treatments-xml/data/BB/6A/FC/BB6AFCEC3FC55F68A0A0CFB80E085396.xml

330 lines
35 KiB
XML
Raw Normal View History

2024-06-21 12:49:34 +02:00
<document ID-DOI="http://dx.doi.org/10.3897/BDJ.10.e85072" ID-Pensoft-Pub="1314-2828-10-e85072" ID-Pensoft-UUID="800EEABFC7DA557BABDF55886CE7DE64" ID-ZooBank="C6B1095B09B149B8A5570944203D1A02" ModsDocID="1314-2828-10-e85072" checkinTime="1652359721169" checkinUser="pensoft" docAuthor="Zhang, Jianshuang, Zhang, Wanling, Deng, Langju, Lu, Qianle &amp; Yu, Hao" docDate="2022" docId="BB6AFCEC3FC55F68A0A0CFB80E085396" docLanguage="en" docName="BiodivDatJour 10: e85072" docOrigin="Biodiversity Data Journal 10" docPubDate="2022-05-12" docSource="http://dx.doi.org/10.3897/BDJ.10.e85072" docTitle="Synema guiyang Zhang, Zhang, Deng, Lu &amp; Yu 2022, sp. n." docType="treatment" docVersion="1" id="800EEABFC7DA557BABDF55886CE7DE64" lastPageNumber="85072" masterDocId="800EEABFC7DA557BABDF55886CE7DE64" masterDocTitle="Synema guiyang sp. nov., the fourth endemic species of Synema Simon, 1864 (Araneae, Thomisidae) from China" masterLastPageNumber="85072" masterPageNumber="85072" pageNumber="85072" updateTime="1652359721169" updateUser="pensoft">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Synema guiyang sp. nov., the fourth endemic species of Synema Simon, 1864 (Araneae, Thomisidae) from China</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Zhang, Jianshuang</mods:namePart>
<mods:affiliation>The State Key Laboratory of Southwest Karst Mountain Biodiversity Conservation of Forestry Administration, School of life sciences, Guizhou Normal University, Guiyang, China &amp; The Key Laboratory of Plant Physiology and Development in Guizhou Province, School of life sciences, Guizhou Normal University, Guiyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Zhang, Wanling</mods:namePart>
<mods:affiliation>School of Biological Sciences, Guizhou Education University, Guiyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Deng, Langju</mods:namePart>
<mods:affiliation>School of Biological Sciences, Guizhou Education University, Guiyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Lu, Qianle</mods:namePart>
<mods:affiliation>College of Life Sciences and Oceanography, Shenzhen University, Shenzhen, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Yu, Hao</mods:namePart>
<mods:affiliation>The Key Laboratory of Plant Physiology and Development in Guizhou Province, School of life sciences, Guizhou Normal University, Guiyang, China &amp; School of Biological Sciences, Guizhou Education University, Guiyang, China &amp; The State Key Laboratory of Southwest Karst Mountain Biodiversity Conservation of Forestry Administration, School of life sciences, Guizhou Normal University, Guiyang, China</mods:affiliation>
<mods:nameIdentifier type="email">insect1986@126.com</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-05-12</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>10</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>85072</mods:start>
<mods:end>85072</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.10.e85072</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.10.e85072</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828-10-e85072</mods:identifier>
<mods:identifier type="ZooBank">C6B1095B09B149B8A5570944203D1A02</mods:identifier>
<mods:identifier type="Pensoft-UUID">800EEABFC7DA557BABDF55886CE7DE64</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:plazi:treatment:BB6AFCEC3FC55F68A0A0CFB80E085396" httpUri="http://treatment.plazi.org/id/BB6AFCEC3FC55F68A0A0CFB80E085396" lastPageNumber="85072" pageId="0" pageNumber="85072">
<subSubSection pageId="0" pageNumber="85072" type="nomenclature">
<paragraph pageId="0" pageNumber="85072">
<taxonomicName LSID="BB6AFCEC-3FC5-5F68-A0A0-CFB80E085396" authority="Zhang, Zhang, Deng, Lu &amp; Yu" authorityName="Zhang, Zhang, Deng, Lu &amp; Yu" authorityYear="2022" class="Arachnida" family="Thomisidae" genus="Synema" kingdom="Animalia" lsidName="Synema guiyang" order="Araneae" pageId="0" pageNumber="85072" phylum="Arthropoda" rank="species" species="guiyang" status="sp. n.">Synema guiyang Zhang, Zhang, Deng, Lu &amp; Yu</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="85072">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85072" type="materials_examined">
