diff --git a/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml b/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml index 43846b6bf9d..25ce2d495d4 100644 --- a/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml +++ b/data/0E/F3/02/0EF302DDBD47544EA9A2605C87529DC0.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Moostea based on the - -ITS - -region (positions 68–97 gcagatgatcgtgagggagttctcttcttc; one mismatch allowed) and -LSU -(positions 436–455 tgggcttctgctccggcgta; one mismatch allowed) as indicated in Fig. +ITS +region (positions 68–97 gcagatgatcgtgagggagttctcttcttc; one mismatch allowed) and LSU (positions 436–455 tgggcttctgctccggcgta; one mismatch allowed) as indicated in Fig. 11 . @@ -100,33 +96,40 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 128417 ( +sample +TUE 128417 +( holotype ); eDNA -sequence EUK 1604044 ( +sequence +EUK 1604044 +( lectotype ); GSMc -plot -G -5828, +plot G 5828, + Malus domestica -orchard (soil sample TUE 028417) in Mooste, +orchard + +(soil sample +TUE 028417 +) in +Mooste +, Estonia , @@ -134,6 +137,7 @@ orchard (soil sample TUE 028417) in Mooste, , 27.19642 ° E + . @@ -142,15 +146,9 @@ orchard (soil sample TUE 028417) in Mooste, Description. -Other sequences: EUK 1600287 ( -LSU -: -type -locality); EUK 1604043 and EUK 1603823 (both +Other sequences: EUK 1600287 (LSU: type locality); EUK 1604043 and EUK 1603823 (both GSMc -plot -G -5835, airfield soil in Ridali, +plot G 5835, airfield soil in Ridali, Estonia , @@ -167,13 +165,9 @@ plot Mooste -(Estonian) refers to -type -locality; and +(Estonian) refers to type locality; and Stephanie -(English) refers to the first name of Stephanie -A -. Eichorst who collected the first materials from the respective family. +(English) refers to the first name of Stephanie A. Eichorst who collected the first materials from the respective family. @@ -184,12 +178,8 @@ locality; and Found in two sites in Estonia , with - -ITS - -and -LSU -sequences displaying up to 1 % and 0.3 % differences, respectively. +ITS +and LSU sequences displaying up to 1 % and 0.3 % differences, respectively. diff --git a/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml b/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml index 795897bce9d..596a39ae2b6 100644 --- a/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml +++ b/data/20/25/C7/2025C7196EB25F8882D3678705158197.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,14 +76,8 @@ Separation from other species of Hoforsa based on the - -ITS - -region ( -ITS -2 positions 108–127 ggratcycccgaggtgtgaaac; one mismatch allowed) and -LSU -(positions 546–565 ctcctggtgctctcacccgt; no mismatch allowed) as indicated in Fig. +ITS +region (ITS 2 positions 108–127 ggratcycccgaggtgtgaaac; one mismatch allowed) and LSU (positions 546–565 ctcctggtgctctcacccgt; no mismatch allowed) as indicated in Fig. 4 . @@ -102,29 +96,36 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample: TUE 128830 ( +sample: +TUE 128830 +( holotype ); eDNA -sequence EUK 1100001 ( +sequence +EUK 1100001 +( lectotype ); + Pinus sylvestris -forest near Hofors, +forest + +near +Hofors +, Sweden ( @@ -132,7 +133,9 @@ forest near Hofors, , 16.30 ° E -). +) + +. @@ -140,13 +143,8 @@ forest near Hofors, Description. -Other sequences: EUK 1104560 ( -type -locality); - -OU -004104 - +Other sequences: EUK 1104560 (type locality); +OU 004104 (San Francisco, Ecuador , root sample); and @@ -166,9 +164,7 @@ and Hofors -(Swedish) refers to -type -locality; and +(Swedish) refers to type locality; and Rebekka (Scotch) refers to the first name Rebekka Artz who was the first to collect materials from this genus. @@ -179,12 +175,8 @@ locality; and Found from three sites across three continents, with - -ITS - -sequences differing up to 3.5 % and -LSU -sequences up to 0.5 %. +ITS +sequences differing up to 3.5 % and LSU sequences up to 0.5 %. diff --git a/data/3E/F8/9F/3EF89F07323756C3AB4B37AEDC4F9360.xml b/data/3E/F8/9F/3EF89F07323756C3AB4B37AEDC4F9360.xml new file mode 100644 index 00000000000..6cb70474da4 --- /dev/null +++ b/data/3E/F8/9F/3EF89F07323756C3AB4B37AEDC4F9360.xml @@ -0,0 +1,189 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Pseudoentrophospora kesseensis +Tedersoo & Magurno + +sp. nov. + + + + +Diagnosis. + + +Differs from other species of + +Pseudoentrophospora + +and + +Entrophospora + +based on the +ITS +region (ITS 2 positions 127–146 gaaccgcaaattacgcatta, one mismatch allowed) and LSU (positions 486–515 gaacaggtcaacatcaattcttattgccat, one mismatch allowed) as indicated in Fig. +3 +. + + + + + + +Diagnostic barcodes for + +Pseudoentrophospora kesseensis + +relative to closely-related taxa in ITS 2 and LSU. + + + + + +Type. + + + +Soil +eDNA +sample +TUE 101916 +( + +holotype + +); +eDNA +sequence +EUK 1631429 +( + +lectotype + +); +GSMc +plot G 4940, + +coppiced + +Juniperus + +- + +Acer + +woodland + +(soil sample +TUE 001916 +) in +Kesse Island +, +Estonia +, + +58.63443 ° N +, +23.43938 ° E + + +. + + + + +Description. + + +Other +eDNA +sequences EUK 1636430 – EUK 1636432 from the type locality. + + + + +Etymology. + + +pseudo +(Greek) = false; +Entrophospora +(Latin) refers to a related fungal genus; and +kesseensis +(Latin) indicates locality of the type species. The name depicts phylogenetic relatedness to +Entrophosphora +and the only locality where the type species has been recorded. + + + + +Notes. + + +Found from a single site, with +ITS +and LSU sequences differing up to 0.5 % and 1 %, respectively. The ITS 1 subregion harbours only 58 bases, being amongst the shortest across fungi (excl. microsporidians). + + + + \ No newline at end of file diff --git a/data/40/E1/47/40E147F5E4AD52189307DE6B082407FB.xml b/data/40/E1/47/40E147F5E4AD52189307DE6B082407FB.xml new file mode 100644 index 00000000000..c92bb7ca58d --- /dev/null +++ b/data/40/E1/47/40E147F5E4AD52189307DE6B082407FB.xml @@ -0,0 +1,163 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Viscospora deserticola +(Trappe, Bloss & J. A. Menge) Tedersoo & Magurno + +comb. nov. + + + + + + + +Glomus deserticola +Trappe, Bloss & J. A. Menge + +, Mycotaxon 20 (1): 123 (1984) + +. Basionym. + + + + + + +Blaszkowskia deserticola +(Trappe, Bloss & J. A. Menge) Oehl & G. A. Silva + +, Mycol. Progr. 