../87/BC7687FC1707812D1459FB7CFD4DF9AA.xml | 249 +++++++++++++++ 10 files changed, 1877 insertions(+) create mode 100644 data/03/DB/87/03DB87BDAA6E3E5AFCD0F8D2FC12F89A.xml create mode 100644 data/03/EB/87/03EB87FCFFB0FFD0D18B902449060115.xml create mode 100644 data/03/EB/87/03EB87FCFFB0FFD0D18B922F48E0053F.xml create mode 100644 data/03/EB/87/03EB87FCFFB6FFD7D2629359496400EE.xml create mode 100644 data/03/EB/87/03EB87FCFFB7FFD7D1B593824F83018C.xml create mode 100644 data/BC/76/87/BC7687FC1700812B178EFC4BFC74FB22.xml create mode 100644 data/BC/76/87/BC7687FC1700812C1437FB2DFC52FBF5.xml create mode 100644 data/BC/76/87/BC7687FC1701812B17B0FC6AFE9AFC04.xml create mode 100644 data/BC/76/87/BC7687FC1702812A178EFD48FDDDFCE7.xml create mode 100644 data/BC/76/87/BC7687FC1707812D1459FB7CFD4DF9AA.xml diff --git a/data/03/DB/87/03DB87BDAA6E3E5AFCD0F8D2FC12F89A.xml b/data/03/DB/87/03DB87BDAA6E3E5AFCD0F8D2FC12F89A.xml new file mode 100644 index 00000000000..9ac16358fa2 --- /dev/null +++ b/data/03/DB/87/03DB87BDAA6E3E5AFCD0F8D2FC12F89A.xml @@ -0,0 +1,286 @@ + + + +New report of Diekeana insignis (Gorham, 1892) (Coleoptera: Coccinellidae: Epilachnini) in South Korea + + + +Author + +Jung, Sang Woo +DASARI Research Institute of BioResources, Daejeon 35203, Republic of Korea + + + +Author + +Kim, Chan Shin and Yoon-Ho + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +240 +243 + + + +journal article +10.12651/JSR.2023.12.3.240 +2713-8615 +13139722 + + + + + + + +Diekeana insignis +( +Gorham, 1892 +) + +( +Figs. 1-9 +) + + + +남ǧṞṪŖṜḏNj + + + + + + +Epilachna insignis +Gorham, 1892: 84 + + +(orig. descr.); + + +Pang +et al. +, 2012: 13 + + +(note). + + + + + + +Epilachna fairmairei +Frivaldszky, 1892: 121 + + +(descr.). + + + + + +Diagnosis. +Adults of + +D. insignis + +can be recognized by the following combination of characters: Body length +9.4 mm +, width +7.8 mm +( +one male +), oval, and strongly convex dorsally, with yellowish pubescence. Dorsum ( +Fig. 1 +) reddish brown with several large black markings. Head ( +Fig. 2 +) reddish brown, concealed under pronotum; clypeus narrow, not projecting in front of eyes; antennae short, as long as head width, with 11 antennomeres; antennomere 1 large and stout; antennomere 2 more or less stout, 1/2 length of antennomere 1; antennomere 3 long and slender; antennomeres 4 and 5 slender, shorter than antennomere 3, equal in length; antennomeres 6-8 shortest, equal in length; antennomeres 9-11 elongate, truncate at apex. Mandibles longer than wide, multidentate (more than three long teeth, with several small teeth in dorsal and apical view). Maxillae ( +Fig. 3 +) large; maxillary palp with four palpomeres; palpomere 1 slender; palpomere 2 longer than wide, more or less stout; palpomere 3 shortest and stout; palpomere 4 broadly securiform. Labial palps slender, with three palpomeres; approximate ratio of palpomeres as 1.0: 3.0: 3.5. Pronotum ( +Fig. 4 +) wider than long, with transverse large black marking in middle part; anterior angle protruding and rounded, posterior area broad and rounded. Scutellum visible, triangular, with fine punctures. Elytra reddish brown, convex dorsally, densely pubescence; each elytron with seven large black markings. Prosternum and hypomeron finely punctate; prosternal process ( +Fig. 5 +) longer than wide, with two carinae, round at apex. Legs short and flattened; femora widened; tibiae slender, tibial spur formula 1-2-2; mid and hind tibiae without carina; tarsal formula 4-4-4; tarsomeres 1 and 2 large, lobed ventrally; tarsomere 3 shortest; tarsomere 4 elongate and cylindrical; tarsal claws long and bifid. Abdomen ( +Fig. 6 +) with six ventrites, wider than long; abdominal postcoxal line incomplete, ending at 1/3 length of abdominal ventrite I, not reaching posterior margin of ventrite; abdominal intercoxal process wide; abdominal ventrites I- VI with punctate; abdominal ventrite V longer than ventrite VI, slightly emarginate in middle part; abdominal ventrite VI ( +Fig. 7 +) narrowest, with densely setae, more or less wide emarginate in middle part. Male genitalia as figured ( +Figs. 8, 9 +). + + + + +Material examined. + +KOREA +: +3♂ +, +Gyeongsangnam-do +, +Changwon-si +, +Masanhappo-gu +, +Gapo-ro +, + +11.vii. 2021 + +, leg. +S.B. Son +& +I.C. Shin + +; + +1♂ +, +Gyeongsangnam-do +, +Geoje-si +, +Dongbu-myeon +, +Osong-ri +, ( +34°47′58.44″N +, +128°35′17.36″ E +, + +24 m +a.s.l. + +), + +3.v.2022 + +, leg. +S.W. Jung +& +Y.H. Kim. + + + + + +Distribution. +Korea +(South), +China +( +Anhui +, +Fujian +, +Guangdong +, +Guangxi +, +Guizhou +, +Hainan +, +Henan +, +Hubei +, +Jiangxi +, +Shaanxi +, +Sichuan +, +Yunnan +). + + + +Mitochondrial DNA (mtDNA) sequence of + +Diekeana insignis + +. + +Total 829 bp (accession number OQ706052) COI showing 99.25% similarity to the reference sequence of the + +Epilachna insignis + +(accession number KP123271.1) + + +from +China +. The partial mitochondrial cytochrome +c +oxidase subunit I (COI) gene sequence is shown in the below: ACATCCGGAAGTTTATATTTTAATTCTTCCT G G AT T T G G A ATA AT T T C T C ATAT TAT TA G C CAAGAAAGAGGGAAAAAAGAAGCTTTTGGCT CATTAGGAATAATTTATGCTATAATAGCAATTG GATTACTAGGATTTGTAGTTTGAGCTCAT CATATATTTACAGTAGGAATAGATGTTGACACTC GAGCTTATTTTACCTCAGCAACAATAATTATTG C A G T T C C TA C T G G TAT TA A A AT T T T T T C AT GATTAGCAACTCTTCATGGAGTTCAATTTA ATTTTAGACCTTCACTTTTTTGAGTTCTAG GATTTTTATTCTTATTTACAATTGGTGGATTA A C A G G A G T T G TAT TA G C A A AT T C AT C TAT T G ATAT TAT T C T T C AT G A C A C ATA C TAT G T T G TA G C T C AT T T T C AT TAT G T T C T T T C A ATA G G GGCCGTTTTTGCAATTATAGCCGGATTTGTC CATTGATTTCCTTTATTTACAGGTTTTAATCT TAACAGAAAACTTTTAAAAATTCAATTTATTG TAATATTTATTGGAGTAAACTTAACTTTTTTC CCTCAACATTTTTTAGGGTTAGCAGGTATAC CCCGACGATATTCTGATTATCCAGATGCTTATTTA ATGTGAAATAAAATTTCCTCTATTGGATCAATA ATTTCTTCTATTAGAATTATTTTTTTTATATTA ATTATTTGAGAAAGATTTTATAGATTCCGTATA A G A AT TATA A G A AT TA G A ATA C C T T C C T TA ATAGAATGATTTCAATTAACTCCTCCAAATGAA CATAGATATTCAGAAATTCCTATACTGTCAATA ATTTTC + + + + +Remarks. +Gorham (1892) +described + +Epilachna insignis + +based on the collection on Mr. Pratt in +China +(Kiu-kiang) as a new species. + +Pang +et al. +(2012) + +reported 20 species of Chinese + +Epilachna +Chevrolat + +including + +E. insignis + +, with digital illustrations of the habitus, male and female genitalia. However, no description or other morphological illustrations were provided. According to +Tomaszewska and Szawaryn (2016) +, some parts of genus + +Epilachna + +, including + +E. insignis + +, have been transferred to the genus + +Diekeana + +based on morphological and molecular characters. We collected +four adult +male specimens from southern part of +south Korea +and provide a detailed diagnosis for the first time herein. The species of + +Diekeana insignis + +can be distinguished by the following morphological characters: pronotum with transverse black marking in middle part, elytra strongly convex with densely pubescence, each elytron with seven large black markings, penis long, slightly bent at apical part, truncate at apex, parameres narrow and as long as penis guide in lateral view, penis guide narrow and pointed at apex. + + + + \ No newline at end of file diff --git a/data/03/EB/87/03EB87FCFFB0FFD0D18B902449060115.xml b/data/03/EB/87/03EB87FCFFB0FFD0D18B902449060115.xml new file mode 100644 index 00000000000..35c8055ab72 --- /dev/null +++ b/data/03/EB/87/03EB87FCFFB0FFD0D18B902449060115.xml @@ -0,0 +1,106 @@ + + + +Isolation and characterization of four unrecorded wild yeasts from the soils of Republic of Korea in winter + + + +Author + +Park, Yuna +Department of Bio & Environmental Technology, College of Natural Science, Seoul Women’s University, Seoul 01797, Republic of Korea + + + +Author + +Srinivasan, Soohyun Maeng and Sathiyaraj + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +197 +202 + + + +journal article +300363 +10.12651/JSR.2023.12.3.197 +0077af3c-0237-4399-a885-39ed9bf75ab2 +2713-8615 +13139710 + + + + + + +Description of + +Holtermanniella wattica +NH + +20 + + + + +Cells are oval shaped and budding is polar ( +Fig. 1 +). Colonies are convex, smooth, and white-colored after 3 days of incubation on YM agar at 10℃. In the API 20C AUX test, strain NH20 is positive for +D- +glucose, calcium, 2-keto-D- gluconate, L- arabinose, D- xylose, inositol, D- sorbitol, +N +-methyl-D- glucoside, D- cellobiose, D- lactose (bovine origin), +D- +maltose, +D- +saccharose (sucrose), +D- +trehalose, and D- raffinose; weak positive for glycerol, adonitol, xylitol, and D- galactose; and negative for +N +-acetyl-D- Glucosamine. + + +Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39(4):783-791. +Kimura, M. 1983. The neutral theory of molecular evolution. Cambridge University Press. +Kumar, S., G. Stecher and K. Tamura. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger data dets. Mol Biol Evol 33(7):1870-1874. + +Kurtzman, C.P. and C.J. Robnett. 1998. Identification and phylogeny of +ascomycetous +yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73(4):331-371. + + + + +Strain NH +20 ( +KCTC 37091 +) was isolated from the soil collected in +Namhansanseong Forest +, +Gwangju + + +City, +Gyeonggi Province +, +Republic of Korea + +. + + + + \ No newline at end of file diff --git a/data/03/EB/87/03EB87FCFFB0FFD0D18B922F48E0053F.xml b/data/03/EB/87/03EB87FCFFB0FFD0D18B922F48E0053F.xml new file mode 100644 index 00000000000..02acb0b6a40 --- /dev/null +++ b/data/03/EB/87/03EB87FCFFB0FFD0D18B922F48E0053F.xml @@ -0,0 +1,90 @@ + + + +Isolation and characterization of four unrecorded wild yeasts from the soils of Republic of Korea in winter + + + +Author + +Park, Yuna +Department of Bio & Environmental Technology, College of Natural Science, Seoul Women’s University, Seoul 01797, Republic of Korea + + + +Author + +Srinivasan, Soohyun Maeng and Sathiyaraj + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +197 +202 + + + +journal article +300363 +10.12651/JSR.2023.12.3.197 +0077af3c-0237-4399-a885-39ed9bf75ab2 +2713-8615 +13139710 + + + + + + +Description of + +Mrakia terrae +YP + +416 + + + + +Cells are oval shaped and budding is polar ( +Fig. 1 +). Colonies are convex, smooth, and orange-colored after 3 days of incubation on YM agar at 10℃. In the API 20C AUX test, strain YP416 is positive for glucose, inulin, sucrose, raffinose, melibiose, galactose, lactose, trehalose, maltose, melezitose, +methyl-D- +glucoside, cellobiose, salicin, +L- +sorbose, D- xylose, L- arabinose, D- ribose, methanol, ethanol, ribitol, xylitol, galactitol, D- mannitol, D- glucitol, D- lactate, succinate, citrate, D- gluconate, gluconolactone, D- glucosamine, +N +- +acetyl-D- +glucosamine, potassium nitrate, sodium nitrate, cadaverine dihydrochloride, and L- lysine; and negative for soluble starch, cellobiose, salicin, L- sorbose, L- rhamnose, D- xylose, L- arabinose, D- arabinose, D- ribose, methanol, ethanol, glycerol, erythritol, ribitol, xylitol, galactitol, D- mannitol, D- glucitol, and myo-Inositol. + + + + + +Strain YP +416 ( +KCTC 27889 +) was isolated from the soil collected in +Pocheon City +, +Gyeonggi Province +, +Republic of Korea + +. + + + + \ No newline at end of file diff --git a/data/03/EB/87/03EB87FCFFB6FFD7D2629359496400EE.xml b/data/03/EB/87/03EB87FCFFB6FFD7D2629359496400EE.xml new file mode 100644 index 00000000000..486a03dd7f3 --- /dev/null +++ b/data/03/EB/87/03EB87FCFFB6FFD7D2629359496400EE.xml @@ -0,0 +1,100 @@ + + + +Isolation and characterization of four unrecorded wild yeasts from the soils of Republic of Korea in winter + + + +Author + +Park, Yuna +Department of Bio & Environmental Technology, College of Natural Science, Seoul Women’s University, Seoul 01797, Republic of Korea + + + +Author + +Srinivasan, Soohyun Maeng and Sathiyaraj + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +197 +202 + + + +journal article +300363 +10.12651/JSR.2023.12.3.197 +0077af3c-0237-4399-a885-39ed9bf75ab2 +2713-8615 +13139710 + + + + + + +Description of + +Buckleyzyma aurantiaca +NH + +33 + + + + +Cells are oval shaped and budding is polar ( +Fig. 1 +). Colonies are convex, smooth, and orange-colored after 3 days of incubation on YM agar at 10℃. In the API 20C AUX test, strain NH33 is positive for L- arabinose, +N +-acetyl-D- glucosamine, D- lactose (bovine origin), D- saccharose (sucrose), +D- +trehalose, +D- +melezitose, and +D- +raffinose; weak positive for glycerol, glucose, 2-keto-D- gluconate, L- arabinose, adonitol, D- galactose, inositol, D- sorbitol, and +N +-methyl-D- glucoside; and negative for D- glucose, D- xylose, +D- +cellobiose, and +D- +maltose. + + + + + +Strain NH +33 ( +KCTC 37082 +) was isolated from the soil collected in +Namhansanseong Forest +, +Gwangju + + +City, +Gyeonggi Province +, +Republic of Korea + +. + + + + \ No newline at end of file diff --git a/data/03/EB/87/03EB87FCFFB7FFD7D1B593824F83018C.xml b/data/03/EB/87/03EB87FCFFB7FFD7D1B593824F83018C.xml new file mode 100644 index 00000000000..e0a33d30c2d --- /dev/null +++ b/data/03/EB/87/03EB87FCFFB7FFD7D1B593824F83018C.xml @@ -0,0 +1,94 @@ + + + +Isolation and characterization of four unrecorded wild yeasts from the soils of