<paragraph pageId="0" pageNumber="85072">Materials</paragraph>
<paragraph pageId="0" pageNumber="85072">
<materialsCitation accessionNumber="ON435709" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Hao Yu, J. Zhang, Q. Lu, H. Yu" country="China" determinerName="Hao Yu" latitude="26.555403" location="Guiyang Forest Park" longitude="106.75899" pageId="0" pageNumber="85072" specimenCount="1" specimenCount-male="1" stateProvince="Guizhou" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="85072">Type status:</emphasis>
<materialsCitation accessionNumber="ON435709" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Hao Yu, J. Zhang, Q. Lu, H. Yu" country="China" determinerName="Hao Yu" latitude="26.555403" location="Guiyang Forest Park" longitude="106.75899" specimenCount="1" specimenCount-male="1" stateProvince="Guizhou" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="85072">Holotype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="85072">Occurrence:</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="85072">Hao Yu</collectorName>
; individualID: YHTHO002; individualCount:
<specimenCount pageId="0" pageNumber="85072" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="85072">male</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="85072">adult</specimenType>
; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank:
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/nucleotide/ON435709">ON435709</accessionNumber>
;
<emphasis bold="true" pageId="0" pageNumber="85072">Taxon:</emphasis>
order: Araneae; family: Thomisidae; genus: Synema; specificEpithet: guiyang; scientificNameAuthorship:
<collectorName>J. Zhang</collectorName>
,
<collectorName>Q. Lu</collectorName>
&amp;
<collectorName>H. Yu</collectorName>
,;
<emphasis bold="true" pageId="0" pageNumber="85072">Location:</emphasis>
continent: Asia; country:
<collectingCountry name="China" pageId="0" pageNumber="85072">China</collectingCountry>
; countryCode: CHN; stateProvince:
<collectingRegion country="China" name="Guizhou">Guizhou</collectingRegion>
; county: Guiyang City; locality:
<location LSID="urn:lsid:plazi:treatment:BB6AFCEC3FC55F68A0A0CFB80E085396:18F6362746390202B34354B57C14D713" country="China" latitude="26.555403" longitude="106.75899" name="Guiyang Forest Park" pageId="0" pageNumber="85072" stateProvince="Guizhou">
<location LSID="urn:lsid:plazi:treatment:BB6AFCEC3FC55F68A0A0CFB80E085396:78E7BE693361502FEA9DAE0CAC05208D" country="China" latitude="26.555403" longitude="106.75899" name="Guiyang Forest" stateProvince="Guizhou">Guiyang Forest</location>
Park
</location>
; decimalLatitude:
<geoCoordinate orientation="latitude" pageId="0" pageNumber="85072" value="26.55540319">26.55540319</geoCoordinate>
; decimalLongitude:
<geoCoordinate orientation="longitude" pageId="0" pageNumber="85072" value="106.75898910">106.75898910</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="85072">Identification:</emphasis>
identifiedBy:
<determinerName pageId="0" pageNumber="85072">Hao Yu</determinerName>
; dateIdentified: 2021-11;
<emphasis bold="true" pageId="0" pageNumber="85072">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="85072">by hand</collectingMethod>
; samplingEffort:
<quantity metricMagnitude="4" metricUnit="m" metricValue="1.0" unit="km" value="10.0">10 km</quantity>
by foot; year: 2021; month: 8; day: 10;
<emphasis bold="true" pageId="0" pageNumber="85072">Record Level:</emphasis>
institutionID: MGEU; basisOfRecord: PreservedSpecimen
<materialsCitation accessionNumber="ON435708" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Hao Yu, J. Zhang, Q. Lu, H. Yu" country="China" determinerName="Hao Yu" latitude="26.555403" location="Guiyang Forest Park" longitude="106.75899" pageId="0" pageNumber="85072" specimenCount="1" specimenCount-female="1" stateProvince="Guizhou" typeStatus="Paratype">
