213 lines
16 KiB
XML
213 lines
16 KiB
XML
![]() |
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.208.3326" ID-GBIF-Dataset="692c4233-dfa9-4ea1-8f8e-0afadbd1f996" ID-PMC="PMC3406448" ID-Pensoft-Pub="1313-2970-208-61" ID-PubMed="22859873" ModsDocAuthor="" ModsDocDate="2012" ModsDocID="1313-2970-208-61" ModsDocOrigin="ZooKeys 208" ModsDocTitle="Mariapanteles (Hymenoptera, Braconidae), a new genus of Neotropical microgastrine parasitoid wasp discovered through biodiversity inventory" checkinTime="1451248886443" checkinUser="pensoft" docAuthor="Whitfield, James B., Fernandez-Triana, Jose L., Janzen, Daniel H., Hallwachs, Winnie, Smith, M. Alex & Cardinal, Sophie" docDate="2012" docId="9E15BFD4118A4C0784BD083DED92C8E2" docLanguage="en" docName="ZooKeys 208: 61-80" docOrigin="ZooKeys 208" docSource="http://dx.doi.org/10.3897/zookeys.208.3326" docTitle="Mariapanteles felipei Whitfield, sp. n." docType="treatment" docVersion="4" lastPageNumber="66" masterDocId="FFBCFFF6FF8AFF86FF9BFF86FF80FF8C" masterDocTitle="Mariapanteles (Hymenoptera, Braconidae), a new genus of Neotropical microgastrine parasitoid wasp discovered through biodiversity inventory" masterLastPageNumber="80" masterPageNumber="61" pageNumber="65" updateTime="1668154176021" updateUser="ExternalLinkService">
|
|||
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
|||
|
<mods:titleInfo>
|
|||
|
<mods:title>Mariapanteles (Hymenoptera, Braconidae), a new genus of Neotropical microgastrine parasitoid wasp discovered through biodiversity inventory</mods:title>
|
|||
|
</mods:titleInfo>
|
|||
|
<mods:name type="personal">
|
|||
|
<mods:role>
|
|||
|
<mods:roleTerm>Author</mods:roleTerm>
|
|||
|
</mods:role>
|
|||
|
<mods:namePart>Whitfield, James B.</mods:namePart>
|
|||
|
</mods:name>
|
|||
|
<mods:name type="personal">
|
|||
|
<mods:role>
|
|||
|
<mods:roleTerm>Author</mods:roleTerm>
|
|||
|
</mods:role>
|
|||
|
<mods:namePart>Fernandez-Triana, Jose L.</mods:namePart>
|
|||
|
</mods:name>
|
|||
|
<mods:name type="personal">
|
|||
|
<mods:role>
|
|||
|
<mods:roleTerm>Author</mods:roleTerm>
|
|||
|
</mods:role>
|
|||
|
<mods:namePart>Janzen, Daniel H.</mods:namePart>
|
|||
|
</mods:name>
|
|||
|
<mods:name type="personal">
|
|||
|
<mods:role>
|
|||
|
<mods:roleTerm>Author</mods:roleTerm>
|
|||
|
</mods:role>
|
|||
|
<mods:namePart>Hallwachs, Winnie</mods:namePart>
|
|||
|
</mods:name>
|
|||
|
<mods:name type="personal">
|
|||
|
<mods:role>
|
|||
|
<mods:roleTerm>Author</mods:roleTerm>
|
|||
|
</mods:role>
|
|||
|
<mods:namePart>Smith, M. Alex</mods:namePart>
|
|||
|
</mods:name>
|
|||
|
<mods:name type="personal">
|
|||
|
<mods:role>
|
|||
|
<mods:roleTerm>Author</mods:roleTerm>
|
|||
|
</mods:role>
|
|||
|
<mods:namePart>Cardinal, Sophie</mods:namePart>
|
|||
|
</mods:name>
|
|||
|
<mods:typeOfResource>text</mods:typeOfResource>
|
|||
|
<mods:relatedItem type="host">
|
|||
|
<mods:titleInfo>
|
|||
|
<mods:title>ZooKeys</mods:title>
|
|||
|
</mods:titleInfo>
|
|||
|
<mods:part>
|
|||
|
<mods:date>2012</mods:date>
|
|||
|
<mods:detail type="volume">
|
|||
|
<mods:number>208</mods:number>
|
|||
|
</mods:detail>
|
|||
|
<mods:extent unit="page">
|
|||
|
<mods:start>61</mods:start>
|
|||
|
<mods:end>80</mods:end>
|
|||
|
</mods:extent>
|
|||
|
</mods:part>
|
|||
|
</mods:relatedItem>
|
|||
|
<mods:location>
|
|||
|
<mods:url>http://dx.doi.org/10.3897/zookeys.208.3326</mods:url>
|
|||
|
</mods:location>
|
|||
|
<mods:classification>journal article</mods:classification>
|
|||
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.208.3326</mods:identifier>
|
|||
|
<mods:identifier type="Pensoft-Pub">1313-2970-208-61</mods:identifier>
|
|||
|
</mods:mods>
|
|||
|
<treatment ID-GBIF-Taxon="152036390" LSID="urn:lsid:zoobank.org:act:2A5E1320-5C93-45FE-AEB0-AF9382929A78" httpUri="http://treatment.plazi.org/id/9E15BFD4118A4C0784BD083DED92C8E2" lastPageId="5" lastPageNumber="66" pageId="4" pageNumber="65">
|
|||
|
<subSubSection pageId="4" pageNumber="65" type="nomenclature">
|
|||
|
<paragraph pageId="4" pageNumber="65">
|
|||
|
<taxonomicName LSID="urn:lsid:zoobank.org:act:2A5E1320-5C93-45FE-AEB0-AF9382929A78" authority="Whitfield" class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles felipei" order="Hymenoptera" pageId="4" pageNumber="65" phylum="Arthropoda" rank="species" species="felipei">Mariapanteles felipei Whitfield</taxonomicName>