Republic of Korea in winter + + + +Author + +Park, Yuna +Department of Bio & Environmental Technology, College of Natural Science, Seoul Women’s University, Seoul 01797, Republic of Korea + + + +Author + +Srinivasan, Soohyun Maeng and Sathiyaraj + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +197 +202 + + + +journal article +300363 +10.12651/JSR.2023.12.3.197 +0077af3c-0237-4399-a885-39ed9bf75ab2 +2713-8615 +13139710 + + + + + + +Description of + +Leucosporidium scottii +NH + +19 + + + + +Cells are oval shaped and budding is polar ( +Fig. 1 +). Colonies are convex, smooth, and beige-colored after 3 days of incubation on YM agar at 10℃. In the API 20C AUX test, strain NH19 is positive for glycerol, 2-keto-D- gluconate, L- arabinose, and adonitol; weak positive for glucose, D- xylose, D- sorbitol, +N +-acetyl-D- glucosamine, D- cellobiose, D- lactose (bovine origin), D- maltose, and +D- +melezitose; and negative for xylitol, +D- +galactose, inositol, +N +-methyl-D- glucoside, D- saccharose (sucrose), D- trehalose, and D- raffinose. + + + + + +Strain NH +19 ( +KCTC 37092 +) was isolated from the soil collected in +Namhansanseong Forest +, +Gwangju + + +City, +Gyeonggi Province +, +Republic of Korea + +. + + + + \ No newline at end of file diff --git a/data/BC/76/87/BC7687FC1700812B178EFC4BFC74FB22.xml b/data/BC/76/87/BC7687FC1700812B178EFC4BFC74FB22.xml new file mode 100644 index 00000000000..a8c048543b4 --- /dev/null +++ b/data/BC/76/87/BC7687FC1700812B178EFC4BFC74FB22.xml @@ -0,0 +1,217 @@ + + + +New record of five Euplotes species (Protozoa, Ciliophora) collected from South Korea + + + +Author + +Yeo, Jeong Hyeon +Department of Biology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea + + + +Author + +Jung, Pablo Quintela-Alonso and Jae-Ho + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +203 +211 + + + +journal article +10.12651/JSR.2023.12.3.203 +2713-8615 +13139732 + + + + + + +3. + +Euplotes octocarinatus +Carter, 1972 + +( +Fig. 3 +) + + + + + + +Material examined. + +Freshwater +collected from ecological reservoir, +Gyeongpo-dong +, +Gangneung-si +, +Gangwondo +, +Korea +( +37°46′57″N +, +128°52′60″E +) on + +July 23, 2020 + + +. + + + + +Diagnosis. +Body size 60.3-79.3 × 32.0-49.9 μm (on average 66.5 × 46.4 μm) after protargol impregnation, shape oval to ellipsoidal, 6 dorsal and 3 ventral ridges; one macronucleus C-shaped with a single small spherical micronucleus attached; 33-36 adoral membranelles; 9 frontoventral, 5 transverse, 2 caudal and 2 marginal cirri; invariably 8 dorsal kineties, of which the middle kinety composed of about 14-19 dikinetids; dorsal argyrome pattern in double- + +patella + +type +. + + + + +Distribution. +Worldwide ( +Carter, 1972 +; + +Méndez-Sánchez +et al. +, 2020 + +). + + + + +Remarks. +The characteristics of the Korean population correspond well with the +type +( +Carter, 1972 +) and Mexican populations ( + +Méndez-Sánchez +et al. +, 2020 + +). + + +Some species with silverline system of double- + +patella + +type +in + +Euplotes + +(i.e., + +E. apsheronicus +Agamaliev, 1966 + +, + +E. patella +( +Müller, 1773 +) Ehrenberg, 1838 + +, + +E. zenkewitchi +Curds, 1975 + +and + +E. elegans +Kahl, 1932 + +) also resemble + +E. octocarinatus + +. However, + +E. apsheronicus + +differs from + +E. octocarinatus + +in the number of dorsal kineties (9 vs. 8) and the habitat (marine vs. freshwater) ( +Curds, 1975 +). + +Euplotes patella + +can be distinguished from + +E. octocarinatus + +by the body size (90-120 × 55-75 vs. 60-79 × 32-50) and the number of dorsal kineties (9 vs. 8) ( + +Foissner +et al. +, 1991 + +). + +Euplotes zenkewitchi + +differs from + +E. octocarinatus + +in the body size (80 × 50 vs. 60-79 × 32-50), the number of adoral membranelles (50-55 vs. 33-36), the number of dorsal kineties (10 vs. 8), and the habitat (marine vs. freshwater) ( +Curds, 1975 +). + +Euplotes elegans + +differs from + +E. octocarinatus + +in the body size (65-118 × 33-63 vs. 60-79 × 30-50), the number of adoral membranelles (47- 64 vs. 33-36), the number of dorsal kineties (9-10 vs. 8), and the habitat (marine vs. freshwater) ( + +Schwarz +et al. +, 2007 + +). + + +Voucher slides. +One slide with protargol-impregnated specimens (NNIBRPR25659) and one slide with wet silver nitrate-impregnated specimens (NNIBRPR25660) were deposited at the Nakdonggang National Institute of