<emphasis bold="true" pageId="0" pageNumber="85072">Type status:</emphasis>
<materialsCitation accessionNumber="ON435708" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Hao Yu, J. Zhang, Q. Lu, H. Yu" country="China" determinerName="Hao Yu" latitude="26.555403" location="Guiyang Forest Park" longitude="106.75899" specimenCount="1" specimenCount-female="1" stateProvince="Guizhou" typeStatus="Paratype">
<typeStatus pageId="0" pageNumber="85072">Paratype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="85072">Occurrence:</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="85072">Hao Yu</collectorName>
; individualID: YHTHO003; individualCount:
<specimenCount pageId="0" pageNumber="85072" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="85072">female</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="85072">adult</specimenType>
; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank:
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/nucleotide/ON435708">ON435708</accessionNumber>
;
<emphasis bold="true" pageId="0" pageNumber="85072">Taxon:</emphasis>
order: Araneae; family: Thomisidae; genus: Synema; specificEpithet: guiyang; scientificNameAuthorship:
<collectorName>J. Zhang</collectorName>
,
<collectorName>Q. Lu</collectorName>
&amp;
<collectorName>H. Yu</collectorName>
,;
<emphasis bold="true" pageId="0" pageNumber="85072">Location:</emphasis>
continent: Asia; country:
<collectingCountry name="China" pageId="0" pageNumber="85072">China</collectingCountry>
; countryCode: CHN; stateProvince:
<collectingRegion country="China" name="Guizhou">Guizhou</collectingRegion>
; county: Guiyang City; locality:
<location LSID="urn:lsid:plazi:treatment:BB6AFCEC3FC55F68A0A0CFB80E085396:4F80588AC60D610CC9506B94BABA5D4F" country="China" latitude="26.555403" longitude="106.75899" name="Guiyang Forest Park" pageId="0" pageNumber="85072" stateProvince="Guizhou">
<location LSID="urn:lsid:plazi:treatment:BB6AFCEC3FC55F68A0A0CFB80E085396:D24768AB389FAD7F4F02BB653F108D8D" country="China" latitude="26.555403" longitude="106.75899" name="Guiyang Forest" stateProvince="Guizhou">Guiyang Forest</location>
Park
</location>
; decimalLatitude:
<geoCoordinate orientation="latitude" pageId="0" pageNumber="85072" value="26.55540319">26.55540319</geoCoordinate>
; decimalLongitude:
<geoCoordinate orientation="longitude" pageId="0" pageNumber="85072" value="106.75898910">106.75898910</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="85072">Identification:</emphasis>
identifiedBy:
<determinerName pageId="0" pageNumber="85072">Hao Yu</determinerName>
; dateIdentified: 2021-11;
<emphasis bold="true" pageId="0" pageNumber="85072">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="85072">by hand</collectingMethod>
; samplingEffort:
<quantity metricMagnitude="4" metricUnit="m" metricValue="1.0" unit="km" value="10.0">10 km</quantity>
by foot; year: 2021; month: 8; day: 10;
<emphasis bold="true" pageId="0" pageNumber="85072">Record Level:</emphasis>
institutionID: MGEU; basisOfRecord: PreservedSpecimen
</materialsCitation>
</materialsCitation>
</materialsCitation>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85072" type="description">
<paragraph pageId="0" pageNumber="85072">Description</paragraph>
<paragraph pageId="0" pageNumber="85072">
<emphasis bold="true" pageId="0" pageNumber="85072">Male</emphasis>
(holotype) (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
E and Fig.
<figureCitation captionStart="Figure 4" captionStartId="F7818800" captionText="Figure 4. Habitus of Synema guiyang sp. nov., male holotype (A-C) and female paratype (D-F). A, D Dorsal view; B, E Ventral view; C, F Lateral view. Scale bars: 1 mm (equal for A-C, equal for D-F)." figureDoi="10.3897/BDJ.10.e85072.figure4" httpUri="https://binary.pensoft.net/fig/667837" pageId="0" pageNumber="85072">4</figureCitation>
A-C). Total length 3.68; carapace 1.69 long, 1.59 wide; abdomen 1.99 long, 1.33 wide.