|
|||
|
<taxonomicNameLabel pageId="4" pageNumber="65">sp. n.</taxonomicNameLabel>
|
|||
|
Figs 1-6
|
|||
|
</paragraph>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection pageId="4" pageNumber="65" type="holotype">
|
|||
|
<paragraph pageId="4" pageNumber="65">Holotype.</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">Female (NMNH).COSTA RICA: Alajuela Province, Sector Rincon Rain Forest of ACG, Caribe, Rio Francia, 400 m, latitude 10.90093, longitude -85.28915; 11-17.vii.2007, Malaise Trap. Voucher code: DHJPAR0025453.</paragraph>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection pageId="4" pageNumber="65" type="paratype">
|
|||
|
<paragraph pageId="4" pageNumber="65">Paratype.</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">Male (NMNH).Same data as for holotype, except for collecting date: 22-28.viii.2007. Voucher code: DHJPAR0025443.</paragraph>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection lastPageId="5" lastPageNumber="66" pageId="4" pageNumber="65" type="description">
|
|||
|
<paragraph pageId="4" pageNumber="65">Description.</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">
|
|||
|
Female. Antenna about the same length as body; body length 2.6 mm; forewing 2.9 mm. Head: face with shallow and sparse punctures and sparse, uniformly distributed setae; face width at antennal base/face width at clypeus edge: 1.1
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; intertentorial pit distance/face width at clypeus edge: 0.5
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; compound eye height/head height: 0.8
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; head height/width: 0.8
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; face width at antennal base/head maximum width: 0.6
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; malar space/basal width of mandible 1.3
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; clypeus width/height: 3.1
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
. Length/width of flagellomeres: 2nd (2.3
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
), 8th (2.5
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
), 14th (1.3
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
). Length of flagellomere 2nd/length of flagellomere 14th: 2.2
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
. Ocello-ocular distance/posterior ocelli diameter: 2.3
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; distance between posterior ocelli/ocelli diameter: 1.4
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
.
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">
|
|||
|
Mesosoma. Pronotum with two lateral grooves, the lower one excavated. Mesoscutum more or less uniformly sculptured by impressed punctures (distance between punctures about the same as their diameter). Mesoscutum 1.4
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
wider than long. Mesoscutum and scutellum uniformly covered by dense, pale-coloured pilosity. Scutellum similarly sculptured to mesoscutum. Scutellum length/width at base 1.0
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
. Scutellar suture broad, with 6-8 costulae. Posterior band of scutellum polished. Scutellar lateral face with polished area less than 30% the face height and about half the face width. Mesopleuron mostly smooth and glabrous, except for punctures on the anterior margin and setae on the all margins; separated from metapleuron by a crenulated sulcus. Metapleuron mostly smooth, with some punctures and setae in the apical half; metapleuron with a crenulate, longitudinal sulcus running from lower margin near metacoxa through spiracle. Metapleural carina raised with a short lamella. Propodeum mostly smooth, with a median carina well defined and raised its entire length; and with a clearly complete transverse carina that reaches the spiracles and forks around them (also with additional, shorter transverse carinae, some of them radiating from the median carina but not reaching the spiracles). Transverse carina on propodeum delimiting two areas, the anterior, basal one being more or less horizontal, while the posterior, apical one is declivous.
