diff --git a/data/24/6A/87/246A879BFFD8FFCCFF42FF077E3142F4.xml b/data/24/6A/87/246A879BFFD8FFCCFF42FF077E3142F4.xml new file mode 100644 index 00000000000..56aa646ff6c --- /dev/null +++ b/data/24/6A/87/246A879BFFD8FFCCFF42FF077E3142F4.xml @@ -0,0 +1,380 @@ + + + +A review of the genus Neoconger (Anguilliformes: Moringuidae), with the description of a new species + + + +Author + +Smith, David G. +Smithsonian Institution, Museum Support Center, MRC- 534, 4210 Silver Hill Road, Suitland, MD 20746, + + + +Author + +Marceniuk, Alexandre P. +Programa de Poìs-Graduac ̧ aÞo em Ecologia e Conservac ̧ aÞo, Universidade Estadual da Paraíba, 58429 - 500, Campina Grande, PB, Brazil. & Centro de Pesquisa e Gestão de Recursos Pesqueiros do Litoral Norte, 66635 - 110, Av. Tancredo Neves, 2501, Belém, PA, Brazil. + + + +Author + +Rotundo, Matheus M. +Acervo Zoológico da Universidade Santa Cecília, 11045 - 907, Santos, SP, Brazil. + + + +Author + +Carvalho, Cintia O. +Universidade Federal do Pará, Centro de Estudos Avançados da Biodiversidade, 66075 - 750, Belém, PA, Brazil. + + + +Author + +Caires, Rodrigo A. +Laboratório de Diversidade, Ecologia e Evolução de Peixes (DEEP Lab), Instituto Oceanográfico da Universidade de São Paulo, 05508 - 120, São Paulo, SP, Brazil. & Museu de Zoologia da Universidade de São Paulo, 04263 - 000, São Paulo, SP, Brazil + +text + + +Zootaxa + + +2024 + +2024-08-02 + + +5492 + + +1 + + +109 +128 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.1.6 + +journal article +10.11646/zootaxa.5492.1.6 +1175-5326 +13212151 +FC66BD60-DD14-435D-B55B-7105CA7DF544 + + + + + + + +Neoconger anaelisae +( +Tommasi, 1960 +) + + + + + + + +( +Figures 5 +, +6 +, +11 +; +Tables 1–5 +) + + + + + + + +Leptocephalus anaelisae +Tommasi, 1960: 93 + + +, fig. 3; off the Amazon region of +Brazil +, +02° 27.5’ N +, +44° 02.5’ W +, +holotype +lost. + +Smith 1989b: 701 + +(synonym of + +Neoconger mucronatus + +). + +Melo & Caires 2016: 2 + +(leptocephali described by Tommasi; synonym of + +Neoconger mucronatus + +). + + + + + + +Neoconger mucronatus, +Smith, 1989a: 60 + + +(in part). + + + + + +Neoconger +sp. + +, + + +Marceniuk +et al +., 2019: 7 + + +, 13, table 1, fig. 4b (listed; photograph). + + +Caires +et al +. 2021: 127 + + +(short description; photograph). + + + + + +FIGURE 5. + +Neoconger anaelisae + +, lectotype, MPEG 38951, freshly caught. + + + + +FIGURE 6. + +Neoconger anaelisae + +, lectotype, MPEG 38951, preserved. + + + + +Study material +( +3 specimens +, +132–254 mm +TL). +HOLOTYPE +(by monotypy, no catalog number given): lost. + +NEOTYPE +(designated here): MPEG 38951 ( +1, 254 mm +TL), +Brazil +, + + +Amapá Prov. +, +03° 44’ 05” N +, +50° 18’ 48” W +, + +58.5 m + +, + +16 Mar 2018 + + +. + +OTHER MATERIAL +: AZUSC 5785 (1, 135), +Brazil +, +Pará Prov. +, +0° 05’ 56” N +, +48° 31’ 10” W +, + +10 m + +, + +09 Aug 2018 + +. +USNM +, 214062 (1, 156), + + +Brazil +, +Pará Prov. +, +1.87° N +, +48.35° W +, + +42–44 m + +, Geomar sta. 156 + +. + + + + +Diagnosis. + +Neoconger anaelisae + +has fewer predorsal vertebrae (32–34) than any of the other Atlantic species (38–48) and overlaps only slightly with + +N. vermiformis + +(34–38). It further differs from + +N. mucronatus + +in total vertebrae (98–104 vs 94–99); from + +N. torrei + +in preanal vertebrae (42–44 vs 48–49) and total vertebrae (98–104 vs 104–107); from + +N. hygomi + +in preanal vertebrae (42–44 vs 55) and total vertebrae (98–104 vs 107); and slightly from + +N. vermiformis + +in total vertebrae (98–104 vs 93–102). The larva has a flatter intestinal loop than the other species; the posterior lateral melanophore is present, but the anterior ventral melanophore is apparently absent (see Notes on Leptocephali below). + + + + +Description. +See genus account for general appearance. Morphometric characters in % TL: preanal 48.7–53.8, predorsal 37.2–39.7, head 10.7–11.1, depth at anus 3.0–3.5. In % HL: snout 19.2–21.7, eye 3.1–4.8, interorbital 13.2–13.7, snout-rictus 34.9–40.8, gill opening 7.5–12.8, interbranchial 12.8–23.5, pectoral fin 14.5–20.2. Meristic characters: lateral-line pores 32–35, predorsal vertebrae 32–34, preanal vertebrae 42–44, precaudal vertebrae 49– 56, total vertebrae 98–104. Mandibular pores as in + +N. mucronatus + +. + +Color of freshly caught specimen gray to reddish brown. + +The largest specimen is +254 mm +TL. + + + + +Distribution. +The +three adult +specimens were collected on the continental shelf off the coast of northern +Brazil +near the mouth of the Amazon River. The +holotype +of + +Leptocephalus anaelisae + +was collected in the same general area but farther offshore ( + +2 +° +27.5’ N + +, +44° 02.5’ W +). +Smith (1989a: 64) +reported that the larvae of this species extend northward to the Guianas and the eastern Caribbean, where they co-occur with larvae of + +Neoconger torrei + +. If this pattern occurs in adults as well, it would be added evidence for the distinction of these two species. + + + + +Remarks. +The description of + +Leptocephalus anaelisae + +is somewhat problematic. The single type specimen is lost, and the reported number of total myomeres (93) is well below the vertebral counts of the adults (98–104). In addition, the specimen is stated to lack a pectoral fin, which is present in all larval + +Neoconger + +. Nevertheless, the illustration clearly shows a + +Neoconger + +larva, and the type locality is close to the area where the +three adult +specimens were collected. We therefore designate one of the adult specimens, MPEG 38951, as the +neotype +and hence fix the name to that specimen. Supporting the morphological diagnosis, the DNA barcoding sequences from + +Neoconger anaelisae + +show that the analyzed specimen has a K2P genetic distance between 4.0% and 23 distinct haplotypes ( +Table 4 +and +Table 5 +) from + +N. torrei + +(see above), corroborating its recognition as a distinct species. + + + + +Etymology. +Named by Tommasi for his daughter, Ana Elisa. + + + + \ No newline at end of file diff --git a/data/24/6A/87/246A879BFFDAFFCBFF42FA857CD84324.xml b/data/24/6A/87/246A879BFFDAFFCBFF42FA857CD84324.xml new file mode 100644 index 00000000000..18bdc910cad --- /dev/null +++ b/data/24/6A/87/246A879BFFDAFFCBFF42FA857CD84324.xml @@ -0,0 +1,1277 @@ + + + +A review of the genus Neoconger (Anguilliformes: Moringuidae), with the description of a new species + + + +Author + +Smith, David G. +Smithsonian Institution, Museum Support Center, MRC- 534, 4210 Silver Hill Road, Suitland, MD 20746, + + + +Author + +Marceniuk, Alexandre P. +Programa de Poìs-Graduac ̧ aÞo em Ecologia e Conservac ̧ aÞo, Universidade Estadual da Paraíba, 58429 - 500, Campina Grande, PB, Brazil. & Centro