</paragraph>
<paragraph pageId="0" pageNumber="85072">
Carapace (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
E and Fig.
<figureCitation captionStart="Figure 4" captionStartId="F7818800" captionText="Figure 4. Habitus of Synema guiyang sp. nov., male holotype (A-C) and female paratype (D-F). A, D Dorsal view; B, E Ventral view; C, F Lateral view. Scale bars: 1 mm (equal for A-C, equal for D-F)." figureDoi="10.3897/BDJ.10.e85072.figure4" httpUri="https://binary.pensoft.net/fig/667837" pageId="0" pageNumber="85072">4</figureCitation>
A, C) yellowish-brown, sides brown, a pair of coffee-coloured paramedian stripes starting from behind PME and PLE, almost reaching the posterior margin. In dorsal view, anterior eye row (AER) slightly recurved, posterior eye row (PER) distinctly recurved, PER nearly as wide as AER. Eye sizes and interdistances: anterior median eyes (AME) 0.08, anterior lateral eyes (ALE) 0.15, posterior median eyes (PME) 0.07, posterior lateral eyes (PLE) 0.11; distance between AMEs (AME-AME) 0.16, distance between AME and ALE (AME-ALE) 0.14, distance between PMEs (PME-PME) 0.20, distance between PME and PLE (PME-PLE) 0.34. Length of median ocular quadrangle (MOQ) 0.37, MOQ anterior width 0.31, MOQ posterior width 0.32. Clypeal height 0.18. Chelicerae yellowish-brown, both margins with one tooth. Labium and endites coloured as chelicerae, endites depressed posteriorly, slightly convergent anteriorly, with dense scopulae on anterior margin; labium nearly hexagona, anterior margin with sparse setae. Sternum yellow, more or less cordiform, 0.86 long, 0.77 wide.
</paragraph>
<paragraph pageId="0" pageNumber="85072">
Abdomen (Fig.
<figureCitation captionStart="Figure 4" captionStartId="F7818800" captionText="Figure 4. Habitus of Synema guiyang sp. nov., male holotype (A-C) and female paratype (D-F). A, D Dorsal view; B, E Ventral view; C, F Lateral view. Scale bars: 1 mm (equal for A-C, equal for D-F)." figureDoi="10.3897/BDJ.10.e85072.figure4" httpUri="https://binary.pensoft.net/fig/667837" pageId="0" pageNumber="85072">4</figureCitation>
A-C) elongate-oval in dorsal view, tapering posteriorly, almost flat in profile, shield-shaped. Dorsum centrally with several pairs of grey spots; lateral with five pairs of white spots and with fuzzy pattern represented by numerous horizontal stripes or blotches; venter yellow, without distinct pattern; spinnerets brown.
</paragraph>
<paragraph pageId="0" pageNumber="85072">
Legs basically yellowish-brown (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
E), all legs with inconspicuous dark brown annuli in the distal parts of femur, patella, tibia and entire metatarsus. Leg length: I 9.29 (2.59, 3.22, 2.37, 1.11), II 9.22 (2.64, 3.22, 2.27, 1.09), III 4.33 (1.33, 1.61, 0.88, 0.51), IV 4.88 (1.31, 1.70, 0.94, 0.53).
</paragraph>
<paragraph pageId="0" pageNumber="85072">
Palp (Fig.
<figureCitation captionStart="Figure 2" captionStartId="F7818792" captionText="Figure 2. Male left palp of the holotype of Synema guiyang sp. nov. A Ventral view; B Dorsal view; C Prolateral view; D Retrolateral view. Abbreviations: E = embolus; EB = embolar base; ET = embolar tip; ITA = intermediate tibial apophysis; RTA = retrolateral tibial apophysis; SD = sperm duct; T = tegulum; VTA = ventral tibial apophysis. Scale bar: 0.2 mm (equal for A-D)." figureDoi="10.3897/BDJ.10.e85072.figure2" httpUri="https://binary.pensoft.net/fig/667834" pageId="0" pageNumber="85072">2</figureCitation>
A-D). Tibia relatively long, more than 1/2 of cymbium length, with three apophyses: a thick, thumb-shaped ventral one (VTA), ca. 1/3 of palpal tibia length; a distinctly small intermediate apophysis (ITA), triangular or dentiform in prolateral view, nearly invisible in ventral view, ~ 1/3 VTA length; and a relatively thin, spiny retrolateral apophysis (RTA). Tegulum circular and relatively flat, anterior part with numerous scale-like furcella; sperm duct (SD) distinct, forming a loop along tegular margin. Embolus (E) filiform, spiralled along tegular margin, but separated from tegulum; embolar base (EB) situated posterior margin of the tegulum (ca. 6
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
position), embolar tip (ET) terminated at the retrolateral flank (ca. 3
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
position).