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">
|
|||
|
Metasoma. Mediotergite 1 mostly smooth and with a deep medial groove over its basal half; slightly widening for the first quarter of its length, then narrowing towards apex; basal width/apical width 2.1
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; length/apical width 4.8
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
. Mediotergite 2 mostly smooth, transverse, subtriangular to trapezoidal in shape; basal width/apical width 0.4
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
; length/apical width 0.4
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
. Mediotergite 3 1.5
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
the length of mediotergite 2. Mediotergite 3 and following unsculptured, polished and with sparse setae. Hypopygium mostly inflexible but with a median, translucid fold ventrally where no pleats are distinguishable. Ovipositor sheaths fully setose, 0.7
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
as long as metatibia length.
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">
|
|||
|
Legs. Metacoxa long, surpassing the length of the third metasomal tergum. Metatibial inner spur 1.6
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
the length of outer spur, and 0.6
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
the length of metatarsomere 1. Metafemur 3.2
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
as long as wide.
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="4" pageNumber="65">
|
|||
|
Wings. Vein R1a 1.3
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
as long as stigma length. Stigma 3.1
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
as long as wide. Length of R1a about 12
|
|||
|
<normalizedToken originalValue="×">x</normalizedToken>
|
|||
|
as long as the distance between its end and the end of 3RSb. Vein r and 2RS evenly curved to very slightly arched, with no clear limits between the two veins. Vein 2M about the same length of vein (RS+M)b. Edge of vannal lobe of hind wing medially straight to slightly concave and with uniformly distribute setae which are shorter than those at base and apex of the lobe.
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">
|
|||
|
<pageBreakToken pageId="5" pageNumber="66" start="start">Colour</pageBreakToken>
|
|||
|
: Mostly an orange-yellowish species. Antennal flagellomere and dorsal part of scape brown. Apical edge of scutellum, metascutellum and some carina on propodeum, reddish-brown. Central area on mediotergites 3 and following dark brown. Forewing stigma and most of the wing veins dark brown.
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">Male. Like the female except for darker coloration as follows: interocellar area, propodeum, metascutellum, apical edge of scutellum, most of the lateral face of scutellum, and most of mediotergites 2+, dark brown to black.</paragraph>
|
|||
|
<caption pageId="5" pageNumber="66">
|
|||
|
<paragraph pageId="5" pageNumber="66">
|
|||
|
Figures 1-6.
|
|||
|
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles felipei" order="Hymenoptera" pageId="5" pageNumber="66" phylum="Arthropoda" rank="species" species="felipei">Mariapanteles felipei</taxonomicName>
|
|||
|
Whitfield. 1 Dorsal habitus, female 2 Dorsal habitus, male 3 forewing, female 4 head and mesoscutum, dorsal view, female 5 hypopygium and ovipositor, lateral view 6 metanotum and propodeum, female, dorsal view.