22 (11, no. 74): 5 (2023). Synonym. + + + + + + +Description. + + +See +Trappe et al. (1984) +. + + + + +Diagnosis. + + +Subtending hyphae pigmented over long distances (> 100 μm) unlike in other species of + +Viscospora + +and + +Septoglomus + +. Differs from other species of + +Viscospora + +by spore colour ( +da Silva et al. 2023 +). + + + + +Notes. + + +Transferred from + +Blaszkowskia + +to + +Viscospora + +because of phylogenetic nestedness within + +Viscospora + +and recognition as a separate genus would render + +Viscospora + +paraphyletic and leave many orphan taxa in the + +Septoglomus + +- + +Viscospora + +clade (Suppl. material +1 +; +da Silva et al. (2023) +). + + + + \ No newline at end of file diff --git a/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml b/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml index 42f2e2048e1..3b070610a53 100644 --- a/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml +++ b/data/4E/91/B0/4E91B05A4FD25067B51FB76F2A2DE7F7.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,14 +76,8 @@ separation from other species of Kungsaengena based on the - -ITS - -region ( -ITS -2 positions 25–44 tgggaacccatttcgtcgga; one mismatch allowed) and -LSU -(positions 665–694 cgttggggctgggacgcccgtcgctcgcac; one mismatch allowed) as indicated in Fig. +ITS +region (ITS 2 positions 25–44 tgggaacccatttcgtcgga; one mismatch allowed) and LSU (positions 665–694 cgttggggctgggacgcccgtcgctcgcac; one mismatch allowed) as indicated in Fig. 7 . @@ -102,28 +96,34 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + eDNA -sample TUE 128324 ( +sample +TUE 128324 +( holotype ); eDNA -sequence EUK 1603402 ( +sequence +EUK 1603402 +( lectotype ); GSMc -plot -G -5763, wet grassland (soil sample TUE 028324) in Haage, +plot G 5763, +wet grassland +(soil sample +TUE 028324 +) in +Haage +, Estonia , @@ -131,7 +131,9 @@ plot , 26.61277 ° E -). +) + +. @@ -141,9 +143,7 @@ plot other sequences: EUK 1604022 ( GSMc -plot -G -5906, football field soil in Karksi-Nuia, +plot G 5906, football field soil in Karksi-Nuia, Estonia , @@ -153,9 +153,7 @@ plot ); EUK 1604023 ( GSMc -plot -G -5844, wet pasture soil in Tuhala, +plot G 5844, wet pasture soil in Tuhala, Estonia , @@ -165,9 +163,7 @@ plot ); EUK 1604025 ( GSMc -plot -G -4444, +plot G 4444, Estonia , mixed forest soil in Altnurga, Estonia @@ -178,10 +174,7 @@ plot 26.28321 ° E ); and - -OU -942286 - +OU 942286 (grassland soil in Kungsängen, Sweden , @@ -201,13 +194,9 @@ plot Kungsängen -(Swedish) refers to -type -locality; and +(Swedish) refers to type locality; and Shadi -(Persian) refers to the first name of Shadi Eshghi Sahraei who analysed materials collected from the -type -locality. +(Persian) refers to the first name of Shadi Eshghi Sahraei who analysed materials collected from the type locality. @@ -218,22 +207,14 @@ locality. Found from the Baltic States and Sweden , with - -ITS - -and -LSU -sequences differing up to 15 % and 1 %, respectively. The - -ITS - +ITS +and LSU sequences differing up to 15 % and 1 %, respectively. The +ITS region is infested with microsatellite-like regions and homopolymers, and many sequence variants have long deletions in multiple positions. K. shadiae -seems to be generalist in terms of habitat -type -. +seems to be generalist in terms of habitat type. diff --git a/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml b/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml index 9aff5fe665b..75ea14c3ec3 100644 --- a/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml +++ b/data/54/0E/E3/540EE31A230A5EA2B48A7CBFA29997CF.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Langduoa based on the - -ITS - -region (positions 87–106 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and -LSU -(positions 617–636 ccctctcggggggctgggga; no mismatch allowed) as indicated in Fig. +ITS +region (positions 87–106 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 617–636 ccctctcggggggctgggga; no mismatch allowed) as indicated in Fig. 8 . @@ -100,25 +96,31 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 128827 ( +sample +TUE 128827 +( holotype ); eDNA -sequence: EUK 1107335 ( +sequence: +EUK 1107335 +( lectotype -); montane grassland in Langduo, +); +montane grassland +in +Langduo +, Tibet , @@ -126,6 +128,7 @@ sequence: EUK 1107335 ( , 94.4 ° E + . @@ -136,9 +139,7 @@ sequence: EUK 1107335 ( Other sequences: EUK 1602727 and EUK 1602728 (both from GSMc -plot -G -5906, stadium grassland soil in Karksi-Nuia, +plot G 5906, stadium grassland soil in Karksi-Nuia, Estonia , @@ -148,9 +149,7 @@ plot ); EUK 1604031 ( GSMc -plot -G -4185, +plot G 4185, Picea - @@ -166,9 +165,7 @@ forest soil in Ristipalo, ); and EUK 1604032 ( GSMc -plot -G -4766, soil of coppiced garden dominated by +plot G 4766, soil of coppiced garden dominated by Fraxinus @@ -193,9 +190,7 @@ in Ruudiküla, Langduo -(Tibetan) refers to -type -locality; and +(Tibetan) refers to type locality; and Diana (Lithuanian) refers to the first name of Diana Marčiulynienė who was the first to record this genus. @@ -208,12 +203,8 @@ locality; and Found from grassland soils in Estonia and Tibet, with - -ITS - -and -LSU -sequences differing up to 0.2 %. So far, not found from the roots. +ITS +and LSU sequences differing up to 0.2 %. So far, not found from the roots. diff --git a/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml b/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml index bb3da2d56ff..3cdc2b62877 100644 --- a/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml +++ b/data/5A/06/ED/5A06EDBE08CB5D3EBC1C68891B139752.