de Pesquisa e Gestão de Recursos Pesqueiros do Litoral Norte, 66635 - 110, Av. Tancredo Neves, 2501, Belém, PA, Brazil. + + + +Author + +Rotundo, Matheus M. +Acervo Zoológico da Universidade Santa Cecília, 11045 - 907, Santos, SP, Brazil. + + + +Author + +Carvalho, Cintia O. +Universidade Federal do Pará, Centro de Estudos Avançados da Biodiversidade, 66075 - 750, Belém, PA, Brazil. + + + +Author + +Caires, Rodrigo A. +Laboratório de Diversidade, Ecologia e Evolução de Peixes (DEEP Lab), Instituto Oceanográfico da Universidade de São Paulo, 05508 - 120, São Paulo, SP, Brazil. & Museu de Zoologia da Universidade de São Paulo, 04263 - 000, São Paulo, SP, Brazil + +text + + +Zootaxa + + +2024 + +2024-08-02 + + +5492 + + +1 + + +109 +128 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.1.6 + +journal article +10.11646/zootaxa.5492.1.6 +1175-5326 +13212151 +FC66BD60-DD14-435D-B55B-7105CA7DF544 + + + + + + + +Neoconger + +species + + + + + + + + +Neoconger +sp. + + +Smith 1989b: 702 + +. + + +This species is represented only by larvae. The corresponding adult has not been found. Therefore, we refrain from formally describing and naming it. + + + +Study material. + +From +Smith 1989b +. +Dana +1214 (1, 43), +Central Caribbean +, +14° 21’ N +, +76° 50’ W +, + +26 Jan 1922 + +. +University +of the +West Indies +FERP 7374-A-10-11-B (1, 46), + + +Jamaica +. +Dana +1186 (2, 36–37), + + +Virgin Islands +, +17° 58.5’ N +, +64° 41’ W +, + +1 Dec 1921 + +. +Dana +1189 (1), + + +Virgin Islands +, +17° 58.5’ N +, +64° 41’ W +, + +8 Dec 1921 + +. +Dana +1192 (1), + + +Virgin Islands +, +17° 43.4’ N +, +64° 54.3’ W +, + +16 Dec 1921 + +. +Dana +1195 (1, 43), + + +Virgin Islands +, +19° 01’ N +, +65° 23’W +, + +3 Jan 1922 + +. +Dana +1196 (1, 43), + + +Virgin Islands +, +17° 43’ N +, +64° 56’ W +, + +4 Jan 1922 + +. +Dana +1289 (1, 41), + + +Virgin Islands +, +17° 43’ N +, +64° 56’ W +, + +15 Apr 1922 + +. +Dana +1202 (1, 40), + + +Panama +( +Caribbean +), 09° 40’ B, 79° 56’ W, + +10 Jan 1922 + +. +UMML + +, + +Pillsbury +384 (1, 41), +Colombia +( +Caribbean +), +10° 24.2’ N +, +75° 58’ W +, + +15 Jul 1966 + +. +UMML + +, + +Pillsbury +426 (1, 21), +Panama +( +Caribbean +), +09° 48.2’ N +, +79° 18’ W +, + +20 Jul 1966 + +. +ANSP 155452 +(1, 22) + +, + +Yucatan Channel +, +20° 34’ 06” N +, +87° 01’00” W +, + +35–55 m + +, + +8 Nov 1975 + +. +ANSP 155453 +(1, 43) + +, + +Yucatan Channel +, +21°27’12” N +, +86°00’00” W +, + +27–63 m + +, + +8 Nov 1975 + +. +ANSP 155454 +(1, 31) + +, + +Yucatan Channel +, +20°36’18” N +, +87°00’30” W +, + +30 m + +, + +8 Nov 1975 + + +. + + + + +Diagnosis. +This species differs from all the others in lacking the posterior lateral melanophore. It further differs from + +N. torrei + +and + +N. anaelisae + +in lacking the anterior ventral melanophore. In addition, it has more predorsal myomeres than the other species (57–62 vs 39–56). It has more total myomeres on average than the other species (105–110 vs 93–108). It differs from + +N. anaelisae + +in having a sharper intestinal loop. + + + + +TABLE 5. +Nucleotide differences observed in COI sequences among the samples analyzed. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
3691215161819212427303336394245485154576063666972
+Neoconger anaelisae +CAAAACTCTTCCACTTTCCGGCTCAA
+Neoconger torrei +..........................