|
|||
|
</paragraph>
|
|||
|
</caption>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection pageId="5" pageNumber="66" type="distribution">
|
|||
|
<paragraph pageId="5" pageNumber="66">Distribution.</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">The known specimens were captured in July-August 2007 (full rainy season) by the same Malaise trap placed in old growth rain forest understory on the banks of Rio Francia, where it crosses the access road through Sector Rincon Rain Forest of ACG, at 400 m.</paragraph>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection pageId="5" pageNumber="66" type="molecular data">
|
|||
|
<paragraph pageId="5" pageNumber="66">Molecular data.</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">The two known specimens bear the same DNA barcode. The nucleotide sequence in fasta format is:</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">
|
|||
|
>
|
|||
|
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles felipei" order="Hymenoptera" pageId="5" pageNumber="66" phylum="Arthropoda" rank="species" species="felipei">Mariapanteles felipei</taxonomicName>
|
|||
|
</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">ATTTTATATTTTTTATTTGGAATATGATCTGGAATATTAGGATTTTCATTAAGAATAATTATCCGATTAGAGTTAGGCACACCAGGAAGATTAATTAGAAATGATCAAATCTATAATAGAATTGTTACATCACATGCTTTTATCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTATTTAATTCCATTAATATTAGCAACTCCTGATATATCATTCCCACGAATAAATAATATGAGATTTTGATTACTAATTCCTTCATTATTTTTATTAATTTTTAGAAGATTTATTAATACAGGAGTAGGTACAGGTTGAACAGTTTATCCACCTTTATCATCAAATTTAGGACATAGAGGTATATCAGTTGATTTAGGAATCTTTTCTCTACATTTAGCAGGAGCCTCATCAATTATAGGAGCAATTAATTTTATTACAACAATTAAAAATATACGAGTTAAATTATTAAAAATAGATAAAATTTCTTTATTTACTTGATCAGTTTTAATTACAGCAATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTTCAGGAGGTGGGGATCCAATTTTATACCAACATTTATTT</paragraph>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection pageId="5" pageNumber="66" type="etymology">
|
|||
|
<paragraph pageId="5" pageNumber="66">Etymology.</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">
|
|||
|
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles felipei" order="Hymenoptera" pageId="5" pageNumber="66" phylum="Arthropoda" rank="species" species="felipei">Mariapanteles felipei</taxonomicName>
|
|||
|
is dedicated toLuis Felipe
|
|||
|
<normalizedToken originalValue="Chavarría">Chavarria</normalizedToken>
|
|||
|
<normalizedToken originalValue="Díaz">Diaz</normalizedToken>
|
|||
|
of ACG and San Jose, Costa Rica, in recognition of his 30+ years of dedication to Costa Rican conservation, biodiversity systematics, and biodiversity development throughout Costa Rica, and very specifically within Area de
|
|||
|
<normalizedToken originalValue="Conservación">Conservacion</normalizedToken>
|
|||
|
de Guanacaste.
|
|||
|
</paragraph>
|
|||
|
</subSubSection>
|
|||
|
<subSubSection pageId="5" pageNumber="66" type="comments">
|
|||
|
<paragraph pageId="5" pageNumber="66">Comments.</paragraph>
|
|||
|
<paragraph pageId="5" pageNumber="66">
|
|||
|
The biology of this species, collected with Malaise traps, is unknown. Since its inception in 1978, the ACG caterpillar and parasitoid inventory (
|
|||
|
<bibRefCitation author="Janzen, DH" journalOrPublisher="Biodiversity" pageId="9" pageNumber="70" title="Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity. Molecular Ecology Resources 9 (Supplement 1): 1 - 26." url="10.1111/j.1755-0998.2009.02628.x" year="2009">Janzen et al. 2009</bibRefCitation>
|
|||
|
) has achieved
|
|||
|
<taxonomicName lsidName="" pageId="5" pageNumber="66" rank="subFamily" subFamily="Microgastrinae">Microgastrinae</taxonomicName>
|
|||
|
rearings from 9,000+ wild-caught caterpillars and has Malaise-trapped 5,000+ individual
|
|||
|
<taxonomicName lsidName="" pageId="5" pageNumber="66" rank="subFamily" subFamily="Microgastrinae">Microgastrinae</taxonomicName>
|
|||
|
in dry forest, cloud forest and rain forest (
|
|||
|
<bibRefCitation pageId="5" pageNumber="66">Janzen and Hallwachs 2012</bibRefCitation>
|
|||
|
,
|
|||
|
<bibRefCitation author="Smith, MA" journalOrPublisher="Proceedings of the National Academy of Sciences of the USA" pageId="9" pageNumber="70" pagination="12359 - 12364" title="Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology and collections." url="10.1073/pnas.0805319105" volume="105" year="2008">Smith et al. 2008</bibRefCitation>
|
|||
|
); this intense effort has yielded only two conspecific individuals of
|
|||
|
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles" order="Hymenoptera" pageId="5" pageNumber="66" phylum="Arthropoda" rank="genus">Mariapanteles</taxonomicName>
|
|||
|
, both from the same Malaise trap a few weeks apart. While this may suggest that the species is
|
|||
|
<normalizedToken originalValue="“rare”">"rare"</normalizedToken>
|
|||
|
, it has been the experience of the ACG inventory that when the wasp is finally reared and therefore its host caterpillar known, or the Malaise trap is placed in the
|
|||
|
<normalizedToken originalValue="“right”">"right"</normalizedToken>
|
|||
|
place, it may well be found to be common.
|
|||
|
</paragraph>
|
|||
|
</subSubSection>
|
|||
|
</treatment>
|
|||
|
</document>
|