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -78,12 +78,8 @@ Separation from other species of and other species of Endogonomycetes based on - -ITS - -(positions 228–257 ggaccgagaaggcgcaatagttgaacaatt; one mismatch allowed) and -LSU -(positions 585–604 ataactatcggacaaagttt; one mismatch allowed) as indicated in Fig. +ITS +(positions 228–257 ggaccgagaaggcgcaatagttgaacaatt; one mismatch allowed) and LSU (positions 585–604 ataactatcggacaaagttt; one mismatch allowed) as indicated in Fig. 16 . @@ -102,33 +98,40 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + eDNA -sample TUE 100731 ( +sample +TUE 100731 +( holotype ); eDNA -sequence EUK 1602762 ( +sequence +EUK 1602762 +( lectotype ); GSMc -plot -G -4189, +plot G 4189, + Populus tremula -forest (soil sample TUE 000731) in -Tammsaare +forest + +(soil sample +TUE 000731 +) in + +Tammsaare + , Estonia , @@ -137,6 +140,7 @@ forest (soil sample TUE 000731) in , 27.20141 ° E + . @@ -144,11 +148,7 @@ forest (soil sample TUE 000731) in Description. - -Other sequences EUK 1604048 and EUK 1604049 ( -type -locality). - +Other sequences EUK 1604048 and EUK 1604049 (type locality). @@ -156,13 +156,9 @@ locality). Tammsaare -(Estonian) refers to the -type -locality and one of the most famous Estonian writers, Anton Hansen Tammsaare; and +(Estonian) refers to the type locality and one of the most famous Estonian writers, Anton Hansen Tammsaare; and Vivika -(Estonian) refers to the first name of Vivika Adamson who provided access to the -type -locality. +(Estonian) refers to the first name of Vivika Adamson who provided access to the type locality. @@ -173,12 +169,8 @@ locality. Found from a single locality in Estonia , with - -ITS - -and -LSU -sequences differing up to 0.5 % and 0.3 %, respectively. +ITS +and LSU sequences differing up to 0.5 % and 0.3 %, respectively. diff --git a/data/64/AF/15/64AF15C7631D5EF7B44CD219A627DB40.xml b/data/64/AF/15/64AF15C7631D5EF7B44CD219A627DB40.xml new file mode 100644 index 00000000000..69122119f88 --- /dev/null +++ b/data/64/AF/15/64AF15C7631D5EF7B44CD219A627DB40.xml @@ -0,0 +1,136 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Diversispora nevadensis +(Palenz., N. Ferrol, Azcón-Aguilar & Oehl) Tedersoo & Magurno + +comb. nov. + + + + + + +Entrophospora nevadensis + +Palenz., N. Ferrol, Azcón-Aguilar & Oehl, in + + +Palenzuela, Barea, Ferrol & Azcón-Aguilar, +Mycologia 102 (3): 627 (2010) + + +. Basionym. + + + + + + + +Description. + + +See +Palenzuela et al. (2010) +. + + + + +Diagnosis. + + + +Diversispora nevadensis + +differs from other species of the + +Diversispora + +by producing entrophosporoid (tricisporoid) spores compared with diversisporoid and acaulosporoid (otosporoid) spores in other species. Glomerospores with inner flexible hyaline wall layers without granular beaded surface and no Melzer reaction. Phylogenetically nested in + +Diversispora + +based on the SSU- +ITS +- LSU phylogram (Fig. +1 +, Suppl. material +1 +). + + + + +Notes. + + +The new combination invites an amendment of the genus + +Diversispora + +to accommodate species with entrophosporoid (tricisporoid) spores. + + + + \ No newline at end of file diff --git a/data/76/66/44/7666441803815937993CE8A1D5B82667.xml b/data/76/66/44/7666441803815937993CE8A1D5B82667.xml index f379e7bfe59..f3960160758 100644 --- a/data/76/66/44/7666441803815937993CE8A1D5B82667.xml +++ b/data/76/66/44/7666441803815937993CE8A1D5B82667.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,14 +76,10 @@ Separation from other species of Lokruma based on the - -ITS - +ITS region (positions 159–178 taacttaattttttcccgag; one mismatch allowed) as shown in Fig. 10 -. There are no short barcodes in the first 700 bp of -LSU -that allow distinguishing +. There are no short barcodes in the first 700 bp of LSU that allow distinguishing L. stenii @@ -104,31 +100,38 @@ relative to closely-related taxa in ITS 2. - -Type -. - +Type. + Soil eDNA -sample TUE 103193 ( +sample +TUE 103193 +( holotype -); type sequence EUK 1203766 ( +); type sequence +EUK 1203766 +( lectotype ); GSMc -plot -S -689, +plot S 689, + Pinus halepensis -forest (soil sample TUE 003193) in Lokrum, +forest + +(soil sample +TUE 003193 +) in +Lokrum +, Croatia , @@ -136,6 +139,7 @@ forest (soil sample TUE 003193) in Lokrum, , 18.1241 ° E + . @@ -146,9 +150,7 @@ forest (soil sample TUE 003193) in Lokrum, Other sequences: EUK 1603283 ( GSMc -plot -G -4301, +plot G 4301, Betula pendula @@ -162,9 +164,7 @@ forest soil in Männamaa, ); EUK 1604041 ( GSMc -plot -S -480, +plot S 480, Populus - @@ -180,9 +180,7 @@ forest soil in Käru, ); EUK 1604042 ( GSMc -plot -G -4734, +plot G 4734, Populus - Alnus @@ -195,13 +193,9 @@ forest soil in Urissaare, , 24.65739 ° E -); and EUK 1600039 ( -LSU -: +); and EUK 1600039 (LSU: GSMc -plot -HB -19, +plot HB 19, Populus x wettsteinii @@ -223,13 +217,9 @@ forest plantation soil, Oja, Lokrum -(Serbo-Croatian) refers to -type -locality; and +(Serbo-Croatian) refers to type locality; and Sten -(Estonian) refers to the first name of Sten Anslan who collected the materials from the -type -locality. +(Estonian) refers to the first name of Sten Anslan who collected the materials from the type locality. @@ -242,12 +232,8 @@ Found in and Estonia , with - -ITS - -and -LSU -sequences displaying up to 1 % of differences. +ITS +and LSU sequences displaying up to 1 % of differences. diff --git a/data/79/9A/EC/799AECC1553650BB8D371A618B2DA4F8.xml b/data/79/9A/EC/799AECC1553650BB8D371A618B2DA4F8.xml new file mode 100644 index 00000000000..a43d7885923 --- /dev/null +++ b/data/79/9A/EC/799AECC1553650BB8D371A618B2DA4F8.xml @@ -0,0 +1,137 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Pseudoentrophospora +Tedersoo & Magurno + +gen. nov. + + + + +Type species. + + + +Pseudoentrophospora kesseensis +Tedersoo & Magurno. + + + + + +Description. + + +Covers the monophyletic group in +Pseudoentrophosporaceae +(Fig. +1 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1631429, EUK 1105140 and EUK 0135500 (Suppl. material +1 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. There are potentially 3–6 species in + +Pseudoentrophospora + +based on +ITS +sequences, some of which are represented by sequences EUK 1105140 (tropical rainforest soil in El Yunque, +Puerto Rico +, + +18.29 ° N +, - +65.78 ° E + +); EUK 1010525 ( +GSMc +plot S 056, tropical rainforest soil in Pegaima Mountains, +Guyana +, + +5.43567 ° N +, - +60.08825 ° E + +); and EUK 0133825 (flooded grassland soil in Dijle, +Belgium +, + +5.83 ° N +, +4.65 ° E + +). + + + + \ No newline at end of file diff --git a/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml b/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml index eefbe2529cf..b9a1ebc7a87 100644 --- a/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml +++ b/data/85/7D/C2/857DC24241B55BCD9ACAB042FC3E784D.