7578818487909394969799102105108111114117120121123124126129130132135
+Neoconger anaelisae +CCTAAGCGAAACGGTCCACTGGATAA
+Neoconger torrei +........G..T.A............
138141144147150153156159162165168171174177180183184186187189190192195198201204
+Neoconger anaelisae +CTCATGACCAACCACCTACACGACGC
+Neoconger torrei +.....................A....
205207208210211213214216217218219222225226227228229231234237240242243246249252
+Neoconger anaelisae +CACTCACGGCCCAGGCGAACTCCTCA
+Neoconger torrei +.G..T.......G.....G....C..
255258261264267270271273274276277279282283285288291294297300303306309310312313
+Neoconger anaelisae +ATACCACAGCGGCCGATCAACATTAA
+Neoconger torrei +...T.G........A...........
315318321324325327330331333336339340342345348351352354357358360363366369372375
+Neoconger anaelisae +CTCATACCCAGGTACTCAGGTCCCTT
+Neoconger torrei +T.........C...............
378381382383384387390393396399400402403404405406407408411414417420421422423424
+Neoconger anaelisae +ACCTATGGTTGCATCACAATACCCGT
+Neoconger torrei +.......A.C..............C.
426429430432433435436438439441442444445447450453454456457459460462463465466468
+Neoconger anaelisae +ACGATATCGTCTGGACGCCCCTCCCA
+Neoconger torrei +.....G....................
471472474477480481483486489492495498501502504505507510513516519520522525528531
+Neoconger anaelisae +CCCAACGAAGCAACATATCACCACAA
+Neoconger torrei +......A..A.......C.G......
53453553754054354654754955255555856156456556757073576577
+Neoconger anaelisae +TTTCATGACACACCCTGCC
+Neoconger torrei +..........T........
+ + + + +Description (from +Smith 1989b +). + +Total myomeres 105–110, predorsal myomeres 57–62, preanal myomeres 56–63, LVBV 57–60, nephric myomeres 53–57, dorsal-fin rays 140–187, anal-fin rays 136–195. Morphometric characters in %SL: preanal 63–73, predorsal 64–73, head 7–12, greatest depth 21–30. Anterior ventral melanophore and posterior lateral melanophore absent; pigment present only on intestinal loop. Largest specimen +46 mm +SL. + + + + +Distribution. +Known from the Caribbean: +Colombia +, +Panama +, +Virgin Islands +, and Yucatan Channel, where it co-occurs with + +N. torrei + +. + + + + +Remarks. +This larva is known from only +22 specimens +, as opposed to +265 specimens +for the other western Atlantic species ( +Smith 1989b: 702 +, 703). Considering that larvae are much more frequently collected than adults, this suggests that the present species may be less common than the co-occurring + +N. torrei + +, and hence less likely to be collected as adults. + + + + +Etymology. +None. + + + + \ No newline at end of file diff --git a/data/24/6A/87/246A879BFFDFFFC9FF42FACD7E0C407C.xml b/data/24/6A/87/246A879BFFDFFFC9FF42FACD7E0C407C.xml new file mode 100644 index 00000000000..6ff73366af5 --- /dev/null +++ b/data/24/6A/87/246A879BFFDFFFC9FF42FACD7E0C407C.xml @@ -0,0 +1,209 @@ + + + +A review of the genus Neoconger (Anguilliformes: Moringuidae), with the description of a new species + + + +Author + +Smith, David G. +Smithsonian Institution, Museum Support Center, MRC- 534, 4210 Silver Hill Road, Suitland, MD 20746, + + + +Author + +Marceniuk, Alexandre P. +Programa de Poìs-Graduac ̧ aÞo em Ecologia e Conservac ̧ aÞo, Universidade