</paragraph>
<paragraph pageId="0" pageNumber="85072">
<emphasis bold="true" pageId="0" pageNumber="85072">Female</emphasis>
(Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
F and Fig.
<figureCitation captionStart="Figure 4" captionStartId="F7818800" captionText="Figure 4. Habitus of Synema guiyang sp. nov., male holotype (A-C) and female paratype (D-F). A, D Dorsal view; B, E Ventral view; C, F Lateral view. Scale bars: 1 mm (equal for A-C, equal for D-F)." figureDoi="10.3897/BDJ.10.e85072.figure4" httpUri="https://binary.pensoft.net/fig/667837" pageId="0" pageNumber="85072">4</figureCitation>
D-F). Total length 3.69; carapace 1.61 long, 1.53 wide; abdomen 2.08 long, 1.86 wide. Eye sizes and interdistances: AME 0.08, ALE 0.14, PME 0.06, PLE 0.10; AME-AME 0.18, AME-ALE 0.17, PME-PME 0.23, PME-PLE 0.36. MOQL 0.37, MOQA 0.32, MOQP 0.35. Sternum 0.79 long, 0.75 wide. Measurements of legs: I 6.04 (1.57, 1.77, 1.22, 0.74), II 7.50 (2.02, 2.50, 1.48, 0.75), III 3.45 (0.93, 1.09, 0.61, 0.41), IV - (1.04, 0.69, -, -). General characters as in male, but slightly larger in size and lighter in colour.
</paragraph>
<paragraph pageId="0" pageNumber="85072">
Epigyne (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
A-D). Epigynal plate distinctly wider than long, anterior and lateral margin not delimited, posterior margin rebordered; the arrangement of the various parts of the vulva are clearly visible through the tegument in ventral view. Epigynal plate with an atrium (A) and a hood (H). Atrium large and nearly crescent-shaped, anteriorly located, anterior margin with a triangular membrane (AM), posterior margin distinctly procurved. Hood bell-shaped, located at central portion of epigynal plate, its anterior margin overpasses the posterior margin of atrium. Copulatory openings (CO) indistinct, located antero-laterally to atrial borders, leading to parallel copulatory ducts (CD) directed posteriorly and then running transversely to connect with centrally located spermathecae (SP). Copulatory ducts sac-shaped, strongly twisted with several clearly visible constrictions, forming 3 ~ 4 balloon-shaped structures. Spermathecae distinctly small, papilliform or globular, located on the both sides of the hood, separated by about two diameters. Fertilisation ducts (FD) short and curved, acicular, located on dorsal surface of spermathecae.
</paragraph>
<paragraph pageId="0" pageNumber="85072">
<emphasis bold="true" pageId="0" pageNumber="85072">DNAbarcode</emphasis>
: 5'TATTTGGAGCTTGATCTGCTATAGTAGGGACAGCTATAAGAGTGTTAATTCGTATGGAATTAGGA AGATCTGGAAGATTATTAGGAAATGATCATCTTTATAATGTAATTGTTACCGCTCATGCTTTTGTTATGATTTTTTTTATA GTAATACCTATTTTAATTGGGGGTTTTGGAAATTGATTAGTACCTTTAATGTTAGGGGCTCCTGATATATCTTTCCCTCG GATGAATAATTTATCTTTTTGATTATTACCCCCTTCATTATTTTTATTATTTATATCTTCTATAGTAGAGGTAGGTGTAGGG GCAGGATGAACTGTTTATCCTCCTTTAGCTTCTAGAGTTGGGCATATAGGAGGATCTATAGATTTTGCTATTTTTTCTTT ACATTTAGCTGGAGCTTCTTCTATTATAGGAGCGGTTAATTTTATTTCTACTATTATTAATATACGAACTAGAGGTATAAG AATAGAAAAGGTTCCTTTGTTTGTATGATCTGTATTAATTACAGCTATTTTACTTCTTTTGTCTTTACCTGTATTAGCAGG TGCTATTACTATATTATTAACTGATCGTAATTTTAACACTTCTTTTTTTGATCCTGCAGGGGGAGGGGATCCAATTTTATT TCAACATTTGTTTTGATTTTT3' (holotype, YHTHO002; GenBank: ON435709).