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Ruua based on the - -ITS - -region (positions 217–243 gaaaaaaaaagaaaggaaagaaaaggt; one mismatch allowed) and -LSU -(positions 470–489 tagtgcacttgctttcgcac; no mismatch allowed) as indicated in Fig. +ITS +region (positions 217–243 gaaaaaaaaagaaaggaaagaaaaggt; one mismatch allowed) and LSU (positions 470–489 tagtgcacttgctttcgcac; no mismatch allowed) as indicated in Fig. 15 . @@ -100,28 +96,35 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + eDNA -sample TUE 101598 ( +sample +TUE 101598 +( holotype ); eDNA -sequence EUK 1603424; +sequence +EUK 1603424 +; GSMc -plot -G -4464, +plot G 4464, + Quercus robur -forest (soil sample TUE 101598) in Ruu, +forest + +(soil sample +TUE 101598 +) in +Ruu +, Estonia , @@ -129,6 +132,7 @@ forest (soil sample TUE 101598) in Ruu, , 25.22166 ° E + . @@ -137,13 +141,9 @@ forest (soil sample TUE 101598) in Ruu, Description. -Other sequences: EUK 1602853 and EUK 1600135 ( -type -locality); EUK 1604050 ( +Other sequences: EUK 1602853 and EUK 1600135 (type locality); EUK 1604050 ( GSMc -plot -G -5002, +plot G 5002, Tilia - @@ -159,9 +159,7 @@ forest soil in Naissaar, ); and EUK 1604051 ( GSMc -plot -S -480, +plot S 480, Populus - @@ -184,9 +182,7 @@ forest soil in Käru, Ruu -(Estonian) refers to -type -locality; and +(Estonian) refers to type locality; and Coralie (French) refers to the first name of Coralie Damon, who collected the first materials belonging to this genus. @@ -199,12 +195,8 @@ locality; and Found from three sites in Estonia , with - -ITS - -and -LSU -sequences displaying up to 0.3 % differences. +ITS +and LSU sequences displaying up to 0.3 % differences. diff --git a/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml b/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml index 7219cba0723..38733f86837 100644 --- a/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml +++ b/data/89/C1/02/89C10250C79954E997E2E2AAFE6E3EF9.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,16 +76,12 @@ Separation from other species of Unemaeea based on the - -ITS - +ITS region ( 5.8 S positions 122–151 gtcagtgtttgccacggagtatgccggctt; no mismatch allowed) and from other species of Endogonomycetes -based on -LSU -(positions 694–723 gggcttgtcatggcagagggacacgtcgta; no mismatch allowed) as indicated in Fig. +based on LSU (positions 694–723 gggcttgtcatggcagagggacacgtcgta; no mismatch allowed) as indicated in Fig. 17 . @@ -104,29 +100,35 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 100213 ( +sample +TUE 100213 +( holotype ); eDNA -sequence EUK 1630871 ( +sequence +EUK 1630871 +( lectotype ); GSMc -plot -G -3318, marshland (soil sample TUE 000213) in Unemäe, +plot G 3318, +marshland +(soil sample +TUE 000213 +) in +Unemäe +, Estonia , @@ -134,6 +136,7 @@ plot , 22.46296 ° E + . @@ -142,11 +145,7 @@ plot Description. -Other sequences: EUK 1635887 – EUK 1635890 ( -type -locality) and EUK 1213720 (FunAqua sample -W -0581 s, river sediment in Floresti, +Other sequences: EUK 1635887 – EUK 1635890 (type locality) and EUK 1213720 (FunAqua sample W 0581 s, river sediment in Floresti, Romania , @@ -163,15 +162,9 @@ locality) and EUK 1213720 (FunAqua sample Unemäe -(Estonian) refers to the -type -locality; and +(Estonian) refers to the type locality; and Nathalie -(English) refers to the first name of Nathalie -J -. -A -. Curlevski who collected the first materials belonging to this genus. +(English) refers to the first name of Nathalie J. A. Curlevski who collected the first materials belonging to this genus. @@ -181,26 +174,20 @@ locality; and The end of 5.8 S -and start of -LSU -are strongly diverged compared with other species of +and start of LSU are strongly diverged compared with other species of Unemaeea and Endogonomycetes -. As no other confamilial -LSU -sequences are available, the diagnostic positions are compared against the most divergent, unalignable part across +. As no other confamilial LSU sequences are available, the diagnostic positions are compared against the most divergent, unalignable part across Endogonomycetes . Found in anoxic soil in Estonia and Romania , with - -ITS - +ITS sequences displaying up to 4 % differences. diff --git a/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml b/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml index 39db3ae83dc..d086b562179 100644 --- a/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml +++ b/data/9E/7F/08/9E7F08B84B5F5D4AA6FDE53BEF71D3D8.