Estadual da Paraíba, 58429 - 500, Campina Grande, PB, Brazil. & Centro de Pesquisa e Gestão de Recursos Pesqueiros do Litoral Norte, 66635 - 110, Av. Tancredo Neves, 2501, Belém, PA, Brazil. + + + +Author + +Rotundo, Matheus M. +Acervo Zoológico da Universidade Santa Cecília, 11045 - 907, Santos, SP, Brazil. + + + +Author + +Carvalho, Cintia O. +Universidade Federal do Pará, Centro de Estudos Avançados da Biodiversidade, 66075 - 750, Belém, PA, Brazil. + + + +Author + +Caires, Rodrigo A. +Laboratório de Diversidade, Ecologia e Evolução de Peixes (DEEP Lab), Instituto Oceanográfico da Universidade de São Paulo, 05508 - 120, São Paulo, SP, Brazil. & Museu de Zoologia da Universidade de São Paulo, 04263 - 000, São Paulo, SP, Brazil + +text + + +Zootaxa + + +2024 + +2024-08-02 + + +5492 + + +1 + + +109 +128 + + + + +http://dx.doi.org/10.11646/zootaxa.5492.1.6 + +journal article +10.11646/zootaxa.5492.1.6 +1175-5326 +13212151 +FC66BD60-DD14-435D-B55B-7105CA7DF544 + + + + + + + +Neoconger tuberculatus +( +Castle, 1965 +) + + + + + + + +( +Figure 12 +; +Table 3 +) + + + + + + + +Leptocephalus tuberculatus + +Castle, 1965: 131 + + + +, fig. 1 F–H; +Manly Beach +, +Sydney +, +New South Wales +, +Australia +, coll. 1907; +32.7 mm +TL (“type”) and +33.5 mm +(“ +paratype +”) AMS IA. 2477. + + + + + +Diagnosis. +Based on the available information ( +Castle 1965 +; +Smith 1989b +), the larva of + +Neoconger tuberculatus + +has fewer preanal myomeres (46–48) than any of the Atlantic species (49–60). It further differs from + +N. torrei + +in lacking the anterior ventral melanophore (vs present); from + +N. anaelisae + +in having a sharper intestinal loop and lacking the anterior ventral melanophore (vs present). It differs from + +Neoconger +species + +in having the posterior lateral melanophore (vs absent) and fewer LVBV myomeres (51–53 vs 57–60). It differs from + +N. vermiformis + +in lacking the anterior ventral melanophore (vs present). + + + + +Description +(from +Castle 1965 +). Intestinal loop sharp, anterior ventral melanophore absent, posterior lateral melanophore present. Predorsal myomeres 53–54, preanal myomeres 46–48, LVBV 51–53, total myomeres 100– 101, dorsal-fin rays 180–182, anal-fin rays 147–165. + + + + +Distribution. +Coast of +New South Wales +near Sydney, +Australia +. + + + + +Remarks. +This species was described from two larval specimens collected in 1907 at Manly Beach near Sydney in southeastern +Australia +. It has not been reported since, and no adult specimens of + +Neoconger + +are known from the area, or anywhere in the Indo-West Pacific. + + +Smith & Castle (1972: 245) +briefly reported finding +two specimens +of larval + +Neoconger + +in the ZMUC that were collected in 1893 and were originally from the Godefroy Museum in +Hamburg +, +Germany +. The locality was given only as “Sydhavet” (South Sea). Total myomeres were given as 99 and 100 myomeres, close to the values in + +N. tuberculatus + +. No further information is available, but it is one additional piece of evidence for + +Neoconger + +in the Indo-Pacific, assuming that Sydhavet does refer to that ocean. + + + + \ No newline at end of file