</paragraph>
<paragraph pageId="0" pageNumber="85072">
<emphasis bold="true" pageId="0" pageNumber="85072">DNAbarcode</emphasis>
: 5'TATTTGGAGCTTGATCTGCTATAGTAGGGACGGCTATAAGAGTGTTAATTCGTATGGAATTAGGA AGATCTGGAAGATTATTAGGAAATGATCATCTTTATAATGTAATTGTTACCGCTCATGCTTTTGTCATGATTTTTTTTATA GTAATACCTATTTTAATTGGGGGTTTTGGAAATTGATTAGTACCTTTAATGTTAGGGGCTCCTGATATATCTTTCCCTCG GATAAATAATTTATCTTTTTGATTATTACCCCCTTCATTATTTTTACTATTTATATCTTCTATAGTAGAGGTAGGTGTGGGG GCAGGATGAACTGTTTATCCTCCTCTAGCTTCTAGAGTTGGGCATATAGGAGGATCTATAGATTTTGCTATTTTTTCTTT ACATTTAGCTGGGGCTTCTTCTATTATAGGGGCGGTTAATTTTATTTCTACTATTATTAATATACGAACTAGAGGTATAAG AATAGAAAAGGTTCCTTTGTTTGTATGATCTGTATTAATTACAGCTATTTTACTTCTTTTGTCTTTACCTGTATTAGCAGG TGCTATTACTATATTATTAACTGATCGTAATTTTAACACTTCTTTTTTTGATCCTGCAGGGGGAGGGGATCCAATTTTATT TCAACATTTGTTTTGATTTTT3' (paratype, YHTHO003; GenBank: ON435708).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85072" type="diagnosis">
<paragraph pageId="0" pageNumber="85072">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="85072">
The new species resembles
<taxonomicName genus="S." lsidName="S. albomaculatum" pageId="0" pageNumber="85072" rank="species" species="albomaculatum">
<emphasis italics="true" pageId="0" pageNumber="85072">S. albomaculatum</emphasis>
</taxonomicName>
and
<taxonomicName genus="S." lsidName="S. chikunii" pageId="0" pageNumber="85072" rank="species" species="chikunii">
<emphasis italics="true" pageId="0" pageNumber="85072">S. chikunii</emphasis>
</taxonomicName>
in having the similar habitus (abdomen dorsally with characteristic spots) (cf. Fig.
<figureCitation captionStart="Figure 4" captionStartId="F7818800" captionText="Figure 4. Habitus of Synema guiyang sp. nov., male holotype (A-C) and female paratype (D-F). A, D Dorsal view; B, E Ventral view; C, F Lateral view. Scale bars: 1 mm (equal for A-C, equal for D-F)." figureDoi="10.3897/BDJ.10.e85072.figure4" httpUri="https://binary.pensoft.net/fig/667837" pageId="0" pageNumber="85072">4</figureCitation>
A, D and
<bibRefCitation author="Ono, H." journalOrPublisher="Entomologica Basiliensis" pageId="0" pageNumber="85072" pagination="203 - 236" refId="B7818437" refString="Ono, H., 2001. Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae). Entomologica Basiliensis 23: 203 - 236" title="Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae)" volume="23" year="2001">Ono 2001</bibRefCitation>
: 230, figs. 65 and 69,
<bibRefCitation author="Ono, H." journalOrPublisher="Acta Arachnologica" pageId="0" pageNumber="85072" pagination="59 - 63" refId="B7818428" refString="Ono, H., 1983. Eine neue Japanische Synaema-Art (Araneae: Thomisidae). Acta Arachnologica 31 (2): 59 - 63" title="Eine neue Japanische Synaema-Art (Araneae: Thomisidae)" volume="31" year="1983">Ono 1983</bibRefCitation>
: 60, figs. 1-3) and by the general shape of copulatory organs (filiform embolus spiralled along tegular margin, VTA thumb-shaped in males; copulatory duct sac-shaped with several clearly visible constrictions, spermathecae relatively small in females) (cf. Fig.