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,14 +76,8 @@ Separation from other species of Riederberga based on the - -ITS - -region ( -ITS -2 positions 186–215 gctttggacggcatgcgaatctgcatcaca; one mismatch allowed) and -LSU -(positions 656–685 tcaccaatcgacgtcaatcggcatgcgtct; one mismatch allowed) as indicated in Fig. +ITS +region (ITS 2 positions 186–215 gctttggacggcatgcgaatctgcatcaca; one mismatch allowed) and LSU (positions 656–685 tcaccaatcgacgtcaatcggcatgcgtct; one mismatch allowed) as indicated in Fig. 14 . @@ -102,29 +96,35 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 128372 ( +sample +TUE 128372 +( holotype ); eDNA -sequence: EUK 1602903 ( +sequence: +EUK 1602903 +( lectotype ); GSMc -plot -G -5783, wet grassland (soil sample TUE 028372) in Altnurga, +plot G 5783, +wet grassland +(soil sample +TUE 028372 +) in +Altnurga +, Estonia , @@ -132,6 +132,7 @@ plot , 26.29259 ° E + . @@ -140,17 +141,10 @@ plot Description. -Other sequences: EUK 1604046 and EUK 1604047 (both -type -locality); and - -GU -055683 - +Other sequences: EUK 1604046 and EUK 1604047 (both type locality); and +GU 055683 ( - -ITS - +ITS part considered; managed grassland soil in Riederberg, Austria , @@ -170,15 +164,9 @@ part considered; managed grassland soil in Riederberg, Riederberg -(German) refers to -type -locality; and +(German) refers to type locality; and Sylvia -(German) refers to the first name of Sylvia Klaubauf, who first collected the materials of -type -species and the entire order from the -type -habitat. +(German) refers to the first name of Sylvia Klaubauf, who first collected the materials of type species and the entire order from the type habitat. @@ -191,12 +179,8 @@ Found in and Estonia , with - -ITS - -and -LSU -sequences displaying up to 1 % differences. +ITS +and LSU sequences displaying up to 1 % differences. diff --git a/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml b/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml index d44ae403181..f9c7a069930 100644 --- a/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml +++ b/data/A2/00/4B/A2004B52C41B510F93D814C7C8D1AD94.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Nikkaluokta based on the - -ITS - -region (positions 97–116 cctgggcaaatttttttttc; one mismatch allowed) and -LSU -(positions 687–717 cttggatataagaagtggaatctacacaaat; one mismatch allowed) as indicated in Fig. +ITS +region (positions 97–116 cctgggcaaatttttttttc; one mismatch allowed) and LSU (positions 687–717 cttggatataagaagtggaatctacacaaat; one mismatch allowed) as indicated in Fig. 12 . @@ -100,31 +96,41 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 100497 ( +sample +TUE 100497 +( holotype ); eDNA -sequence EUK 1203196 ( +sequence +EUK 1203196 +( lectotype -); subarctic +); + +subarctic Pinus sylvestris -forest (soil sample TUE 000497) in +forest + +(soil sample +TUE 000497 +) in -Nikkaluokta + +Nikkaluokta + , Sweden @@ -134,6 +140,7 @@ forest (soil sample TUE 000497) in , 19.47575 ° E + . @@ -142,13 +149,9 @@ forest (soil sample TUE 000497) in Description. -Other sequences: EUK 1203537 ( -type -locality) and EUK 1603797 ( +Other sequences: EUK 1203537 (type locality) and EUK 1603797 ( GSMc -plot -G -5003, +plot G 5003, Pinus sylvestris @@ -169,13 +172,9 @@ forest soil in Naissaare, Nikkaluokta -(Sami) refers to -type -locality; and +(Sami) refers to type locality; and Mahdieh -(Persian) refers to the first name of Mahdieh Hosseyni Moghaddam who sequenced the -type -materials using target capture protocols. +(Persian) refers to the first name of Mahdieh Hosseyni Moghaddam who sequenced the type materials using target capture protocols. @@ -188,12 +187,8 @@ Found in and Estonia , with - -ITS - -and -LSU -sequences displaying up to 1 % and 0.2 % differences, respectively. +ITS +and LSU sequences displaying up to 1 % and 0.2 % differences, respectively. diff --git a/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml b/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml index 2b6f0171185..44f2e3e5ae9 100644 --- a/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml +++ b/data/BB/D6/E7/BBD6E7DBB7665D21BBAEBB0CC7E23B0A.xml @@ -1,65 +1,65 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + - + Fuscutata reticulata (Koske, D. D. Mill. & C. Walker) Tedersoo & Magurno @@ -69,30 +69,26 @@ - - + Gigaspora reticulata -Koske, D. D. Mill. & C. Walker, Mycotaxon +Koske, D. D. Mill. & C. Walker -16 (2): 429 (1983) +, Mycotaxon 16 (2): 429 (1983) . Basionym. - - - + Dentiscutata reticulata -(Koske, D. D. Mill. & C. Walker) Sieverd., F. A. Souza & Oehl, Mycotaxon +(Koske, D. D. Mill. & C. Walker) Sieverd., F. A. Souza & Oehl -106: 342 (2009) +, Mycotaxon 106: 342 (2009) . Synonym. - @@ -122,15 +118,9 @@ by spore wall ornamentation, three-walled spores and dark-pigmented, multilobed F. heterogama -- -type -species of genus - based on the SSU- - -ITS - -- -LSU -phylogram (Fig. +- type species of genus - based on the SSU- +ITS +- LSU phylogram (Fig. 1 , Suppl. material 1 diff --git a/data/C5/2E/87/C52E87A8D703FFB00532F9AF4BAAFC50.xml b/data/C5/2E/87/C52E87A8D703FFB00532F9AF4BAAFC50.xml index c4d70b4728a..d29f67fd1d3 100644 --- a/data/C5/2E/87/C52E87A8D703FFB00532F9AF4BAAFC50.xml +++ b/data/C5/2E/87/C52E87A8D703FFB00532F9AF4BAAFC50.xml @@ -1,41 +1,44 @@ - - - -El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela + + + +El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela - - -Author + + +Author -Joly, En Enezuela Luis J. +Joly, En Enezuela Luis J. -text - - -Papéis Avulsos de Zoologia +text + + +Papéis Avulsos de Zoologia - -2010 - -2010-12-31 + +2010 + +2010-12-31 - -50 + +50 - -46 + +46 - -701 -707 + +701 +707 -journal article -10.1590/S0031-10492010004600001 -1807-0205 +journal article +301169 +10.1590/S0031-10492010004600001 +1f3e0d65-5454-4adb-b86d-47546a0b13f4 +1807-0205 +13286992 - + @@ -52,7 +55,7 @@ ( -Fig. 4 +Fig. 4 ) @@ -68,7 +71,7 @@ Latín, ♀ : Coloración general amarillo anaranjado, la frente castaña, las antenas y las patas (las tibias más oscuras que los fémures) castañas amarillentas y con las siguientes áreas castañas rojizas: borde anterior del pronoto, una banda longitudinal a cada lado del pronoto que llega hasta el tercio anterior, escutelo, metasterno y ventritos apicales. Elitros suave y gradualmente enanchados hacia atrás desde la base, con puntos pilíferos no contrastantes y con las siguientes bandas castañas rojizas: una postescutelar transversa, que se ensancha gradualmente desde el borde lateral hacia la sutura; una premedia recta, delgada, oblicua, descendente del borde externo hacia la