Biological Resources. + + + + \ No newline at end of file diff --git a/data/BC/76/87/BC7687FC1700812C1437FB2DFC52FBF5.xml b/data/BC/76/87/BC7687FC1700812C1437FB2DFC52FBF5.xml new file mode 100644 index 00000000000..a16a596d13c --- /dev/null +++ b/data/BC/76/87/BC7687FC1700812C1437FB2DFC52FBF5.xml @@ -0,0 +1,182 @@ + + + +New record of five Euplotes species (Protozoa, Ciliophora) collected from South Korea + + + +Author + +Yeo, Jeong Hyeon +Department of Biology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea + + + +Author + +Jung, Pablo Quintela-Alonso and Jae-Ho + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +203 +211 + + + +journal article +10.12651/JSR.2023.12.3.203 +2713-8615 +13139732 + + + + + + +4. + +Euplotes petzi +Wilbert and Song, 2008 + +( +Fig. 4 +) + + + + + + +Material examined. + +Marine +water (salinity 28‰) collected from +West Sea +, +Janghang-eup +, +Seocheon-gun +, +Chungcheongnam-do +, +Korea +( +36°00′55″N +, +126°39′49″E +) on + +January 21, 2021 + + +. + + + +Fig. 3. + +Euplotes octocarinatus + +in vivo (A, B) and after protargol (C, D) and “wet” silver nitrate impregnation (E). A- D. Ventral (A, C) and dorsal (B, D) views of different specimens showing the infraciliature and nuclear apparatus. E. Dorsal argyrome of double- + +patella + +type. AZM, adoral zone of membranelles; CC, caudal cirri; DK, dorsal kineties; FVC, frontoventral cirri; MC, marginal cirri. Scale bars: 50 μm. + + + +A B C + + + + +Fig. 4. + +Euplotes petzi + +after protargol (A, B) and after “wet” silver nitrate impregnation (C). A, B. Ventral (A) and dorsal (B) view of a representative specimen. Note the narrow separation between the two marginal cirri, a distinctive characteristic of this species. C. Dorsal view showing the argyrome in double- + +patella + +pattern. AZM, adoral zone of membranelles; CC; caudal cirri; DK, dorsal kineties; FVC, frontoventral cirri; MC, marginal cirri. Scale bars: 30 μm. + + + + +Diagnosis. +Body size 38.2-46.2 × 25.3-36.7 μm (on average 42.6 × 29.9 μm) after protargol impregnation, shape ellipsoidal; macronucleus hook-shaped, with one spherical micronucleus attached; 35-45 adoral membranelles; 10 frontoventral, 5 transverse, 2 caudal and 2 marginal cirri; invariably 6 dorsal kineties, of which the middle kinety composed of about 8-10 dikinetids; dorsal argyrome pattern in double- + +patella + +type +. + + + + +Distribution. +King George Island ( +Wilbert and Song, 2008 +) and +Korea +(present study). + + + + +Remarks. +The morphology of the Korean and King George Island populations of + +Euplotes petzi +( +Wilbert and Song, 2008 +) + +is mostly similar except cell size (38-46 × 25-37 μm, and 50-80 × 30-50 μm). A distinctive morphological feature of this species is the narrow separation between the two marginal cirri compared to other + +Euplotes +species. + + +Di Giuseppe +et al. +(2014) + +improved the morphological characterization of + +E. petzi + +and used SSU rDNA gene sequences to relate this species to + +E. sinicus + +Jiang +et al. +, 2010b + + +as the deepest branch at the base of the + +Euplotes + +phylogenetic tree. Moreover, their investigation revealed notable similarities between these two species in terms of the cell size and key characteristics. + + +Voucher slides. +One slide with protargol-impregnated specimens (NNIBRPR25661) and one slide with wet silver nitrate-impregnated specimens (NNIBRPR25662) were deposited at the Nakdonggang National Institute of Biological Resources. + + + + \ No newline at end of file diff --git a/data/BC/76/87/BC7687FC1701812B17B0FC6AFE9AFC04.xml b/data/BC/76/87/BC7687FC1701812B17B0FC6AFE9AFC04.xml new file mode 100644 index 00000000000..58cb4841219 --- /dev/null +++ b/data/BC/76/87/BC7687FC1701812B17B0FC6AFE9AFC04.xml @@ -0,0 +1,258 @@ + + + +New record of five Euplotes species (Protozoa, Ciliophora) collected from South Korea + + + +Author + +Yeo, Jeong Hyeon +Department of Biology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea + + + +Author + +Jung, Pablo Quintela-Alonso and Jae-Ho + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +203 +211 + + + +journal article +10.12651/JSR.2023.12.3.203 +2713-8615 +13139732 + + + + + + +2. + +Euplotes nobilii +Valbonesi and Luporini, 1990 + + + + + + + + +( +Fig. 2 +) + + + + + +Material examined. + +Marine +water (salinity 21‰) collected from +Gyeonpo Lake +, +Jeo-dong +, +Gangneung-si +, +Gangwon-do +, +Korea +( +37°48′6″N +, +128°54′14″E +) on + +July 23, 2020 + + +. + + + + +Diagnosis. +Body size about 29.7-41.7 × 14.9-26.4 μm (on average 33.8 × 20.0 μm) after protargol impregnation, body shape sharp oval, left margin slightly more convex than right margin, 6 dorsal and 3 ventral ridges; one macronucleus C-shaped with one spherical micronucleus attached; 19-29 adoral membranelles; 10 frontoventral, 5 transverse, 2 caudal and 1 marginal cirrus; 7 or 8 dorsal kineties, of which the middle kinety composed of 6-9 dikinetids; dorsal argyrome pattern of double- + +patella + +type +. + + + + +Distribution. +Probably cosmopolitan ( +Greenland +, Tierra del Fuego, Terra Nova, Antarctic Ocean and +Korea +; +Valbonesi and Luporini, 1990a +; + +Di Giuseppe +et al. +, 2013 + +). + + + + +Remarks. +The Korean population corresponds well with the +type +population ( +Valbonesi and Luporini, 1990a +), although one outlier specimen from the Korean population showed a slightly higher number of adoral membranelles (i.e., 29 adoral membranelles) than the +type +population (19-23 vs. 18-22). + + +Compared to other species in the genus, + +E. rariseta + +Curds +et al. +, 1974 + + +highly resembles + +E. nobilii + +, but it differs from the latter by the number of dikinetids in the middle kinety (maximum 6 vs. 6-9) ( + +Curds +et al. +, 1974 + +; +Valbonesi and Luporini, 1990a +). However, the description of the morphometric features of the dorsal kinety of + +E. rariseta + +has experienced some variation since it was originally described, to include variability among populations, i.e., (number of dorsal kineties/number of dikinetids on mid-kinety) 5/maximum 6 ( +Wilbert and Kahan, 1981 +), 6/5-7 ( +Kim and Lee, 2019 +), 7/7 ( + +Dallai +et al. +, 1987 + +), 7/5-7 ( +Song and Packroff, 1997 +; + +Ma +et al. +, 2007 + +), 7/8-10 ( +Valbonesi and Luporini, 1990a +). The Antarctic population reported by +Valbonesi and Luporini (1990a) +might be new to science, as already mentioned by the authors, because it has more adoral membranelles than the others: 28-30 vs. 23 (as seen in the original line drawings of the +type +population in + +Curds +et al. +, 1974 + +), 22±2 ( + +Dallai +et al. +, 1987 + +), 17-21 ( +Song and Packroff, 1997 +), 17-22 ( + +Ma +et al. +, 2007 + +). Unfortunately, phylogenetic analyses based on small subunit ribosomal DNA (SSU rDNA), do not provide enough resolution to discriminate among species of + +Euplotes + +. Thus, + +E. nobilii + +and + +E. rariseta + +(GenBank accession numbers KC599234 and AF492706, respectively) cluster together as almost similar species according to the SSU rDNA phylogeny ( + +Lian +et al. +, 2021 + +). In contrast to the limited resolution provided by the SSU rDNA gene to identify cryptic species, mitochondrial cytochrome +c +oxidase subunit I gene ( +CO1 +) has been proved as a valuable barcode to distinguish among cryptic species with identical SSU rDNA regions ( + +Quintela-Alonso +et al. +, 2013 + +), because it has a distinct ‘barcode gap’ between maximum intra-specific and minimum inter-specific divergences ( + +Park +et al. +, 2019 + +). + + + +Fig. 2. + +Euplotes nobilii + +in vivo (A) and after protargol (B, C) and “wet” silver nitrate impregnation (D). A- C. Ventral (A, B) and dorsal (C) views showing the infraciliature. D. Dorsal view showing the argyrome pattern of double- + +patella + +type. AZM, adoral zone of membranelles; DK, dorsal kineties; FVC, frontoventral cirri; MC, marginal cirri; TC, transverse cirri. Scale bars: 30 μm (A), 20 μm (B- D). + + + +Voucher slides. +One slide with protargol-impregnated specimens (NNIBRPR25657) and one slide with wet silver nitrate-impregnated specimens (NNIBRPR25658) were deposited at the Nakdonggang National Institute of Biological Resources. + + + + \ No newline at end of file diff --git a/data/BC/76/87/BC7687FC1702812A178EFD48FDDDFCE7.xml b/data/BC/76/87/BC7687FC1702812A178EFD48FDDDFCE7.xml new file mode 100644 index 00000000000..1260e0deb14 --- /dev/null +++ b/data/BC/76/87/BC7687FC1702812A178EFD48FDDDFCE7.xml @@ -0,0 +1,295 @@ + + + +New record of five Euplotes species (Protozoa, Ciliophora) collected from South Korea + + + +Author + +Yeo, Jeong Hyeon +Department of Biology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea + + + +Author + +Jung, Pablo Quintela-Alonso and Jae-Ho + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +203 +211 + + + +journal article +10.12651/JSR.2023.12.3.203 +2713-8615 +13139732 + + + + + + +1. + +Euplotes focardii +Valbonesi and Luporini, 1990 + + + + + + + + +( +Fig. 1 +) + + + + + +Material examined. + +Marine +water (salinity 34.9‰, temperature 21℃) collected from +Seobudu +, +Geonib-dong +, +Jeju-si +, +Jeju-do +, +Korea +( +33°31′2″N +, +126°32′3″E +) on + +February 20, 2020 + + +. + + + + +Diagnosis. +Body size 53.9-72.7 × 41.7-58.8 μm (on average 65.1 × 47.1 μm) after protargol impregnation, shape ellipsoidal, 6 dorsal and 3 ventral ridges (shorter ventral ridges between frontoventral cirri are not included); macronucleus C-shaped, with a single small spherical micronucleus attached to it; 49-56 adoral membranelles; 10 frontoventral, 5 transverse, 2 caudal and 2 marginal cirri; 9 or 10 dorsal kineties, of which the middle kinety composed of about 15-20 dikinetids; dorsal argyrome pattern of double- + +eurystomus + +type +. + + + + +Distribution. +Antarctica +( +Valbonesi and Luporini, 1990b +) and +Korea +(present study). + + + + +Remarks. +The Korean population resembles the +type +population except for the dorsal (distinct vs. indistinct) and ventral ridges (3 vs. 2) ( +Valbonesi and Luporini, 1990b +). These populations were collected from marine environments and the other morphometric data correspond each other. The identification of + +E. focardii + +is rather complex due to the strong overlapping of morphometric data among several + +Euplotes +species + +(e.g., body size, adoral membranelles, cirri, dorsal kineties). + +Euplotes focardii + +morphologically resembles + +E. neapolitanus +Wichterman, 1964 + +, + +E. platystoma +Dragesco and Dragesco-Kernéis, 1986 + +and + +E. shanghaiensis + +Song +et al. +, 1998 + + +. + +Euplotes neapolitanus + +differs from + +E. focardii + +by the body size (130-150 × 70-75 μm vs. 38-110 × 30-92 μm), the shape of anterior body end (truncated vs. rounded) and the arrangement of marginal and caudal cirri (evenly distributed vs. a distinct gap between marginal and caudal cirri) ( +Curds, 1975 +; + +Liu +et al. +, 2020 + +). + +Euplotes shanghaiensis + +can be distinguished from + +E. focardii + +by the body shape (D-shaped vs. ellipsoidal), the number of dorsal kineties (12 or 13 vs. 9 or 10) and the habitat (freshwater vs. marine) ( + +Song +et al. +, 1998 + +). + + +Based on the original descriptions, + +E. platystoma + +differs from + +E. focardii + +in the number of dorsal kineties (11 vs. 10), the arrangement of marginal and caudal cirri (evenly distributed vs. a distinct gap between marginal and caudal cirri), and the habitat (brackish water vs. marine) ( +Dragesco and Dragesco-Kernéis, 1986 +; +Valbonesi and Luporini, 1990b +). However, recent descriptions blur the boundary between these two species. For instance, the number of dorsal kineties varies among + +E. platystoma + +populations ( +11 in +the +type +and Shenzhen populations, +13 in +Shanghai +population, and 10 or +11 in +Huizhou population). Regarding the habitat, the +type +population was collected from brackish water, while + +Lian +et al. +(2018) + +sampled two populations from freshwater and brackish water (6‰), respectively. In addition, while +Dragesco and Dragesco-Kernéis (1986) +did not include any information about the dorsal ridges in the +type +population, + +Lian +et al. +(2018) + +and + +Yan +et al. +(2018) + +described the ridges as indistinct or absent, respectively. Interestingly, according to + +Lian +et al. +(2018) + +, the small subunit ribosomal RNA gene sequences of the +Shanghai +population (13 dorsal kineties, brackish water) and Shenzhen population (11 dorsal kineties, freshwater) are identical. Considering the gap between marginal and caudal cirri, it varies among populations (evenly distributed in the Huizhou population vs. a distinct gap in +Shanghai +and Shenzhen populations) ( + +Lian +et al. +, 2018 + +; + +Yan +et al. +, 2018 + +). In conclusion, when considering the features analyzed in both the original and recent redescriptions of + +E. platystoma + +and + +E. focardii + +, the main differences between these two species lie in their habitat preferences (fresh to brackish water vs. marine) and genetic markers (as depicted in the tree by + +Liu +et al. +, 2020 + +, they are clearly distinct from each other). + + + +Fig. 