<figureCitation captionStart="Figure 2" captionStartId="F7818792" captionText="Figure 2. Male left palp of the holotype of Synema guiyang sp. nov. A Ventral view; B Dorsal view; C Prolateral view; D Retrolateral view. Abbreviations: E = embolus; EB = embolar base; ET = embolar tip; ITA = intermediate tibial apophysis; RTA = retrolateral tibial apophysis; SD = sperm duct; T = tegulum; VTA = ventral tibial apophysis. Scale bar: 0.2 mm (equal for A-D)." figureDoi="10.3897/BDJ.10.e85072.figure2" httpUri="https://binary.pensoft.net/fig/667834" pageId="0" pageNumber="85072">2</figureCitation>
A, D and Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
B, D and
<bibRefCitation author="Ono, H." journalOrPublisher="Entomologica Basiliensis" pageId="0" pageNumber="85072" pagination="203 - 236" refId="B7818437" refString="Ono, H., 2001. Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae). Entomologica Basiliensis 23: 203 - 236" title="Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae)" volume="23" year="2001">Ono 2001</bibRefCitation>
: 230, figs. 66, 67, 71,
<bibRefCitation author="Ono, H." journalOrPublisher="Acta Arachnologica" pageId="0" pageNumber="85072" pagination="59 - 63" refId="B7818428" refString="Ono, H., 1983. Eine neue Japanische Synaema-Art (Araneae: Thomisidae). Acta Arachnologica 31 (2): 59 - 63" title="Eine neue Japanische Synaema-Art (Araneae: Thomisidae)" volume="31" year="1983">Ono 1983</bibRefCitation>
: 60, figs. 4, 5, 7).
<taxonomicName genus="S." lsidName="S. guiyang" pageId="0" pageNumber="85072" rank="species" species="guiyang">
<emphasis italics="true" pageId="0" pageNumber="85072">S. guiyang</emphasis>
</taxonomicName>
sp. nov. can be distinguished from
<taxonomicName genus="S." lsidName="S. albomaculatum" pageId="0" pageNumber="85072" rank="species" species="albomaculatum">
<emphasis italics="true" pageId="0" pageNumber="85072">S. albomaculatum</emphasis>
</taxonomicName>
and
<taxonomicName genus="S." lsidName="S. chikunii" pageId="0" pageNumber="85072" rank="species" species="chikunii">
<emphasis italics="true" pageId="0" pageNumber="85072">S. chikunii</emphasis>
</taxonomicName>
by the following characters: for the males, embolus apically not curved, ITA distinctly smaller than RTA, apex of RTA relatively blunt and not bifurcate (Fig.