sutura, unida a la postescutelar por el borde lateral del élitro; una post-media ancha, con el borde posterior nítido, sinuoso y el borde anterior difuso, descendente de la sutura hacia el borde lateral prolongada hacia atrás estrechamente por la sutura hasta unirse a la franja preapical y una preapical recta transversal. - + FIGURAS 1‑4: Habitus y diseño de los élitros: diff --git a/data/C5/2E/87/C52E87A8D703FFB206F2FE0F4E4CFA2F.xml b/data/C5/2E/87/C52E87A8D703FFB206F2FE0F4E4CFA2F.xml index 5b4bbb68d41..9701cdefbf9 100644 --- a/data/C5/2E/87/C52E87A8D703FFB206F2FE0F4E4CFA2F.xml +++ b/data/C5/2E/87/C52E87A8D703FFB206F2FE0F4E4CFA2F.xml @@ -1,41 +1,44 @@ - - - -El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela + + + +El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela - - -Author + + +Author -Joly, En Enezuela Luis J. +Joly, En Enezuela Luis J. -text - - -Papéis Avulsos de Zoologia +text + + +Papéis Avulsos de Zoologia - -2010 - -2010-12-31 + +2010 + +2010-12-31 - -50 + +50 - -46 + +46 - -701 -707 + +701 +707 -journal article -10.1590/S0031-10492010004600001 -1807-0205 +journal article +301169 +10.1590/S0031-10492010004600001 +1f3e0d65-5454-4adb-b86d-47546a0b13f4 +1807-0205 +13286992 - + @@ -52,7 +55,7 @@ ( -Fig. 3 +Fig. 3 ) diff --git a/data/C5/2E/87/C52E87A8D704FFB206E3FD0F4B64FE8F.xml b/data/C5/2E/87/C52E87A8D704FFB206E3FD0F4B64FE8F.xml index 35896294eef..6f3b8cfea60 100644 --- a/data/C5/2E/87/C52E87A8D704FFB206E3FD0F4B64FE8F.xml +++ b/data/C5/2E/87/C52E87A8D704FFB206E3FD0F4B64FE8F.xml @@ -1,41 +1,44 @@ - - - -El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela + + + +El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela - - -Author + + +Author -Joly, En Enezuela Luis J. +Joly, En Enezuela Luis J. -text - - -Papéis Avulsos de Zoologia +text + + +Papéis Avulsos de Zoologia - -2010 - -2010-12-31 + +2010 + +2010-12-31 - -50 + +50 - -46 + +46 - -701 -707 + +701 +707 -journal article -10.1590/S0031-10492010004600001 -1807-0205 +journal article +301169 +10.1590/S0031-10492010004600001 +1f3e0d65-5454-4adb-b86d-47546a0b13f4 +1807-0205 +13286992 - + @@ -52,7 +55,7 @@ ( -Fig. 2 +Fig. 2 ) diff --git a/data/C5/2E/87/C52E87A8D705FFB5070CFCCF4AC4FD90.xml b/data/C5/2E/87/C52E87A8D705FFB5070CFCCF4AC4FD90.xml index 6c17886b873..ec71d0a8fff 100644 --- a/data/C5/2E/87/C52E87A8D705FFB5070CFCCF4AC4FD90.xml +++ b/data/C5/2E/87/C52E87A8D705FFB5070CFCCF4AC4FD90.xml @@ -1,41 +1,44 @@ - - - -El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela + + + +El Género Obrium Dejean, 1821 (Coleoptera, Cerambycidae, Obriini) En Venezuela - - -Author + + +Author -Joly, En Enezuela Luis J. +Joly, En Enezuela Luis J. -text - - -Papéis Avulsos de Zoologia +text + + +Papéis Avulsos de Zoologia - -2010 - -2010-12-31 + +2010 + +2010-12-31 - -50 + +50 - -46 + +46 - -701 -707 + +701 +707 -journal article -10.1590/S0031-10492010004600001 -1807-0205 +journal article +301169 +10.1590/S0031-10492010004600001 +1f3e0d65-5454-4adb-b86d-47546a0b13f4 +1807-0205 +13286992 - + @@ -52,7 +55,7 @@ ( -Fig. 1 +Fig. 1 ) diff --git a/data/C7/36/38/C73638C535FF5D578DD77EAC3C32C667.xml b/data/C7/36/38/C73638C535FF5D578DD77EAC3C32C667.xml new file mode 100644 index 00000000000..d185879620c --- /dev/null +++ b/data/C7/36/38/C73638C535FF5D578DD77EAC3C32C667.xml @@ -0,0 +1,159 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + + +Fuscutata cerradensis +(Spain & J. Miranda) Tedersoo & Magurno + +comb. nov. + + + + + + + +Scutellospora cerradensis + + +Spain & J. Miranda, +Mycotaxon 60: 130 (1996) + +. Basionym. + + + + + + + + + +Dentiscutata cerradensis +Sieverd., F. A. Souza & Oehl + +, Mycotaxon 106: 342 (2009) + +. Synonym. + + + + + +Description. + + +See +Spain and Miranda (1996) +. + + + + +Diagnosis. + + + +Fuscutata cerradensis + +differs from other species of the + +Fuscutata + +by spore wall ornamentation, three-walled spores and dark-pigmented multilobed germinal shield produced in the inner wall. Phylogenetically forms a monophyletic clade with + +F. heterogama + +- the type species of genus - based on the SSU- +ITS +- LSU phylogram (Fig. +1 +, Suppl. material +1 +). + + + + +Notes. + + +The new combination invites an amendment of genus + +Fuscutata + +to accommodate species with dark, multilobed germinal shields. However, we decided not to prepare an amendment for + +Fuscutata + +because the genus + +Dentiscutata + +, their close relative, requires additional information to confirm their status, supported only in the LSU sequence of + +D. nigra + +. + + + + \ No newline at end of file diff --git a/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml b/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml index 321d37599f2..22f85656d51 100644 --- a/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml +++ b/data/E3/58/7C/E3587C65108750AEBCB0CA7ADC90CAE1.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Kelottijaervia based on the - -ITS - -region (positions 212–239 taatgtgagtgcaggaaatattatgact; one mismatch allowed) and -LSU -(positions 600–619 ctttggggtggcggtcgctg; one mismatch allowed) as indicated in Fig. +ITS +region (positions 212–239 taatgtgagtgcaggaaatattatgact; one mismatch allowed) and LSU (positions 600–619 ctttggggtggcggtcgctg; one mismatch allowed) as indicated in Fig. 6 . @@ -100,34 +96,42 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + eDNA -sample TUE 100189 ( +sample +TUE 100189 +( holotype ); eDNA -sequence EUK 1202520 ( +sequence +EUK 1202520 +( lectotype ); GSMc -plot -G -2836 +plot G 2836 Finland -, subpolar +, + +subpolar Betula pubescens -forest (soil sample TUE 000189) in Kelottijärvi, +forest + +(soil sample +TUE 000189 +) in +Kelottijärvi +, Finland , @@ -135,6 +139,7 @@ forest (soil sample TUE 000189) in Kelottijärvi, , 21.74517 ° E + . @@ -145,9 +150,7 @@ forest (soil sample TUE 000189) in Kelottijärvi, Other sequences: EUK 1603540, ( GSMc -plot -G -4196, +plot G 4196, Populus - @@ -169,9 +172,7 @@ forest soil in ); EUK 1603663 ( GSMc -plot -G -4406, mixed coniferous forest soil in Tarumaa, +plot G 4406, mixed coniferous forest soil in Tarumaa, Estonia , @@ -181,9 +182,7 @@ plot ); EUK 1602832 ( GSMc -plot -G -5828, +plot G 5828, Malus domestica @@ -201,11 +200,7 @@ orchard soil in Mooste, British Columbia , Canada -) that was first isolated by Shannon -H -. -A -. Guichon ( +) that was first isolated by Shannon H. A. Guichon ( Guichon 2015 ). @@ -216,15 +211,9 @@ orchard soil in Mooste, Kelottijärvi -(Finnish) refers to -type -locality; and +(Finnish) refers to type locality; and Shannon -(English) refers to the first name of Shannon -H -. -A -. Guichon who collected the first materials belonging to this genus. +(English) refers to the first name of Shannon H. A. Guichon who collected the first materials belonging to this genus. @@ -239,12 +228,8 @@ Found in and Canada , with - -ITS - -and -LSU -sequences displaying up to 2 % and 1 % of differences, respectively. +ITS +and LSU sequences displaying up to 2 % and 1 % of differences, respectively. diff --git a/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml b/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml index 7b670feb501..78388fcca7f 100644 --- a/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml +++ b/data/EB/20/E4/EB20E4EE572F53DB849A4606F20139EB.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,16 +76,10 @@ Separation from other species of Kahvena based on the - -ITS - -region ( -ITS -2 positions 200–218 cattcgcaggaatagccag; one mismatch allowed) and from other species of +ITS +region (ITS 2 positions 200–218 cattcgcaggaatagccag; one mismatch allowed) and from other species of Endogonomycetes -based on -LSU -(positions 653–683 acgcaagctccagatcgaatctccgggctaa; one mismatch allowed) as indicated in Fig. +based on LSU (positions 653–683 acgcaagctccagatcgaatctccgggctaa; one mismatch allowed) as indicated in Fig. 5 . @@ -104,29 +98,30 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 100738 ( +sample +TUE 100738 +( holotype ); eDNA -sequence EUK 1634339 ( +sequence +EUK 1634339 +( lectotype ); GSMc -plot -G -4196, +plot G 4196, + Populus - @@ -134,9 +129,15 @@ plot - Pinus -forest (soil sample TUE 000738) in +forest + +(soil sample +TUE 000738 +) in -Kahvena + +Kahvena + , Estonia @@ -146,7 +147,9 @@ forest (soil sample TUE 000738) in , 25.23165 ° E -). +) + +. @@ -154,13 +157,9 @@ forest (soil sample TUE 000738) in Description. -Other sequences: EUK 1635883 – EUK 1635886 ( -type -locality); EUK 1631811 ( +Other sequences: EUK 1635883 – EUK 1635886 (type locality); EUK 1631811 ( GSMc -plot -G -2767, mixed woodland soil at Mäebe, +plot G 2767, mixed woodland soil at Mäebe, Estonia , @@ -174,15 +173,10 @@ plot Picea mariana -forest soil, -AK -, +forest soil, AK, USA ); - -MT -596306 - +MT 596306 (Tobiotsuka Kofun, Japan , @@ -192,15 +186,10 @@ forest soil, 133.6814 ° E ); - -KU -062529 - +KU 062529 (unknown source); and KF 565426 -(Duke Forest, -NC -, +(Duke Forest, NC, USA , @@ -219,13 +208,9 @@ forest soil, Kahvena -(Estonian) refers to -type -locality; and +(Estonian) refers to type locality; and Rebecca -(English) refers to the first name of Rebecca C. Mueller, who collected the first materials belonging to this genus and the -type -species. +(English) refers to the first name of Rebecca C. Mueller, who collected the first materials belonging to this genus and the type species. @@ -234,25 +219,12 @@ species. Found from temperate and subarctic forests in Europe, Asia and North America, with - -ITS - -and -LSU -sequences differing up to 4 % (excluding a 29 - base deletion in EUK 1631811 and - -KU -062529 - -) and 1.5 %, respectively. Considered as a single species because of high intraspecific variation amongst common sequence variants in the -type -locality (2 % in - -ITS - -and 1 % in -LSU -, representing both indels and substitutions). +ITS +and LSU sequences differing up to 4 % (excluding a 29 - base deletion in EUK 1631811 and +KU 062529 +) and 1.5 %, respectively. Considered as a single species because of high intraspecific variation amongst common sequence variants in the type locality (2 % in +ITS +and 1 % in LSU, representing both indels and substitutions). diff --git a/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml b/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml index 61cc934a37b..b90ddc15aa0 100644 --- a/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml +++ b/data/EB/33/0B/EB330B0EF11F5A3CAA197758D63BE4E1.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Lehetua based on the - -ITS - -region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and -LSU -(positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. +ITS +region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9 . @@ -100,31 +96,38 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 103095 ( +sample +TUE 103095 +( holotype -); type sequence EUK 1603180 ( +); type sequence +EUK 1603180 +( lectotype ); GSMc -plot -S -590, +plot S 590, + Populus tremula -forest (soil sample TUE 003095) in Lehetu, +forest + +(soil sample +TUE 003095 +) in +Lehetu +, Estonia , @@ -132,6 +135,7 @@ forest (soil sample TUE 003095) in Lehetu, , 24.28041 ° E + . @@ -140,19 +144,11 @@ forest (soil sample TUE 003095) in Lehetu, Description. -Other sequences: EUK 1603180 ( -type -locality); EUK 1602367 ( -LSU -only; -type -locality; also found in 50 other sites in +Other sequences: EUK 1603180 (type locality); EUK 1602367 (LSU only; type locality; also found in 50 other sites in Estonia ); EUK 1634481 ( GSMc -plot -G -4195, +plot G 4195, Quercus robur @@ -166,9 +162,7 @@ woodland soil in Lustivere, ); EUK 1603818 ( GSMc -plot -G -5824, managed grassland soil in Kuremaa, +plot G 5824, managed grassland soil in Kuremaa, Estonia , @@ -178,9 +172,7 @@ plot ); EUK 1603131 ( GSMc -plot -G -4105, +plot G 4105, Picea abies @@ -194,9 +186,7 @@ forest soil in Lepa, ); EUK 0021956 ( GSMc -plot -G -5150, subarctic grassland soil in