1. + +Euplotes focardii + +in vivo (A) and after protargol (B, C) and “wet” silver nitrate impregnation (D). A- D. Ventral (A, C) and dorsal (B, D) views of two specimens showing the infraciliature and the three ventral and six dorsal ridges. E. Dorsal argyrome in double- + +eurystomus + +pattern. AZM, adoral zone of membranelles; CC; caudal cirri; DK, dorsal kineties; FVC, frontoventral cirri; MC, marginal cirri. Scale bars: 20 μm. + + + +Voucher slides. +One slide with protargol-impregnated specimens (NNIBRPR25655) and one slide with wet silver nitrate-impregnated specimens (NNIBRPR25656) were deposited at the Nakdonggang National Institute of Biological Resources, Sangju, +Republic of Korea +. + + + + \ No newline at end of file diff --git a/data/BC/76/87/BC7687FC1707812D1459FB7CFD4DF9AA.xml b/data/BC/76/87/BC7687FC1707812D1459FB7CFD4DF9AA.xml new file mode 100644 index 00000000000..990b1ed43c9 --- /dev/null +++ b/data/BC/76/87/BC7687FC1707812D1459FB7CFD4DF9AA.xml @@ -0,0 +1,249 @@ + + + +New record of five Euplotes species (Protozoa, Ciliophora) collected from South Korea + + + +Author + +Yeo, Jeong Hyeon +Department of Biology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea + + + +Author + +Jung, Pablo Quintela-Alonso and Jae-Ho + +text + + +Journal of Species Research + + +2023 + +12 + + +3 + + +203 +211 + + + +journal article +10.12651/JSR.2023.12.3.203 +2713-8615 +13139732 + + + + + + +5. + +Euplotes raikovi +Agamaliev, 1966 + +( +Fig. 5 +) + + + + + + +Material examined. + +Marine +water (salinity 34‰, temperature 26℃) collected from +Jongdal +harbor, +Gujwa-eup +, +Jeju-si +, +Jeju-do +, +Korea +( +33°29′48″N +, +126°54′42″E +) on + +August 19, 2020 + + +. + + + + +Diagnosis. +Body size about 35.2-48.0 × 20.0-28.7 μm (on average 40.5 × 24.6 μm) after protargol impregnation, shape oval, 6 dorsal and 3 ventral ridges; macronucleus C-shaped with a single spherical micronucleus attached to it; 27-31 adoral membranelles; 7 frontoventral [note that the reduced, non-ciliated, frontoventral cirrus (basal plaque) is not counted], 5 transverse, 2 caudal cirri and 1 marginal cirrus; 7 or 8 dorsal kineties, of which the middle one is composed of about 9-11 dikinetids; dorsal argyrome pattern of double- + +patella + +type +. + + + + +Distribution. +Cosmopolitan. + + + + +Remarks. +The Korean population of + +E. raikovi + +highly resembles the +type +population ( +Agamaliev, 1966 +) except for the number of dorsal kineties (7 or 8 vs. 6 or 7). Short time after the original description, +Agamaliev (1967) +reported a population with 8 frontoventral cirri (vs. +7 in +the +type +), but + +Jiang +et al. +(2010a) + +considered it as a different form because the basal plaque is very stable among populations ( +Washburn and Borror, 1972 +; + +Miceli +et al. +, 1981 + +; + +Jiang +et al. +, 2010a + +). Additionally, + +Jiang +et al. +(2010a) + +reported 8 kineties. Considering the basal plaque and saline habitat, + +E. raikovi + +is similar to + +E. elegans +Kahl, 1932 + +, + +E. orientalis + +Jiang +et al. +, 2010a + + +, + +E. pseudoraikovi +Alekperov, 2005 + +, and + +E. strelkovi +Agamaliev, 1967 + +. Originally, + +E. raikovi + +had 8 frontoventral cirri, one of which disappeared and remained as a trace, leaving 7 frontoventral cirri. Only two species within the genus + +Euplotes + +have 7 frontoventral cirri, i.e., + +E. raikovi + +and + +E. oropensis +(Fernández-Leboráns and Castro de Zaldumbide, 1986) + +, however, they can be distinguished by the dorsal argyrome pattern, double- + +patella + +in + +E. raikovi + +vs. double- + +eurystomus + +in + +E. oropensis + +. + + + +Fig. 5. + +Euplotes raikovi + +in vivo (A) and after protargol (B, C) and “wet” silver nitrate impregnation (D). A- C. Ventral (A, B) and dorsal (C) views of specimens showing the infraciliature and ventral and dorsal ridges. D. Silverline system on dorsal side of double- + +patella + +type. AZM, adoral zone of membranelles; DK, dorsal kineties; FVC, frontoventral cirrus; MC, marginal cirri. Scale bars: 30 μm. + + + +Voucher slides. +One slide with protargol-impregnated specimens (NNIBRPR25663) and one slide with wet silver nitrate-impregnated specimens (NNIBRPR25664) were deposited at the Nakdonggang National Institute of Biological Resources. + + + +A +KEY + +TO +THE + +SPECIES +OF + + +KOREAN + + + +EUPLOTES + + + + + + \ No newline at end of file