<figureCitation captionStart="Figure 2" captionStartId="F7818792" captionText="Figure 2. Male left palp of the holotype of Synema guiyang sp. nov. A Ventral view; B Dorsal view; C Prolateral view; D Retrolateral view. Abbreviations: E = embolus; EB = embolar base; ET = embolar tip; ITA = intermediate tibial apophysis; RTA = retrolateral tibial apophysis; SD = sperm duct; T = tegulum; VTA = ventral tibial apophysis. Scale bar: 0.2 mm (equal for A-D)." figureDoi="10.3897/BDJ.10.e85072.figure2" httpUri="https://binary.pensoft.net/fig/667834" pageId="0" pageNumber="85072">2</figureCitation>
A, B, D) (vs. embolus apically slightly curved; ITA absent, RTA apically sharp in
<taxonomicName genus="S." lsidName="S. albomaculatum" pageId="0" pageNumber="85072" rank="species" species="albomaculatum">
<emphasis italics="true" pageId="0" pageNumber="85072">S. albomaculatum</emphasis>
</taxonomicName>
, as in
<bibRefCitation author="Ono, H." journalOrPublisher="Entomologica Basiliensis" pageId="0" pageNumber="85072" pagination="203 - 236" refId="B7818437" refString="Ono, H., 2001. Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae). Entomologica Basiliensis 23: 203 - 236" title="Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae)" volume="23" year="2001">Ono 2001</bibRefCitation>
: 230, figs. 66-68; ITA slightly shorter than RTA, RTA apically bifurcate in
<taxonomicName genus="S." lsidName="S. chikunii" pageId="0" pageNumber="85072" rank="species" species="chikunii">
<emphasis italics="true" pageId="0" pageNumber="85072">S. chikunii</emphasis>
</taxonomicName>
, as in
<bibRefCitation author="Ono, H." journalOrPublisher="Acta Arachnologica" pageId="0" pageNumber="85072" pagination="59 - 63" refId="B7818428" refString="Ono, H., 1983. Eine neue Japanische Synaema-Art (Araneae: Thomisidae). Acta Arachnologica 31 (2): 59 - 63" title="Eine neue Japanische Synaema-Art (Araneae: Thomisidae)" volume="31" year="1983">Ono 1983</bibRefCitation>
: 60, figs. 4, 5); for the females, epigyne plate with a large atrium, bell-shaped hood about 1/5 epigyne width (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F7818796" captionText="Figure 3. Synema guiyang sp. nov., female paratype and male holotype, epigyne (A-D), frontal views of prosoma (E - F). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A-D); 1 mm (E, F)." figureDoi="10.3897/BDJ.10.e85072.figure3" httpUri="https://binary.pensoft.net/fig/678763" pageId="0" pageNumber="85072">3</figureCitation>
A, D) (vs. atrium absent, transverse band-shaped hood nearly as wide as epigynal plate, as in
<bibRefCitation author="Ono, H." journalOrPublisher="Entomologica Basiliensis" pageId="0" pageNumber="85072" pagination="203 - 236" refId="B7818437" refString="Ono, H., 2001. Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae). Entomologica Basiliensis 23: 203 - 236" title="Crab spiders of the family Thomisidae from the Kingdom of Bhutan (Arachnida, Araneae)" volume="23" year="2001">Ono 2001</bibRefCitation>
: 230, fig. 70 and
<bibRefCitation author="Ono, H." journalOrPublisher="Acta Arachnologica" pageId="0" pageNumber="85072" pagination="59 - 63" refId="B7818428" refString="Ono, H., 1983. Eine neue Japanische Synaema-Art (Araneae: Thomisidae). Acta Arachnologica 31 (2): 59 - 63" title="Eine neue Japanische Synaema-Art (Araneae: Thomisidae)" volume="31" year="1983">Ono 1983</bibRefCitation>
: 60, fig. 6).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85072" type="etymology">
<paragraph pageId="0" pageNumber="85072">Etymology</paragraph>
<paragraph pageId="0" pageNumber="85072">The species name is derived from the name of the type locality; noun in apposition.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85072" type="distribution">
<paragraph pageId="0" pageNumber="85072">Distribution</paragraph>
<paragraph pageId="0" pageNumber="85072">
Known from the Guiyang City, Guizhou Province, China (Fig.
<figureCitation captionStart="Figure 1" captionStartId="F7818779" captionText="Figure 1. Distribution record of Synema guiyang sp. nov. (red circle)." figureDoi="10.3897/BDJ.10.e85072.figure1" httpUri="https://binary.pensoft.net/fig/682558" pageId="0" pageNumber="85072">1</figureCitation>
).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85072" type="biology">
<paragraph pageId="0" pageNumber="85072">Biology</paragraph>
<paragraph pageId="0" pageNumber="85072">
<taxonomicName authorityName="Zhang, Zhang, Deng, Lu &amp; Yu" authorityYear="2022" class="Arachnida" family="Thomisidae" genus="Synema" kingdom="Animalia" lsidName="Synema guiyang" order="Araneae" pageId="0" pageNumber="85072" phylum="Arthropoda" rank="species" species="guiyang">
<emphasis italics="true" pageId="0" pageNumber="85072">Synema guiyang</emphasis>
</taxonomicName>
sp. nov. is a typical leaf-dwelling spider. The types were obtained from foliage in woods in the core zone of Guiyang Forest Park.
</paragraph>
</subSubSection>
</treatment>
</document>