Kokelv, +plot G 5150, subarctic grassland soil in Kokelv, Norway , @@ -206,9 +196,7 @@ plot ); and EUK 0023592 ( GSMc -plot -S -035, mixed deciduous forest soil in Kedrovaya Pad, +plot S 035, mixed deciduous forest soil in Kedrovaya Pad, Russia , @@ -225,13 +213,9 @@ plot Lehetu -(Estonian) refers to -type -locality (also meaning “ leafless ”); and +(Estonian) refers to type locality (also meaning “ leafless ”); and Indrek -(Estonian) refers to the first name of Indrek Hiiesalu who collected materials from the -type -locality. +(Estonian) refers to the first name of Indrek Hiiesalu who collected materials from the type locality. @@ -242,14 +226,8 @@ locality. Found in Baltic States, Scandinavia and Russia , with - -ITS - -and -LSU -sequences differing up to 3.5 % and 0.2 %, respectively. Seems to be a generalist in terms of habitat -type -and soil pH; so far, not found from roots. +ITS +and LSU sequences differing up to 3.5 % and 0.2 %, respectively. Seems to be a generalist in terms of habitat type and soil pH; so far, not found from roots. diff --git a/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml b/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml index ea0b13beb79..204508b2dc8 100644 --- a/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml +++ b/data/EB/91/1E/EB911EB9126A5830815B5352D47ACEA6.xml @@ -1,62 +1,62 @@ - - - -Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) - - -Author + + +Author -Tedersoo, Leho -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Magurno, Franco -0000-0002-3117-8149 -Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland - - -Author + + +Author -Alkahtani, Saad -0000-0001-7381-5110 -Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia - - -Author + + +Author -Mikryukov, Vladimir -0000-0003-2786-2690 -Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia -text - - -MycoKeys +text + + +MycoKeys - -2024 - -2024-08-09 + +2024 + +2024-08-09 - -107 + +107 - -249 -271 + +249 +271 -journal article -10.3897/mycokeys.107.125549 +journal article +10.3897/mycokeys.107.125549 - + @@ -76,12 +76,8 @@ Separation from other species of Parnigua based on the - -ITS - -region (positions 51–80 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and -LSU -(positions 444–463 ggcgggaaatcagcccccct; no mismatch allowed) as indicated in Fig. +ITS +region (positions 51–80 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 444–463 ggcgggaaatcagcccccct; no mismatch allowed) as indicated in Fig. 13 . @@ -100,31 +96,38 @@ relative to closely-related taxa in ITS 2 and LSU. - -Type -. - +Type. + Soil eDNA -sample TUE 102228 ( +sample +TUE 102228 +( holotype -); type sequence: EUK 1635261 ( +); type sequence: +EUK 1635261 +( lectotype ); GSMc -plot -G -5251, +plot G 5251, + Quercus robur -woodland (soil sample TUE 002228) in Parnigu, +woodland + +(soil sample +TUE 002228 +) in +Parnigu +, Estonia , @@ -132,6 +135,7 @@ woodland (soil sample TUE 002228) in Parnigu, , 26.38468 ° E + . @@ -142,9 +146,7 @@ woodland (soil sample TUE 002228) in Parnigu, Other sequences: EUK 1635874 ( GSMc -plot -G -4499, calcareous +plot G 4499, calcareous Picea abies @@ -158,9 +160,7 @@ forest soil in Kurisoo, ); EUK 1635875 ( GSMc -plot -G -4746, +plot G 4746, Betula pendula @@ -174,9 +174,7 @@ forest soil in Karjamõisa, ); EUK 1635878 ( GSMc -plot -G -4794, +plot G 4794, Ulmus - @@ -192,9 +190,7 @@ forest soil in Lõhtsuu, ); EUK 1603328 ( GSMc -plot -G -4167, +plot G 4167, Salix pentandra @@ -208,9 +204,7 @@ peat soil in Tammispää, ); EUK 1602985 ( GSMc -plot -G -5923, +plot G 5923, Malus domestica @@ -223,10 +217,7 @@ orchard soil in Kalnabeites, 24.8566 ° E ); - -OU -939710 - +OU 939710 (grassland soil in Kungsängen, Sweden , @@ -236,10 +227,7 @@ orchard soil in Kalnabeites, 17.661 ° E ); and - -MH -625006 - +MH 625006 (grassland soil in Wakanui, New Zealand , @@ -249,9 +237,7 @@ orchard soil in Kalnabeites, , 172.470 ° E -), first isolated by Craig -R -. Anderson ( +), first isolated by Craig R. Anderson ( Anderson et al. 2018 ). @@ -262,13 +248,9 @@ orchard soil in Kalnabeites, Parnigu -(Estonian) refers to -type -locality; and +(Estonian) refers to type locality; and Craig -(English) refers to the first name of Craig -R -. Anderson who was the first to record this species. +(English) refers to the first name of Craig R. Anderson who was the first to record this species. @@ -283,12 +265,8 @@ Found from and New Zealand , with - -ITS - -and -LSU -sequences differing up to 0.5 %. Found in all croplands, grasslands, deciduous and coniferous forests. +ITS +and LSU sequences differing up to 0.5 %. Found in all croplands, grasslands, deciduous and coniferous forests. diff --git a/data/F5/45/EB/F545EB4CFA9F5CACA79E85C9BAF058D5.xml b/data/F5/45/EB/F545EB4CFA9F5CACA79E85C9BAF058D5.xml new file mode 100644 index 00000000000..69fdafdfb9d --- /dev/null +++ b/data/F5/45/EB/F545EB4CFA9F5CACA79E85C9BAF058D5.xml @@ -0,0 +1,104 @@ + + + +Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) + + + +Author + +Tedersoo, Leho +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Magurno, Franco +0000-0002-3117-8149 +Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland + + + +Author + +Alkahtani, Saad +0000-0001-7381-5110 +Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia + + + +Author + +Mikryukov, Vladimir +0000-0003-2786-2690 +Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia + +text + + +MycoKeys + + +2024 + +2024-08-09 + + +107 + + +249 +271 + + + +journal article +10.3897/mycokeys.107.125549 + + + + +Hoforsaceae Tedersoo +fam. nov. + + + + +Type genus. + + + +Hoforsa +Tedersoo. + + + + + +Description. + + +Covers the monophyletic group in + +Hoforsales + +(Fig. +2 +). Phylogenetically delimited as the least inclusive clade covering sequence accessions EUK 1100001, EUK 1107311 and EUK 1602325 (Suppl. material +3 +). + + + + +Notes. + + +Recognised based on +eDNA +sequences only. Currently monogeneric. + + + + \ No newline at end of file